A Study of the South African Tomato Curly Stunt Virus Pathosystem: Epidemiology, Molecular Diversity and Resistance by Lindy L

A study of the South African Tomato curly stunt virus pathosystem: epidemiology, molecular diversity and resistance by Lindy L. Esterhuizen (909904525)

Thesis

Submitted in fulfilment of the requirements for the degree Philosophiae doctor in Biochemistry

in the Faculty of Science at the University of Johannesburg

Supervisor: Dr H van Heerden

Co-supervisors: Prof MEC Rey Dr SW van Heerden

May 2012

Abstract

ABSTRACT

In South Africa, tomato (Solanum lycopersicum) is an important vegetable crop with considerable nutritional and economic value. Over the last decade, begomovirus (family Geminiviridae) infections associated with an upsurge of the whitefly vector, Bemisia tabaci, on tomato crops has become a serious threat to sustainable tomato production in South Africa. Begomovirus disease control in tomato is challenging and requires an integrated “pest” and “vector” management strategy, primarily based on the use of chemical and cultural practices aimed at reducing the virus vector as well as the use of resistant cultivars. Development of effective disease management practices for South Africa therefore requires detailed information on the complex vector-virus-host cropping system interactions. The aim of the study presented in this thesis was to investigate the South African whitefly vector/begomovirus/tomato-host pathosystem, with emphasis on the virus and vector diversity and distribution, and the identification of possible resistance sources.

A survey of tomato-infecting begomoviruses was conducted during a six-year period (2006-2011). Techniques used to determine begomoviruses diversity included whole genome amplification using PCR, RCA (rolling circle amplification), conventional as well as next generation sequencing and development of a RCA-RFLP (restriction fragment length polymorphism) for rapid assessment of diversity. Sequence comparisons and phylogenetic analyses revealed the presence of three new monopartite begomovirus species, in addition to ToCSV, all of which belong to the African/South West Indian Ocean (SWIO) begomovirus clade. Recombination analysis indicated that all four tomato-infecting begomovirus species appear to be complex recombinants and suggests that they have evolved within the sub-Saharan Africa region, along with other African begomoviruses and that they are most likely indigenous to the region. Several weed species were also confirmed as symptomless begomovirus reservoirs, supporting their role in the emerging begomovirus epidemics in South Africa

As established during the survey, the most predominant begomovirus in South Africa was ToCSV. Phylogenetic analysis distinguished two ToCSV variants, namely ToCSV-I and ToCSV-II, based on the presence of a recombination fragment in the V2 coding region of the virus. A PCR-RFLP was developed that differentiates between the ToCSV variants, which allowed assessment of the ToCSV variant distribution in South Africa. In order to complete Koch’s postulate for ToCSV and assess the infectivity and symptom phenotype of the two viral variants, an infectious clone of each virus variant was constructed. Both constructs caused typical curling and stunting symptoms when inoculated into tomato plants and were transmissible by B. tabaci type B, confirming their true monopartite nature. It was further established that the recombinant ToCSV-II variant causes a distinctly milder symptom phenotype in tomato, in contrast to the severe symptoms phenotype induced by ToCSV-I. Using a chimaeric genome approach it was also determined that the recombination fragment in ToCSV-II did not play a role as symptom phenotype determinant.

As the spread of begomoviruses are completely dependent on their whitefly vector, the whitefly is one of the most important components of the vector/virus/host pathosystem. Consequently, the distribution, genetic diversity and host association of B. tabaci haplotypes in eight South African provinces were investigated during an eight-year period (2002-2009). B. tabaci population analysis was done by estimating the degree of genetic relatedness using the mtCOI gene sequence as a molecular marker, or by using an mtCOI PCR-RFLP that discriminate between the different haplotypes. The study revealed the presence of members from two distinct and endemic sub-Saharan Africa subclades (SSAF-1 and SSAF-5) co-existing with two exotic B. tabaci haplotypes (B and Q type) belonging to the Middle East-Asia minor 1 and Mediterranean clades. The SSAF-1 subclade included cassava host-adapted B. tabaci populations, whereas the more polyphagous whiteflies in the SSAF-5 subclade represent a new subclade among previously recognized Southern Africa clades. The study also provided the first report of the occurrence of the exotic Q type in South Africa, alongside the more widely distributed B type. Both the indigenous and exotic whitefly types were found to be responsible for transmission of distinct begomovirus species and thereby contributing to the spread of begomovirus infection in South Africa.

Faced with the high incidence of begomovirus infection by several distinct viral species and rapid build-up of whitefly populations on tomato crops in the summer months, the

iii generation of resistant cultivars are considered to be the best control alternative to manage this disease. As a first step towards improved resistant cultivars, a preliminary screening of thirty-two tomato hybrids with combined resistance from Solanum chilense, S. pimpinellifolium, S. peruvianum and S. habrochaites was performed. Their response to the severe variant of ToCSV (I) was assessed using whitefly-mediated inoculation and compared to two TYLCV-resistant commercial cultivars currently used to control the disease in the country. Following infection the accessions were evaluated for disease symptom severity (DSI), virus accumulation and yield reduction. The resistance phenotype was also correlated with the presence of known resistance loci. None of the accessions tested were immune, with virus accumulating in all the plants, but various degrees of partial resistance were observed. A few hybrids resulting from crosses between S. peruvianum and S. chilense or S. habrochaites, appeared to be good candidates for enhanced resistance and were selected as future breeding sources. The resistance in these accessions expressed as attenuation of leaf curl disease symptoms, delay in time of symptom development, a decrease in viral presence and only a small reduction in yielding ability. Marker analysis also indicated that these hybrids contained a combination of the Ty-1, Ty-3 and Ty-3a resistance introgressions and emphasizes the combining ability of the different resistance sources.

It is envisaged that the major findings from these studies have contributed to a better understanding of the South African whitefly vector/begomovirus/tomato-host pathosystem and highlighted many serious implications for disease control and resistance strategies, which need further critical investigation.

Acknowledgements

ACKNOWLEDGEMENTS

I would like to acknowledge and express my sincere appreciation to everyone who supported me on this journey, for without you, this study would not have been possible. In particular, I would like to give a very special thanks to the following:

To the Lord for giving me the strength to reach for my goals, endurance to complete my studies, guidance through my life, and for just being there on the days that the sun didn’t shine.

To my husband, Andre. You were my loving companion on the good days and my anchor and safe haven in the stormy days. I will always be grateful for your endless amounts of emotional support. You were there to listen to my successes as well as my failures, always providing encouragement and guidance. In addition, your technical assistance, whenever a new whitefly containment cage needed to be designed or built, was much appreciated.

My parents, my brother, my mother-in-law and other family members for their never ending love and support that carried me through the last twelve years of studies.

To my supervisor, Dr. Henriette van Heerden, for the continued guidance you provided and the knowledge you shared with me throughout my project. For providing the funding to visit the laboratory of Prof. H. Czosnek in Israel in 2007 and to attendant the 6th International Symposium on Geminivirus in Mexico in 2010. And lastly, for your endless technical support and editing of publications and the final thesis manuscript.

To my co-supervisors, Prof. Chrissie Rey and Dr. Schalk van Heerden for your invaluable contributions to my project. Thank you both for pointing me in the right direction when I needed it.

To my colleagues in the Biochemistry Department at the University of Johannesburg for your patience, encouragement, support and willingness to lend a hand or offer advice.

For Dr. Amina Nel, my friend and co-lecturer in Biology. Your continued support and understanding in the last three years are very much appreciated.

All my friends and lab partners, especially Marisa, Sonestie, Elize, Natasha, Sonja and Edwin. Thanks for the thought-provoking discussions, the laughter and above all, your friendship. You all mean more to me than I would ever be able to say in words.

For the National Research foundation (NRF), United States Agency for International Aid (USAID) and University of Johannesburg, for financial assistance.

Richard Devey form Statkon, UJ, for statistical assistance.

Prof. Doug Maxwell for allowing me to use the Ty-4 markers.

Prof. H. Czosnek from the Institute of Plant Sciences and Genetics in Agriculture at the Hebrew University of Jerusalem and Favi Vidavski from Tomatech R&D, Israel, for providing the hybrids used in the resistance screening.

Sakata Vegenetics RSA Pty (Ltd) for the use of their greenhouse facilities for the field trials and in particular, the staff members for their assistance in sample collection, planting the field trials and laboratory analysis.

Thank you Watson, Joule, Lucy and Emma for all the smiles and unconditional love.

I dedicate this thesis to my son Sebastian Esterhuizen, who will join this world in early July 2012. You have been my motivation in completing this thesis, and you have carried me through the last months.

CONTENTS CONTENTS

Abstract ...... ii

Acknowledgements ...... v

Contents ...... vii

List of symbols and abbreviations ...... x

1.0 Literature review ...... 1 1.1 Introduction ...... 2 1.2 SECTION A: Virus ...... 4 1.2.1 Geminiviridae classification and genome organization 4 1.2.2 Genome expression and protein function 8 1.2.3 Geminivirus evolution 12 1.2.4 Factors driving geminivirus diversity and emergence 13 1.2.5 Tomato-infecting begomoviruses in South Africa: Economic importance and distribution 17 1.3 SECTION B – Vector ...... 21 1.3.1 Bemisia tabaci (Hemiptera: Aleyrodidae) 21 1.3.2 Bemisia tabaci – From biotype to cryptic species complex 21 1.3.3 Feeding damage and vectoring of viruses 23 1.4 SECTION C – Solanum lycopersicum host ...... 25 1.4.1 Breeding for host plant resistance to tomato-infecting begomoviruses 26 1.4.2 Tagging loci for resistance to begomoviruses 28 1.4.3 Genetic engineering strategies for developing crops resistant to geminiviruses 31 1.5 Outline of the thesis ...... 34 1.6 References ...... 36

2.0 Distribution and genetic diversity of tomato-infecting begomoviruses in South Africa ...... 61 2.1 Introduction ...... 63 2.2 Material and methods ...... 65 2.2.1 Sample collection and DNA extraction 65 2.2.2 Virus detection and genetic characterization: Detection of DNA-A, DNA-B and satellite DNA molecules 66 2.2.3 Phylogenetic analysis 71 2.2.4 Recombination analyses 76 2.3 Results...... 76 2.3.1 Sample collection and virus detection 76 2.3.2 Genetic diversity of begomovirus isolates 77 2.3.3 Sequence homology and phylogenetic analysis 79 2.3.4 Analysis of recombination 83 2.4 Discussion ...... 87 2.5 References ...... 94

vii

3.0 Tomato curly stunt virus: demonstrating the monopartite nature of a mild and severe virus variant...... 102 3.1 Introduction ...... 103 3.2 Materials and methods ...... 105 3.2.1 Sample collection, sequence and phylogenetic analyses of ToCSV isolates 105 3.2.2 Development of ToCSV-specific PCR 105 3.2.3 Differentiation between ToCSV variant cluster I and II using a ToCSV specific PCR-RFLP 106 3.2.4 Infectious clone construction 106 3.2.5 Agroinoculation and analysis of symptoms 108 3.2.6 Whitefly transmission of the virus progeny from agroinfected plants 109 3.2.7 Southern blot analysis 109 3.2.8 Construction of a chimaeric ToCSV-[ZA:Mks30:08] and ToCSV- [ZA:Mks22:07] infectious clone 109 3.3 Results...... 110 3.3.1 Molecular characterization and phylogenetic analysis of the two ToCSV variants 110 3.3.2 Development of a ToCSV-specific PCR 115 3.3.3 Differentiation between ToCSV variant cluster I and II using a ToCSV specific PCR-RFLP 116 3.3.4 Infectivity of the cloned ToCSV variant I and II DNA 116 3.3.5 ToCSV-[ZA:Mks30:08] and ToCSV-[ZA:Mks22:07] isolates are transmissible by B. tabaci 118 3.3.6 Southern blot analysis 119 3.3.7 Infectivity and symptom phenotype of the chimaeric ToCSV clone 120 3.4 Discussion ...... 122 3.5 References ...... 126

4.0 Genetic identification of members of the Bemesia tabaci cryptic species complex in South Africa reveals native and introduced haplotypes ...... 134 4.1 Introduction ...... 136 4.2 Materials and methods ...... 138 4.2.1 Whitefly collection 138 4.2.2 Nucleic acid extraction 140 4.2.3 mtCOI PCR amplification and sequencing 140 4.2.4 Phylogenetic analysis 142 4.2.5 mtCOI PCR-RFLP marker 142 4.3 Results...... 143 4.3.1 mtCOI sequences and analysis 143 4.3.2 Genetic distance analysis 147 4.3.3 mtCOI PCR-RFLP analysis 147 4.4 Discussion ...... 148 4.5 References ...... 152

5.0 Screening of Solanum species with pyramided resistance towards Tomato curly stunt virus ...... 159 5.1 Introduction ...... 161 5.2 Materials and methods ...... 163 5.2.1 Virus and whitefly maintenance 163 5.2.2 Plant material 164 5.2.3 Viral transmission efficiency 164 5.2.4 Whitefly-mediated inoculation 164 5.2.5 Detection of viral DNA via squash or dot-blot analysis 166

viii

5.2.6 Disease severity scoring 167 5.2.7 Greenhouse trail for yield estimation 168 5.2.8 PCR amplification of Ty resistance markers 168 5.2.9 Data analysis 169 5.3 Results...... 169 5.3.1 Infection efficiency of vector mediated inoculation 169 5.3.2 Resistance assessment - detection of viral DNA and monitoring symptom severity 171 5.3.3 Disease progression between 21 and 75 days post inoculation 172 5.3.4 Resistance assessment – Effect of ToCSV infection on yield 177 5.3.5 Resistance assessment – Detection of resistance markers 179 5.4 Discussion ...... 181 5.5 References ...... 187

6.0 General Discussion ...... 194

ADDENDUM A – Genetic identification of two sweet potato-infecting begomoviruses in South Africa ...... 211

List of symbols and abbreviations

LIST OF SYMBOLS AND ABBREVIATIONS

alpha AAP acquisition access period

beta BLAST basic local alignment search tool bp base pair

C complementary sense strand C degree celsius CAPS cleaved amplified polymorphic sequences cM centimorgan cm centimetre CP coat protein CPMR coat protein mediated resistance CR common region CSPD disodium 3-(4-methoxy-spiro{1,2-dioxetane-3,2‘-(5‘-chloro) tricycle [3.3.1.1] decan}-4-yl) phenyl phosphate cv cultivar

DAS days after sowing DIG digoxygenin DNA deoxyribonucleic acid dNTP deoxyribonucleotide DPI days post inoculation ds double strand

DSI disease symptom severity

EC Eastern Cape EDTA ethylene diamine tetra-acetic acid EST expressed sequence tagged EtBr ethidium bromide

G g gram xg times gravitational force GMM genic molecular markers

H h hour ha hectare Hz hertz

IAP inoculation access periods ICTV international committee on taxonomy of viruses Id identity IDT integrated DNA technologies IPM integrated pest management IR intergenic region ITS internal transcribed spacer

K kb kilobase pair kDa kilodalton kg kilogram km kilometre KZN Kwazulu-Natal

L lin linear

M molar MAS marker-assisted selection MB megabytes mg milligram min minutes ml milliliter mm millimetre mM millimolar g microgram l microliter m micrometre M micromolar MP movement protein mRNA messenger ribonucleic acid mtCOI mitochondrial cytochrome oxidase I

NC Northern Cape nc not computable NDA national department of agriculture NJ neighbour-joining nm nanometre NSP nuclear shuttle protein nt nucleotide NW new world

O oc open-circular ORF open reading frame ori origin of replication

xii

OW old world

PCR polymerase chain reaction PD plasmodesmata PDR pathogen derived resistance % percentage PTGS post-transcriptional gene silencing

QTL quantitative trait loci

RCA rolling circle amplification RCR rolling circle replication RDP recombination detection program REn replication enhancer protein Rep replication-associated protein RF replicative form RFLP restriction fragment length polymorphism RISC RNA-induced silencing complexes RNA ribonucleic acid RNAi RNA interference

S sc supercoiled SCAR sequence characterized amplified region SCR sequence-conserved region SD standard deviation sec seconds SGN Solanaceae genomics network siRNA small interfering RNA

xiii spp species ss single strand SSL squash silverleaf disorder SSAF sub-Saharan Africa SWIO south west indian ocean

TrAP transcription activation protein Tris Tris(2-amino-2-hydroxymethyl)-1,3-propandiol

U unit UV ultraviolet light

V Virion-sense strand V2 pre-coat protein v/v volume to volume v/w volume to weight

WC Western Cape

X times

xiv

1.0 Literature review

CHAPTER 1 Literature Review

1.1 Introduction

The cultivated tomato is widely grown around the world. It belongs to the Solanaceae family that includes the cultivated tomato, Solanum lycopersicum L. (formerly Lycopersicon esculentum Miller), and more than 10 related wild species (Foolad, 2007; Diez & Nuez, 2008). With an annual production of 130 million metric tons and a value of over 30 billion dollars in 2008, it constitutes a major agricultural industry. In South Africa, about 5400 hectares are cultivated annually for both fresh market and processing industry, with a total production of 345 440 tons (NDA, 2009). Tomato cultivation and processing involves a vast human labor and contributes towards South Africa’s economy. Currently, one of the most important and damaging (potent) threats to tomato production worldwide involves the whitefly vector/begomovirus pathogen/tomato host pathosystem.

Whiteflies, in the genus Bemisia tabaci (Hemiptera: Aleyrodidae), have caused escalating problems worldwide to agricultural crops and ornamental plants (De Barro et al., 2011). B. tabaci is considered to constitute a cryptic species complex whose members exhibit a range of genetic, biological and behavioral variation, but are morphologically indistinguishable (Brown, 2010; Gill & Brown, 2010; De Barro et al., 2011). Some members of this species complex have a global distribution and cause damage directly through excessive sap removal, excretion of honeydew that promotes growth of sooty mold fungi and the induction of systemic disorders. The most devastating damage induced by whtieflies is due to the transmission of plant pathogenic viruses that they acquire when feeding from the plant phloem. Bemisia tabaci has been demonstrated to vector over 150 different viruses, most of which belong to the Begomovirus genus (family Geminiviridae) (Lapidot & Polston, 2011).

Tomato is espacially vulnerable to a large number of species within the genus Begomovirus. These tomato-infecting begomoviruses comprise a complex of about 60 monopartite and bipartite viruses. They all induce a mild to severe tomato disease characterized by yellowing and cupping of apex leaves and stunted plant growth coupled with significant yield losses (Fauquet et al., 2000; Jones, 2003). During the last three decades, begomoviruses have emerged worldwide following the spread of their insect vector and have become one of the major constraints to tomato production (Polston & Anderson, 1997; Lapidot & Friedmann, 2002). The increasing incidence

(geographical and / or host range) of existing viruses or frequent appearance of new virus species/strains are linked to their extraordinary capacity for diversity through mutation, recombination and pseudorecombination (Seal et al., 2006b). Human activities also considered as contributory factors to their emergence include agricultural intensification, loss of genetic diversity, excessive use of chemical control measures and international trade in vegetable material (Morales, 2006; Seal et al., 2006b; Jones, 2009; Nawaz-ul-Rehman & Fauquet, 2009; Navas-Castillo et al., 2011).

Management of begomovirus-induced diseases is mainly based on the use of insecticides to reduce the vector population. Chemical control methods have however only been partially effective and in addition to the deleterious environmental consequences of excessive insecticide applications, the vector has been shown to develop resistance to the insecticides used (Dennehy et al., 2010). The most effective management measures form part of an integrated pest management (IPM) strategy, in which tolerant or resistant cultivars plays a central role. Generation of resistant cultivars has thus become a priority (Lapidot & Friedmann, 2002).

To improve the worldwide critical situation, a variety of approaches have been used to achieve begomovirus resistance, including classical breeding and genetic engineering (Lapidot & Friedmann, 2002; Shephard et al., 2009). Conventional breeding for resistance is based on the identification of resistance sources in wild relatives and significant advances have been made to produce cultivars resistant to a number of begomvirus species. Although commercial cultivars with adequate resistance have since been released, the best cultivars and breeding lines available show tolerance to these viruses rather than true resistance (Vidavski et al., 2008). Begomoviruses and their vector thus remain a serious problem in worldwide agricultural systems.

1.2 SECTION A: Virus

1.2.1 Geminiviridae classification and genome organization

Geminiviruses are plant-infecting viruses causing severe economic losses to agricultural production worldwide. Viruses belonging to the family Geminiviridae are distinct in having genomes of circular, single-stranded DNA (ssDNA), contained within twinned icosahedral virions from which they derive their name (Harrison, 1985) (Figure 1.1). Their genomes are either monopartite (one ssDNA component also called DNA-A) or bipartite (two ssDNA components of equal sizes - DNA-A and DNA-B) and in many instances they are accompanied by circular ssDNA alpha- or betasatellites. The Geminiviridae exhibit considerable diversity in terms of their genome structure, sequence, host range and insect vectors. Based on these properties, the family has been divided into four different genera, the names of which were derived from the type members: Mastrevirus, Curtovirus, Topocuvirus, and Begomovirus (Fauquet & Stanley, 2003) (Table 1.1).

The genus Mastrevirus (type species Maize streak virus, MSV) has a monopartite genome and is transmitted by leafhoppers (Hemiptera: Cicadellidae) in a persistent, circulative and non-propagative manner: once the insect feeds on an infected plant and acquires the virus, transmission can occur within hours and continue for the entire life of the insect (Harrison, 1985). Members of this genus have been found only in the Old World (OW) (Eastern Hemisphere) where they mainly infect monocots in the family Poaceae, such as Zea mays (maize), Saccharum spp. (sugarcane) and Panicum spp. (grass).

The genus Curtovirus (type species Beet curly top virus, BCTV) has a monopartite genome and is transmitted by leafhoppers (Hemiptera: Cicadellidae) in a circulative, non-propagative manner. Their host range is composed of eudicots, especially Beta vulgaris (sugar beet), S. lycopersicum (tomato) and Cucurbitaceae spp. (melon) (Stanley et al., 1986). They are found mostly in India, America and Mediterranean countries.

The genus Topocuvirus currently has only one member (Tomato pseudo-curly top virus, TPCTV), with a similar monopartite genome to curtoviruses, but transmitted by a treehopper (Hemiptera: Membracoidea) (Briddon et al., 1996).

Figure 1.1 Electron micrograph of purified geminivirus particles consisting of twin virons (http://www.rothamsted.bbsrc.ac.uk/ppi/links/pplinks/virusems/b3.jpeg ).

Table 1.1 The taxonomy of the family Geminiviridae including the genome organization, host plant target, insect vectors and type species.

Genus Genome Target Vector Type species

Begomovirus Monopartite or Bipartite Eudicot Whitefly Bean golden mosaic virus (BGMC)

Curtovirus Monopartite Eudicot Leafhopper Beet curly top virus (BCTV)

Mastrevirus Monopartite Monocot Leafhopper Maize streak virus (MSV)

Topocuvirus Monopartite Eudicot Treehopper Tomato pseudo-curly top virus (TPCTV)

Topocuviruses have been found only in the New World (NW) (Western Hemisphere) and appear to result from a recombination between mastreviruses and begomoviruses (Rojas et al., 2005).

The largest, most diverse and economically important group in the family Geminiviridae is the genus Begomovirus, named after its type member Bean golden mosaic virus (BGMV). Begomoviruses are transmitted by the whitefly, B. tabaci in a persistent, circulative manner and only infect eudicots (Moriones & Navas-Castillo, 2000).

Begomoviruses can be subdivided into NW (Western Hemisphere) and OW members. NW members of this genus typically has a bipartite genome, with the DNA-A component encoding five or six proteins and the DNA-B component encoding two proteins, each component being 2.5-2.8 kb in size. Both DNA components are needed for infectivity (Hamilton et al., 1983). A small number of OW members in this genus have a true monopartite genome, containing a DNA-A molecule of ~2.8 kb (homologous to the DNA-A component of bipartite members), with six open reading frames (ORFs) that are sufficient to cause wild-type disease symptoms.

The genomes of topocuviruses, curtoviruses, and begomoviruses have similar features and genome organization (Figure 1.2). The ssDNA-A molecule consist of a virion- sense strand (V), which is the encapsidated strand. Between the virion-sense and complementary-sense gene sets lies an intergenic region (IR) where the cis-acting signals regulating viral replication and transcription occur (Hanley-Bowdoin et al., 2000).

The IRs of the DNA-A and DNA-B components of bipartite begomoviruses generally also share a common region (CR) of 200 nucleotides of high sequence identity (Harrison & Robinson, 1999). They all utilize bidirectional transcription and overlapping genes for efficient coding of proteins. The V encodes the AV1 and AV2 ORF for bipartite and V1 and V2 ORF for monopartite viruses. There are four genes, termed AC1 to AC4 (C1-C4 for monopartite viruses), on the complementary-sense strand (C). DNA-B encodes only two proteins termed BC1 and BV1. Based on their protein functions or relative proximity to the CR, these genes or ORFs have been named: coat protein (CP, V1/AV1), pre-coat protein (V2/ AV2), replication enhancer protein (REn, C3/AC3), transcription activation protein (TrAP, C2/AC2), replication-associated protein (Rep, C1/AC1), (A)C4 protein, movement protein (MP, BC1) and nuclear shuttle protein (NSP, BV1).

Some of the OW monopartite begomoviruses are associated with additional subviral ssDNA components (satellites), termed alpha- or betasatellites (Briddon & Stanley, 2006). For most monopartite begomoviruses, the DNA-A component alone has been shown to cause wild-type disease symptoms (Kheyr-Pour et al., 1991; Navot et al., 1991; Dry et al., 1993; Bananej et al., 2004). In contrast, some begomoviruses with

Figure 1.2 Genome organization of the Geminiviridae genera. The monopartite begomovirus is represented by the type member Tomato yellow leaf curl virus (TYLCV), the bipartite Begomovirus by Bean golden mosaic virus (BGMV), the Curtovirus by Beet curly top virus (BCTV), the Mastrevirus by Maize streak virus (MSV) and Topocuvirus by Tomato pseudo-curly top virus (TPCTV). The arrows indicate direction and represent open reading frames. Genes are named according to the DNA component. CP: coat protein, Rep: replication initiator protein, TrAP: transcriptional activator protein, REn: replication enhancer protein, MP: movement protein, NSP: nuclear shuttle protein, IR: intergenic region, CR: common region and origin of replication (ori). DNA strand on which they are encoded is indicated by viral (V) or complementary (C)-sense strand (Figure adapted from Rojas et al., 2005).

only a DNA-A component are infectious to their respective hosts but unable to induce typical disease symptoms (Briddon et al., 2000; Saunders et al., 2000; Zhou et al., 2003). These viruses require an ssDNA satellite molecule termed DNA-β, in addition to DNA-A, to develop full disease symptoms. The DNA-βs is necessary for the accumulation of DNA-A to levels normally found in symptomatic plants (Saunders et al., 2000; Briddon et al., 2001).

Biologically active DNA-β molecules are about half the size of the helper DNA-A component, with an average size of ~1350 nucleotides (Briddon et al., 2003). DNA-β are completely dependent on the helper component (DNA-A) for their replication, encapsidation and transmission by whitefly vectors. They are widespread in the OW and all contain three conserved regions: an A-rich region, a sequence-conserved region (SCR) and an ORF termed β C1 (Briddon et al., 2003; Zhou et al., 2003; Bull et al., 2004). Alpha-satellites are self-replicating satellite-like molecules, only dependent on the helper virus for movement, encapsidation and vector transmission. Although alpha-satellites have a highly conserved genome organization, encompassing a replication-associated protein, an adenine-rich region of nearly 200 nucleotides and an origin of replication (ori) (including a conserved nonanucleotide TAGTATT/AC), no known specific function are attributed to alpha-satellites (Nawaz-ul-Rehman & Fauquet, 2009).

1.2.2 Genome expression and protein function

Geminiviruses have small genomes, comprising one or two DNA components of less than 3 kb, with limited coding capacity. They do not encode polymerases but specify multifunctional proteins that initiate specific steps in replication and/or transcription, facilitate virus spread within and between hosts, and suppress host defenses (Jeske, 2009). Replication for all geminiviruses occurs in the nuclei of infected cells. After delivery by the insect into the phloem of host plant, the viral particles have to find their way across the cell wall and plasma membrane, and eventually the DNA enters the nucleus. Within the nucleus, the geminivirus depend on host machinery to amplify their DNA genomes. They employ a combination of rolling circle and recombination strategies through a concatameric double stranded DNA (dsDNA) intermediate

(Gutierrez, 1999; Hanley-Bowdoin et al., 1999; Jeske et al., 2001; Preiss & Jeske, 2003). Rolling circle replication (RCR) system is used to amplify their ssDNA genomes and to produce dsDNAs (replicative form, RF) (Gutierrez, 1999). The dsDNA is organized as mini-chromosomes complexed with histone proteins (Pilartz & Jeske, 2003; Jeske, 2009) and serve as template for RCR and transcription of viral genes. As both processes occur within the host plant nucleus, nuclear import and export of viral DNA and/or virions is essential for the successful completion of their life cycle. The ssDNA copies are associated with capsid/nuclear shuttle proteins and are transported to neighbouring cells through the plasmodesmata with the help of movement proteins (Waigmann et al., 2004). Ultimately, ssDNA-containing virions enter the vascular tissue and spread systemically throughout the host plant (Gafni & Epel, 2002; Gafni, 2003).

Members of the begomo-, curto- and topocuviruses encode two conserved proteins, (A)C1 (Rep) and (A)C3 (REn), that are implicated for efficient viral replication (Hanley- Bowdoin et al., 2000). The Rep has several structural domains which are responsible for a range of different functions during viral DNA replication. The Rep localizes to the nucleus of infected plant cells where it mediates initiation and termination of RCR by recognition and nicking its cognate viral origin of replication (Fontes et al., 1994; Laufs et al., 1995; Hanley-Bowdoin et al., 2000). It also induces the accumulation of host replication factors in infected cells (Nagar et al., 1995). In addition to its key role in viral DNA replication, the Rep represses transcription of its own gene (Sunter et al., 1993; Eagle et al., 1994). It specifically recognizes double-stranded sequences in the IR (referred to as iterons), cleaves and ligates DNA within an invariant sequence in a hairpin loop of the plus-strand origin (Laufs et al., 1995; Orozco et al., 1996) and acts as a DNA helicase to unwind viral DNA during plus-strand replication (Desbiez et al., 1995). Rep is involved in a variety of protein interactions with itself (Orozco et al., 1997), with REn, and a number of host proteins (Nash et al., 2011). REn, like Rep, localizes to infected nuclei (Nagar et al., 1995) and is seen as an auxiliary replication enhancing protein that may modulate Rep activity and is required for high levels of viral DNA accumulation (Elmer et al., 1988; Settlage et al., 1996; Settlage et al., 2001). The most studied host protein interacting with Rep is a plant retinoblastoma homologue, which modulates the plant cell cycle and differentiation (Arguello-Astorga et al., 2004; Hanley-Bowdoin et al., 2004). This interaction leads to the reprogramming of mature plant cells in order to replicate viral DNA and allow infection to take place (Kong et al., 2000; Nash et al., 2011).

Transcription takes place inside the nucleus from dsDNA-RF generated during RCR and is accomplished by host RNA polymerase II (Bisaro, 2006). Transcription is bidirectional from promoter sequences located in the IR and frequently gives rise to multiple overlapping polycistronic mRNAs (Hanley-Bowdoin et al., 2000). The (A)C2 gene codes for transcriptional activator protein (TrAP), a multifunctional regulatory protein required for efficient transcription of the late viral sense genes, (A)V1 and BV1 that encoding the coat protein (CP) and BR1 movement protein, respectively (Figure 1.1; Sunter & Bisaro, 1997). The TrAP was found to localize in the nucleus, where it binds to ssDNA in preference to dsDNA, but does not exhibit sequence specificity. Its activation of transcription is not virus specific and suggests that it probably interacts with host plant cellular proteins to trigger transcriptional activation rather than direct recognition of specific promoter sequences (Hartitz et al., 1999). Furthermore, TrAP interacts and inactivates SNF1 and adenosine kinase, enzymes which appear to be involved in defense response (Wang et al., 2003). TrAP has also been shown to reverse RNA silencing in plants (Selth et al., 2004; Vanitharani et al., 2004; Wang et al., 2005).

The (A)C4 gene lies completely embedded within the Rep coding region, but in a different reading frame (Bissaro, 2006). (A)C4 gene is the least conserved geminivirus gene and no general role has been ascribed to this gene product. Functional analysis using mutagenesis and/or transgenic expression of some (A)C4 genes did not reveal any effect on viral replication or symptom development (Elmer et al., 1988; Etessami et al., 1991; Hoogstraten et al., 1996), while others produce phenotypes consistent with a movement protein or a symptom determinant (Jupin et al., 1994; Latham et al., 1997; Krake et al., 1998). Recently, the bipartite African cassava mosaic virus (ACMV-CM)- AC4 and Sri Lankan cassava mosaic virus (SLCMV)-AC4 were reported to suppress RNA silencing, allowing it to enhance disease progression and promote viral invasiveness (Vanitharani et al., 2004; 2005)

Once the geminiviruses gained control over the required DNA replication and transcription machinery, the next challenge involves moving out of the initially infected cells (Gafni & Epel, 2002). For movement to adjacent cells, the viral genome has to be transported to the cell periphery. Nuclear import and export of viral DNA and/or virions is therefore essential for the successful completion of their life cycle. In bipartite geminiviruses, the DNA-B gene product BV1 is involved in this shuttling process

(Pascal et al., 1994; Sanderfoot & Lazarowitz, 1996), whereas the movement protein (BC1) redirects viral DNA to the plasmodesmata (PD) for cell-to-cell movement (Sanderfoot & Lazarowitz, 1996; Ward & Lazarowitz, 1999). For monopartite begomoviruses, the products of the V1 (encoding the multifunctional coat protein (CP)), V2 and C4 genes have been implicated in virus movement in plant tissues (Rojas et al., 2001; 2005). The CP and pre-coat protein are both essential for local and systemic movement and are supposed to shuttle the viral genome into and out of the host nucleus (Wartig et al., 1997; Noris et al., 1998; Gafni & Epel, 2002). The predominant function of the CP is encapsidation of ssDNA and formation of the virus particles to protect viral DNA during transmission. For monopartite geminiviruses the CP is absolutely essential for virus movement, whereas bipartite viruses wtih CP mutations are able to systemically infect certain hosts (Pooma et al., 1996). The CP is also required for efficient accumulation of viral ssDNA (Qin et al., 1998; Harrison et al., 2002), insect transmission and determines insect specificity (Briddon et al., 1990; Harrison et al., 2002; Rojas et al., 2005). It is necessary for virus transport through the whitefly gut wall into the haemocele, where it binds a GroEL homologue (chaperonin protein), produced by a bacterial endosymbiont, possibly to protect virus particles from degradation (Morin et al., 2000).

The V2 protein is also called the pre-coat protein, a designation that indicates its genomic position but does not reflect its structural tasks. The pre-coat protein has been shown to act as a pathogenicity determinant, possibly via the regulation of ss- and ds- DNA levels (Padidam et al., 1996). Mutations in this gene have led to a disturbance of the ssDNA/dsDNA ratio and affect symptom expression in the plant (Rigden et al., 1993; Wartig et al., 1997; Rojas et al., 2001). The pre-coat protein has also been implicated in cell-to-cell movement (Rojas et al., 2005). For Tomato yellow leaf curl virus (TYLCV) it was shown to enhance CP mediated export of viral DNA from the nucleus to the PD (Rojas et al., 2001). It had a limited capacity to interact with the PD to mediate an increase in size exclusion limit and thereby affect cell-to-cell movement of viral DNA (Rojas et al., 2001) For Tomato leaf curl New Delhi virus (ToLCNDV) it was shown to be involved in systemic movement (Padidam et al., 1996). For both bipartite and monopartite begomoviruses, the V2 and its homolog AV2 have also been shown to function as a suppressor of RNA silencing (Zrachya et al., 2007a,b; Chowda- Reddy et al., 2008; Glick et al., 2008). For the monopartite begomovirus TYLCV, this activity has been shown to require interaction with SGS3 (tomato homolog of the

Arabidopsis SGS3 protein (AtSGS3), which is known to be involved in the RNA silencing pathway) (Glick et al., 2008), a host-encoded protein specifically required for the RNA silencing defense against geminiviruses (Muangsan et al., 2004).

1.2.3 Geminivirus evolution

In the absence of a fossil record that can be used to trace their biological activity, it is difficult to explain the evolution of viruses and we therefore rely on existing viruses to rebuild the possible evolution history. Geminivirus are thought to have evolved from an ancient episomal ssDNA plasmid present in the primitive pro- and eukaryotic ancestors of modern plants (Rojas et al., 2005; Nawaz-ul-Rehman & Fauquet, 2009). This hypothesis is supported by several lines of evidence, including the RCR mechanism of replication that is common to geminiviruses, a range of viruses infecting animals and bacteria and plasmids replicating in bacteria, archae and algae (Nawaz-ul-Rehman & Fauquet, 2009). Other supporting factors include the conserved features of the Rep protein of modern pro- and eukaryotic DNA replicons (Krupovic et al., 2009), the polysistronic nature of geminivirus mRNAs and the capacity of geminiviruses to be replicated in Agrobacterium tumefaciens (Selth et al., 2002).

By coevolving with their eukaryotic host cells, the DNA replicons must have acquired new genes, possibly through recombination with the host genome and other replicons, to evolve into independent viruses capable of movement between cells, tissue and plant hosts (Rojas et al., 2005). Krupovic et al. (2009) suggested a scenario whereby the phytoplasmal plasmid acquired a capsid protein-coding gene, possibly from an ssRNA plant virus coinfecting the same plant cell and gave rise to the ancestor of geminiviruses. Exactly how these replicons acquired genes that constitute the geminivirus genome today is still unclear, but phylogenetic studies suggest that the ancestral geminivirus had a single genome component, infected monocots and was leafhopper transmitted (Paddidam et al., 1995). Similar changes allowed the ancestral virus to infect eudicot plants and become whitefly transmissible, giving rise to single component whitefly-transmitted geminiviruses (begomoviruses) in the OW.

These monopartite viruses also had the capacity to capture other molecules. The acquisition of an ancestor of what is today a B-component occurred later in evolution, but before separation of the continents, as bipartite begomoviruses occur in both the

OW and NW. Monopartite begomoviruses also became associated with satellite molecules, alpha-satellites from pre-nanoviruses and beta-satelites from an unknown source (Briddon et al., 2003; Nawaz-ul-Rehman & Fauquet, 2009). Although the function(s) provided by the satellites are not yet fully understood, their importance is evidenced by the association of these replicons with most OW monopartite viruses (Briddon & Stanley, 2006). Recombination is another feature of geminiviruses that has been fundamental to their evolution. Recombination is made possible by their recombination-dependent replication strategy (Preiss & Jeske, 2003), frequent occurrence of mixed infection (Harrison et al., 1997; Harrison & Robinson, 1999; Sanz et al., 2000; Pita et al., 2001; Ribeiro et al., 2003) and the ability of more than one virus to co-infect the same cell nucleus (Morilla et al., 2004). Recombination have possibly contributed to the high number of viral species found in the Geminiviridae family and in addition, possible recombination events between Mastrevirus-infecting dicots and monopartite begomovirus has led to the development of the genus Curtovirus and Topocuvirus (Briddon et al., 1996). Figure 1.3 shows a phylogenetic tree representing more than two hundred species belonging to the four genera of the family Geminiviridae. This shows the grouping of begomoviruses according to either geographical origin or the host from which the viruses were isolated.

1.2.4 Factors driving geminivirus diversity and emergence

An ever-increasing number of geminivirus species are being described. There are now more than 218 recognized geminivirus species (ICTV, 2009) of which 117 belong to the genus Begomovirus (Fauquet & Stanley, 2005; Fauquet et al., 2008). To date there are more than 1348 nucleotide sequences deposited in Genbank. Geminiviruses in general, but especially those belonging to the genus Begomovirus, are considered to be emerging important plant viruses. This is due to the increasing incidence (geographical and / or host range) of new strains of existing viruses or of new viruses (Anderson et al., 2004). Their capacity for diversity makes these viruses capable of adapting to new niches. The mechanisms that viruses in general use to generate this diversity, as well as the driving forces involved in the evolution and emergence of plant viruses, have been discussed in a number of recent articles (Roossinck, 1997; Morales & Anderson, 2001; García-Arenal et al., 2003; Varma & Maluthi, 2003; Anderson et al.,

2004; Morales & Jones, 2004; Fargette et al., 2006; Morales, 2006; Seal et al., 2006a,b; Jones, 2009; Nawaz-ul-Rehman & Fauquet, 2009; Navas-Castillo et al., 2011). The major contributory factors for the increased prevalence of these viral diseases appears to be closely related to human activities and are attributed to (I) major agricultural changes, (II) altered pathosystem biology and (III) evolutionary changes that take place at the molecular level.

Agricultural changes are reported to play a pivotal role in promoting virus adaptation. The changes include agricultural intensification and diversification, loss of genetic diversity due to introduction of new crops and vulnerable cultivars, excessive use of chemical control measures, all-year-round cropping and increased use of protected cropping (Morales & Anderson, 2001; Anderson et al., 2004; Morales & Jones, 2004; Fargette et al., 2006; Morales, 2006; Seal et al., 2006a,b). Latin America provides a well-documented example where the complex interplay between agricultural intensification and diversification has led to the expansion of the vector population and consequently had a positive feedback effect on plant pathogen populations (Morales & Anderson, 2001; Anderson et al., 2004; Morales & Jones, 2004; Morales, 2006). The increased cultivation of soybean (Glycine max) in Brazil and Argentina in the 1970– 1980s promoted greater B. tabaci populations, which reproduced on the soybean plants, and led to the emergence of two major disease threats (Bean golden mosaic virus (BGMV) and Bean dwarf mosaic virus (BDMV)) to bean (Phaseolus vulgaris). The severe yield loses resulted in a switch from common bean to other crops, resulting in Brazil, previously the main producer of common bean globally, now having to import to meet internal demand (Morales, 2006).

Another major contributor to the global spread of these viral diseases is the international trade in vegetative plant material. The worldwide dissemination of tomatoes is one of the best examples of human impact on begomovirus emergence and spread. The movement of the more polyphagous B. tabaci B type and begomoviruses on these materials has had particular devastating consequences (Polston & Anderson, 1997; Polston et al., 1999; Varma & Malathi, 2003). Export of

Figure 1.3 Phylogenetic tree based on the complete DNA-A nucleotide sequences representing four genera and 212 species of the Geminiviridae. The figure shows the grouping of begomoviruses according to their geographical origin in the New World (Latin America and Meso America) and Old World (Africa, India, Asia and Japan) or the host from which the virus were isolated (Legumoviruses from a range of legume spp., Corchoviruses from Corchorus and Swepovirus from Ipomoea spp.). A group designated ‘Outsiders’ do not fit into the above mentioned geographical or host groupings (Modified from Briddon et al., 2010).

15 tomato seedlings from Israel into the Caribbean during the early 1990s resulted in the introduction of TYLCV firstly into the Dominican Republic and within 10 years, to all the tomato growing areas of Central and North America, and later to the rest of the world (Polston et al., 1994, Duffy & Holmes, 2007).

The principal factors driving alteration in pathosystem biology are the expansion in natural (viral and vector) host range, greater adaptation to infect introduced crops, introduction of host susceptibility genes in introduced crops and the introduction of more efficient virus-vector types or variants of existing vector species (Fargette et al., 2006; Jeger et al., 2006; Morales, 2006; Seal et al., 2006a,b; Sacristan & García- Arenal, 2008). The use of TYLCV resistance cultivars in Spain and the better performance of TYLCV on the resistant genotypes, coupled with the fact that TYLCV- Israel (TYLCV-IL) could also use the common bean as a host (bridge crop), appears to have selected TYLCV-IL over TYLCV-Sardinia (TYLCV-SV) (García-Andrés et al., 2009).

However, perhaps the most important driver for begomovirus emergence is the worldwide expansion of the B. tabaci B type. By being far more polyphagous and aggressive in terms of its fecundity, the B type has an enhanced capacity for adaptation to different hosts and environments, compared to indigenous B. tabaci haplotypes (Varma & Maluthi, 2003). The emergence and dissemination of begomoviruses in United States and Latin America in the 1980s and 1990s have been directly correlated with the wide spread of the B type of B. tabaci (Polston et al., 1996; Polston & Anderson 1997; Ribeiro et al., 1998; Morales & Anderson, 2001; Nawaz-ul- Rehman & Fauquet, 2009) (See section B).

When considering the evolutionary changes that take place at the molecular level it is clear that geminivirus genomes show extreme plasticity (Seal et al., 2006b). The three major forces that drive their molecular diversity is mutation, recombination, and reassortment. The mutation frequencies for three different geminiviruses have been studied and it was shown to be equivalent to that of RNA viruses (Isnard et al., 1998; Ge et al, 2007; Duffy & Holmes, 2009). Nevertheless, it is believed that recombination among different DNA-A components between co-infecting viruses is the main source of molecular variation among geminiviruses. Recombination within begomoviruses can occur at the strain (Fondong et al., 2000), species (Briddon et al., 1996; Martin et al., 2001; Saunders et al., 2002), genus (Klute et al., 1996; Saunders & Stanley, 1999),

and even family levels (Jones, 2003). This form of genetic exchange not only contributed to their genetic diversification and acquisition of new satellite molecules, but has often been associated with host switches, host range expansion and appearance of novel virus variants better adapted to local ecological conditions (Padidam et al., 1999; Rybicki & Pietersen, 1999). The most devastating genomic recombination event amongst the begomoviruses has been between East African cassava mosaic virus (EACMV) and ACMV, giving rise to the virulent EACMV-Uganda variant. This variant has caused the devastating cassava mosaic disease pandemic in East Africa (Legg et al., 2006; Ndunguru et al., 2005). The epidemics of begomoviruses of the TYLCV complex in the western Mediterranean basin are another excellent example of natural recombination of two begomoviruses (Navas-Castillo et al., 2000; Davino et al., 2009; García-Andrés et al., 2007a; Moriones & Navas-Castillo, 2008) where the novel recombinants were better adapted to their environment than either parental virus (García-Andrés et al., 2007b; Monci et al., 2002).

Another factor involved in molecular alteration that still needs further clarification is the role of circular ssDNA satellites in begomovirus evolution. The DNA-satellites molecules appear to be extending the host range of begomoviruses. For example, at least five diverse begomovirus species, including Papaya leaf curl virus (PaLCuV), can cause cotton leaf curl disease in Pakistan, but only when associated with a particular DNA- β molecule (Mansoor et al., 2003).

Considerable progress has been made in understanding virus and vector diversity, the complex interactions between plant host, vector and virus, and how to relate this to new and changing cropping practices. Integration of the biological and molecular knowledge within an epidemiological framework will lead to a better understanding of the forces involved in geminivirus evolution and emergence. This may assist the development of control measures that limit the exposure of the viruses or their vector to selection pressures that are undesirable from the human perspective.

1.2.5 Tomato-infecting begomoviruses in South Africa: Economic importance and distribution

Geminiviruses are responsible for various economically significant crop diseases throughout the tropical and subtropical regions of the world, but are also a particularly

17 serious problem in Africa. They threaten production of the continent's two main food crops namely, maize and cassava, as well as, several vegetable crops including cucurbits, okra, watermelon, beans, cowpea, pepper and tomatoes (Fauquet et al., 2008) Table 1.2 list the Mastrevirus and Begomovirus species reported up to date in South Africa. (Fauquet et al., 2008).

Tomato is an economically important vegetable crop commonly grown by subsistence and resource poor farmers in South Africa. It is one of the main vegetables used for hawking by small-scale entrepreneurs in the informal sector. The crop is also grown commercially and provides a large number of employment opportunities in this country. The total annual production of tomatoes is about 345440 tons (NDA, 2009; Tshiala & Olwoch, 2010; Abstract of Agricultural Statistics, 2011). The total production areas in South Africa are estimated at more than 5400 hectares (ha) (Figure 1.4). Approximately 100 ha of this area consist of production under protection (tunnels and greenhouses). In the Limpopo Province, the country’s main tomato production area, that included 3259 ha in Letaba around Mooketsi, 859 ha in Musina and smaller productions in the Giyani, Polokwane and Mokopane districts, is cultivated year-round, mainly in open field production. Other important regions in terms of hectares under tomato cultivation are the Onderberg area in Mpumalanga Province consisting of 550 ha and the Border area in the Eastern Cape consisting of 450 ha. In Gauteng Province virtually no tomatoes are planted and low plantings in the Northern Cape and Free State consist of only about 75 ha.

The first report of a begomovirus infecting tomato plants in South Africa was from the Onderberg region in 1997 (Figure 1.4) (Rybicki & Pietersen, 1999; Pietersen et al., 2000, 2008). The affected tomato plants showed foliar symptoms similar to those induced by TYLCV, including upper leaf yellowing, reduction in leaflet area, upward curling margins, stunting and flower abortion. After complete DNA-A component sequencing and comparison with other geminivirus species, the new viral isolate, termed Tomato curly stunt virus (ToCSV), was confirmed as a new begomovirus species closely related to Tobacco leaf curl Zimbabwe virus (TbLCZV) (84% nucleotide identity) (Pietersen & Smith, 2002). ToCSV was shown to be experimentally transmissible in a persistent manner by the whitefly B. tabaci B type, a recent introduction to South Africa. (Brown, 2000). Since the first report of ToCSV in Mpumalanga, the virus, along with the vector, has spread to additional tomato

18 producing areas, including Pongola and Nkwalini (KwaZulu-Natal), and Trichardtsdal (Limpopo) (Pietersen et al., 2000; 2008). Although no formal crop loss assessment studies have been conducted since the first identification of the virus, yield losses of up to 95% have been recorded in many production seasons (Pietersen et al., 2008). In many of the tomato growing regions in the Northern Provinces, ToCSV has become the main factor limiting outdoor tomato production.

Table 1.2 List of geminivirus species reported up to date in South Africa, indicating the region and host plant were the viruses were detected and Genbank accession numbers of virus sequences (Fauquet et al., 2008).

Genus Species Region Host plant Accession number Mastrevirus Maize streak virus, A Komatipoort Zea mays AF003952 (MSV-A ) Vaalhart AF329884 Makatini Y00514 w Maize streak virus, B Vaalhart Triticum spp. AF239962 i (MSV-B) AF239960 t Maize streak virus, C Setaria AF007881 h (MSV-C)

Maize streak virus, D Rawsonville AF329889 i (MSV-D) t Maize streak virus, E AF329888 s (MSV-E)

Sugarcane streak Natal Saccharum M82918, S64567 w virus (SSV) spp. h Bean yellow dwarf Mpumalanga Phaseolus Y11023 i virus (BeYDV) vulgaris t Bean yellow dwarf Pretoria Phaseolus DQ45879 e virus-mild (BeYDV- vulgaris m) f l Begomovirus South African Manihot AF155806 cassava mosaic virus esculenta AF155807 y (SACMV)

Tomato curly stunt Onderberg Solanum AF261885 virus (ToCSV) lycopersicum

Figure 1.4 Production areas for tomatoes in South Africa include the following: 1, Far North; 2, Northern Lowveld; 3, Mpumalanga Onderberg; 4, Mpumalanga Middelveld; 5, North West; 6, Kwazulu-Natal; 7, Free State; 8, Northern Cape; 9, Eastern Cape; 10, Noordoewer/Vioolsdrift; 11, West Coast; 12, Boland (Western Cape).

1.3 SECTION B – Vector

1.3.1 Bemisia tabaci (Hemiptera: Aleyrodidae)

The only known insect vector of geminiviruses is the Bemisia tabaci (Gennadius) (Hemiptera) cryptic species complex. The whitefly B. tabaci in the family Aleyrodidae (Gennadius, 1889) is a plant-sucking insect that is an important invasive agricultural pest causing direct- and indirect damage to crops globally. Bemisia tabaci is considered to constitute a cryptic species complex whose members exhibit a range of genetic, biological and behavioral variation, but are morphologically indistinguishable (Bedford et al., 1994; Frohlich et al., 1999; Brown, 2010; Gill & Brown, 2010, De Barro et al., 2011). Bemisia tabaci is primarily adapted to the subtropics/tropics and is competent across a range of ecological zones and in climates that span arid deserts, dry-subtropics and Mediterranean conditions (Brown, 2010). Since the early 1980s, it has caused escalating problems to both field and protected agricultural crops and ornamental plants.

1.3.2 Bemisia tabaci – From biotype to cryptic species complex

The existence of distinct ‘host-plant related races’ or ‘biotypes’ was first proposed in the late 1950s due to the absence of distinct morphological characters (Gill 1992; Bedford et al., 1994) that could be readily linked to biotic, biochemical, and/or genetic polymorphisms observed between different B. tabaci populations (Bird, 1957; Costa & Russell, 1975). The term host race was first applied to distinguish between a polyphagous variant called the ‘Sida race’ and a monophagous variant, the ‘Jatropha race’ recognized by Dr. Julio Bird in 1953 and Russell and Costa in 1975 (Bird, 1957; Costa & Russell, 1975). Russell and Costa observed that although B. tabaci in Brazil never colonized cassava, they widely colonized cassava plants throughout Africa. Furthermore, the variability was also linked to their capacity to transmit begomoviruses, with the polyphagous Sida race transmitting several viruses, where the monophagous Jatropha race transmitted just one (Bird & Maramosch, 1978).

The concept of biotype in B. tabaci came to prominence in the late 1980s, due to the recognition of an invading B. tabaci population in the southern United States that behaved quite differently from the indigenous population. This whitefly had a different

21 esterase profile and host range than the indigenous population and caused phytotoxic symptoms like irregular ripening in tomato and squash silverleaf disorder (SSL) on cucurbits (Schuster et al., 1990; Costa & Brown, 1991; Brown, 2010). Based on the earlier observations, the indigenous population was termed the A biotype (cotton, sweetpotato or tobacco strain) and the invader as the B biotype (poinsettia strain) (Brown et al., 1995a). Thereafter, the use of biological types (biotypes) became the accepted way to refer to phenotypically or genetically distinguishable B. tabaci. Since the determination of A and B, there has been an explosion in biotype designation, with the identification of numerous biotypes (A, AN, B, B2, BR, C, Cassava, Cv, D, E, F, G (India), G (Guatemala), H, I, J, Jatropha, K, L, M, N, NA, Okra, P, PCG-1, PCG-2, PK1, Q, R, S, Sida, SY, T, ZHJ1, ZHJ2, and ZHJ3) (De Barro et al., 2011). Many of these biotypes are poorly studied or entirely uncharacterized in terms of biological characteristics (Costa & Brown, 1991; Brown et al., 1995a,b; Brown, 2010). In fact, the majority of biotype designations from C to T are based primarily on genetic polymorphism (mtCOI; ITS etc.) and these variants remain unstudied in terms of biological data.

Although abundant evidence underscores the existence of biological variants for the B. tabaci group, there is no definitive set of biological data that can be applied across the whole group (De Barro et al., 2011). Furthermore, the vast majority of the biotype designations were made primarily on genetic markers and not biological data. Therefore the term biotype in the context of B. tabaci is a surrogate term for ‘genetic group’. There has been considerable debate about whether this diversity indicates the existence of numerous different species or diversity within a single species (Brown, 2010; De Barro et al., 2011). A recent study by Dinsdale et al. (2010) refined the global analysis of B. tabaci and provided quantifiable bounds to subdivide B. tabaci. Dinsdale et al. (2010) proposed the 3.5% pairwise genetic divergence to be the boundary that separates different species. The 3.5% pairwise genetic divergence was further supported by evidence for either complete or partial mating isolation between a number of the putative B. tabaci ‘species’ (Xu et al., 2010, Wang et al., 2011). Bemisia tabaci is now considered as composed of a complex of at least 24 cryptic species, which barely interbreed and form different phylogenetic clades (Dinsdale et al., 2010; Xu et al., 2010; De Barro et al., 2011). The 24 putative species identified by Dinsdale et al. (2010) are (names of associated biotypes are placed in parentheses): Mediterranean (Q, J, and L type, Sub-Saharan Africa Silverleaf); Middle East-Asia Minor 1 (B, B2

type); Middle East-Asia Minor 2; Indian Ocean (MS); Asia I (H, M, NA); Australia/Indonesia; Australia (AN); China 1 (ZHJ3); China 2; Asia II 1 (K, P, ZHJ2); Asia II 2 (ZHJ1); Asia II 3; Asia II 4; Asia II 5 (G); Asia II 6; Asia II 7 (Cv); Asia II 8; Italy (T); Sub-Saharan Africa 1; Sub-Saharan Africa 2 (S); Sub-Saharan Africa 3; Sub- Saharan Africa 4; New World (A, C, D, F, Jatropha, N, R, Sida type); and Uganda. Currently, the working strategy for classification and identification of B. tabaci relies on estimates of the degree of genetic relatedness using the mitochondrial cytochrome oxidase I (mtCOI) gene sequence as a molecular marker.

1.3.3 Feeding damage and vectoring of viruses

Bemisia tabaci is unusual among whiteflies in that it is broadly polyphagous on herbaceous plant species feeding on an estimated 600 plant species. This is in contrast to other whitefly species that colonize flowering woody perennials. They have piercing and sucking mouthparts specialized for feeding in the plant phloem and heavy infestation by B. tabaci cause significant economic damage to field and horticultural crops. Three types of damage may be caused by B. tabaci namely i) direct damage, ii) indirect damage, and iii) virus transmission (Berlinger, 1986; Pico et al., 1996).

Both B. tabaci adults and nymphs cause direct damage to plants by feeding on phloem sap. They feed from the phloem from the abaxial side of leaves using their stylet, penetrating leaf tissues intercellularly (Freeman et al., 2001). This feeding may reduce host vigour, growth rate, yield and cause weakening and early wilting of the plant (Berlinger, 1986). It may also cause leaf chlorosis, leaf withering, premature dropping of leaves and plant death. Feeding by some whitefly nymphs (notably the B type) are also associated with phytotoxicity disorders, such as the occurrence of irregular ripening of tomatoes and squash silverleaf disorder (Schuster et al., 1990). This disorder affects many Cucurbita species, including the squashes and pumpkins of C. pepo, C. moschata, and C. mixta. Feeding by immature whiteflies causes newly developing leaves, but not the leaves on which they are feeding, to take on a silvery appearance due to the separation of the upper epidermis from the underlying cell layer. The resultant air space reflects light, causing the silvery color. Fruits that develop on silvered plants may be bleached, and are of lower quality grade (Chen et al. 2004).

Indirect damage results due to the production of honeydew by the feeding nymphs. This honeydew is distributed on plant leaves, flowers and fruit and supports the growth of sooty mold fungus, causing the plant to turn black. This residue reduce the photosynthetic capabilities of the plant and result in defoliation and stunting, further decreasing the yield and market value of the vegetables. (Byrne & Bellows, 1991; Jones, 2003).

The third type of damage is caused by the whitefly vector that spread various plant viruses. Their feeding behavior is effective in the acquisition and later transmission of viruses that characteristically infect phloem associated tissues. Bemisia tabaci adults are a vector of over 150 plant viruses in the following families and genera: Begomovirus (Geminiviridae), Crinivirus (Closteroviridae), Carlavirus or Ipomovirus (Potyviridae) and Torradoviruses (Secoviridae), of which begomoviruses are the most abundant transmitted viruses. (Jones, 2003; Lapidot & Polston, 2011; Navas-Castillo et al., 2011). These plant viruses transmitted by whiteflies cause over 114 diseases of vegetable and fibre crops worldwide and may cause yield losses of between 20% and 100% depending on the crop, season, and prevalence of the whitefly (Brown & Bird, 1992; Jones, 2003).

1.4 SECTION C – Solanum lycopersicum host

The tomato belongs to the Solanaceae family and includes the cultivated tomato, Solanum lycopersicum L., and more than 10 related wild species (Foolad, 2007; Diez & Nuez, 2008). The cultivated tomato is widely grown around the world and constitutes a major agricultural industry. With a worldwide production of 130 million metric tons and a value of over 30 billion dollars in 2008, it is the second most economically important vegetable crop after potato (FAOSTAT- http://faostat.fao.org/, 2008).

Although tomato is a tropical plant, it is grown in almost every country in open fields or in greenhouses where outdoor production is restricted due to cool temperatures. Tomato cultivars can be divided into two groups, namely those produced for fresh consumption and those produced for processing. Within each of these groups, different cropping systems exist. Based on their use, the growers and consumers demand specific characteristics from different varieties, including open growth habit, high yield, earliness, external quality of fruits (shape, color, homogeneity), internal quality of fruits (flavour, sweetness, juiciness), long shelf life, adaptation to growing systems and most importantly, resistance to biotic and abiotic stresses (Diaz & Nuez, 2008).

Tomato is susceptible to over 200 diseases caused by pathogenic fungi, bacteria, viruses, or nematodes (Foolad, 2007). Leaf-curling and stunting diseases of tomato, caused by a complex of monopartite and bipartite begomoviruses, have significantly affected tomato production in many parts of the OW and NW (Polston & Anderson, 1997). Control of begomovirus-induced diseases has mainly been based on the use of insecticides to reduce their vector populations. Chemical control methods have only been partially effective due to the rapid development of resistance to the insecticides (Nauen & Denholm, 2005), the different stages of the whitefly on the plant at the same time, the rapid migration of insect vector populations from neighbouring fields, as well as the deleterious environmental consequences of excessive insecticide applications (Horowitz et al., 2007; Dennehy et al., 2010). Cultural practices, such as the use of virus-free seedlings, the use of 50-mesh screens and UV-absorbing plastic sheets (Antignus et al. 2001) and implementing a whitefly-host-free period have also been used to reduce infection levels (Salati et al., 2002). These practices add significantly to production costs and are insufficient to prevent virus spread under conditions of high whitefly pressure (Antignus, 2007; Polston & Lapidot, 2007).

The most effective management measures form part of an integrated pest management (IPM) strategy aimed at decreasing the amount of viral inoculums. This can be achieved by a combination of physical, chemical and biological practices, and most importantly, developing tolerant or resistant cultivars (Pico et al., 1996). Given the difficulty in controlling begomovirus infection by managing the vector population, resistant breeding for begomovirus is a viable option. Genetic resistance is preferable since it reduces the negative effects of pesticides on plant health and presents clear ecological benefits limiting the risks to growers, consumers, and the environment. If resistance proves durable, then the use of resistant crop varieties is certainly the most cost effective control mechanism (Lapidot & Friedmann, 2002).

1.4.1 Breeding for host plant resistance to tomato-infecting begomoviruses

A variety of approaches have been used to achieve begomovirus resistance, including classical breeding and genetic engineering (Morales, 2001; Lapidot & Friedmann, 2002). Although different begomoviruses infect tomatoes in different regions of the world (Morales & Anderson, 2001; Fauquet et al., 2003; Jones, 2003; Abhary et al., 2007), most of the research done on breeding resistance was done on the monopartite begomovirus TYLCV due to widespread epidemics and economic losses. As the domesticated tomato is susceptible to TYLCV, screening for resistance was focused on wild Solanum species. Various wild type genetic background have been used to establish breeding lines with high levels of resistance, such as: S. chilense (Zamir et al., 1994; Scott et al., 1995; 1996; Scott, 2001), S. peruvianum (Lapidot et al., 1997; Friedmann et al., 1998; Vidavsky et al., 2008), S. pimpinellifolium (Vidavsky et al., 1998) and S. habrochaites ((Vidavsky & Czosnek, 1998; Hanson et al., 2000; Vidavski, 2007) and S. cheesmaniae (Pico et al. 1996; Ji et al. 2007b).

Variable levels of resistance were localized in distinct wild species accessions (see review, Ji et al., 2007b). The first commercial hybrids (TY20) resistant to TYLCV carried a resistance genes derived from S. peruvianum. The resistance in TY20 delayed viral DNA accumulation and the development of disease symptoms following infection, and infected plants were able to produce an acceptable yield (Pilowsky & Cohen, 1990). Advanced breeding lines with high levels of resistance to TYLCV have also been developed from four other accessions of S. peruvianum (Lapidot et al., 1997;

Friedmann et al., 1998; Levy & Lapidot, 2008). Line TY172 and TY197 developed at the Volcani Center in Israel are highly resistant to TYLCV-IS as well as resistant to the bipartite begomovirus-complex in Guatemala (Mejía et al., 2005; Maxwell et al., 2006). Line TY172 shows minimal symptoms following infection, contains low levels of viral DNA and do not suffer the yield reductions of some commercial cultivars derived from other sources of resistance (Lapidot et al., 1997; Friedmann et al., 1998; Lapidot et al., 2001). It was also found that TY172, probably due to its high level of TYLCV resistance, is a poor source for viral acquisition and transmission by whiteflies (Lapidot et al., 2001).

Currently, several breeding programmes around the world are exploiting resistance genes derived from introgressions with S. chilense (Zakay et al., 1991; Scott et al., 1995; Scott, 2001; Mejía et al., 2005). Zakay et al. (1991) integrated resistance from S. chilense accession LA1969 into a cultivated tomato (TY52), and reported high levels of TYLCV resistance. Under low inoculum pressure, the plants remained symptomless upon infection and long distance viral movement was impaired (Michelson et al., 1994; Zamir et al., 1994). However, under high inoculums pressure, resistance derived from this accession could be overcome and reports on its performance against bipartite begomoviruses are variable (Pico et al., 1996; Scott et al., 1995). In addition to LA1969, S. chilense accessions LA1932, LA2779, and LA1938 have also been found to have high levels of resistance to begomoviruses, including the bipartite begomovirus Tomato mottle virus (ToMoV) and is currently being used in the tomato breeding program in Florida (Scott & Schuster 1991; Scott et al., 1995; Scott, 2001).

Two major sources of resistance were introgressed from S. habrochaites (formerly S. hirsutum) and include line H24 developed by Kalloo & Banerjee (1990) and a highly resistant line, Ih902 (using S. habrochaites LA1777 and LA0386) by Vidavsky & Czosnek (1998). H24 confers specific tolerance to some, but not all strains of TYLCV and Tomato leaf curl virus (ToLCV) (Ji et al., 2007b). The breeding line Ih902 was used to create hybrids, including FAVI 9, which has been an important source of resistance for breeding programs in Guatemala (Mejía et al., 2005) and other Middle East countries (Maruthi et al., 2003). Pietersen & Smith (2002) evaluated TYLCV resistant tomato germplasm, and showed that lines with resistance derived from either S. chilense or S. habrochaites were resistant to ToCSV. Most recently, Tomás et al. (2011) characterized a TYLCV-IL resistance source from S. habrochaites that impede

systemic TYLCV-IL accumulation and symptom expression even under severe disease pressure. Furthermore, resistant to ToLCV in accessions of S. habrochaites and S. peruvianum were attributed to the presence of exudates from trichome glands on the leaf surface in which whiteflies became entrapped (Channarayappa et al., 1992). In this case, genetic resistance to a viral disease has been achieved indirectly by incorporating genetic traits against the whitefly vector. Some TYLCV tolerance and resistance to B. tabaci has also been found in certain S. pimpinellifolium accessions, although resistance from this species is not commonly used in commercial cultivars (Ji et al., 2007b).

After more than 30 years of effort, progress in breeding for tomato yellow leaf curl disease (TYLCD) resistance has been difficult. Breeding for resistance based on introgressing genes from wild relatives is slow due to the complex genetics of resistance and the inadequacy of traditional breeding protocols to identify, select, and successfully transfer genes controlling such complex traits (Lapidot & Friedmann, 2002). Furthermore, after transferring the desired gene from the wild species into elite breeding lines, a major task becomes eliminating the great bulk of undesirable exotic genes while maintaining and selecting for desirable characteristics (Sharma et al., 2008). As a result, the best cultivars and breeding lines available show tolerance to the virus rather than true resistance (Morales, 2001; Lapidot & Friedmann, 2002; Vidavski et al., 2008). Current efforts are focused on elucidating the molecular basis of viral disease resistance by discovering the participating host-resistant genes and using molecular biology tools such as genetic markers, maps and marker-assisted selection (MAS) for rapid introgression of resistance genes into susceptible cultivars.

1.4.2 Tagging loci for resistance to begomoviruses

Classical breeding for begomovirus resistance has involved the identification of resistance sources in the above-mentioned wild Solanum species, followed by the introgression of genes controlling resistance into cultivars via phenotypic selection of resistant progeny. As a result, these resistant tomato cultivars contain chromosomal fragments from the wild species on a background of the domesticated tomato. The inheritance of the genes controlling TYLCV resistance originating from nearly all of the wild species has been characterized using classical genetic methodologies and is

28 identifiable with polymorphic DNA markers. In most cases the sources of TYLCV resistance appeared to be controlled by multiple genes (Pico et al., 1999; Anbinder et al., 2009). Currently five different begomovirus resistance loci (Ty-1 through Ty-5) from different wild tomato accessions have been identified (Zamir et al., 1994; Chagué et al., 1997; Agrama & Scott, 2006; Anbinder et al., 2009; Ji et al., 2009).

The first resistant locus to be placed on linkage maps with molecular markers originated from S. chilense accession LA1969 and was designated Ty-1. The partially dominant Ty-1 gene and two or more modifier genes was found to control resistance to TYLCV in this accession. The Ty-1 was mapped to the region comprising the RFLP marker TG97 on chromosome 6 of tomato (Michelson et al., 1994; Zamir et al. 1994). This region linked to TG97, is considered a “hot-spot” for resistance since it contain several other resistance genes, including Am (Alfalfa mosaic virus), Mi (Meloidogyne spp), Cf-2/Cf-5 (Cladosporium fulvum), Ty-3 (TYLCV and ToMoV), Ol-1 (Oidium lycopersicum) and Bw-5 (Ralstonia solanacearum) (reviewed in Zhang et al., 2002; Labate et al., 2007). PCR-based markers used to tag the Ty-1 gene are being used in MAS by research institutes and commercial companies. A marker for the TG97 locus can be licensed from Hebrew University of Jerusalem, Israel or alternatively, the REX-1 or JB-1 CAPS (cleaved amplified polymorphic sequences) marker associated with the Ty-1 gene can be used (Williamson et al., 1994; De Castro et al., 2007). Most of the commercial cultivars resistant to TYLCV contain the Ty-1 gene (García-Cano et al., 2008). De Castro et al. (2007) reported the presence of Ty-1 gene in commercial cultivar Boludo and Anastasia (Seminis Vegetable Seeds Iberica, Barcelona, Spain).

As mentioned above, three accessions of S. chilense, LA1932, LA2779 and LA1938, showed resistance to TYLCV and ToMoV (Agrama & Scott, 2006). Inheritance studies and QTL mapping revealed at least three regions on chromosome 6 which contribute to both TYLCV and ToMoV resistance. Recently, Ji et al. (2007a) identified a large S. chilense introgression in advanced breeding line derived from LA2779. A major partially dominant gene, termed Ty-3, was mapped to chromosome 6. The introgression derived from LA2779 was found to also contain Ty-1, suggesting a genetic linkage between Ty- 1 and Ty-3 (Ji et al., 2007a). Using sequence analysis, two different alleles have been observed at the Ty-3 locus in lines with resistance derived from S. chilense LA2779 and S. chilense LA1932 (Maxwell et al., 2007). Therefore, in addition to the co- dominant sequence characterized amplified region (SCAR) marker reported by Ji et al.

(2007a) to detect the Ty-3 loci introgressed from S. chilense LA2779, another co- dominant SCAR marker has been reported for detection of the introgressions from S. chilense LA1932. This introgression has been given the tentative designation Ty-3a (Jensen et al., 2007; Ji et al., 2007a). Using advanced breeding lines derived from the above three S. chilense accessions, another minor resistance locus from S. chilense, termed Ty-4, was mapped to the long arm of chromosome 3. While approximately 60% of the variance in the TYLCV resistance in a segregating population was explained by the Ty-3 locus, Ty-4 accounted for only 16%. It was therefore concluded that Ty-3 has a major effect on resistance, while Ty-4 has a lesser effect (Ji et al., 2008).

Another TYLCV resistance locus, which originated from S. habrochaites f. glabratum accession B6013 (Kalloo & Banerjee, 1990) was introgression in H24. This locus was responsible for moderate resistance to ToLCV, had a partly dominant effect and was localized to the long arm of chromosome 11 (Hanson et al., 2000). This locus was further delimited to a smaller interval at approximately 5 cM from markers TG105A and T0302 (Ji et al., 2007b), and formally designated Ty-2 (Hanson et al., 2006). A locus linked to resistance from S. pimpinellifolium (hirsute-INRA) was mapped to a marker interval between TG153 and CT83 on tomato chromosome 6 (Chagué et al., 1997). Most recently, a major locus linked to resistance from S. peruvianum was localized on chromosome 4, and four additional loci were mapped to chromosomes 1, 7, 9 and 11 (Anbinder et al., 2009). The major quantitative trait loci (QTL), termed Ty-5, accounted for about 45% of the variation in symptom severity among segregating plants, while the minor QTLs contributed 12%.

Cumulatively, the above mentioned results suggest that resistance from different wild type Solanum species is controlled by multiple genes and underline the importance of different sources of resistant for tomato breeding. Unfortunately, although conventionally bred cultivars have often showed reduced virus titers compared to susceptible cultivars, none are immune to TYLCV and most lines bred for TYLCV resistance have been susceptible to bipartite viruses such as ToMoV (Ji et al., 2007b). In a recent F1 diallele study, Vidavski et al. (2008) crossed TYLCV-resistant lines that originated from different wild tomato progenitors and reported that several of these Ty resistance genes were complementary and, in some cases, resulted in hybrid plants displaying higher TYLCV resistance compared with their parental lines. The future stability and durability of a viral resistance will therefore strongly depend on the use of

multiple resistance genes with different mechanisms to control a range of disease- associated viruses and to prevent the selection of recombinant viral strains which could eventually result in resistance breaking (Seal et al., 2006b; García-Andrés et al., 2009). A combination of classical breeding with different sources of resistance, together with molecular markers in tight linkage with them, will facilitate pyramiding of these genes in a common background and will allow plant breeders to track resistance genes in a MAS breeding program. This will speed up the development of the next generation of begomovirus-resistant varieties.

Today, a growing repertoire of genetic resources is available that can serve to enhance plant breeding efforts and speed up the release of new resistant varieties. These genomic recourses include: (I) the tomato genome that is currently being sequenced in the framework of the International Solanaceae Genome Project (http://www.sgn.cornell.edu/solanaceaeproject), (II) molecular maps derived from interspecific crosses between S. lycopersicum and S. pennellii, S. habrochaites, S. pimpinellifollium, and others available on the SGN web site (www.sgn.cornell.edu) (Foolad, 2007), (III) microarray-based technologies such as Affymetrix GeneChip® Tomato Genome array and Agilent tomato gene expression microarrays that are used for tomato transcriptome analysis (Rensink & Buell, 2005) and (IV) the expanding tomato expressed sequence tagged (EST) database (Barone et al., 2008). Due to these genomic approaches, considerable progress is being made in unravelling gene functions and genome functionality. It is expected that many new resistance genes and polymorphisms in these genes or their regulation regions between resistant and susceptible genotypes could be found, expanding the gene pools available for crop improvement (Barone et al., 2009). The development of molecular markers directly from these genes, also referred to as “genic” molecular markers (GMM), will allow real gene-assisted breeding, without losing the desirable trait due to recombination events between the marker and the gene under selection and increase the precision and efficiency with which superior resistant varieties can be developed.

1.4.3 Genetic engineering strategies for developing crops resistant to geminiviruses

Although natural host-plant resistance remains the most desirable means of reducing crop losses, in order to broaden the options for plant virus resistance, future control

31 strategies may include transgenic resistance as an alternative or complementary strategy toward stable and broad-based resistance. The most used approach to achieve geminivirus resistance by genetic engineering is based on the pathogen derived resistance (PDR) mechanism/concept (Sanford & Johnson, 1985). PDR attempts used to date include (I) the expression of natural, mutant or truncated viral proteins that interfere with viral replication cycle and (II) the expression of viral nucleic acids sequence that silence the expression of virus genes (Baulcombe, 1996).

The first notable success achieved with PDR based on expression of a viral protein was CP mediated resistance (CPMR) against Tobacco mosaic virus (TMV; Powell-Abel et al., 1986). Although the molecular mechanisms that govern CPMR are not fully understood, it has been widely used to engineer resistance to a number of RNA viruses (Vanderschuren et al., 2007). Regarding CPMR resistance to begomoviruses, tomato plants expressing the CP of the monopartite begomovirus TYLCV exhibited delayed symptom development that was dependent on the expression levels of the transgenic CP (Kunik et al., 1994), Nevertheless, durable geminivirus resistance has not been achieved using this approach (Vanderschuren et al., 2007; Shephard et al. 2009). The integral role of the geminivirus Rep protein in viral replication and transcription has also made it a favored target for the PDR strategy. Various Rep-based mutation and truncation strategies undertaken by several groups demonstrated tolerance or strain specific immunity to geminiviruses, including ACMV (Hong & Stanley, 1995; Sangaré et al., 1999), TYLCV-SV (Noris et al., 1996; Brunetti et al., 1997; Lucioli et al., 2003; Antignus et al., 2004), Tomato leaf curl New Delhi virus (ToLCNDV) (Chatterji et al., 2001), BGMV (Hanson & Maxwell, 1999) and MSV (Shepherd et al., 2007a,b). Compared with CP- or replicase-mediated resistance strategies that were only highly effective against cognate viral infection (i.e. infection with the virus isolate from which the transgene was derived), the expression of dysfunctional or mutant movement proteins (MP) has been reported to confer a broader resistance (Von Arnim & Stanley, 1992; Duan et al., 1997; Prins et al., 2008).

In some protein mediated resistance approaches, it was found that the expression levels of transgene-encoded viral proteins often did not correlate with the level of virus resistance (Sinisterra et al., 1999; Prins et al., 2008). It was later discovered that in several cases the observed transgenic resistance turned out to be due to sequence- specific RNA breakdown (Vanderschuren et al., 2007). This post-transcriptional gene

32 silencing (PTGS) process, also known as RNA silencing or RNA interference (shortly RNAi), is a sequence-specific breakdown mechanism in plants and eukaryotes which represents a natural antiviral defense mechanism (Voinnet, 2001; 2005; Ding & Voinnet, 2007). In plants, PTGS involves the cleavage of dsRNA into 21-25 nucleotide small interfering RNAs (siRNAs; Hamilton & Baulcombe, 1999) by enzymes known as Dicers (Hamilton & Baulcombe 1999). The siRNAs then interact with various host proteins to form RNA-induced silencing complexes (RISC) in which the ds siRNAs are unwound and used as guides in the specific binding (by complementary base pairing) and destruction of targeted mRNA molecules. In addition to silencing through cleavage, RNA-mediated resistance toward DNA viruses is believed to also work through methylation of viral DNA causing transcriptional inactivation (Dogar, 2006). PTGS can be activated in transgenic plants by the introduction of dsRNAs homologous to viral sequences (for a review on geminivirus-induced PTGS and RNAi, see Pooggin & Hohn, 2004; Vanitharani et al., 2005; Vanderschuren et al., 2007; Shephard et al. 2009). Several studies reported the use of RNAi for obtaining resistance against geminiviruses, including ACMV (Chellappan et al., 2004; Vanderschuren et al., 2009); Mungbean yellow mosaic virus (MYMV; Pooggin & Hohn, 2003; 2004), TYLCV (Fuentes et al., 2006; Zrachya et al., 2007a,b), BGMV (Bonfim et al., 2007), SLCMV, EACMV (Chellappan et al., 2004), Cotton leaf curl Multan virus (CLCuMV Mubin et al., 2011) and Tomato leaf curl Taiwan virus (ToLCTWV; Lin et al., 2011), and have resulted in diverse resistance levels. Research utilizing RNAi to achieve geminivirus resistance is very promising in that any viral coding or non-coding sequence can be used without the need for protein expression. However, a major drawback of sequence-based RNA-mediated resistance is that the protection conferred is limited to cognate and closely related viruses (Prins et al., 1996; Mubin et al., 2011).

More recently, transgenic strategies based on the expression of non-pathogen derived antiviral agents have been investigated (Shepherd et al., 2009). The first such alternative resistance strategy mimicked the hypersensitive reaction used by plants at the initial site of infection. This strategy has been deployed against ACMV and Tomato leaf curl virus-Australia (TLCV-AU) by using the cell death inducing ribonuclease barnase and barstar genes from Bacillus amyloliquefaciens (Taylor et al., 2004; Pakniat-Jahromy et al., 2010). While this strategy was successful in achieving complete resistance to TLCV-AU, the fact that several geminiviruses have been shown to encode a suppressor of the hypersensitive response, provide a potential obstacle to

this approach (Hussain et al., 2005; Bisaro, 2006; Hussain et al., 2007; Mubin et al., 2011). Several other novel approaches to engineer geminivirus-resistance include the expression of DNA binding proteins (Rep-based artificial zinc finger proteins, Sera, 2005), peptide aptamers that binds strongly to the Rep protein and interferes with its intracellular function, and lastly the use of a GroEL homologues that bind to the viral CP as a tool to trap or capture viral particles and thereby disrupt geminivirus infections or lessen their harmful effects (Akad et al., 2007).

Several of the above mentioned approaches have demonstrated experimental resistance to geminiviruses in model plants. Most of the above mentioned transgenic plants have provided only moderate levels of resistance comparable to those obtained by conventional breeding techniques. Recently a bean cultivar with RNAi-mediated resistance to Bean golden mosaic virus as been approved for use in Brazil (Collinge et al., 2010’ Bonfirm et al., 2007; Tollefson, 2011), The commercial release of transgenic crops is however hampered due to rejection by certain sectors of consumers. Genetic engineering therefore remains an alternative and rapid method to transfer resistance genes to susceptible crops. In future, it is probable that genetic engineering and traditional breeding, using multiple resistance strategies, will be used in combination to achieve durable resistance to geminiviruses in the world’s most important food crops.

1.5 Outline of the thesis

Tomato is an important vegetable crop with nutritional and economic value, frequently grown by subsistence and resource poor farmers in South Africa. Production constraints due to pest and diseases are a major problem, reducing yield and crop quality. Since 1997 an epidemic of ToCSV (Begomovirus genus, family Geminiviridae) associated with an upsurge of the whitefly B. tabaci on tomato crops, has been reported in South Africa and Mozambique. Commercial tomato fields with 100% incidences are frequently recorded, leading to a complete lack of production in many regions. This PhD project investigated the South African whitefly vector/begomovirus/tomato-host pathosystem in order to provide information that is crucial to the development of knowledge-based disease management practices. To date, the variability of begomoviruses of tomato in South Africa is unknown, and no isolates from the majority of the tomato production regions have been studied. The first

34 step was to identify the viruses involved in the disease epidemics and further molecular and biological characterization of the most predominant variants/species. Virus diversity was assessed during a six year period (2006-2011) in most of the tomato production regions of the country and the role of recombination in the emergence of these virus species were assessed (Chapter 2). The next chapter (Chapter 3) deals with the construction of infectious clones of two of the most predominant and widespread ToCSV variants and assessment of their pathogenicity on tomato. As the spread of begomoviruses are completely dependent on their whitefly vector, the whitefly is one of the most important components of the vector/virus/host pathosystem. Consequently, the distribution, genetic diversity and host association of B. tabaci types (species) in the country was investigated using mitochondrial cytochrome oxidase I sequences in Chapter 4. Considering the increased incidence of begomovirus infection and considerable yield losses experienced, host plant resistance is considered to be the best control alternative. A preliminary screening of hybrids with combined resistance from different wild tomato species (S. chilense, S. pimpinellifolium, S. peruvianum and S. habrochaites) was performed to assess their responses to a severe variant of ToCSV, after the establishment of a controlled whitefly-mediated inoculation protocol (Chapter 5). Finally, chapter 6 presents a general discussion on the major findings and implications of the research results.

1.6 References

Abhary, M., Patil, B.L. & Fauquet, C.M. (2007) Molecular Biodiversity, taxonomy and nomenclature of Tomato Yellow leaf curl-like viruses. In: Tomato yellow leaf curl virus disease: Management, molecular biology, breeding for resistance. Ed. by Czosnek, H. Springer, Dordrecht, The Netherlands, pp. 86-121.

Abstract of Agricultural Statistics. (2011) Directorate: Statistics and Economic Analysis of the Department of Agriculture, Forestry and Fisheries, http://www.daff.gov.za/docs/statsinfo/Abstract_2011.pdf

Agrama, H.A. & Scott, J.W. (2006) Quantitative trait loci for Tomato yellow leaf curl virus and Tomato mottle virus resistance in tomato. Journal for the American Society for Horticultural Sciences 131:267-272.

Akad, F., Eybishtz, A., Edelbaum, D., Gorovits, R., Dar-Issa, O., Iraki, N. & Czosnek, H. (2007) Making a friend from a foe: Expressing a GroEL gene from the whitefly Bemisia tabaci in the phloem of tomato plants confers resistance to Tomato yellow leaf curl virus. Archives of Virology 152:1323-1339.

Anbinder, I., Reuveni, M., Azari, R., Paran, I., Nahon, S., Shlomo, H., Chen, L., Lapidot, M. & Levin, I. (2009) Molecular dissection of tomato leaf curl virus resistance in tomato line TY172 derived from Solanum peruvianum. Theoretical and Applied Genetics 119:519-530.

Anderson, P.K., Cunningham, A.A., Patel, N.G., Morales, F.J., Epstein, P.R. & Daszak, P. (2004) Emerging infectious diseases of plants: Pathogen pollution, climate change and agrotechnology drivers. Trends in Ecology and Evolution 19:535-544.

Antignus, Y., Nestel, D., Cohen, S. & Lapidot, M. (2001) Ultraviolet-deficient greenhouse environment affects whitefly attraction and flight-behavior. Environmental Entomology 30:394-399.

Antignus, Y., Vunsh, R., Lachman, O., Pearlsman, M., Maslenin, L., Hananya, U. & Rosner, A. (2004) Truncated rep gene originated from Tomato yellow leaf curl virus- Israel [mild] confers strain-specific resistance in transgenic tomato. Annals of Applied Biology 144:39-44.

Antignus Y. (2007) The management of Tomato yellow leaf curl virus (TYLCV) in greenhouses and the open field, a strategy of manipulation. In: Tomato yellow leaf curl virus disease: Management, molecular biology, breeding for resistance. Ed. by Czosnek, H. Springer, Dordrecht, The Netherlands, pp. 263-278.

Arguello-Astorga, G., Lopez-Ochoa, L., Kong, L.J., Orozco, B.M., Settlage, S.B. & Hanley-Bowdoin, L. (2004) A novel motif in geminivirus replication proteins interacts with the plant retinoblastoma-related protein. Journal of Virology 78:4817-4826.

Bananej, K., Kheyr-Pour, A., Salekdeh, G.H. & Ahoonmanesh, A. (2004) Complete nucleotide sequence of Iranian Tomato yellow leaf curl virus isolate: Further evidence for natural recombination amongst begomoviruses. Archives of Virology 149:1435- 1443.

Barone, A., Chiusano, M.L., Ercolano, M.R., Giuliano, G., Grandillo, S. & Frusciante, L. (2008) Structural and functional genomics of tomato. International Journal of Plant Genomics 820274:1-12.

Barone, A., Di Matteo, A., Carputo, D. & Frusciante, L. (2009) High-throughput genomics enhances tomato breeding efficiency. Current Genomics 10:1-9.

Baulcombe, D.C. (1996) Mechanisms of pathogen-derived resistance to viruses in transgenic plants. The Plant Cell 8:1833-1844.

Bedford, I.D., Briddon, R.W., Brown, J.K., Rosell, R.C. & Markham, P.G. (1994) Geminivirus-transmission and biological characterization of Bemisia tabaci (Gennadius) biotypes from different geographic regions. Annals of Applied Biology 125:311-325.

Berlinger, M.J. (1986) Host plant-resistance to Bemisia tabaci. Agriculture Ecosystems and Environment 17:69-82.

Bird, J. (1957) A whitefly-transmitted mosaic of Jatropha gossypifolia. Technical Paper Agricultural Experimental Station 22:1-35.

Bird, J. & Maramorosch, K. (1978) Viruses and virus diseases associated with whiteflies. Advances in Virus Research 22:55-110.

Bisaro, D.M. (2006) Silencing suppression by geminivirus proteins. Virology 344:158- 168.

Bonfim, K., Faria, J.C., Nogueira, E.O.P.L., Mendes, E.A. & Aragao, F.J.L. (2007) RNAi-mediated resistance to Bean golden mosaic virus in genetically engineered common bean (Phaseolus vulgaris). Molecular Plant-Microbe Interaction 20:717-726.

Briddon, R.W., Pinner, M.S., Stanley, J. & Markham, P.G. (1990) Geminivirus coat protein gene replacement alters insect specificity. Virology 177:85-94.

Briddon, R.W., Bedford, I.D., Tsai, J.H. & Markham, P.G. (1996) Analysis of the nucleotide sequence of the treehopper-transmitted geminivirus, Tomato pseudo-curly top virus, suggests a recombinant origin. Virology 219:387-394.

Briddon, R.W., Mansoor, S., Bedford, I.D., Pinner, M.S. & Markham, P.G. (2000) Clones of cotton leaf curl geminivirus induce symptoms atypical of cotton leaf curl disease. Virus Genes 20:19-26.

Briddon, R.W., Mansoor, S., Bedford, I.D., Pinner, M.S., Saunders, K., Stanley, J., Zafar, Y., Malik, K.A. & Markham, P.G. (2001) Identification of DNA components required for induction of cotton leaf curl disease. Virology 285:234-243.

Briddon, R.W., Bull, S.E., Amin, I., Idris, A.M., Mansoor, S., Bedford, I.D., Dhawan, P., Rishi, N., Siwatch, S.S., Abdel-Salam, A.M., Brown, J.K., Zafar, Y. & Markham, P.G. (2003) Diversity of DNA beta, a satellite molecule associated with some monopartite begomoviruses. Virology 312:106-121.

Briddon, R.W. & Stanley, J. (2006) Subviral agents associated with plant single- stranded DNA viruses. Virology 344:198-210.

Briddon, R.W., Patil, B.L., Bagewadi, B., Nawaz-ul-Rehman, M.S. & Fauquet, C.M. (2010) Distinct evolutionary histories of the DNA-A and DNA-B components of bipartite begomoviruses. BMC Evolutionary Biology 10:97.

Brown, J.K. (2000) Molecular markers for the identification and global tracking of whitefly vector-begomovirus complexes. Virus Research 71:233-260.

Brown, J.K. (2010) Phylogenetic biology of the Bemisia tabaci sibling species group. In: Bionomics and management of a global pest. Ed. by Stansly, P.A. & Naranjo, S.E., Springer, Amsterdam, pp. 31-67.

Brunetti, A., Tavazza, M., Noris, E., Tavazza, R., Caciagli, P., Ancora, G., Crespi, S., & Accotto, G.P. (1997) High expression of truncated viral Rep protein confers resistance to tomato yellow leaf curl virus in transgenic tomato plants. Molecular Plant-Microbe Interaction 10:571-579.

Bull, S.E., Tsai, W.S., Briddon, R.W., Markham, P.G., Stanley, J. & Green, S.K. (2004) Diversity of begomovirus DNA beta satellites of non-malvaceous plants in East and South East Asia - brief report. Archives of Virology 149:1193-1200.

Byrne, D.N. & Bellows, T.S. (1991) Whitefly biology. Annual Review of Entomology 36:431-457.

Chague, V., Mercier, J.C., Guenard, M., De Courcel, A. & Vedel, F. (1997) Identification of RAPD markers linked to a locus involved in quantitative resistance to TYLCV in tomato by bulked segregant analysis. Theoretical and Applied Genetics 95:671-677.

Chatterji, A., Beachy, R.N. & Fauquet, C.M. (2001) Expression of the oligomerization domain of the replication-associated protein (Rep) of Tomato leaf curl New Delhi virus interferes with DNA accumulation of heterologous geminiviruses. Journal of Biological Chemistry 276:25631-25638.

Channarayappa, Muniyappa, V., Schwegler-Berry, D., Shivashankar, G. (1992) Ultrastructural-changes in tomato infected with tomato leaf curl virus, a whitefly- transmitted geminivirus. Canadian Journal of Botany-Revue Canadienne de Botanique 70:1747-1753.

Chellappan, P., Masona, M.V., Vanitharani, R., Taylor, N.J. & Fauquet, C.M. (2004) Broad spectrum resistance to ssDNA viruses associated with transgene-induced gene silencing in cassava. Plant Molecular Biology 56:601-611.

Chen, J., Mcauslane, H.J., Carle, R.B. & Webb, S.E. (2004) Impact of Bemisia argentifolii (Homoptera:Auchenorrhynca:Aleyrodidae) infestation and squash silverleaf disorder on zucchini yield and quality. Journal of Economic Entomology 97:2083-2094.

Chowda-Reddy, R.V., Achenjang, F., Felton, C., Etarock, M.T., Anangfac, M.T., Nugent, P. & Fondong, V.N. (2008) Role of a geminivirus AV2 protein putative protein kinase C motif on subcellular localization and pathogenicity. Virus Research 135:115- 124.

Collinge, D.B., Jorgensen, H.J.L., Lund, O.S. & Lyngkjaer, M.F. (2010) Engineering pathogen resistance in crop plants: Current trends and future prospects. Annual Review of Phytopathology 48:269-291.

Costa, A.S. & Russell, L.M. (1975) Failure of Bemisia tabaci to breed on cassava plants in Brazil (Homoptera: Aleyrodidae). Ciencia e Cultura 27:388-390.

Costa, H.S. & Brown, J.K. (1991) Variation in biological characteristics and esterase patterns among populations of Bemisia tabaci and the association of one population with silverleaf symptom induction. Entomologia Experimentalis et Applicata 61:211- 219.

Davino, S., Napoli, C., Dellacroce, C., Miozzi, L., Noris, E., Davino, M. & Accotto, G.P. (2009) Two new natural begomovirus recombinants associated with the tomato yellow leaf curl disease co-exist with parental viruses in tomato epidemics in Italy. Virus Research 143:15-23.

De Barro, P.J., Liu, S.S., Boykin, L.M. & Dinsdale, A.B. (2011) Bemisia tabaci: A statement of species status. Annual Review of Entomology 56:1-19.

De Castro, A.P., Blanca, J.M., Diez, M.J. & Vinals, F.N. (2007) Identification of a CAPS marker tightly linked to the tomato yellow leaf curl disease resistance gene Ty-1 in tomato. European Journal Plant Pathology 117:347-356.

Dennehy, T.J., Degain, B.A., Harpold, V.S., Zaborac, M., Morin, S., Fabrick, J.A., Nichols, R.L., Brown, J.K., Byrne, F.J. & Li, X. (2010) Extraordinary resistance to insecticides reveals exotic Q biotype of Bemisia tabaci (Gennadius) in the New World. Journal of Economic Entomology 103:2174-2186.

Desbiez, C.C., Mettouchi, D.A., Laufs, J. & Gronenborn, B. (1995) Rep protein of tomato yellow leaf curl geminivirus (TYLCV) has an ATPase activity required for viral DNA replication. Proceedings of the National Academy of Sciences 92:5640-5644.

Diez, M.J. & Nuez, F. (2008) Tomato. In: Handbook of plant breeding: Vegetables II. Ed. by Prohens, J., Nuez, F & Carena, M.J., Springer, New York. pp. 249-323.

Ding, S.W. & Voinnet, O. (2007) Antiviral immunity directed by small RNAs. Cell 130:413-426.

Dinsdale, A., Cook, L., Riginos, C., Buckley, Y.M. & De Barro, P. (2010) Refined global analysis of Bemisia tabaci (Hemiptera: Sternorrhyncha: Aleyrodoidea: Aleyrodidae) mitochondrial cytochrome oxidase 1 to identify species level genetic boundaries. Annals of the Entomological Society of America 103:196-208.

Dogar, A.M. (2006) RNAi dependent epigenetic marks on a geminivirus promoter. Virology Journal 3:5.

Dry, I.B., Rigden, J.E., Krake, L.R., Mullineaux, P.M. & Rezaian, M.A. (1993) Nucleotide-sequence and genome organization of tomato leaf curl geminivirus. Journal of General Virology 74:147-151.

Duan, Y.P., Powell, C.A., Webb, S.E., Purcifull, D.E. & Hiebert, E. (1997) Geminivirus resistance in transgenic tobacco expressing mutated BC1 protein. Molecular Plant- Microbe Interactions 10:617-623.

Duffy, S. & Holmes, E.C. (2007) Multiple introductions of the old world begomovirus Tomato yellow leaf curl virus into the new world. Applied and Environmental Microbiology 73:7114-7117.

Duffy, S. & Holmes, E.C. (2009) Validation of high rates of nucleotide substitution in geminiviruses: Phylogenetic evidence from East African cassava mosaic viruses. Journal of General Virology 90:1539-1547.

Eagle, P.A., Orozco, B.M. & Hanleybowdoin, L. (1994) A DNA-sequence required for geminivirus replication also mediates transcriptional regulation. Plant Cell 6:1157-1170.

Elmer, J.S., Brand, L., Sunter, G., Gardiner, W.E., Bisaro, D.M. & Rogers, S.G. (1988) Genetic analysis of the Tomato golden mosaic virus 2. The product of the Al1 coding sequence is required for replication. Nucleic Acids Research 16:7043-7060.

Etessami, P., Saunders, K., Watts, J. & Stanley, J. (1991) Mutational analysis of complementary-sense genes of African cassava mosaic virus DNA-A. Journal of General Virology 72:1005-1012.

Fargette, D., Konate, G., Fauquet, C., Muller, E., Peterschmitt, M. & Thresh, J.M. (2006) Molecular ecology and emergence of tropical plant viruses. Annual Review of Phytopathology 44:235-260.

Fauquet, C.M., Maxwell, D.P., Gronenborn, B. & Stanley, J. (2000) Revised proposal for naming geminiviruses. Archives of Virology 145:174-176.

Fauquet, C.M. & Stanley, J. (2003) Geminivirus classification and nomenclature: Progress and problems. Annals of Applied Biology 142:165-189.

Fauquet, C.M. & Stanley, J. (2005) Revising the way we conceive and name viruses below the species level: A review of geminivirus taxonomy calls for new standardized isolate descriptors. Archives of Virology 150:2151-2179.

Fauquet, C.M., Briddon, R.W., Brown, J.K., Moriones, E., Stanley, J., Zerbini, M. & Zhou, X. (2008) Geminivirus strain demarcation and nomenclature. Archives of Virology 153:783-821.

Fondong, V.N., Pita, J.S., Rey, M.E.C., De Kochko, A., Beachy, R.N. & Fauquet, C.M. (2000) Evidence of synergism between African cassava mosaic virus and a new double-recombinant geminivirus infecting cassava in Cameroon. Journal of General Virology 81:287-297.

Fontes, E.P.B., Gladfelter, H.J., Schaffer, R.L., Petty, I.T.D. & Hanley-Bowdoin, L. (1994) Geminivirus replication origins have a modular organization. Plant Cell 6:405- 416.

Foolad, M.R. (2007) Genome mapping and molecular breeding of tomato. International Journal of Plant Genomics 64358:1-52.

Freeman, T.P., Buckner, J.S., Nelson, D.R., Chu, C.C. & Henneberry, T.J. (2001) Stylet penetration by Bemisia argentifolii (Homoptera: Aleyrodidae) into host leaf tissue. Annals of the Entomological Society of America 94:761-768.

Friedmann, M., Lapidot, M., Cohen, S. & Pilowsky, M. (1998) Novel source of resistance to Tomato yellow leaf curl virus exhibiting a symptomless reaction to viral infection. Journal of the American Society for Horticultural Science 123:1004-1007.

Frohlich, D.R., Torres-Jerez, I., Bedford, I.D., Markham, P.G. & Brown, J.K. (1999) A phylogeographical analysis of the Bemisia tabaci species complex based on mitochondrial DNA markers. Molecular Ecology 8:1683-1691.

Fuentes, A., Ramos, P.L., Fiallo, E., Callard, D., Sanchez, Y., Peral, R., Rodriguez, R. & Pujol, M. (2006) Intron-hairpin RNA derived from replication associated protein C1 gene confers immunity to Tomato yellow leaf curl virus infection in transgenic tomato plants. Transgenic Research 15:291-304.

Gafni, Y. & Epel, B.L. (2002) The role of host and viral proteins in intra- and inter- cellular trafficking of geminiviruses. Physiological and Molecular Plant Pathology 60:231-241.

Gafni, Y. (2003) Tomato yellow leaf curl virus, the intracellular dynamics of a plant DNA virus. Molecular Plant Pathology 4:9-15.

García-Arenal, F., Fraile, A. & Malpica, J.M. (2003) Variation and evolution of plant virus populations. International Microbiology 6:225-232.

García-Andres, S., Accotto, G.P., Navas-Castillo, J. & Moriones, E. (2007a) Founder effect, plant host, and recombination shape the emergent population of begomoviruses that cause the tomato yellow leaf curl disease in the mediterranean basin. Virology 359:302-312.

García-Andres, S., Tomas, D.M., Sanchez-Campos, S., Navas-Castillo, J. & Moriones, E. (2007b) Frequent occurrence of recombinants in mixed infections of tomato yellow leaf curl disease-associated begomoviruses. Virology 365:210-219.

García-Cano, E., Resende, R.O., Boiteux, L.S., Giordano, L.B., Fernandez-Munoz, R. & Moriones, E. (2008) Phenotypic expression, stability, and inheritance of a recessive resistance to monopartite begomoviruses associated with tomato yellow leaf curl disease in tomato. Phytopathology 98:618-627.

García-Andres, S., Tomas, D.M., Navas-Castillo, J. & Moriones, E. (2009) Resistance- driven selection of begomoviruses associated with the tomato yellow leaf curl disease. Virus Research 146:66-72.

Ge, L.M., Zhang, J.T., Zhou, X.P. & Li, H.Y. (2007) Genetic structure and population variability of Tomato yellow leaf curl China virus. Journal of Virology 81:5902-5907.

Gennadius, P. (1889) Disease of the tobacco plantations in the Trikonia. The aleurodid of tobacco. Ellenike Georgia 5:1-3.

Gill, R.J. (1992) A review of the sweetpotato whitefly in southern California. The Pan- Pacific Entomologist 68:144-152.

Gill, R. & Brown, J.K. (2010) Systematics of Bemisia and Bemisia Relatives: Can molecular techniques solve the Bemisia tabaci complex conundrum-a Taxonomist’s viewpoint. In: Bionomics and Management of a Global Pest. Ed. by Stansly P.A. & Naranjo S.E., Springer, Amsterdam, pp. 5-29.

Glick, E., Zrachya, A., Levy, Y., Mett, A., Gidoni, D., Belausov, E., Citovsky, V. & Gafni, Y. (2008) Interaction with host SGS3 is required for suppression of RNA silencing by Tomato yellow leaf curl virus V2 protein. Proceedings of the National Academy of Sciences 105:157-161.

Gutierrez, C. (1999) Geminivirus DNA replication. Cellular and Molecular Life Sciences 56:313-329.

Hamilton, W.D.O., Bisaro, D.M., Coutts, R.H.A. & Buck, K.W. (1983) Demonstration of the bipartite nature of the genome of a single-stranded DNA plant virus by infection with the cloned DNA components. Nucleic Acids Research 11:7387-7396.

Hamilton, A.J. & Baulcombe, D.C. (1999) A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286:950-952.

Hanley-Bowdoin, L., Settlage, S.B., Orozco, B.M., Nagar, S. & Robertson, D. (1999) Geminiviruses: models for plant DNA replication, transcription, and cell cycle regulation. Critical Review in Plant Science 18:71-106.

Hanley-Bowdoin, L., Settlage, S.B., Orozco, B.M., Nagar, S. & Robertson, D. (2000) Geminiviruses: Models for plant DNA replication, transcription, and cell cycle regulation. Critical Reviews in Biochemistry and Molecular Biology 35:105-140.

Hanley-Bowdoin, L., Settlage, S.B. & Robertson, D. (2004) Reprogramming plant gene expression: A prerequisite to geminivirus DNA replication. Molecular Plant Pathology 5:149-156.

Hanson, S.F. & Maxwell, D.P. (1999) Trans-dominant inhibition of geminiviral DNA replication by Bean golden mosaic geminivirus rep gene mutants. Phytopathology 89:480-486.

Hanson, P.M., Bernacchi, D., Green, S., Tanksley, S.D., Muniyappa, V., Padmaja, S., Chen, H.M., Kuo, G., Fang, D. & Chen, J.T. (2000) Mapping a wild tomato introgression associated with Tomato yellow leaf curl virus resistance in a cultivated tomato line. Journal of the American Society for Horticultural Science 125:15-20.

Hanson, P., Green, S.K. & Kuo, G. (2006) Ty-2, a gene on chromosome 11 conditioning geminivirus resistance in tomato. Tomato Genetics Cooperative Report 56:17-18.

Harrison, B.D. (1985) Advances in geminivirus research. Annual Review of Phytopathology 23:55-82.

Harrison, B.D., Zhou, X., Otim-Nape, G.W., Liu, Y. & Robinson, D.J. (1997) Role of a novel type of double infection in the geminivirus-induced epidemic of severe cassava mosaic in Uganda. Annals of Applied Biology 131:437-448.

Harrison, B.D. & Robinson, D.J. (1999) Natural genomic and antigenic variation in whitefly-transmitted geminiviruses (begomoviruses). Annual Review of Phytopathology 37:369-398.

Harrison, B. D., Swanson, M. M. & Fargette, D. (2002) Begomovirus coat protein: Serology, variation and functions. Physiological and Molecular Plant Pathology 60:257- 271.

Hartitz, M.D., Sunter, G. & Bisaro, D.M. (1999) The tomato golden mosaic virus transactivator (TrAP) is a single-stranded DNA and zinc-binding phosphoprotein with an acidic activation domain. Virology 263:1-14.

Hong, Y.G. & Stanley, J. (1995) Regulation of African cassava mosaic virus complementary-sense gene-expression by N-terminal sequences of the replication- associated protein Ac1. Journal of General Virology 76:2415-2422.

Hoogstraten, R.A., Hanson, S.F. & Maxwell, D.P. (1996) Mutational analysis of the putative nicking motif in the replication-associated protein (AC1) of Bean golden mosaic geminivirus. Molecular Plant-Microbe Interactions 9:594-599.

Horowitz, R., Denholm, I. & Morin, S. (2007) Resistance to insecticides in the TYLCV whitefly vector Bemisia tabaci. In: Tomato yellow leaf curl virus disease: Management, molecular biology, breeding for resistance. Ed. by Czosnek, H. Springer, Dordrecht, The Netherlands, pp. 305-325.

Hussain, M., Mansoor, S., Iram, S., Fatima, A.N. & Zafar, Y. (2005) The nuclear shuttle protein of Tomato leaf curl New Delhi virus is a pathogenicity determinant. Journal of Virology 79:4434-4439.

Hussain, M., Mansoor, S., Iram, S., Zafar, Y. & Briddon, R.W. (2007) The hypersensitive response to Tomato leaf curl New Delhi virus nuclear shuttle protein is inhibited by transcriptional activator protein. Molecular Plant-Microbe Interaction 20:1581-1588.

ICTV. (2009) Virus Taxonomy (2009 release) http://www.ictvonline.org/virus Taxonomy.asp?version=2009

Isnard, M., Granier, M., Frutos, R., Reynaud, B. & Peterschmitt, M. (1998) Quasispecies nature of three Maize streak virus isolates obtained through different modes of selection from a population used to assess response to infection of maize cultivars. Journal of General Virology 79:3091-3099.

Jeger, M.J., Seal, S.E. & Van den Bosch, F. (2006) Evolutionary epidemiology of plant virus disease. Plant Virus Epidemiology 67:163-203.

Jensen, K.S., Martin, C.T. & Maxwell, D.P. (2007) A CAPS marker, FER-G8, for detection of Ty3 and Ty3a alleles associated with S. chilense introgressions for begomovirus resistance in tomato breeding lines. http://www.plantpath.wisc.edu/ GeminivirusResistantTomatoes/Markers/ MAS-Protocols/Ty3a-CAPS.pdf.

Jeske, H. (2009) Geminiviruses. In: Torque Teno Virus: the still elusive human pathogens. Ed. by Hausen, H. & de Villiers, E.-M., Springer, Berlin pp.185-226.

Jeske, H., Lutgemeier, M. & Preiss, W. (2001) DNA forms indicate rolling circle and recombination-dependent replication of Abutilon mosaic virus. EMBO Journal 20:6158- 6167.

Ji, Y., Schuster, D.J. & Scott, J.W. (2007a) Ty-3, a begomovirus resistance locus near the Tomato yellow leaf curl virus resistance locus Ty-1 on chromosome 6 of tomato. Molecular Breeding 20:271-284.

Ji, Y., Scott, J.W., Hanson, P., Graham, E. & Maxwell, D.P. (2007b) Sources of resistance, inheritance, and location of genetic loci conferring resistance to members of the tomato-infecting begomoviruses. In: Tomato yellow leaf curl virus disease: Management, molecular biology, breeding for resistance. Ed. by Czosnek, H. Springer, Dordrecht, The Netherlands, pp. 343-362.

Ji, Y., Scott, J. W., Maxwell, D. P. & Schuster, D. J. (2008) Ty-4, a tomato yellow leaf curl virus resistance gene on chromosome 3 of tomato. Tomato Genetics Cooperative Report 58:29-31.

Ji, Y.F., Scott, J.W., Schuster, D.J. & Maxwell, D.P. (2009) Molecular mapping of Ty-4, a new Tomato yellow leaf curl virus resistance locus on chromosome 3 of tomato. Journal of the American Society for Horticultural Science 134:281-288.

Jones, D.R. (2003) Plant viruses transmitted by whiteflies. European Journal of Plant Pathology 109:195-219.

Jones, R.A.C. (2009) Plant virus emergence and evolution: Origins, new encounter scenarios, factors driving emergence, effects of changing world conditions, and prospects for control. Virus Research 141:113-130.

Jupin, I., Dekouchkovsky, F., Jouanneau, F. & Gronenborn, B. (1994) Movement of Tomato yellow leaf curl geminivirus (TYLCV) - involvement of the protein encoded by ORF C4. Virology 204:82-90.

Kalloo, G. & Banerjee, M.K. (1990) Transfer of tomato leaf curl virus resistance from Lycopersicon hirsutum f. glabratum to L. esculentum. Plant Breeding 105:156-159.

Kheyr-Pour, A., Bendahmane, M., Matzeit, V., Accotto, G.P., Crespi, S. & Gronenborn, B. (1991) Tomato yellow leaf curl virus from Sardinia is a whitefly-transmitted monopartite geminivirus. Nucleic Acids Research 19:6763-6769.

Klute, K.A., Nadler, S.A. & Stenger, D.C. (1996) Horseradish curly top virus is a distinct subgroup II geminivirus species with rep and C4 genes derived from a subgroup III ancestor. Journal of General Virology 77:1369-1378.

Kong, L. J., Orozco, B.M., Roe, J.L., Nagar, S., Ou, S., Feiler, H.S., Durfee, T., Miller, A.B., Gruissem, W., Robertson, D. & Hanley-Bowdoin, L. (2000) A geminivirus replication protein interacts with the retinoblastoma protein through a novel domain to determine symptoms and tissue specificity of infection in plants. European Molecular Biology Organization Journal 19:3485-3495.

Krake, L.R., Rezaian, M.A. & Dry, I.B. (1998) Expression of the tomato leaf curl geminivirus C4 gene produces viruslike symptoms in transgenic plants. Molecular Plant-Microbe Interactions 11:413-417.

Krupovic, M., Ravantti, J.J. & Bamford, D.H. (2009) Geminiviruses: A tale of a plasmid becoming a virus. BMC Evolutionary Biology 9:112.

Kunik, T., Salomon, R., Zamir, D., Navot, N., Zeidan, M., Michelson, I., Gafni, Y. & Czosnek, H. (1994) Transgenic tomato plants expressing the tomato yellow leaf curl virus capsid protein are resistant to the virus. Bio/Technology 12:500-504.

Labate, J.A., Grandillo, S., Fulton, T., Munos, S., Caicedo, A.L., Peralta, I., Ji, R.T. et al. (39 authors in total) (2007) Tomato. In: Genome Mapping and Molecular Breeding in Plants, Vegetables. Ed. by Kole, C.R., Springer-Verlag, Berlin, Heidelberg, pp. 1-125.

Lapidot, M., Friedmann, M., Lachman, O., Yehezkel, A., Nahon, S., Cohen, S. & Pilowsky, M. (1997) Comparison of resistance level to Tomato yellow leaf curl virus among commercial cultivars and breeding lines. Plant Disease 81:1425-1428.

Lapidot, M., Friedmann, M., Pilowsky, M., Ben-Joseph, R. & Cohen, S. (2001) Effect of host plant resistance to Tomato yellow leaf curl virus (TYLCV) on virus acquisition and transmission by its whitefly vector. Phytopathology 91:1209-1213.

Lapidot, M. & Friedmann, M. (2002) Breeding for resistance to whitefly-transmitted geminiviruses. Annals of Applied Biology 140:109-127.

Lapidot, M & Polston, J.E. (2011) Biology and Epidemiology of Bemisia-vectored viruses. In: Bionomics and Management of a Global Pest. Ed. by Stansly P.A. & Naranjo S.E., Springer, Amsterdam, pp. 227-231.

Latham, J.R., Saunders, K., Pinner, M.S. & Stanley, J. (1997) Induction of plant cell division by Beet curly top virus gene C4. Plant Journal 11:1273-1283.

Laufs, J., Traut, W., Heyraud, F., Matzeit, V., Rogers, S.G., Schell, J. & Gronenborn, B. (1995) In-vitro cleavage and joining at the viral origin of replication by the replication initiator protein of Tomato yellow leaf curl virus. Proceedings of the National Academy of Sciences 92:3879-3883.

Lazarowitz, S.G. & Lazdins, I.B. (1991) Infectivity and complete nucleotide-sequence of the cloned genomic components of a bipartite Squash leaf curl geminivirus with a broad host range phenotype. Virology 180:58-69.

Legg, J.P., Owor, B., Sseruwagi, P. & Ndunguru, J. (2006). Cassava mosaic virus disease in east and central Africa: Epidemiology and management of a regional pandemic. Plant Virus Epidemiology 67:355-418.

Levy, D. & Lapidot, M. (2008) Effect of plant age at inoculation on expression of genetic resistance to Tomato yellow leaf curl virus. Archives of Virology 153:171-179.

Lin, C.Y., Ku, H.M., Tsai, W.S., Green, S.K. & Jan, F.J. (2011) Resistance to a DNA and a RNA virus in transgenic plants by using a single chimeric transgene construct. Transgenic Research 20:261-270.

Lucioli, A., Noris, E., Brunetti, A., Tavazza, R., Ruzza, V., Castillo, A.G., Bejarano, E.R., Accotto, G.P. & Tavazza, M. (2003) Tomato yellow leaf curl Sardinia virus rep- derived resistance to homologous and heterologous geminiviruses occurs by different mechanisms and is overcome if virus-mediated transgene silencing is activated. Journal of Virology 77:6785-6798.

Mansoor, S., Briddon, R.W., Zafar, Y. & Stanley, J. (2003) Geminivirus disease complexes: An emerging threat. Trends in Plant Science 8:128-134.

Martin, D.P., Willment, J.A., Billharz, R., Velders, R., Odhiambo, B., Njuguna, J., James, D. & Rybicki, E.P. (2001) Sequence diversity and virulence in Zea mays of Maize streak virus isolates. Virology 288:247-255.

Maruthi, M.N., Czosnek, H., Vidavski, F., Tarba, S.Y., Milo, J., Leviatov, S., Venkatesh, H.M., Padmaja, A.S., Kulkarni, R.S. & Muniyappa, V. (2003) Comparison of resistance to Tomato leaf curl virus (india) and Tomato yellow leaf curl virus (Israel) among Lycopersicon wild species, breeding lines and hybrids. European Journal of Plant Pathology 109:1-11.

Maxwell, D.P., Martin, C., Salus, M., Montes, L., & Mejía, L. (2006) Tagging begomovirus resistance genes. http://www.plantpath.wisc.edu/Geminivirus ResistantTomatoes/Markers.

Maxwell, D.P., Martin, C.T., Garcia, B.E., Salus, M.S., Jensen, K.S, Havey, M.J. & Mejía, L. (2007) Markers for tomato chromosomes. www.plantpath.wisc.edu/ GeminivirusResistant Tomatoes.

Mejía, L., Teni, R.E., Vidavski, F., Czosnek, H., Lapidot, M., Nakhla, M.K. & Maxwell, D.P. (2005) Evaluation of tomato germplasm and selection of breeding lines for resistance to begomoviruses in Guatemala. Acta Horticultura 695:251-256.

Michelson, I., Zamir, D. & Czosnek, H. (1994) Accumulation and translocation of Tomato yellow leaf curl virus (TYLCV) in a Lycopersicon esculentum breeding line containing the L. chilense TYLCV tolerance gene Ty-1. Phytopathology 84:928-933.

Monci, F., Sanchez-Campos, S., Navas-Castillo, J. & Moriones, E. (2002) A natural recombinant between the geminiviruses Tomato yellow leaf curl Sardinia virus and Tomato yellow leaf curl virus exhibits a novel pathogenic phenotype and is becoming prevalent in spanish populations. Virology 303:317-326.

Morales, F.J. (2001) Conventional breeding for resistance to Bemisia tabaci- transmitted geminiviruses. Crop Protection 20:825-834.

Morales, F.J. & Anderson, P.K. (2001) The emergence and dissemination of whitefly- transmitted geminiviruses in Latin America - brief review. Archives of Virology 146:415- 441.

Morales, F.J. & Jones, P.G. (2004) The ecology and epidemiology of whitefly- transmitted viruses in Latin America. Virus Research 100:57-65.

Morales, F.J. (2006) History and current distribution of begomoviruses in Latin America. Advances in Virus Research 67:127-162.

Morilla, G., Krenz, B., Jeske, H., Bejarano, E.R. & Wege, C. (2004) Tête à tête of Tomato Yellow Leaf Curl virus and Tomato yellow leaf curl Sardinia virus in single nuclei. Journal of Virology 78:10715-10723.

Morin, S., Ghanim, M., Sobol, I. & Czosnek, H. (2000) The GroEL protein of the whitefly Bemisia tabaci interacts with the coat protein of transmissible and nontransmissible begomoviruses in the yeast two-hybrid system. Virology 276:404-416.

Moriones, E. & Navas-Castillo, J. (2000) Tomato yellow leaf curl virus, an emerging virus complex causing epidemics worldwide. Virus Research 71:123-134.

Moriones, E. & Navas-Castillo, J. (2008) Rapid evolution of the population of begomoviruses associated with the tomato yellow leaf curl disease after invasion of a new ecological niche. Spanish Journal of Agricultural Research 6:147-159.

Muangsan, N., Beclin, C., Vaucheret, H. & Robertson, D. (2004) Geminivirus VIGS of endogenous genes requires SGS2/SDE1 and SGS3 and defines a new branch in the genetic pathway for silencing in plants. Plant Journal 38:1004-1014.

Mubin, M., Hussain, M., Briddon, R.W. & Mansoor, S. (2011) Selection of target sequences as well as sequence identity determine the outcome of RNAi approach for resistance against cotton leaf curl geminivirus complex. Virology Journal 8:122.

Nagar, S., Pedersen, T.J., Carrick, K.M., Hanleybowdoin, L. & Robertson, D. (1995) A geminivirus induces expression of a host DNA-synthesis protein in terminally differentiated plant-cells. Plant Cell 7:705-719.

Nash, T.E., Dallas, M.B., Reyes, M.I., Buhrman, G.K., Ascencio-Ibanez, J.T. & Hanley- Bowdoin, L. (2011) Functional analysis of a novel motif conserved across geminivirus rep proteins. Journal of Virology 85:1182-1192.

Nauen, R. & Denholm, I. (2005) Resistance of insect pests to neonicotinoid insecticides: current status and future prospects. Archives of Insect Biochemistry and Physiology 58:200-215.

Navas-Castillo, J., Sanchez-Campos, S. Noris, E., Louro, D., Accotto, G.P. & Moriones, E. (2000) Natural recombination between Tomato yellow leaf curl virus-Is and Tomato leaf curl virus Journal of General Virology 81:2797-2801.

Navas-Castillo, J., Fiallo-Olive, E. & Sanchez-Campos, S. (2011) Emerging virus diseases transmitted by whiteflies. Annual Review of Phytopathology 49:15.1-15.30.

Navot, N., Pichersky, E., Zeidan, M., Zamir, D. & Czosnek, H. (1991) Tomato yellow leaf curl virus - a whitefly-transmitted geminivirus with a single genomic component. Virology 185:151-161.

Nawaz-Ul-Rehman, M.S. & Fauquet, C.M. (2009) Evolution of geminiviruses and their satellites. FEBS Letters 583:1825-1832.

NDA. (2009) Directorate: Agricultural Statistics Section. Pretoria, South Africa. http://www.nda.agric.za/docs/statsinfo/Abstract_2009.pdf.

Ndunguru, J., Legg, J.P., Aveling, T.A.S., Thompson, G. & Fauquet, C.M. (2005). Molecular biodiversity of cassava begomoviruses in Tanzania: Evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses. Virology Journal 2:21.

Noris, E., Accotto, G.P., Tavazza, R., Brunetti, A., Crespi, S. & Tavazza, M. (1996) Resistance to Tomato yellow leaf curl geminivirus in Nicotiana benthamiana plants transformed with a truncated viral C1 gene. Virology 224:130-138.

Noris, E., Vaira, A.M., Caciagli, P., Masenga, V., Gronenborn, B. & Accotto, G.P. (1998) Amino acids in the capsid protein of Tomato yellow leaf curl virus that are crucial for systemic infection, particle formation, and insect transmission. Journal of Virology 72:10050-10057.

Orozco, B.M. & Hanley-Bowdoin, L. (1996) A DNA structure is required for geminivirus replication origin function. Journal of Virology 70:148-158.

Orozco, B.M., Miller, A.B., Settlage, S.B. & Hanley-Bowdoin, L. (1997) Functional domains of a geminivirus replication protein. Journal of Biological Chemistry 272:9840- 9846.

Padidam, M., Beachy, R.N. & Fauquet, C.M. (1995) Classification and identification of geminiviruses using sequence comparisons. Journal of General Virology 76:249-263.

Padidam, M., Beachy, R.N. & Fauquet, C.M. (1996) The role of AV2 (''precoat'') and coat protein in viral replication and movement in tomato leaf curl geminivirus. Virology 224:390-404.

Padidam, M., Sawyer, S. & Fauquet C.M. (1999) Possible emergence of new geminiviruses by frequent recombination Virology 265:218-225.

Pakniat-Jahromy, A., Behjatnia, S.A.A., Dry, I.B., Izadpanah, K. & Rezaian, M.A. (2010) A new strategy for generating geminivirus resistant plants using a DNA betasatellite/split barnase construct. Journal of Virological Methods 170:57-66.

Pascal, E., Sanderfoot, A.A., Ward, B.M., Medville, R., Turgeon, R. & Lazarowitz, S.G. (1994) The geminivirus Br1 movement protein binds single-stranded-DNA and localizes to the cell nucleus. Plant Cell 6:995-1006.

Pico, B., Diez, M.J. & Nuez, F. (1996) Viral diseases causing the greatest economic losses to the tomato crop .2. The Tomato yellow leaf curl virus - A review. Scientia Horticulturae 67:151-196.

Pico, B., Ferriol, M., Dı´ez, M.J. & Nuez, F. (1999) Developing tomato breeding lines resistant to tomato yellow leaf curl virus. Plant Breeding 118:537-542.

Pietersen, G., Idris, A.M., Krüger, K. & Brown, J.K. (2000) Tomato curly stunt virus, a new begomovirus of tomato within the Tomato yellow leaf curl virus-Is cluster in South Africa. Plant Disease 84:810.

Pietersen, G. & Smith, M.F. (2002) Tomato yellow leaf curl virus resistant tomatoes show resistance to Tomato curly stunt virus. Plant Disease 86:528-534.

Pietersen, G., Idris, A.M., Kruger, K. & Brown, J.K. (2008) Characterization of Tomato curly stunt virus: A new tomato-infecting begomovirus from South Africa. Plant Pathology 57:809-818.

Pilartz, M. & Jeske, H. (2003) Mapping of abutilon mosaic geminivirus minichromosomes. Journal of Virology 77:10808-10818.

Pilowsky, M. & Cohen, S. (1990) Tolerance to Tomato yellow leaf curl virus derived from Lycopersicon peruvianum. Plant Disease 74:248-250.

Pita, J.S., Fondong, V.N., Sangare, A., Kokora, R.N.N. & Fauquet, C.M. (2001) Genomic and biological diversity of the African cassava geminiviruses. Euphytica 120:115-125.

Polston, J.E., Bois, D., Serra C.A. & Concepcion S. (1994) First report of a tomato yellow a Tomato yellow leaf curl-like geminivirus in the Western Hemisphere. Plant Disease 78:831.

Polston, J.E., Chellemi, D.O., Schuster, D.J., McGovern, R.J. & Stansly, P.A. (1996) Spatial and temporal dynamics of tomato mottle geminivirus and Bemisia tabaci (Genn) in Florida tomato fields. Plant Disease 80:1022-1028.

Polston, J.E. & Anderson, P.K. (1997) The emergence of whitefly-transmitted geminiviruses in tomato in the Western Hemisphere. Plant Disease 81:1358-1369.

Polston, J.E., McGovern, R.J. & Brown, L.G. (1999) Introduction of Tomato yellow leaf curl virus in Florida and implications for the spread of this and other geminiviruses of tomato. Plant Disease 83:984-988.

Polston, J.E. & Lapidot, M. (2007) Management of Tomato yellow leaf curl virus - US and Israel perspectives. In: Tomato yellow leaf curl virus disease: Management, molecular biology, breeding for resistance. Ed by Czosnek, H. Springer, Dordrecht, The Netherlands, pp. 363-372.

Pooggin, M. & Hohn, T. (2003) RNAi targeting of DNA virus in plants. Nature Biotechnology 21:131-132.

Pooggin, M. & Hohn, T. (2004) Fighting geminiviruses by RNAi and vice versa. Plant Molecular Biology 55:149-152.

Pooma, W., Gillette, W.K., Jeffrey, J.L. & Petty, I.T.D. (1996) Host and viral factors determine the dispensability of coat protein for bipartite geminivirus systemic movement. Virology 218:264-268.

Powell-Abel, P., Nelson, R.S., De, B., Hoffman, N., Rogers, S.G., Fraley, R.T. & Beachy, R.N. (1986) Delay of disease development in transgenic plants that express the tobacco mosaic virus coat protein gene. Science 232:738-743.

Preiss, W. & Jeske, H. (2003) Multitasking in replication is common among geminiviruses. Journal of Virology 77:2972-2980.

Prins, M., Resende, R.D., Anker, C., vanSchepen, A., deHaan, P. & Goldbach, R. (1996) Engineered RNA-mediated resistance to Tomato spotted wilt virus is sequence specific. Molecular Plant-Microbe Interactions 9:416-418.

Prins, M., Laimer, M., Noris, E., Schubert, J., Wassenegger, M. & Tepfer, M. (2008) Strategies for antiviral resistance in transgenic plants. Molecular Plant Pathology 9:73- 83.

Qin, S.W., Ward, B.M. & Lazarowitz, S.G. (1998) The bipartite geminivirus coat protein aids BR1 function in viral movement by affecting the accumulation of viral single- stranded DNA. Journal of Virology 72:9247-9256.

Rensink, W.A. & Buell, C.R. (2005) Microarray expression profiling resources for plant genomics. Trends in Plant Science 10:603-609.

Ribeiro, S.G., De Avila, A.C., Bezerra, I.C., Fernandes, J.J., Faria, J.C., Lima, M.F., Gilbertson, R.L., Maciel Zambolim, E. & Zerbini, F.M. (1998) Widespread occurrence of tomato geminiviruses in Brazil, associated with the new biotype of the whitefly vector. Plant Disease 82: 830.

Ribeiro, S.G., Ambrozevicius, L.P., Avila, A.C., Bezerra, I.C., Calegario, R.F., Fernandes, J.J., Lima, M.F., De Mello, R.N., Rocha, H. & Zerbini, F.M. (2003) Distribution and genetic diversity of tomato-infecting begomoviruses in Brazil. Archives of Virology 148:281-295.

Rigden, J.E., Dry, I.B., Mullineaux, P.M. & Rezaian, M.A. (1993) Mutagenesis of the virion-sense open reading frames of tomato leaf curl geminivirus. Virology 193:1001- 1005.

Rojas, M.R., Jiang, H., Salati, R., Xoconostle-Cazares, B., Sudarshana, M.R., Lucas, W.J. & Gilbertson, R.L. (2001). Functional analysis of proteins involved in movement of the monopartite begomovirus, Tomato yellow leaf curl virus. Virology 291:110-125.

Rojas, M.R., Hagen, C., Lucas, W.J. & Gilbertson, R.L. (2005) Exploiting chinks in the plant's armor: Evolution and emergence of geminiviruses. Annual Review of Phytopathology 43:361-394.

Roossinck, M.J. (1997) Mechanisms of plant virus evolution. Annual Review of Phytopathology 35:191-209.

Sacristan, S. & Garcia-Arenal, F. (2008) The evolution of virulence and pathogenicity in plant pathogen populations. Molecular Plant Pathology 9:369-384.

Salati, R., Nahkla, M. K., Rojas, M. R., Guzman, P., Jaquez, J., Maxwell, D. P., & Gilbertson, R. L. (2002) Tomato yellow leaf curl virus in the Dominican Republic: Characterization of an infectious clone, virus monitoring in whiteflies, and identification of reservoir hosts. Phytopathology 92:487-496.

Sanderfoot, A.A. & Lazarowitz, S.G. (1996) Getting it together in plant virus movement: Cooperative interactions between bipartite geminivirus movement proteins. Trends in Cell Biology 6:353-358.

Sanford, J.C. & Johnston, S.A. (1985) The concept of parasite-derived resistance - Deriving resistance genes from the parasite own genome. Journal of Theoretical Biology 113:395-405.

Sangare, A., Deng, D., Fauquet, C.M. & Beachy, R.N. (1999) Resistance to African cassava mosaic virus conferred by a mutant of the putative NTP-binding domain of the rep gene (AC1) in Nicotiana benthamiana. Molecular Breeding 5:95-102.

Sanz, A.I., Fraile, A., Garcia-Arenal, F., Zhou, X.P., Robinson, D.J., Khalid, S., Butt, T. & Harrison, B.D. (2000) Multiple infection, recombination and genome relationships among begomovirus isolates found in cotton and other plants in Pakistan. Journal of General Virology 81:1839-1849.

Saunders, K. & Stanley, J. (1999) A nanovirus-like DNA component associated with yellow vein disease of Ageratum conyzoides: Evidence for interfamilial recombination between plant DNA viruses. Virology 264:142-152.

Saunders, K., Bedford, I.D., Briddon, R.W., Markham, P.G., Wong, S.M. & Stanley, J. (2000) A unique virus complex causes Ageratum yellow vein disease. Proceedings of the National Academy of Sciences 97:6890-6895.

Saunders, K., Salim, N., Mali, V.R., Malathi, V.G., Briddon, R., Markham, P.G. & Stanley, J. (2002) Characterisation of Sri Lankan cassava mosaic virus and Indian cassava mosaic virus: Evidence for acquisition of a DNA-B component by a monopartite begomovirus. Virology 293:63-74.

Schuster, D.J., Mueller, T.F., Kring, J.B. & Price, J.F. (1990) Relationship of the sweetpotato whitefly to a new tomato fruit disorder in Florida. Horticultural Science 25:1618- 1620.

Scott, J.W. & Schuster, D.J. (1991) Screening of accessions for resistance to Florida tomato geminivirus. Report Tomato Genetics Cooperative 41:48-50.

Scott, J.W., Stevens, M.R., Barten, J.H.M., Thome, C.R., Polston, J.E., Schuster, D.J. & Serra. C.A. (1995) Introgression of resistance to whitefly transmitted geminiviruses from Lycopersicon chilense to tomato. In: Bemisia 1995: Taxonomy, biology, damage control, and management. Ed. Gerling D. & Mayer. R.T. Intercept Ltd., Andover, U.K. pp. 357-367.

Scott, J.W. (2001) Geminivirus resistance derived from Lycopersicon chilense accessions LA1932, LA1938, and LA2779. In: Proceedings of Tomato Breeders Roundtable, Antigua. http://tgc.ifas.ufl.edu/2001/TBRT01Abstracts.pdf.

Seal, S.E., Jeger, M.J. & Van den Bosch, F. (2006a) Begomovirus evolution and disease management. Advanced Virus Research 67:297-316.

Seal, S.E., Van den Bosch, F. & Jeger, M.J. (2006b) Factors influencing begomovirus evolution and their increasing global significance: Implications for sustainable control. Critical Reviews in Plant Sciences 25:23-46.

Selth, L.A., Randles, J.W. & Rezaian, M.A. (2002) Agrobacterium tumefaciens supports DNA replication of diverse geminivirus types. FEBS Letters 516:179-182.

Selth, L.A., Randles, J.W. & Rezaian, M.A. (2004) Host responses to transient expression of individual genes encoded by Tomato leaf curl virus. Molecular Plant- Microbe Interactions 17:27-33.

Sera, T. (2005) Inhibition of virus DNA replication by artificial zinc finger proteins. Journal of Virology 79:2614-2619.

Settlage, S.B., Miller, B. & Hanley-Bowdoin, L. (1996) Interactions between geminivirus replication proteins. Journal of Virology 70:6790-6795.

Settlage, S.B., Miller, A.B., Gruissem, W. & Hanley-Bowdoin, L. (2001) Dual interaction of a geminivirus replication accessory factor with a viral replication protein and a plant cell cycle regulator. Virology 279:570-576.

Sharma, A., Zhang, L., Niño-Liu, D., Ashrafi, H. & Foolad, M.R. (2008) A Solanum lycopersicum × Solanum pimpinellifolium linkage map of tomato displaying genomic locations of R-genes, RGAs, and candidate resistance/defense-eesponse ESTs. International Journal of Plant Genomics 926090. doi:10.1155/2008/926090.

Shepherd, D.N., Mangwende, T., Martin, D.P., Bezuidenhout, M., Kloppers, F.J., Carolissen, C.H., Monjane, A.L., Rybicki, E.P. & Thomson, J.A. (2007a) Maize streak virus-resistant transgenic maize: A first for Africa. Plant Biotechnology Journal 5:759- 767.

Shepherd, D.N., Mangwende, T., Martin, D.P., Bezuidenhout, M., Thomson, J.A. & Rybicki, E.P. (2007b) Inhibition of Maize streak virus (MSV) replication by transient and transgenic expression of MSV replication-associated protein mutants. Journal of General Virology 88:325-336.

Shepherd, D.N., Martin, D.P. & Thomson, J.A. (2009) Transgenic strategies for developing crops resistant to geminiviruses. Plant Science 176:1-11.

Sinisterra, X.H., Polston, J.E., Abouzid, A.M. & Hiebert, E. (1999) Tobacco plants transformed with a modified coat protein of tomato mottle begomovirus show resistance to virus infection. Phytopathology 89:701-706.

Stanley, J., Markham, P.G., Callis, R.J., & Pinner, M.S. (1986) The nucleotide sequence of an infectious clone of the geminivirus Beet curly top virus. European Molecular Biology Organization Journal 5:1761-1767.

Stanley, J. (1995) Analysis of African cassava mosaic-virus recombinants suggests strand nicking occurs within the conserved nanonucleotide motif during the initiation of rolling circle DNA-replication. Virology 206:707-712.

Stanley, J., Bisaro, D.M., Briddon, R.W., Brown, J.K., Fauquet, C.M., Harrison, B.D., Rybicki, E.P. & Stenger, D.C. (2005) Family Geminiviridae. In Virus Taxonomy: Eighth Report of the International Committee on Taxonomy of Viruses, pp. 301–326, Elsevier, London.

Sunter, G., Hartitz, M.D. & Bisaro, D.M. (1993) Tomato golden mosaic virus leftward gene-expression - autoregulation of geminivirus replication protein. Virology 195:275- 280.

Sunter, G. & Bisaro, D.M. (1997) Regulation of a geminivirus coat protein promoter by AL2 protein (TrAP): Evidence for activation and derepression mechanisms. Virology 232:269-280.

Taylor, N., Chavarriaga, P., Raemakers, K., Siritunga, D. & Zhang, P. (2004) Development and application of transgenic technologies in cassava. Plant Molecular Biology 56:671-688.

Tollefson, J. (2011) Brazil cooks up transgenic bean. Nature, 478, 168.

Tomás, D.M., Cañizares, M.C., Abad, J., Fernández-Muñoz, R. & Moriones, E. (2011) Resistance to Tomato yellow leaf curl virus accumulation in the tomato wild relative Solanum habrochaites associated with the C4 viral protein. Molecular Plant- Microbe Interaction 24:849-61.

Tshiala, M.F. & Olwoch, J.M. (2010) Impact of climate variability on tomato production in Limpopo province, South Africa. African Journal of Agricultural Research 5:2945- 2951.

Vanderschuren, H., Akbergenov, R., Pooggin, M.M., Hohn, T., Gruissem, W. & Zhang, P. (2007) Transgenic cassava resistance to African cassava mosaic virus is enhanced by viral DNA-A bidirectional promoter-derived siRNAs. Plant Molecular Biology 64:549- 557.

Vanitharani, R., Chellappan, P., Pita, J.S. & Fauquet, C.M. (2004) Differential roles of AC2 and AC4 of cassava geminiviruses in mediating synergism and suppression of posttranscriptional gene silencing. Journal of Virology 78:9487-9498.

Vanitharani, R., Chellappan, P. & Fauquet, C.M. (2005) Geminiviruses and RNA silencing. Trends in Plant Science 10:144-151.

Varma, A. & Malathi, V.G. (2003) Emerging geminivirus problems: A serious threat to crop production. Annals of Applied Biology 142:145-164.

Vidavsky, F. & Czosnek, H. (1998) Tomato breeding lines resistant and tolerant to Tomato yellow leaf curl virus issued from Lycopersicon hirsutum. Phytopathology 88:910-914.

Vidavsky, F. (2007) Exploitation of resistance genes found in wild tomato species to produce resistant cultivar; pile up of resistant genes. In Tomato yellow leaf curl virus disease: Management, molecular biology, breeding for resistance. Ed. by Czosnek, H. Springer, Dordrecht, The Netherlands, pp. 363-372.

Vidavsky, F, Czosnek, H., Gazit, S., Levy, D. & Lapidot, M. (2008) Pyramiding of genes conferring resistance to Tomato yellow leaf curl virus from different wild tomato species. Plant Breeding 127:625-631.

Voinnet, O. (2001) RNA silencing as a plant immune system against viruses. Trends in Genetics 17:449-459.

Voinnet, O, (2005) Induction and suppression of RNA silencing: insights from viral infections. Nature Reviews Genetics 6:206-220.

Von Arnim, A. & Stanley, J. (1992) Inhibition of African cassava mosaic virus systemic infection by a movement protein from the related geminivirus Tomato golden mosaic virus. Virology 187: 555-564.

Waigmann, E., Ueki, S., Trutnyeva, K. & Citovsky, V. (2004) The ins and outs of nondestructive cell-to-cell and systemic movement of plant viruses. Critical Reviews in Plant Sciences 23:195-250.

Wang, H., Hao, L.H., Shung, C.Y., Sunter, G. & Bisaro, D.M. (2003) Adenosine kinase is inactivated by geminivirus AL2 and L2 proteins. Plant Cell 15:3020-3032.

Wang, H., Buckley, K.J., Yang, X.J., Buchmann, R.C. & Bisaro, D.M. (2005) Adenosine kinase inhibition and suppression of RNA silencing by geminivirus AL2 and L2 proteins. Journal of Virology 79:7410-7418.

Wang, P., Sun, D., Qiu, B. & Liu, S.S. (2011) The presence of six cryptic species of the whitefly Bemisia tabaci complex in China as revealed by crossing experiments. Insect Science 18:67-77.

Ward, B.M. & Lazarowitz, S.G. (1999) Nuclear export in plants: Use of geminivirus movement proteins for a cell-based export assay. Plant Cell 11:1267-1276.

Wartig, L., Kheyr-Pour, A., Noris, E., De Kouchkovsky, F., Jouanneau, F., Gronenborn, B. & Jupin, I. (1997) Genetic analysis of the monopartite tomato yellow leaf curl geminivirus: Roles of V1, V2, and C2 ORFs in viral pathogenesis. Virology 228:132- 140.

Williamson V.M., Ho J.Y., Wu F.F., Miller N. & Kaloshian I. (1994) A PCR-based marker tightly linked to the nematode resistance gene, Mi, in tomato. Theoretical and Applied Genetics 87: 757-763.

Xu, J., Liu, S.S. & De Barro, P.J. (2010) Reproductive incompatibility among genetic groups of Bemisia tabaci supports the proposition that the whitefly is a cryptic species complex. Bulletin of Entomological Research 100:359-66.

Zakay, Y., Navot, N., Zeidan, M., Kedar, N., Rabinowitch, H., Czosnek, H. & & Zamir, D. (1991) Screening of Lycopersicon accessions for resistance to Tomato yellow leaf curl virus: Presence of viral DNA and symptom development. Plant Disease 75:279- 281.

Zamir, D., Eksteinmichelson, I., Zakay, Y., Navot, N., Zeidan, M., Sarfatti, M., Eshed, Y., Harel, E., Pleban, T., Vanoss, H., Kedar, N., Rabinowitch, H.D. & Czosnek, H. (1994) Mapping and introgression of a Tomato yellow leaf curl virus tolerance gene, Ty-1. Theoretical and Applied Genetics 88:141-146.

Zhang, L.P., Khan, A., Nino-Liu, D. & Foolad, M.R. (2002) A molecular linkage map of tomato displaying chromosomal locations of resistance gene analogs based on a Lycopersicon esculentum x Lycopersicon hirsutum cross. Genome 45:133-146.

Zhou, X.P., Xie, Y., Tao, X.R., Zhang, Z.K., Li, Z.H. & Fauquet, C.M. (2003) Characterization of DNA beta associated with begomoviruses in China and evidence for co-evolution with their cognate viral DNA-A. Journal of General Virology 84:237- 247.

Zrachya, A., Glick, E., Levy, Y., Arazi, T., Citovsky, V. & Gafni, Y. (2007a) Suppressor of RNA silencing encoded by Tomato Yellow Leaf Curl virus-Israel. Virology 358:159- 165.

Zrachya, A., Kumar, P.P., Ramakrishnan, U., Levy, Y., Loyter, A., Arazi, T., Lapidot, M. & Gafni, Y. (2007b) Production of siRNA targeted against TYLCV coat protein transcripts leads to silencing of its expression and resistance to the virus. Transgenic Research 16:385-398.

2.0 Distribution and genetic diversity of tomato-infecting begomoviruses in South Africa CHAPTER 2 Distribution and genetic diversity of tomato-infecting begomoviruses in South Africa

Abstract

Tomato-infecting begomoviruses (family Geminiviridae) have emerged as devastating pathogens causing huge economic losses and threatening tomato (Solanum lycopersicum) production worldwide. Following the introduction of the whitefly vector Bemisia tabaci type B in the early 1990s, begomoviruses, specifically Tomato curly stunt virus (ToCSV) have negatively influenced tomato production in South Africa. To establish a more comprehensive view of the diversity and distribution of ToCSV and other tomato-infecting begomoviruses throughout the country, a survey was conducted from 2006-2010 to sample symptomatic tomato and weed plants in the major tomato- growing areas of the country. Universal begomovirus PCR and rolling circle amplification (RCA) were employed to detect viral infections, as well as RCA-restriction fragment-length polymorphism (RCA-RFLP) to identify and establish the begomovirus diversity. Representative members of the population were cloned and sequenced or directly sequenced using a combination of RCA and 454 sequencing technology (next generation sequencing). Sequence comparisons and phylogenetic analyses of 45 DNA-A components, revealed the presence of four monopartite begomoviruses species that belong to the African/South West Indian Ocean begomovirus clade, but represent three distinct subclades tentatively named SAI, SAII and SAIII. The SAI subclade consisted of 37 ToCSV variants sharing >94.9% nucleotide identity and were the most predominant begomovirus species associated with tomato infection in most of the production regions. Subclade SAII and SAIII consisted of eight isolates which had 80-81.8% nucleotide identity with previously known begomovirus isolates and represent three distinct newly identified putative begomovirus species with limited geographical range, namely Tomato curly stunt Mooketsi virus (ToCSMV), Tomato curly stunt Lanseria virus (ToCSLV) and Tomato curly stunt Noordoewer virus

(ToCSNV). Furthermore, detectable recombination events are reported amongst these and other African begomoviruses, which have substantially contributed to the diversity within this begomovirus species complex. Several weed species are also confirmed as symptomless begomovirus reservoirs, which emphasize their role in begomovirus epidemics, both as inoculum sources and as possible sources of emerging novel viruses.

2.1 Introduction

Diseases characterised by stunting, yellowing and leaf curling are among the most devastating diseases of cultivated tomato (Solanum lycopersicum) in tropical and subtropical regions of the world (Polston & Anderson, 1997; Morales & Anderson, 2001; Varma & Malathi, 2003; Hanssen et al., 2010; Navas-Castillo et al., 2011). These diseases are caused by approximately sixty genetically diverse begomovirus species (family Geminiviridae) in geographically distinct regions of the world (Fauquet et al., 2008). Symptoms in infected plants consist of varying degrees of stunted and compacted growth and leaf curling, crumpling and yellowing. Infected plants normally show reduced fruit set and yield losses can reach as high as 100%, particularly when plants are infected early in development (Levy & Lapidot, 2008). During the last three decades, begomoviruses have emerged worldwide following the spread of their insect vector and have become one of the major constraints to open field tomato production (Polston & Anderson, 1997; Lapidot & Friedmann, 2002; Hanssen et al., 2010).

Viruses belonging to the family Geminiviridae are distinct in having either monopartite or bipartite genomes of circular, single-stranded DNA (ssDNA) components, contained within twinned icosahedral virions (Harrison, 1985). The Begomovirus genus comprises the largest, most diverse and economically important group of geminiviruses. Its members are responsible for the worldwide devastation of many food crops such as bean, cassava, cotton, melon, pepper, potato and tomato (Rybicki & Pietersen, 1999; Varma & Malathi, 2003). Begomoviruses are transmitted by the whitefly, Bemisia tabaci in a persistent, circulative manner to eudicot plants (Moriones & Navas-Castillo, 2000). Begomoviruses can be subdivided into New World (NW) and Old World (OW) members. NW members of this genus have a bipartite genome, namely DNA-A and DNA-B component, with both components needed for infectivity (Stanley et al., 2005). In contrast, the majority of begomoviruses in the OW have monopartite genomes, and most of these interact with a class of ssDNA satellites known as alpha and betasatellites (Briddon et al., 2000; Saunders et al., 2000; Zhou et al., 2003). A small number of OW members in this genus, such as Tomato yellow leaf curl virus (TYLCV, Kheyr-Pour et al., 1991; Navot et al., 1991) and Tomato leaf curl virus (ToLCV; Dry et al., 1993), have a true monopartite genome containing a DNA-A molecule that are sufficient to cause wild-type disease symptoms.

In the last three decades the incidence and severity of diseases caused by new strains/variants of existing viruses or of completely new begomoviruses has increased rapidly (Brown & Bird, 1992; Polston & Anderson, 1997; Anderson et al., 2004; Seal et al., 2006b; Jeske, 2009). The global emergence of begomoviruses can be attributed to a combination of factors, including agricultural intensification and the spread of one or more highly polyphagous types/species of their insect vector, B. tabaci, via international trade in horticultural products (Seal et al., 2006a). In addition, virus diversification has been linked to their capability to rapidly evolve via mutation and recombination and their associate with other single-stranded replicons (e.g. satellite DNAs) (Polston & Anderson 1997; Rojas et al., 2005; Briddon & Stanley 2006; Seal et al., 2006a, Duffy & Holmes, 2008). It is through these processes of molecular diversification, that progenitor begomoviruses that are widely distributed in weed (or other) reservoirs, when introduced into tomato via the feeding of polyphagous whitefly species, have independently evolved/adapted to this new host. Eventually, new tomato-infecting begomovirus members that cause similar disease symptoms may emerge.

In South Africa, tomato is an economically important vegetable crop grown commercially, and frequently by subsistence and resource poor farmers. The total annual production of tomatoes is about 345440 tons (NDA, 2009; Tshiala & Olwoch, 2010; Abstract of Agricultural Statistics, 2011) and the total production areas are estimated at more than 5400 hectares. It provides a large number of employment opportunities in the country and is one of the main vegetables used for hawking by small-scale entrepreneurs in the informal sector. Over the last decade, begomoviruses have also become one of the major constraints to open field tomato production in South Africa. The presence of begomovirus infection in tomato was first reported in 1997 (Pietersen et al., 2000) in the Mpumalanga province. The affected tomato plants showed foliar symptoms similar to those induced by TYLCV, including upper leaf yellowing, reduction in leaflet area, upward curling margins, stunting and flower abortion. The viral isolate, termed Tomato curly stunt virus-[South Africa:Onderberg:1998] (ToCSV-[ZA:Ond:98]), was identified as a new monopartite begomovirus species closely related to Tobacco leaf curl Zimbabwe virus-[Zimbabwe] (TbLCZV-[ZW]) (84% nucleotide identity), and is probably endemic to southern Africa (Pietersen et al., 2008).

When first identified, ToCSV was shown to be experimentally transmissible by the whitefly B. tabaci B type in South Africa (Bedford et al., 1994; Brown, 2000). Recently, in addition to the widely distributed B type that is present in all major tomato production regions, two other B. tabaci types have been identified. The indigenous SSAF type and highly invasive Q type were reported in 2007 and 2009, respectively. All three types were found to be responsible for transmission of distinct tomato begomovirus species (Chapter 4) and are contributing to the spread of tomato begomovirus infection across the country.

As indicated, an increase in the incidence of curling and stunting symptoms associated with begomovirus infection has been observed in most of the tomato production regions throughout the country in recent years, with severe yield and quality losses. The main control method employed against begomovirus infection is the intensive use of insecticides targeted at viruliferous adult B. tabaci that spread the viruses to and within tomato crops. Recently however, high-yielding ToCSV-resistant tomato varieties are being developed by various tomato breeding companies to reduce the impact of the virus. In addition, TYLCV-resistant varieties are also being planted in high risk areas as it has been shown to be effective for the control of ToCSV (Pietersen et al., 2002). In order to manage the deployment of these valuable resources and improve the efficacy with which further begomovirus-resistant material is screened, an improved understanding of the diversity and distribution of tomato-infecting begomoviruses present in South Africa is required. With this mind, this study aimed to explore the molecular diversity and taxonomic relationships among begomoviruses associated with the recent disease outbreaks in tomato fields throughout South Africa.

2.2 Material and methods

2.2.1 Sample collection and DNA extraction

Tomatoes are mainly produced in Limpopo, Mpumalanga, the Pongola area of KwaZulu-Natal, the southern parts of the Eastern Cape and the Western Cape (www.southafrica.info). In the areas with a subtropical climate, such as in the Limpopo province, tomatoes are produced year round, enabling the permanent presence of virus source. During 2006-2010, tomato (S. lycopersicum) with typical begomovirus-like symptoms was collected in tomatoes production regions in seven provinces in South Africa (Figure 2.1). Samplings were undertaken every few months during the high

infestation periods (in midsummer (February/March) and the beginning of spring, (October/November) or when viral infections were reported in previously unaffected areas. Infected leaves were cut and stored on ice for transportation to the laboratory. Weeds growing in the vicinity of infected tomato plants were collected in the Mooketsi region (Limpopo province) and Lanseria (Gauteng province). Genomic DNA was extracted from 0.15 g of young, fully expanded leaf tissue either manually according to the method by Noris et al. (1994) or using the Invisorb® Spin Plant Mini DNA extraction kit (Invitek GmbH) according to the manufacturer’s instructions. DNA pellets were resuspended in water and stored at -20°C.

2.2.2 Virus detection and genetic characterization: Detection of DNA-A, DNA-B and satellite DNA molecules

To confirm begomovirus infection, viral DNA was amplified by PCR using universal begomovirus primers, TY1 and TY2 (Table 2.1) (Accotto et al., 2000). The primer pair amplifies a 580-bp DNA fragments comprising the V1 gene (coat protein, CP) from the DNA-A component of begomoviruses. The PCR was performed with ExSel high fidelity DNA polymerase (JMR Holdings) using an Eppendorf thermal cycler. Each PCR was carried out in 25 µl volumes and contained a final concentration of 1 X reaction buffer

containing 2 mM MgSO4, 0.2 mM dNTPs (Bioline), 0.2 µM of each primer, 0.08 U ExSel DNA polymerase and 2-3 µl of total DNA extracted from infected plant material. The cycling parameters were as follows: initial denaturation at 94 °C for 2 min, then 35 cycles of denaturation at 94 °C for 20 sec, annealing at 55 °C for 30 sec and elongation at 72 °C for 40 sec, followed by a final elongation step at 72 °C for 10 min. Amplified fragments were separated on a 1% agarose gels stained with 1 μg/ml ethidium bromide (EtBr) and visualized under UV light.

For a selection of PCR positive samples (using universal begomovirus primers), the full genome (~2.7 kbp) was amplified using the XhoI abutting primer set binding within the V1 ORF (CP gene) (Table 2.1). The PCRs were performed with ExSel high fidelity DNA polymerase (JMR Holdings) as described above. The cycling parameters were as follows: initial denaturation at 94 °C for 2 min, then 35 cycles of denaturation at 94 °C for 20 sec, annealing at 68 °C for 30 sec, and elongation at 72 °C for 3 min, followed by a final elongation step at 72 °C for 15 min to fill in incomplete strand ends. Amplified

66 fragments were separated on a 1% agarose gels stained with 1 μg/ml EtBr and

Figure 2.1 Geographical map of South Africa showing tomato/vegetable production regions sampled (grey circles) during this study: 1, Far North; 2, Northern Lowveld; 3, Mpumalanga Onderberg; 4, Mpumalanga Middelveld; 5, North West; 6, Kwazulu- Natal; 7, Free State; 8, Northern Cape; 9, Eastern Cape; 10, Noordoewer/Vioolsdrift; 11, West Coast; 12, Boland (Western Cape). The areas where ToCSV were reported up until 2003, are indicated by ( ) (1997, Onderberg; 2000, Pongola; 2001, Kwalini; 2003, Trichardtsdal) (Pietersen et al., 2008)

visualized under UV light. Amplicons of approximately full genome size (~2.7 kbp) were purified using one of the following gel extraction kits: Nuceospin® Extract II kit (Macherey-Nagel) or ZymocleanTM Gel DNA Recovery Kit (Zymo Research) according to the manufacturer’s instructions. The purified PCR products were cloned into a pGEM-T Easy vector (Promega). Recombinant DNA was isolated based on the alkaline lysis miniprep method in Sambrook et al. (1989) or using one of the following commercial plasmid extraction kits, according to the manufacturer’s instructions: FastPlasmid Mini kit (Eppendorf), GeneJetTM Plasmid Miniprep Kit (Fermentas), and Invisorb® Spin Plasmid Mini Two (Invitek). The complete DNA-A component of selected viral isolates were sequenced by primer walking (Table 2.1) using the BigDye Terminator Cycle Sequencing Kit and Applied Biosystems 3730XL DNA Analyzer (Applied Biosystems) available in the Botany department at the University of

Johannesburg or Applied Biosystems 3130XL DNA Analyzer (Applied Biosystems) at Inqaba Biotechnical Industries (Pty) Ltd (South Africa).

Since abutting primers designed from ToCSV sequence could limit characterization to only ToCSV, several begomovirus positive samples (using universal begomovirus PCR) were selected and characterized using rolling circle amplification (RCA), a method that enable full-length viral genome amplification of circular DNA viruses. Furthermore the viral diversity involved in natural infection was determined by restriction digestion of the RCA products with HpaII (RCA-RFLP). Circular viral DNA was amplified using the TempliPhi-Kit (GE Healthcare) following the manufacturer’s protocol or by using phi29 polymerase (New England Biolabs) with random hexamer primers. The RCA reaction carried out with phi29 DNA polymerase consisted of 10-20 ng DNA, 2 µl dNTPs (1 mM), and 2 µl random hexamer primer (100 µM, Fermentas), 2 µl 10X reaction buffer and 13.3 µl double-distilled water (Sigma). The mix was heated for 3 min at 95 °C and immediately cooled on ice. A master mix of 1.4 µl, consisting of 1 µl phi29 DNA polymerase (10 U/µl), 0.2 µl pyrophosphatase (0.1 U/µl, Fermentas), and 0.2 µl bovine serum albumin (BSA, 10 mg/ml, New England Biolabs) was added. The reaction was incubated for 18 h at 30 °C, followed by a heat inactivation step of 10 min at 65 °C. The RCA product (3 µl) was digested with HpaII (Fermentas) at 37 °C for 2 h and separated on a 1.5% agarose gels stained with 1 μg/ml ethidium bromide (EtBr) and visualized under UV light. The RCA products were also used as templates for sequencing without further purification (Haible et al., 2006) using the BigDye Terminator Cycle Sequencing Kit and Applied Biosystems 3730XL DNA Analyzer (Applied Biosystems) or Applied Biosystems 3130XL DNA Analyzer (Applied Biosystems) (Inqaba Biotechnical Industries (Pty) Ltd, South Africa). Full-length sequences were obtain by primer walking (Table 2.1)

The presence/absence of a DNA-B genomic component and associated satellite DNA molecule (DNA-β) were also assessed for each of the collected samples using the degenerate PCR primer sets PBL1v2040 and PCRc1 (Rojas et al., 1993) and Beta 1 and Beta 2 (Briddon et al., 2002), respectively (Table 2.1). The PBL1v2040 degenerate primer designed to anneal to the BC1 ORF of DNA-B and PCRc1 primer that binds to the common region of DNA-A and DNA-B, amplify a begomoviral fragment of 600 bp. The Beta 1 and Beta 2 primer pair anneals to a region conserved for all begomovirus-

Table 2.1 Primers used in PCR, sequencing and cloning reactions in this study.

Primer Primer sequence (5'-3') Target Expected regiona (nt) product size (nt) DNA-A detection and cloning TY-1 GCCCATGTA( T/C)CG(A/G)AAGCC 440-460 500 TY-2 GG(A/G)TTAGA(A/G)GCATG(A/C)GTAC 999-120 XhoI-Fb GTCTCGAGGTTGTGAAGGCCCATGTAAGATCCAG ~2768 XhoI-Rb GTCTCGAGGGACATCAGGGCTTCTATACATTCTG

Viral sequencingb A GTCTCGAGGTTGTGAAGGCCCATGTAAGATCCAG 494-526 B GTCTCGAGGGACATCAGGGCTTCTATACATTCTG 469-503 C GGGGATACCAGGTCGAAGAA 1712 - 1732 D CTATCGATGTTGTTGAGACAC 890-910 E GGGCCTGGATTGCAGAGGAA 1693-1713 F AAGGCGGCATCCCACTATC 1713-1732 G TTCATGTGTCTCAACAACATCG 1092-1014 H GACGCTTTAAACGCAGGTTC 2190-2210 SP6 ATTTAGGTGACACTATAG T7 TAATACGACTCACTATAGGG DNA-B / DNA-Beta detection PBL1v2040 GCCTCTGCAGCARTGRTCKATCTTCATACA 600 PCRc1 CTAGCTGCAGCATATTTACRARWATGCCA Beta 01 GGTACCACTACGCTACGCAGCAGCC 600-700 & ~1350

Beta 02 GGTACCTACCCTCCCAGGGGTACAC a Target regions according to ToCSV-[ZA:Ond:98] (AF261885). b Primers were designed with the web-based software program Primer3 (http://frodo.wi.mit.edu /primer3/), integrated DNA technologies (IDT) scitools (http://scitools.idtdna.com/scitools/, applications/ OligoAnalyzer) analysis was used to eliminate primers with stem loop structures or that self-annealed and all primers were synthesized by Inqaba Biotec, South Africa.

associated satDNAs (Briddon et al., 2002; Idris et al., 2005). Amplification of DNA-β with these primers typically produces a major band at 600-700 bp and a minor band at approx 1350 bp. PCR reactions were carried out in 25 μl volumes and contained a final concentration of 1X reaction buffer containing 2 mM MgSO4, 0.2 mM dNTPs (Bioline), 0.2 µM of each primer, 0.08 U ExSel DNA polymerase and 3 µl of total DNA extracted from infected plant material. The reaction was carried out using the following cycling

conditions: a first cycle of 2 min at 94 °C, then 30 cycles at 95 °C for 1 min, 50 °C - 55 °C for 1 min, 72 °C for 1.5 min, and a final cycle at 72 °C for 10 min.

To ensure characterization of all circular viral DNA genomes and possible DNA-beta satellites, samples were also sequenced using next generation sequencing (deep sequencing) technology (454 Life Science GS-FLX sequencer, Roche) at Inqaba Biotec (Pty) Ltd (South Africa), a method that enable DNA sequencing of pooled samples in a single experiment. RCA products of begomovirus positive samples (using universal begomovirus PCR) from different region were differentially labeled and pooled (four pooled samples, each consisting of 10-12 viral RCA products from the same area). After bead recovery and enrichment, the beads were sequenced using the Sequencing kit XLR70 (Roche) according to manufacturer’s instructions. The sequencing reads were sorted according to the genome segments to which they related and were subsequently assembled into contiguous (full-length) sequences (a total of 36 sequences were obtained from the 10 MB of data, each consisting of one contig i.e., a set of overlapping sequencing reads) with Newbler assembler (Roche) since coverage was more than 45 times.

2.2.3 Phylogenetic analysis

The complete sequences obtained for DNA-A components were assembled (Contig Assembly Program, ChromasPro software) (Technelysium Pty. Ltd.) and edited manually using Bioedit (Hall, 1999). The full-length genomes characterized in this study was designated as isolate V1-V67 (Table 2.2). The DNA sequences for the closest viral relatives determined using BLAST searches were downloaded from GenBank (http://www.ncbi.nlm.nih.gov.) and used for phylogenetic analyses. DNA-A components with <88% nucleotide identify are considered new species, 88-93% are considered different strains of the same species and >93% are considered as variant of the same species (Fauquet et al., 2008). Multiple sequence alignments were carried out using the software package ClustalW (www.ebi.ac.uk/Tools/msa/clustalw2/) and the sequence identity determined by pairwise alignment with deletion of gaps using Mega4.1. Phylogenetic analyses were performed using the neighbour-joining (NJ) and bootstrap option (1000 replicates) available in Mega4.1. The outgroup sequences used during phylogenetic analyses was Tomato leaf curl Bangalore virus-A [India:Bangalore 1] (ToLCBV-A[IN:Ban1]), a monopartite isolate from India (Hong & Harrison, 1995).

Table 2.2 Information of South African begomoviruses identified in this study with relevant collection information.

% identity to Isolate Collection date Province/district Host ToCSV Acronym AF261885 Tomato curly stunt virus a ToCSV- V01SAMooketsi06 04/03/2006 Limpopo, Mooketsi S. lycopersicum 99.0 [ZA:Mks04:06] ToCSV- V02SATrichardtsdal06 04/03/2006 Limpopo, Trichardtsdal S. lycopersicum 97.9 [ZA:Trd03:06] ToCSV- V1SAMooketsi07 15/01/2007 Limpopo, Mooketsi S. lycopersicum 98.1 [ZA:Mks1:07] ToCSV- V2SAMooketsi07 15/01/2007 Limpopo, Mooketsi S. lycopersicum 97.9 [ZA:Mks2:07] V4SATomBurk07 20/03/2007 Limpopo, Tom Burke S. lycopersicum 98.1 ToCSV-[ZA:Tb4:07]

V5SATomBurk07 20/03/2007 Limpopo, Tom Burke S. lycopersicum 98.0 ToCSV-[ZA:Tb5:07] ToCSV- V6SATomBurk07 20/03/2007 Limpopo, Tom Burke S. lycopersicum 96.8 [ZA:Mks6:07] ToCSV- V7SAMooketsi07 29/03/2007 Limpopo, Mooketsi S. lycopersicum 98.1 [ZA:Mks7:07] ToCSV- V8SAMooketsi07 29/03/2007 Limpopo, Mooketsi S. lycopersicum 97.9 [ZA:Mks8:07] ToCSV- V11SATrichardtsdal07 29/03/2007 Limpopo, Trichardtsdal S. lycopersicum 99.3 [ZA:Trd11:07] ToCSV- V12SATrichardtsdal07 29/03/2007 Limpopo, Trichardtsdal S. lycopersicum 99.2 [ZA:Trd12:07] ToCSV- V13SAMooketsi07 19/07/2007 Limpopo, Mooketsi S. lycopersicum 97.9 [ZA:Mks13:07] Limpopo, ToCSV- V19SAVivo07 20/08/2007 S. lycopersicum 98.2 Vivo [ZA:Viv01:07] ToCSV- V22SAMooketsi07 15/11/2007 Limpopo, Mooketsi S. lycopersicum 95.5 [ZA:Mks22:07] ToCSV- V23SAMooketsi07 15/11/2007 Limpopo, Mooketsi S. lycopersicum 95.5 [ZA:Mks23:07]

% identity to Isolate Collection date Province/district Host ToCSV Acronym AF261885 ToCSV- V24SAMooketsi07 15/11/2007 Limpopo, Mooketsi S. lycopersicum 95.4 [ZA:Mks24:07] ToCSV- V25SAMooketsi07 15/11/2007 Limpopo, Mooketsi S. lycopersicum 98.0 [ZA:Mks25:07] ToCSV- V26SAMooketsi08 15/11/2007 Limpopo, Mooketsi S. lycopersicum 95.4 [ZA:Mks26:08] ToCSV- V27SAMooketsi08 16/07/2007 Limpopo, Mooketsi S. lycopersicum 99.3 [ZA:Mks27:08] ToCSV- V28SAMooketsi08 20/08/2007 Limpopo, Mooketsi S. lycopersicum 96.9 [ZA:Mks28:08] ToCSV- V29SAMooketsi07 20/08/2007 Limpopo, Mooketsi S. lycopersicum 97.5 [ZA:Mks29:08] ToCSV- V30SAMooketsi08 04/07/2007 Limpopo, Komatipoort S. lycopersicum 97.9 [ZA:Mks30:08] ToCSV-[ZA: V31SAKomatipoort08 07/07/2007 Limpopo, Mooketsi Sida cordifolia 97.9 Kmp31:08] ToCSV-[ZA: V32SAMooketsi08 07/07/2007 Limpopo, Mooketsi S. lycopersicum 96.3 Kmp32:08] ToCSV- V33SAPongola08 8/01/2008 Kwazulu-Natal, Pongola S. lycopersicum 97.8 [ZA:Mks33:08] ToCSV- V34SAPongola08 8/01/2008 Kwazulu-Natal, Pongola S. lycopersicum 99.0 [ZA:Mks34:08] ToCSV- V36SAMooketsi08 31/01/2008 Limpopo, Mooketsi S. lycopersicum 99.2 [ZA:Mks36:08] ToCSV- V37SAMooketsi08 31/01/2008 Limpopo, Mooketsi D. stramonium 99.0 [ZA:Mks37:08] ToCSV- V41SAMooketsi08 31/01/2008 Limpopo, Mooketsi S. lycopersicum 97.5 [ZA:Mks41:08] ToCSV- V43SAMusina08 02/02/2008 Limpopo, Mussina S. lycopersicum 98.3 [ZA:Mus43:08] ToCSV- V46SAKomatipoort09 10/03/2009 Mpumalanga, Komatipoort S. lycopersicum 98.0 [ZA:Kmp46:09]

% identity to Isolate Collection date Province/district Host ToCSV Acronym AF261885 ToCSV- V47SAKomatipoort09 10/03/2009 Mpumalanga, Komatipoort S. lycopersicum 98.0 [ZA:Kmp47:09] ToCSV- V48SAKomatipoort09 10/03/2009 Mpumalanga, Komatipoort S. lycopersicum 98.2 [ZA:Kmp48:09] ToCSV- V49EastLondon109 29/07/2009 Eastern Cape, East London S. lycopersicum 95.4 [ZA:EL01:09] ToCSV- V65EastLondon109 29/07/2009 Eastern Cape, East London S. lycopersicum 95.5 [ZA:EL11:09] ToCSV- V66EastLondon709 29/07/2009 Eastern Cape, East London S. lycopersicum 95.4 [ZA:EL17:09] ToCSV- V67EastLondon2109 29/07/2009 Eastern Cape, East London S. lycopersicum 95.4 [ZA:EL21:09] Tomato curly stunt Mooketsi virusb c ToCSMV- V61Mooketsi08 08/2007 Limpopo, Mooketsi S. lycopersicum 83.8 # [ZA:Mks:07] ToCSMV- V57Mooketsi08d 02/2008 Limpopo, Mooketsi S. lycopersicum 83.8 [ZA:Mks:08]* Tomato curly stunt Lanseria viruse ToCSLV- V51-1Lanseria08f 03/2008 Gauteng, Lanseria S. lycopersicum 78.9 [ZA:Lan:08]# ToCSLV- V51-2Lanseria08f 03/2008 Gauteng, Lanseria Malva parviflora 78.9 [ZA:Lan:08]# ToCSLV- V51-3Lanseria08f 03/2008 Gauteng, Lanseria Datura stramonium 78.9 [ZA:Lan:08]# ToCSLV- V50Lanseria09g 04/2009 Gauteng, Lanseria S. lycopersicum 81.5 [ZA:Lan:09]* ToCSLV- V56Klawer10h 09/2010 Western Cape, Klawer S. lycopersicum 78.9 [ZA:Klw:10]* Tomato curly stunt Noordoewer virusi ToCSNV- V54Noordoewer09j 08/2009 Northern Cape, Noordoewer S. lycopersicum 79.4 [ZA:Nwr06:09]# ToCSNV- V55Noordoewer09k 08/2009 Northern Cape, Noordoewer S. lycopersicum 78.9 [ZA:Nwr11:09]*

% identity to Isolate Collection date Province/district Host ToCSV Acronym AF261885 ToCSNV- V60Lanseria11l 04/2011 Gauteng, Lanseria S. lycopersicum 79.1 [Za:Lan:11]* Begomoviruses (from other cultivated plants) Ipomoea batatas SPMaV- V62SAWaterpoort2011m 03/03/2011 Limpopo, Waterpoort ND [ZA:Wp:2011] Ipomoea batatas SPLCSPV- V63SAWaterpoort2011n 03/03/2011 Limpopo, Waterpoort ND [ZA:Wp:2011] Mastrevirus (from other cultivated plants) V62SAMooketsi07o 20/08/07 Limpopo, Mooketsi Phaseolus vulgaris ND BYDV-[ZA:Mks:07]

# New species proposal * Variant of new species ND – not determined a Tomato curly stunt virus-[South Africa:Onderberg:1998] (ToCSV-[ZA:Ond:98]) (AF261885) b Tomato curly stunt Mooketsi virus-[South Africa:Mooketsi:07] (ToCSMV-[ZA:Mkt:07]). c DNA genome 2275 bp with closest strain relative being ToCSMV-[ZA:Mks:08] with 100% identity. d DNA genome 2275 bp with closest strain relative being ToCSMV-[ZA:Mks:07]with 100% identity. e Tomato curly stunt Lanseria virus-[South Africa:Lanseria:08] (ToCSLV-[ZA:Lan:08]). f DNA genome 2778 bp with closest strain relative being ToCSLV-[ZA:Klw:10] with 95.2% identity. g DNA genome 2780 bp with closest strain relative being ToCSLV-[ZA:Lan:08] with 93.6% identity. h DNA genome 2787 bp with closest strain relative being ToCSLV-[ZA:Lan:08] with 95.2% identity. i Tomato curly stunt Noordoewer virus-[South Africa:Noordoewer:09] (ToCSNV-[ZA:Nwr:09]). j DNA genome 2800 bp with closest strain relative being ToCSNV-[ZA:Nwr11:08] with 97.7% identity. k DNA genome 2800 bp with closest strain relative being ToCSNV-[ZA:Nwr06:08] with 97.7% identity. l DNA genome 2789 bp with closest strain relative being ToCSNV-[ZA:Nwr11:08] with 94.5% identity. m Sweet potato mosaic-associated virus-[South Africa:Waterpoort:2011] (SPMaV-[ZA:Wp:11]). n Sweet potato leaf curl Sao Paulo virus-[South Africa:Waterpoort:2011] (SPLCSPV-[ZA:Wp:11]). o Bean yellow dwarf virus-[South Africa:Mooketsi:2007] (BYDV-[ZA:Mkt:07]).

2.2.4 Recombination analyses

A dataset containing the 45 DNA-A sequences from this study and 204 other begomovirus, seven Curtovirus and one Topocuvirus sequences, were used for the detection of potential recombinant sequences, identification of likely parental sequences and localisation of possible recombination breakpoints. All sequences were aligned using ClustalW (www.ebi.ac.uk/Tools/msa/clustalw2/). The recombination analysis were carried out using the RDP (Martin & Rybicki, 2000), GENECONV (Padidam et al., 1999), BOOTSCAN (Martin et al., 2005a), MAXIMUM χ2 (Smith, 1992), CHIMAERA (Martin et al., 2005b) and SISCAN (Gibbs et al., 2000) options available in the Recombination Detection Program (RDP3) (Martin et al., 2010) available from http:// darwin.uvigo.es/rdp/rdp.html. The analysis was performed with default settings for the different detection methods and a Bonferroni corrected P-value cut-off of 0.05. The putative recombinant sequence(s) and breakpoint positions that were identified were manually checked using Simplot (Lole et al., 1999), adjusted where necessary and verified using phylogenetic analysis using the NJ option available in the Mega4.1 software package.

2.3 Results

2.3.1 Sample collection and virus detection

During the survey conducted between 2006 to 2010 in the main tomato growing area, (Figure 2.1), a total of 529 tomato samples displaying typical symptoms of begomovirus infection were collected. Four hundred and forty five samples (84%) tested positive for begomovirus infection using universal begomovirus PCR primers (Table 2.3). The full- length genome (~2.7kbp) of begomoviruses-positive samples were amplified and 45 were sequenced (Table 2.2). The majority of the samples (529) collected in this study, was collected in Limpopo province (356) since this province has 4118 ha under tomato cultivation (total area of tomato cultivation in South Africa is 5400 ha; Abstract of Agricultural Statistics, 2011) and included 26 of the full genome sequences (Table 2.2 and 2.3). A number of weeds in the vicinity of infected tomato plants, covered with numerous whiteflies were collected and identified as Cleome sp; Datura stramonium; D. ferox; Chenopodium carinatum; Amaranthus hybridus; Alternanthera pungens, Malva parviflora, Sida cordifolia and S. rhombifolia in the Mooketsi (Limpopo province) and Lanseria (Gauteng) region. These weeds also tested positive for begomovirus infection and the begomovirus genome sequences from S. cordifolia and D. stramonium collected in Mooketsi and D. stramonium and M. parviflora in Lanseria were obtained (Table 2.2).

76 Table 2.3 Number of samples collected with typical begomovirus symptoms in different provinces in South Africa from 2006-2010. The number of samples analysed by PCR and/or rolling circle amplification-restriction fragment length polymorphism (RCA-RFLP) and full genome sequences are indicated. Number of Provinces* Total samples per Gauteng Limpopo Mpumalanga KZN NC EC WC province Samples tested 30 356 15 47 11 60 10 529 PCR/RCA-RFLP 28 327 15 45 9 51 10 485 positive samples Full genome 4 26 4 2 4 4 1 45 sequenced Area under tomato -- 4118 550 -- 75 450 -- 5400 cultivation (hectares) ‡ * Kwazulu-Natal (KZN), Northern Cape (NC), Eastern Cape (EC) and Western Cape (WC). ‡ Source: Abstract of Agricultural Statistics, 2011.

2.3.2 Genetic diversity of begomovirus isolates

The genetic diversity of viral isolates involved in natural infections was determined by sequencing the cloned PCR or RCA-amplified full genomes from a number of positive samples, including 42 from tomato plants and three from non-cultivated plants / weeds (D. stramonium / M. parviflora and Sida cordifolia) (Table 2.2). The selection of samples for cloning and sequencing were based primarily on the locations and date as well as the RCA-RFLP using HpaII profile that assisted in the selection of different viral isolates for sequencing. The RCA-RFLP profiles for a select number of tomato-infecting begomovirus isolates are indicated in Figure 2.2. A number of samples produced entirely different profiles to the predicted RCA-RFLP profiles of ToCSV-[ZA:Ond:98] isolates (Figure 2.2), and the full viral genome from these samples were cloned and sequenced, or included in the next generation sequencing analysis.

A final number of 45 full genomes were sequenced and used for subsequent analyses. While PCR amplification and cloning of apparently full-length DNA-A-like components was possible for all these samples, repeated attempts to detect a DNA-B component or a satDNA molecule in infected tomato plant extracts failed using the ‘universal’ B- component- and satDNA-specific PCR primers, respectively and no DNA-B or satDNA molecules were identified using next generation sequencing. This suggests that the 45 viral isolates are all monopartite, as confirmed for ToCSV in agroinoculation experiments with agroinfectious clones (Chapter 3).

Figure 2.2 Rolling circle amplification-restriction fragment length polymorphism (RCA- RFLP) profiles using HpaII on a selection of RCA products from tomato with typical begomovirus symptoms from South Africa. Lanes: (1) and (6) GeneRuler Express DNA ladder (100–5000 bp, Fermentas); (2) V25SAMook07; (3) V22SAMook07, (4) V54Noordoewer09, (5) V60Lanseria11, (7) V30SAMooketsi08 (8) V49EastLondon109, (9) V60Lanseria11, (10) V56Klawer10, (11-15) V54Noordoewer09, (12) V55Noordoewer09, (13) V51-1Lanseria08, (14) V51-2Lanseria08.

The monopartite begomoviruses identified from cloned PCR and RCA products were further confirmed using next generation sequencing. The only additional sequences obtained with next generation sequencing included begomoviruses from Ipomoea batatas (namely Sweet potato mosaic-associated virus (SPMaV) and Sweet potato leaf curl Sao Paulo virus (SPLCSPV) (see Addendum A) as well as Bean yellow dwarf virus from Phaseolus vulgaris (Table 2.2). The full-length tomato-infecting begomoviral isolates sequenced in this study varied between 2766 and 2800 nucleotides (nt) and had a genome organization similar to other monopartite begomoviruses. They all contain the six ORFs: V1, V2, C1, C2, C3 and C4 (Figure 2.3) and a 259 nt intergenic region (IR) containing the invariant nonanucleotide motif (TAATATTAC).

Figure 2.3 Schematic representation of the genome organization of the tomato-infecting begomovirus isolates sequenced in this study. The single-stranded virion DNA genome consisted of 2766-2800 nucleotides. All viral isolates had a genome organization similar to other monopartite begomoviruses containing six ORFs (direction indicated by arrows) namely: two virion-sense (V) ORFs, V1 and V2 and four complementary-sense strand (C) ORFs, C1, C2, C3 and C4. A 259 nt intergenic region (IR) contains the nonanucleotide motif TAATATTAC. The conserved inverted repeat flanking the nonanucleotide sequence is symbolised by a stem-loop. V1 encodes the capsid protein (CP), V2 a movement protein, C1 the replication initiator protein (Rep), C2 a transcriptional activator protein (TrAP), C3 a replication enhancer protein (REn), and C4 a symptom and movement determinant.

2.3.3 Sequence homology and phylogenetic analysis

Phylogenetic analyses using the NJ method, performed with the 45 DNA-A nucleotide genomes of the tomato-infecting begomoviruses and other closely related viral isolates, indicated the presence of mainly four begomoviruses species (Table 2.2; Figure 2.4). The NJ methods separated the sequences into four major clades or phylogroups, namely an African/ South West Indian Ocean (SWIO) cluster (I) and Mediterranean/African cluster (IV) that contain both monopartite viruses and, an African/Cassava/SWIO cluster (III) and African Cassava (II) cluster that contain mono- and bipartite viruses (Figure 2.4). The genome sequences obtained in this study formed three distinct subclades, termed SAI- SAIII, which shared 77–81% nucleotide identity (Figure 2.4). The SAI-SAIII subclades were found in phylogroup I, containing monopartite viruses sampled from various host species (chayote, cotton, hollyhock, pepper, tobacco, tomato) throughout Africa and SWIO. Each of the South African subclades (SAI-III) had 89-99% nucleotide identity within each subclade and are therefore considered as different variants of the same species, but

79 shared less than 88% nucleotide identity among the different subclades (Fauquet et al., 2008). Subclade SAI represented Tomato curly stunt virus isolates, whereas the SAII and SAIII had 80-81.8% nucleotide identity with previously known begomovirus isolates that are under the threshold level (89%) (Fauquet et al., 2008) which demarcates distinct begomovirus species. The results suggest that these isolates represent distinct, new begomovirus species.

The majority (37) of the samples sequenced in this study grouped within the ToCSV cluster (SSI) and were most closely related to Tobacco leaf curl Zimbabwe virus (TbLCZV-[ZW], AF350330; AM701756, 81-82.7%), Pepper yellow vein virus (PepYVV, AY502935, 80%), and Tomato yellow leaf crumple virus from Mali (ToYLCrV, AY502935, 80%) within the African/SWIO clade of begomoviruses (Figure 2.4). All the isolates identified as ToCSV shared >94.9% identity (Table 2.2). According to the demarcation criteria proposed by the International Committee on Taxonomy of Viruses (ICTV) (Fauquet et al., 2008) these ToCSV isolates should be regarded as variants of the ToCSV species (>93% nucleotide identity). All the ToCSV isolates were given descriptors indicating the location and date of collection, i.e. ToCSV-[ZA:Mkt1:07] for the isolate collected in Mooketsi in 2007 (Table 2.2; V1SAMooketsi07).

On the basis of nucleotide identity to their closest known relatives, the remaining eight begomovirus isolates represent three new species and five variants, with sequence identities with known begomovirus isolates of <89%, and >93%, respectively. Viral isolate V61 and V57 were collected in Mooketsi in 2007 and 2008, respectively and showed the highest level of nucleotide sequence identity (86.2%) to that of ToCSV-[ZA:Mkt28:07]. The viral isolates represent a distinct new virus species, for which the names Tomato curly stunt Mooketsi virus-[ZA:Mooketsi:2007] (ToCSMV-[ZA:Mks:07] is proposed. Subclade SAII consist of ToCSMV isolates and is closest to ToCSV variants in SAI subclade as indicated above (Figure 2.5). ToCSMV has thus far only been isolated in Mooketsi area in Limpopo province (Figure 2.7; Table 2.2). Viral isolate V51 was sampled in the Gauteng province in 2008 from tomato plants, but also from weed species, including M. parviflora and D. stramonium. The isolate was most closely related to Tomato leaf curl Uganda virus-[Uganda:Iganga:2005], (ToLCUV, DQ127170) with which it shared 80.6% nucleotide identity. The viral isolates represent a distinct new virus species, for which the name Tomato curly stunt Lanseria virus-[South Africa:Lanseria101:2007] (ToCSLV- [ZA:Lan101:07]) is proposed. Viral isolate V50 and V55 were collected in Gauteng in 2009 and the Western Cape in 2010 (Figure 2.7; Table 2.2), respectively and were most similar to ToCSLV-[ZA:Lan101:07] at 93.6% and 95.2% nucleotide identity, respectively. These two isolates therefore represent variants of ToCSLV-[ZA:Lan101:07] and are therefore termed ToCSLV-[ZA:Lan:09] and ToCSLV-[ZA:Klw:10] (Table 2.2).

80 Figure 2.4 Neighbour joining tree indicating the relationships between the tomato- infecting begomovirus isolates from South Africa and representative African, South West Indian Ocean (SWIO) and Mediterranean begomovirus sequences (DNA-A). Major clades or phylogroups are labeled subclade I-IV. South African sequences from this study are labeled subclade SAI-SAIII. Only representative ToCSV isolates sequenced in this study

81 are included with new viral species marked with a # symbol. The corresponding identifiers, numbers, abbreviations and accession numbers for sequences reported in this study are listed in Table 2.2. Bootstrap values (1000 replicates) are shown above or under the horizontal line. Horizontal branch lengths represent genetic distances as indicated by the scale bar, vertical distances are arbitrary. The out-group is an isolate of Tomato leaf curl Bangalore virus-A [India:Bangalore 1] ToLCBV-A[IN:Ban1]. Representative begomovirus sequences obtained from Genbank are as follows: African cassava mosaic virus- [Cameroon:1998] (ACMV-[CM:98]; AF112352); African cassava mosaic virus-[Coˆte d’Ivoire:1999] (ACMV-[CI:99]; AF259894); East African cassava mosaic virus-Kenya- [Kenya:K2B:1996] (EACMVKE[KE:K2B:96]; AJ006458); East African cassava mosaic virus-Uganda-[Kenya:Funyula:K127:2002] (EACMV-UG [KE:Fun:K127:02]; AJ717517); East African cassava mosaic Cameroon virus-Cameroon-[Coˆte d’Ivoire:1998] (EACMCV- M[CI:98]; AF259896); East African cassava mosaic Zanzibar virus-[Tanzania:Uguja:1998] (EACMZV-[TZ:Ugu:98]; AF422174); South African cassava mosaic virus-[South Africa:1999] (SACMV-[ZA:99]; AF155806); Tomato yellow leaf curl virus-Israel- [Japan:Miyazaki] (AB116629 TYLCV-IL[JR:Miy]; AB116629); Tomato yellow leaf curl virus-Israel-[Spain:Almeria:Pepper:1999] (TYLCV-IL[ES:Alm:Pep:99]; AJ489258); Tomato yellow leaf curl virus-Iran-[Iran:Iranshahr:1998] (TYLCV-IR[IR:Ira:98]; AJ132711); Tomato yellow leaf curl virus-Mild-[Reunion:2002] (TYLCV-Mld[RE:02]; AJ865337); Tomato leaf curl Sudan virus-Gezira-[Sudan:Gezira:1996] (ToLCSDVGez[SD:Gez:96]; AY044137); Tomato yellow leaf curl Mali virus-Ethiopia-[Ethiopia:Melkassa:2005] (TYLCMLVET[ET:Mel:05]; DQ358913); Tomato yellow leaf curl Malaga virus- [Spain:421:1999] (TYLCMalV[ES:421:99]; AF271234); Tomato yellow leaf curl Sardinia virus-Spain-[Spain:Murcia 1:1992] (TYLCSV-ES[ES:Mur1:92]: Z25751); Cotton leaf curl Gezira virus-Sudan-[Sudan:Gezira] (CLCuGV-SD[SD:Gez]; AF260241); Cotton leaf curl Gezira virus- Hollyhock-[Egypt:Cairo:Hollyhock] (CLCuGVHol[EG:Cai:Hol]; AJ542539); Hollyhock leaf crumple virus-[Egypt:Cairo:1997] (HoLCrV-[EG:Cai:97]; AY036009); Chayote yellow mosaic virus-[Nigeria:Ibadan] (ChaYMV-[NG:Iba]; AJ223191); Okra yellow crinkle virus-[Mali:Bamako:2007] (OYCrV-[ML:Bam:07]; EU024118); Pepper yellow vein Mali virus-[Mali:2003] (PepYVMV-[ML:03]; AY502935); Pepper yellow vein Mali virus- [Burkina Faso:Bazega: sweet pepper:2007] (PepYVMV-[BF:Baz:SPe:07]; FM876847); Tomato leaf curl Diana virus-[Madagascar:Namakely5:2001] (ToLCDiaV-[MG:Nam5:01]; AM701765); Tomato leaf curl Bangalore virus-A-[India:Bangalore1] (ToLCBV-A[IN:Ban1]; Z48182); Tobacco leaf curl Zimbabwe virus-[Zimbabwe:2001] (TbLCZV-[ZW:01]; AF350330); Tobacco leaf curl Zimbabwe virus-[Comoros:Foumboudziouni:2005] (TbLCZV [KM:Fbz:05]; AM701756); Tomato leaf curl Mali virus-[Mali:2003] (ToLCMLV-[ML:03]; AY502936); Tomato leaf curl Arusha virus-[Tanzania:Tengelu:2005] (ToLCArV- [TZ:Ten:05]; DQ519575); Tomato leaf curl Madagascar virus-Menabe- [Madagascar:Morondova:2001] (ToLCMGVMen[MG:Mor:01]; AJ865338); Tomato leaf curl Madagascar virus-Androy-[Madagascar:Toliary:2001] (ToLCMGV-[MG:Tol:01]; AJ865339); Tomato leaf curl Comoros virus-[Mayotte:Dembeni:2003] (ToLCKMV- [YT:Dem:03]; AJ865341); Tomato leaf curl Anjouan virus - [Anjouan:Ouani3:2004] (ToLCAnjV-[Anj:Oua3:04]; AM701758); Tomato leaf curl Moheli virus- [Comoros:Fomboni163:2005] (ToLCMohV-[KM:Fom163:05]; AM701763); Tomato leaf curl Antsiranana virus - [Grande Comore:Dimadjou44:2004] (ToLCAntV-[GC:Dim44:04]; AM701761); Tomato leaf curl Uganda virus-[Uganda:Iganga:2005] (ToLCUV-[UG:Iga:05]; DQ127170).

This newly proposed species clusters in the SAIII subclade (Figure 2.4). ToCSLV was therefore first isolated in Lanseria region in Gauteng province but a variant was also isolated in Western Cape Province (Figure 2.7). Viral isolate V54 was sampled in the Northern Cape in 2009 and showed the highest level of nucleotide sequence identity

82 (81%) to that of Tomato leaf curl Comoros virus - [Mayotte:Dembeni:2003] (ToLCKMV, AJ865341). The viral isolates represent a distinct new virus species, for which the name Tomato curly stunt Noordoewer virus-[ZA:Noordoewer06:2009] (ToCSNV-[ZA:Nwr06:09]) are proposed. Viral isolate V60 was collected in Gauteng in 2011 and were most similar to ToCSNV-[ZA:Nwr06:09] at 94.5% nucleotide identity. This isolate represents a variant of ToCSNV-[ZA:Nwr06:09] and is therefore termed ToCSNV-[ZA:Lan:11]. The ToCSNV also cluster in SAIII subclade (Figure 2.4), in a separate subgroup to ToCSLV. Collectively, the three new viral species formed two distinct subclades (SAII and SAIII (Figure 2.4)) and represent two new subclades among the Mediterranean, African and SWIO clades (Figure 2.4). The newly proposed virus species names are based on host plant and region of origin (Table 2.2). A map showing the distribution of the tomato-infecting begomoviruses in South Africa collected in this study and based on the nucleotide sequence data are presented in Figure 2.5.

2.3.4 Analysis of recombination

Phylogenetic relationships based on 249 sequence alignments that include full-length SWIO, African and Mediterranean begomovirus DNA-A sequences (which include the 45 viral isolates sequenced in this study), eight curtovirus and one topocuvirus full genome sequences, clearly showed that the South African isolates had undergone recombination. Each of the identified events was analysed individually and phylogenetic, SimPlot and bootscanning analysis were used to verify the recombination predictions made by RDP3. It was apparent from this analysis that collectively the 37 ToCSV isolates bear detectable evidence of at least two past recombination events (Figure 2.6). One recombinant fragment in the C1 regions was identified in all the ToCSV isolates and an additional recombinant fragment in the V2 region of only eleven ToCSV isolates (V6, V22, V24, V26, V28, V31, V41 - V45; Table 2.2). The ToCSV has apparently obtained almost its entire C1 ORF and 5’ end of IR from a virus resembling TbLCZV-[ZW:01] (Figure 2.6a event a). This recombination event (event a) was strongly supported by 6 of the detection methods used in RDP3 with a P value ranging from 3.13 10-66 to 9.62 10-19 (Figure 2.6b). Figure 2.6a event b indicated that certain ToCSV variants have obtained an additional fragment spanning a part of the V2 ORF from a virus resembling ToLCUV-[Ug:Iga:05]. Figure 2.6a event b was detected by five detection methods and well supported by a P value ranging from 3.65 10-13 to 1.03 10-3 (Figure 2.6b).

Figure 2.5 Map of South Africa showing the geographical origin of the 45 tomato-infecting begomovirus isolates sequenced during this study. This includes 37 Tomato curly stunt virus (ToCSV) variants, as well as the new begomovirus species and variants, namely Tomato curly stunt Mooketsi virus (ToCSMV); Tomato curly stunt Lanseria virus (ToCSLV) and Tomato curly stunt Noordoewer virus (ToCSNV) (see Table 2.2).

Three recombination events were detected among the new begomovirus species and variants. The ToCSLV-[ZA:Lan:09] (V50) isolate have apparently obtained a large portion of the V1 ORF (CP) from a virus resembling ToCSV-[ZA:Mks22:07] (event ‘c’ in Figure. 2.6a), whereas the rest of their genome resembles that of the tomato-infecting virus ToCSLV-[ZA:Lan:08] (P = 1.28 x 10-39 -1.02 x 10-10) (Figure 2.6b). Variant ToCSLV- [ZA:Lan:09] (V50), ToCSLV-[ZA:Lan:08] (V51) and ToCSNV-[ZA:Nwr11:08] (V55) have apparently obtained a section of their C2 and C3 ORF from a virus resembling ToCSV- [ZA:Ond:98] (event ‘d’ in Figure. 2.6a) whereas the rest of their genome resembles that of ToCSLV-[ZA:Klw:10] (P = 1.07 x 10-8 - 4.08 x 10-4) (Figure 2.6b). Events ‘c’ and ‘d’ were confirmed using SimPlot and bootscaning analysis and the putative recombination fragments are indicated in Figure 2.7. No statistically significant recombination events within ToCSNV-[ZA:Nwr06:08] (V54) was detected using RDP3 program. When using ToCSNV-[ZA:Nwr06:08] (V54) as the query sequence in SimPlot and bootscaning analysis, a putative recombination fragment was identified (Figure 2.8) within the V1-C3 ORF interface and ToCSV-[ZA:Ond:98] was identified as the minor parent.

84 (a)

(b)

Event Detected in Region Minor Parent Major parent Detected by P Value

a ToCSV- 1662- TblCZV-[ZW:01] ToCSV- Bootscan 3.13 10 -66 [ZA:Ond:1998] 2768 (AF350330) [ZA:Mkt28:08] (AF261885) b ToCSV (V6, V22, 109-322 ToLCUV-[Ug:Iga:05] ToCSV- RDP 2.42 10 -09 V24, V26, V28, (DQ127170) [ZA:Ond:1998] V31, V49, V65- (AF261885) V67) c ToCSLV- 438-893 ToCSV-[ZA:Mks22:07] ToCSLV-[ZA:Lan:08] RDP 4.15 10 -39 [ZA:Lan:09] d ToCSLV- 1159- ToCSV-[ZA:Ond:1998] ToCSLV-[ZA:Klw:10] Bootscan 1.07 10 -8 [ZA:Lan:09] 1410 (AF261885) ToCSLV- [ZA:Lan:08] ToCSNV- [ZA:Nwr11:08] Figure 2.6 Recombinant regions detected within South African begomovirus isolates using RDP3. (a) Approximate positions of DNA-A genes are shown on a linear map at the top of the figure and the shaded boxes (a, b, c, d) identify the events and regions of recombination. (b) Region coordinates are nucleotide positions of detected recombination breakpoints in the multiple sequence alignment used to detect recombination. Wherever possible, parental sequences are identified. ‘Major’ and ‘minor’ parents are sequences that were used, along with the indicated recombinant sequence, to identify recombination. For each identified event the minor parent appears to be the contributor of the sequence within the indicated region, the major parent is those sequences most similar to the actual parents in the dataset analysed. The region coordinates for the detected recombination breakpoints and the detection method with the best P-value calculated for the region are

85 indicated. Virus abbreviations are as follows: Tomato curly stunt virus-[South Africa:Onderberg:1998] (ToCSV-[ZA:Ond:98]); Tomato curly stunt virus-[South Africa:Mooketsi28:08] (ToCSV-[ZA:Mkt28:08]); Tobacco leaf curl Zimbabwe virus- [Zimbabwe:2001] (TbLCZV-[ZW:01]; AF350330); Tomato leaf curl Uganda virus- [Uganda:Iganga:2005] (ToLCUV-[UG:Iga:05]; DQ127170); Tomato curly stunt Lanseria virus-[South Africa:Lanseria:09] (ToCSLV-[ZA:Lan:09]); Tomato curly stunt Lanseria virus- [South Africa:Lanseria:08] (ToCSLV-[ZA:Lan:08]); Tomato curly stunt Lanseria virus- [South Africa:Klawer:2010] (ToCSLV-[ZA:Lan:10]); Tomato curly stunt Noordoewer virus- [[South Africa:Noordoewer11:08] (ToCSNV-[ZA:Nwr:08])

Figure 2.7 Recombination analysis of Tomato curly stunt Lanseria virus-[ZA:LAn:2009] (ToCSLV-[ZA:Lan:09] (V50)). (a) Results of SimPlot analysis are shown where each point plotted on the y-axis is the percent identity within a sliding window 200 bp wide centered on the position plotted, with a step size between points of 20 bp. Comparison of ToCSLV- [ZA:Lan:09] with ToCSV-[ZA:Ond:98] and ToCSLV-[ZA:Lan:08] (V51) is shown. The red vertical lines show the recombination points identified as event ‘c’ and ‘d’ in Figure 2.6a. The breakpoints for event ‘c’ were identified at nucleotide position 438-893, between positions 573 and 1022 in the alignment and for event ‘d’, at nucleotide position 1159- 1410 between positions 1211 and 1423 in the alignment. (b) Results from bootscan analysis are shown where each point plotted on the y-axis gives the percentage of permutated trees using a sliding window of 200 bp wide centered on the position plotted, with a step size between points of 20 bp. Comparison of ToCSLV-[ZA:Lan:09] with ToCSV-[ZA:Ond:98] (AF261885) and ToCSLV-[ZA:Lan:08] (V51) is shown. Mosaicism is suggested by the high levels of phylogenetic relatedness between the query sequence and ToCSLV-[ZA:Lan:09] with ToCSV-[ZA:Ond:98] and ToCSLV-[ZA:Lan:08] (V51) in different regions of the genome.

86 Figure 2.8 Recombination analysis of Tomato curly stunt Noordoewer virus- [ZA:Nwr06:08] (ToCSNV-[ZA:Nwr06:08] (V54)). (a) Results from SimPlot analysis are shown where each point plotted on the y-axis is the percent identity within a sliding window 200 bp wide centered on the position plotted, with a step size between points of 20 bp. Comparison of ToCSNV-[ZA:Nwr06:08] with ToCSV-[ZA:Ond:98] and ToCSNV- [ZA:Nwr11:08] (V55) is shown. The red vertical lines show the recombination points at nucleotide position 1079-1295, between positions 1178 and 1417 in the alignment. (b) Results from bootscan analysis are shown where each point plotted on the y-axis gives the percentage of permutated trees using a sliding window of 200 bp wide centered on the position plotted, with a step size between points of 20 bp. Comparison of ToCSNV- [ZA:Nwr06:08] with ToCSV-[ZA:Ond:98] and ToCSNV-[ZA:Nwr11:08] (V55) is shown. Mosaicism is suggested by the high levels of phylogenetic relatedness between the query sequence and ToCSNV-[ZA:Nwr06:08] with ToCSV-[ZA:Ond:98] and ToCSNV- [ZA:Nwr11:08] (V55) in different regions of the genome.

2.4 Discussion

Previous studies of tomato-infecting begomoviruses in South Africa have indicated the presence of the ToCSV in the Limpopo, Mpumalanga and Kwazulu-Natal provinces (Pietersen et al., 2008). In this study, it was found that tomato-infecting begomoviruses, along with their whitefly vectors (Chapter 4) are now present in at least seven of the nine provinces in South Africa. PCR/RCA-RFLP results, next generation sequencing and detailed analysis of the sequences of all 45 sequenced genomes demonstrates that isolates of the ToCSV were the most predominant begomoviruses species found in tomato cropping regions and demonstrated the existence of previously undescribed begomovirus species. Three putative new species were identified and described in this study.

87 Phylogenetic analysis placed the tomato-infecting begomoviruses from this study in three distinct subclades, defined as SAI, SAII and SAIII, in the African/SWIO clade (Figure 2.4), apart from all the previously characterized African, Mediterranean and SWIO begomoviruses, and most closely related to begomoviruses from Africa (TbLCZV, PEPYVV and ToYLCrV). SAI subclade consisted of ToCSV isolates sampled from all of the tomato production regions in the northern South African provinces and recently, from southern South African provinces (Figure 2.5. The eight isolates that group in SAII and SAIII subclades shared 80-81.8% nucleotide identity with previously known begomovirus isolates and therefore consist of three distinct new begomovirus species (Fauquet et al., 2008). The SAII subclade includes two isolates of ToCSMV sampled in the Limpopo province. The SAIII subclade includes three isolates of ToCSLV sampled from the Gauteng and Western Cape provinces, as well as three isolates of ToCSNV sampled from the Northern Cape and Gauteng provinces. Collectively, the 45 isolates grouped in SAI, SAII and SAIII subclades and are most closely related to one another and only share a distant common ancestor (bootstrap value of 75%) with the other African and SWIO viruses (Figure 2.4). This suggests that these viruses might be indigenous to Southern Africa, and have not been introduced from other regions, but this needs further investigation. A possible explanation for their recent emergence in cropping systems all over the country would be the transfer of these viruses from local wild hosts to tomatoes by the polyphagous B. tabaci B type, followed by rapid adaptation to the new host via mutation and recombination. The new viruses could have been disseminated by the vector species present in the different cropping regions or due to the movement of infected plant material. Furthermore, detection of variants of the ToCSLV in the Gauteng and Western Cape provinces between 2008 and 2010 and variants of the ToCSNV in the Northern Cape and Gauteng provinces between 2009 and 2011, which are up to 1000 km apart (Figure 2.5), suggests that dissemination of these viruses within the country are rapidly taking place or that they are more widely distributed than indicated by the current survey. These possibilities need to further investigated before an assumptions can be made.

The results of this study have confirmed begomovirus infections as the cause of the observed diseases in tomato fields and provided the first indication of the widespread occurrence of tomato-infecting begomoviruses in South Africa. Although the sampling strategy used was biased in favor of symptomatic plants and the survey was carried out for 5 or less years for some of the regions, the study does provide an idea of the incidence of tomato-infecting begomoviruses in the surveyed areas. The frequency at which begomoviruses were detected was the highest for samples collected in the northern South African provinces. It was high for samples from the Mpumalanga and Kwazulu-Natal province and the highest for those from the Limpopo province (Table 2.3). The higher

88 incidence of tomato-infecting begomoviruses in the northern regions of the country is evident in the large number of samples collected throughout the year in the Limpopo province in comparison with the low number of samples collected in the other six provinces. This may be attributed to a number of factors, including the type of cropping system (open field vs protected), the vector population prevalent in the area and the climate in the region. The subtropical climate in the Limpopo province allows continuous cropping of tomatoes and vegetables throughout the year, thereby enabling the permanent presence of the virus source. In contrast most of the other production areas only produce tomatoes in the warm summer months.

Tomato production in the Cape provinces (± 525 ha) are well established but are on a much smaller scale in comparison to the northern South African provinces (± 4120 ha) and are only planted in the summer season (Abstract of Agricultural Statistics, 2011). The apparent lower incidence of begomovirus infection in the Cape provinces can be explained by the fact that sample collection in these areas were realized only after the recent reports of tomato infections in these areas. In the absence of baseline information regarding the distribution of begomoviruses in the Cape provinces prior to this survey and the fact that begomovirus infections have not posed a serious threat to agricultural crops in this area before the first reports in East London in 2009 and the Western Cape in 2010, suggest a recent emergence or introduction into the Cape provinces. This is further supported by the close genetic relationship between the ToCSV isolates from the northern and southern South African production regions (99.6% nt identity) and may also point to the involvement of human transportation of plant material infected by the vector and/or virus into these regions. Tomato seedlings are regularly transported from nurseries in the Limpopo province to other tomato production regions, including regions as far as Pongola (personal observation). Transportation on crop plants or ornamentals by international trade has been held responsible for the introduction of the vector and/or viral species in other countries (Chu et al., 2006; Brown, 2007).

Similar to the situation in a number of countries around the world (Anderson & Polston, 1997; Ribeiro et al., 1998; 2003; Varma & Malathi, 2003; Rojas et al., 2005; Jiu et al., 2006; Seal et al., 2006a), the emergence of tomato-infecting begomoviruses in South Africa can be correlated to the introduction and dissemination of B. tabaci throughout the country. Bemisia tabaci B type, which readily colonises tomato plants (Brown et al., 1995), was reported in South Africa for the first time in 1992 (Bedford et al., 1994) and was also reported to be the main vector of ToCSV since its emergence in 1997 (Pietersen et al., 2000). In this study, B. tabaci B type was the most widely distributed, found alongside the tomato-infecting viruses in most of the affected areas, where it has largely been responsible for the increase in begomovirus incidence. However, in the Gauteng province,

89 the indigenous SSAF type (Chapter 4) was found to be predominant in the affected fields and was therefore presumed to be responsible for viral transmission. The lower incidence of tomato-infecting begomoviruses in the Gauteng province may be partly due to the cold winter season that limits the presence of the vector to the warmer summer months, as well as the current absence of the more polyphagous and fecund B type. Furthermore, the B. tabaci SSAF type that has been found to predominate in surveyed areas in the Gauteng province, does not readily colonize tomato plants (Chapter 4).

Weed species growing alongside cultivated crops have drawn considerable attention due to their widespread and perennial nature and the diversity of viruses they harbor. Numerous reports of begomovirus infection in weeds in literature support the notion that these weed species act as natural hosts or begomovirus reservoirs, supporting mixed infections that lead to recombination, diversity, and subsequent evolution of these viruses. (Bedford et al., 1998; Ambrozevicius et al., 2002; García-Andrés, et al., 2006, Varsani et al., 2008; Azhar et al., 2011). Apart from the tomato samples collected in this study, a number of weeds harvested in the Mooketsi valley (Limpopo) and Lanseria area (Gauteng) were positive for begomovirus infection; namely Cleome spp., D. stramonium, D. ferox, C. carinatum, Amaranthus hybridus, Alternanthera pungens, S. cordifolia, S. rhombifolia. These weed hosts are widespread in South Africa, often surrounding areas used for tomato cultivation. ToCSV isolates in D. stramonium and S. cordifolia was sequenced and showed a close genetic relationship to ToCSV variants infecting tomato plants (98-99% nt identity, Table 2.2). Furthermore, ToCSLV-[ZA:Lan:08], a new begomovirus species identified in this study was isolated from two indigenous plant species, M. parviflora and D. stramonium, in addition to S. lycopersicum (Table 2.2). Collectively, these results indicate that weeds are acting as begomovirus reservoir and thereby maintaining the virus in the agrosystem. These results should serve as the basis for further analysis of symptomatic and non-symptomatic weeds that are likely reservoirs that can harbor multiple begomoviruses and may lead to the generation of new species/strains by recombination and component exchange. The discovery of a ToCSV in S. cordifolia also represents a further new natural host report for this virus, which has thus far only been reported in S. lycopersicum, D. stramonium, several Nicotiana species and Phaseolus vulgaris cultivars (Pietersen et al., 2008).

In this study, tomato-infecting begomoviruses were investigated using PCR, RCA and RCA-RFLP and the results extended by DNA sequencing. The PCR analysis using degenerate primers amplifying the coat protein gene (universal begomovirus primers), allowed detection of begomovirus infection but did not allow virus identification. Initially, PCR of the full length viral genome using abutting primers followed by sequencing, were used for isolation and identification of the begomoviral genomes. Even though the primers

90 were binding to the V1 ORF, a highly conserved gene (CP) among begomovirus species and generally used for provisional begomovirus identification (Brown, 2000), this technique was not adequate for identification of unknown begomoviruses. This strategy preferentially led to the identification of ToCSV variants, particularly due to the fact that ToCSV was the predominant viral species in most of the surveyed areas. In recent years, the molecular characterization of viruses with circular genomes has become very convenient with the use of the RCA technique, which can detect the presence of DNA A/B genomes and beta satellites without any prior information about the virus sequence (Haible et al., 2006; Paprotka et al., 2010; Wyant et al., 2011). The RCA technique in combination with RFLP determined the biodiversity of virus molecules in the population examined in this study. The RCA-RFLP technique was rapid, reproducible and based on the polymorphism of HpaII fragments, enabled the preliminary detection of new begomovirus species affecting tomatoes. Furthermore, RCA allowed direct sequencing of the viral genomes without cloning, providing high fidelity results with the same quality as conventional cloning and sequencing but with significantly reduced effort and costs. RCA in combination with a high throughput next generation sequencing technology (454 sequencing), a technique referred to as "circomics" (Wyant et al., 2011), accelerated the viral diagnosis and identification and allowed the rapid identification of three distinct new tomato-infecting begomovirus species and five variants, as well as other geminiviruses (Table 2.2).

The analysis of the genomes sequenced in this study further illustrates the hypothesis that new begomoviruses evolve by recombination between previously existing species (Briddon et al., 1996; Zhou et al., 1997; Padidam et al., 1999; Navas-Castillo et al., 2000; García-Andrés et al., 2007a,b; Davino et al., 2009). Evidence was found for four interspecies recombination events in this study, indicating that the South African viruses may have been evolving along with other African begomoviruses for a prolonged period of time. The major recombination fragment (event ‘a’, in Figure 2.6) identified in all of the ToCSV isolates, include the C1 ORF and 5’ of the IR region from TblCZV-[ZW:01] that has previously been predicted using blast analysis by Pietersen et al. (2008) and is perhaps not surprising, as both species infect tomato (Paximadis & Rey, 2001; Thierry et al., 2012). The evolutionary relationship predicted by the exchange of the 213 nt fragment (event ‘b’ in Figure 2.6), spanning the 3’ end of the IR and V2 ORF, between ToCSV and an isolate of ToLCUV, was unexpected given that ToCSV and ToLCUV have currently only been reported in geographically isolated regions. When and where this potential recombination event occurred is an open question, but it cannot be discounted that ToCSV and ToLCUV isolates might occur in various hosts in southern Africa and further sampling and characterization of both crop and weed-infecting species might lead to their identification or possibly a more closely resembling parent. Three recombination events

91 were also detected among the new begomovirus species and variants, indicating that recombination are also playing a role in their evolution. All three events involved the transfer of a small sequence fragments (213-455 nt) between one of the new species and a ToCSV isolate, producing a new virus variant. ToCSV was the main contributing parent in these recombination events with different viruses from various geographical areas and this is perhaps not unexpected, as this study found ToCSV to be the most predominant tomato-infecting begomovirus in most of the production regions in South Africa.

An examination of the distribution of recombination events recorded to date, has indicated that partially conserved recombination hot and cold spots exist for members of the mastre- and begomovirus genus (Jeske et al., 2001; Lefeuvre et al., 2007b; Owor et al., 2007; Lefeuvre et al., 2009; Martin et al., 2011). Seven of the recombination breakpoints identified in this study occurred within recognized hot spots for recombination. Two breakpoint positions were within the IR, and five within the C2/C3 ORF, at sites where similarly breakpoints are frequently observed amongst other geminiviruses (Lefeuvre et al., 2007b; Paprotka et al., 2010). The major recombination fragment in the ToCSV isolates, comprising the C1 ORF and 5’ of the IR region is within the innately recombinogenic Rep gene (Lefeuvre et al., 2007a,b; Prasanna & Rai, 2007) and also allowed the association of the cognate Rep protein and cis-acting motifs in the 5´ half of the IR required for replication to be maintained (Gutiérrez, 1999; Hanley-Bowdoin et al., 2000). Surprisingly, in our study, three breakpoints were identified in recombination cold spots within the V1 and V2 ORF. Two of the breakpoints were detected towards the edge of these genes and one breakpoint within the middle of the V2 gene. Although it has been shown that breakpoints within genes are less tolerable due to a relatively high probability that recombinant proteins will not fold properly (Voigt et al., 2002; Lefeuvre et al., 2007a; 2009), all of these recombination events were present in genomes sampled from multiple plants on more than one occasion and are therefore expected to be within non-defective circulating virus lineages. It would however be interesting to determine if the recombination within the center of the virion sense gene has any delirious effects on viral (viability) fitness, infectivity and survival (Van der Walt et al., 2008; see question partially addressed in chapter 3).

The increased emergence of B. tabaci types and the subsequent emergence of several tomato-infecting begomoviruses in South Africa have resulted in increased costs to tomato production and the industry as a whole. By identifying the most relevant begomovirus lineages currently infecting tomatoes in South Africa, this study provides valuable information critical to the development of control strategies based on host resistance against these pathogens. These results also emphasize the potential for the emergence of novel begomoviruses by interspecies genetic recombination. Future efforts

92 should therefore focus on the identification of broad spectrum resistance by conventional breeding or genetic engineering that will not break down with the emergence of novel viral variants. This study also highlights the need for future monitoring of begomovirus diversity among crops and weed viruses within and outside the regions selected in the present study. The situation is expected to be quite dynamic, with the increased movement of plant material by humans which can alter the distribution of virus species and mixed infections, leading to the emergence of new virus variants. The added effects of whitefly diversity and movement (discussed in chapter 4) may also contribute to exacerbate the problem of this important disease of tomatoes in South Africa.

93 2.5 References

Abstract of Agricultural Statistics, (2011) Directorate: Statistics and Economic Analysis of the Department of Agriculture, Forestry and Fisheries, http://www.daff.gov.za/docs/statsinfo/Abstract_2011.pdf.

Accotto, G.P., Navas-Castillo, J., Noris, E., Moriones, E. & Louro, D. (2000) Typing of tomato yellow leaf curl viruses in Europe. European Journal of Plant Pathology 106:179- 186.

Ambrozevicius, L.P., Calegario, R.F., Fontes, E.P.B., Carvalho, M.G. & Zerbini, F.M. (2002) Genetic diversity of begomovirus infecting tomato and associated weeds in South eastern Brazil. Fitopatologia Brasileira 27:372-377.

Azhar, M.T., Amin, I., Anium, Z.I. & Masoor, S. (2011) Gossypium robinsonii, an Australian wild cotton species is an asymptomatic host of the cotton leaf curl disease pathogen complex. Australasian Plant Disease Notes 6:7-10.

Bedford, I.D., Briddon, R.W., Brown, J.K., Rosell, R.C. & Markham, P.G. (1994) Geminivirus-transmission and biological characterization of Bemisia-tabaci (Gennadius) biotypes from different geographic regions. Annals of Applied Biology 125:311-325.

Bedford, I.D., Kelly, A., Banks, G.K., Briddon, R.W., Cenis, J.L. & Markham, P.G. (1998) Solanum nigrum: an indigenous weed reservoir for a tomato yellow leaf curl geminivirus in southern Spain. European Journal of Plant Pathology 104:221-222.

Briddon, R.W., Bedford, I.D., Tsai, J.H. & Markham, P.G. (1996) Analysis of the nucleotide sequence of the treehopper-transmitted geminivirus, tomato pseudo-curly top virus, suggests a recombinant origin. Virology 219:387-394.

Briddon, R.W., Mansoor, S., Bedford, I.D., Pinner, M.S. & Markham, P.G. (2000) Clones of cotton leaf curl geminivirus induce symptoms atypical of cotton leaf curl disease. Virus Genes 20:19-26.

Briddon, R.W., Bull, S.E., Mansoor, S., Amin, I. & Markham, P.G. (2002) Universal primers for the PCR-mediated amplification of DNA-β: a molecule associated with some monopartite begomoviruses. Molecular Biotechnology 20:315–318.

Briddon, R.W. & Stanley, J. (2006) Subviral agents associated with plant single-stranded DNA viruses. Virology 344:198-210.

94 Brown, J.K. & Bird, J. (1992) Whitefly-transmitted geminiviruses and associated disorders in the America and the Caribbean basin. Plant Disease 76:220-225.

Brown, J.K., Coats, S.A., Bedford, I.D., Markham, P.G., Bird, J. & Frohlich, D.R. (1995) Characterization and distribution of esterase electromorphs in the whitefly, Bemisia tabaci (Genn) (Homoptera: Aleyrodidae). Biochemical Genetics 33:205-214.

Brown, J.K. (2000) Molecular markers for the identification and global tracking of whitefly vector-Begomovirus complexes. Virus Research 71:233-260.

Brown, J.K. (2007) The Bemisia tabaci Complex: Genetic and Phenotypic Variation and Relevance to TYLCV-Vector Interactions. In: Tomato yellow leaf curl virus disease: Management, molecular biology, breeding for resistance. Ed. By Czosnek, H. Springer, Dordrecht, The Netherlands, pp. 25-56.

Chu, D., Zhang, Y.J., Brown, J.K., Cong, B., Xu, B.Y., Wu, Q.J. & Zhu, G.R. (2006) The introduction of the exotic Q biotype of Bemisia tabaci from the Mediterranean region into China on ornamental crops. Florida Entomologist 89:168-174.

Dry, I.B., Rigden, J.E., Krake, L.R., Mullineaux, P.M. & Rezaian, M.A. (1993) Nucleotide- sequence and genome organization of tomato leaf curl geminivirus. Journal of General Virology 74:147-151.

Duffy, S. & Holmes, E.C. (2008) Phylogenetic Evidence for Rapid Rates of Molecular Evolution in the Single-Stranded DNA Begomovirus Tomato Yellow Leaf curl virus. Journal of Virology 82:957–965.

Fauquet, C.M. & Stanley, J. (2003) Geminivirus classification and nomenclature: Progress and problems. Annals of Applied Biology 142:165-189.

Fauquet, C.M., Briddon, R.W., Brown, J.K., Moriones, E., Stanley, J., Zerbini, M. & Zhou, X. (2008) Geminivirus strain demarcation and nomenclature. Archives of Virology 153:783-821.

García-Andrés, S., Monci, F., Navas-Castillo, J. & Moriones, E., (2006) Begomovirus genetic diversity in the native plant reservoir Solanum nigrum: evidence for the presence of a new virus species of recombinant nature. Virology 350:433-442.

Garcia-Andres, S., Accotto, G.P., Navas-Castillo, J. & Moriones, E. (2007a) Founder effect, plant host, and recombination shape the emergent population of begomoviruses

95 that cause the tomato yellow leaf curl disease in the mediterranean basin. Virology 359:302-312.

Garcia-Andres, S., Tomas, D.M., Sanchez-Campos, S., Navas-Castillo, J. & Moriones, E. (2007b) Frequent occurrence of recombinants in mixed infections of tomato yellow leaf curl disease-associated begomoviruses. Virology 365:210-219.

Gibbs, M.J., Armstrong, J.S. & Gibbs, A.J. (2000) Sister-Scanning: a Monte Carlo procedure for assessing signals in recombinant sequences. Bioinformatics 16:573-582.

Gutierrez, C. (1999) Geminivirus DNA replication. Cellular and Molecular Life Sciences 56:313-329.

Hall, T.A. (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41:95-98.

Halley-Stott, R.P., Tanzer, F., Martin, D.P. & Rybicki, E.P. (2007) The complete nucleotide sequence of a mild strain of Bean yellow dwarf virus. Archives of Virology, 152:1237- 1240.

Hanssen, I.M., Lapidot, M. & Thomma B.P.H.J. (2010) Emerging Viral Diseases of Tomato Crops. Molecular Plant Microbe Interaction 23:539-548.

Harrison, B.D. (1985). Advances in geminivirus research. Annual Review of Phytopathology 23:55-82.

Hiable, D., Kober, S., & Jeske, H. (2006) Rolling circle amplification revolutionizes diagnosis and genomics of geminiviruses. Journal of Virological Methods 135:9-16.

Hong, Y. G. & Harrison, B. D. (1995) Nucleotide sequences from tomato leaf curl viruses from different countries: evidence for three geographically separate branches in evolution of the coat protein of whitefly-transmitted geminiviruses. Journal of General Virology 76:2043-2049.

Idris, A.M., Briddon, R.W., Bull, S.E. & Brown, J.K. (2005) Cotton leaf curl Gezira virus- satellite DNAs represent a divergent, geographically isolated Nile Basin lineage: predictive identification of a satDNA REP-binding motif. Virus Research 109:19-32

Jeske, H., Lutgemeier, M. & Preiss, W. (2001) DNA forms indicate rolling circle and recombination-dependent replication of abutilon mosaic virus. EMBO Journal 20:6158- 6167.

Jeske, H. (2009) Geminiviruses. In: Torque Teno Virus: The still elusive human pathogens. Ed. by Hausen, H. & de Villiers, E.-M. 331: Springer, Berlin pp. 185-226..

Jiu, M., Zhou X.-P. & Liu S.-S. (2006) Acquisition and Transmission of two Begomoviruses by the B and a non-B Biotype of Bemisia tabaci from Zhejiang, China. Journal of Phytopathology 154:587-591.

Lapidot, M. & Friedmann, M. (2002) Breeding for resistance to whitefly-transmitted geminiviruses. Annals of Applied Biology 140:109-127.

Lefeuvre, P., Lett, J.M., Reynaud, B. & Martin, D.P. (2007a) Avoidance of protein fold disruption in natural virus recombinants. PLoS Pathogen 3:11.

Lefeuvre, P., Martin, D.P., Hoareau, M., Naze, F., Delatte, H., Thierry, M., Varsani, A., Becker, N., Reynaud, B. & Lett, J.M. (2007b) Begomovirus ‘melting pot’ in the south-west Indian Ocean islands: molecular diversity and evolution through recombination. Journal of General Virology 88:3458-3468.

Lefeuvre, P., Lett, J., Varsani, A. & Martin, D.P. (2009) Widely conserved recombination patterns among single-stranded DNA viruses. Journal of Virology 83:2697-2707.

Levy, D. & Lapidot, M. (2008) Effect of plant age at inoculation on expression of genetic resistance to tomato yellow leaf curl virus. Archives of Virology 153:171-179.

Lole, K.S., Bollinger, R.C., Paranjape, R.S., Gadkari, D., Kulkarni, S.S., Novak, N.G., Ingersoll, R., Sheppard, H.W. & Ray, S.C. (1999) Full-length human immunodeficiency virus type 1 genomes from subtype C- infected seroconverters in India, with evidence of intersubtype recombination. Journal of Virology 73:152-160.

Martin, D. & Rybicki. E. (2000) RDP: detection of recombination amongst aligned sequences. Bioinformatics 16:562–563.

Martin, D.P., Posada, D. Crandall, K.A. & Williamson, C. (2005a) A modified bootscan algorithm for automated identification of recombinant sequences and recombination breakpoints. AIDS Research and Human Retroviruses 21:98-102.

97 Martin, D.P., Williamson, C. & Posada, D. (2005b) RDP2: recombination detection and analysis from sequence alignments. Bioinformatics 21:260-262.

Martin, D.P., Lemey, P., Lott, M., Moulton, V., Posada, D. & Lefeuvre, P. (2010) RDP3: a flexible and fast computer program for analyzing recombination. Bioinformatics 26:2462- 2463.

Martin, D.P., Lefeuvre, P., Varsani, A., Hoareau, M., Semegni, J-Y., Dijoux, B., Vincent, C., Bernard Reynaud, B. & Lett, J. (2011) Complex Recombination Patterns Arising during Geminivirus Coinfections Preserve and Demarcate Biologically Important Intra-Genome Interaction Networks. PLoS Pathogens 7(9):e1002203. doi:10.1371/journal.ppat.1002203.

Morales, F.J. & Anderson, P.K. (2001) The emergence and dissemination of whitefly- transmitted geminiviruses in Latin America - brief review. Archives of Virology 146:415- 441.

Moriones, E., & Navas-Castillo, J. (2000) Tomato yellow leaf curl virus, an emerging virus complex causing epidemics worldwide. Virus Research 71:123-134.

Navas-Castillo, J., Fiallo-Olive, E. & Sanchez-Campos, S. (2011). Emerging virus diseases transmitted by whiteflies. Annual Review of Phytopathology 49:15.1-15.30.

Navot, N., Pichersky, E., Zeidan, M., Zamir, D. & Czosnek, H. (1991) Tomato yellow leaf curl virus - a whitefly-transmitted geminivirus with a single genomic component. Virology 185:151-161.

NDA. (2009) Directorate: Agricultural Statistics Section. Pretoria, South Africa. http://www.nda.agric.za/docs/statsinfo/Abstract_2009.pdf.

Noris, E., Accotto, G.P. & Luisoni, E. (1994) Advances in diagnosing tomato yellow leaf curl geminivirus infection. Molecular Biotechnology 2:219-226.

Owor, B.E., Martin, D.P., Shepherd, D.N., Edema, R., Monjane, A.L., Rybicki, E.P., Thomson, J.A. & Varsani, A. (2007) Genetic analysis of maize streak virus isolates from Uganda reveals widespread distribution of a recombinant variant. Journal of General Virology 88:3154-3165.

Padidam, M., Sawyer, S., & Fauquet, C.M. (1999) Possible emergence of new geminiviruses by frequent recombination. Virology 265:218-225.

98 Paprotka, T., Boiteux, L.S., Fonseca, M.E., Resende, R.O., Jeske, H., Faria, J.C. & Ribeiro, S.G. (2010) Genomic diversity of sweet potato geminiviruses in a Brazilian germplasm bank. Virus Research 149:224-233.

Paximadis, M. & Rey, M.E.C. (2001) Genome organization of Tobacco leaf curl Zimbabwe virus, a new, distinct monopartite begomovirus associated with subgenomic defective DNA molecules. Journal of General Virology 82:3091-3097.

Pietersen, G., Idris, A. M., Krüger, K. & Brown, J. K. (2000) Tomato curly stunt virus, a new begomovirus of tomato within the Tomato yellow leaf curl virus-Is cluster in South Africa. Plant Disease 84:810.

Pietersen, G. & Smith, M.F. (2002) Tomato yellow leaf curl virus resistant tomatoes show resistance to Tomato curly stunt virus. Plant Disease 86:528-534.

Pietersen, G., Idris, A.M., Kruger, K. & Brown, J.K. (2008) Characterization of tomato curly stunt virus: A new tomato-infecting begomovirus from South Africa. Plant Pathology 57:809-818.

Polston, J.E. & Anderson, P.K. (1997) The emergence of whitefly-transmitted geminiviruses in tomato in the western hemisphere. Plant Disease 81:1358-1369.

Prasanna, H.C. & Rai, M. (2007) Detection and frequency of recombination in tomato- infecting begomoviruses of South and Southeast Asia Virology Journal 4:111.

Ribeiro, S.G., A´vila, A.C., Bezerra, I.C., Fernandes, J.J., Faria, J.C., Lima, M.F., Gilbertson, R.L., Zambolim, E.M. & Zerbini, F.M. (1998) Widespread occurrence of tomato geminiviruses in Brazil, associated with the new biotype of the whitefly vector. Plant Disease 82:830.

Ribeiro, S.G., Ambrozev´ıcius, L.P., A´vila, A.C., Bezerra, I.C., Calegario, R.F., Fernandes, J.J., Lima, M.F., De Mello, R.N., Rocha, H. & Zerbini, F.M. (2003) Distribution and genetic diversity of tomato-infecting begomoviruses in Brazil. Archives of Virology 148:281-295.

Rojas, M.R., Gilbertson, R.L., Russell, D.R. & Maxwell, D.P. (1993) Use of degenerate primers in the polymerase chain reaction to detect whitefly-transmitted geminiviruses. Plant Disease 77:340-347.

Rojas, M.R., Hagen, C., Lucas, W.J. & Gilbertson, R.L. (2005) Exploiting chinks in the plant's armor: Evolution and emergence of geminiviruses. Annual Review of Phytopathology 43:361-394.

Rybicki, E.P., & Pietersen, G., (1999) Plant Virus Disease problems in the Developing World. Advances in Virus Research 53:127-175.

99 Sambrook, J., Fritsch, E. & Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbour Laboratory Press, Cold Spring Harbour, USA.

Seal, S.E., Van den Bosch, F. & Jeger, M.J. (2006a) Factors influencing begomovirus evolution and their increasing global significance: Implications for sustainable control. Critical Reviews in Plant Sciences 25:23-46.

Seal, S.E., Jeger, M.J. & Van den Bosch, F. (2006b) Begomovirus evolution and disease management. Advances in Virus Research 67:297-316.

Smith, J.M. (1992) Analyzing the mosaic structure of genes. Journal of Molecular Evolution 34: 126-129.

Thierry, M., Lefeuvre, P., Hoareau, M., Pe´re´farres, F., Delatte, H., Reynaud, B., Martin, D.P. & Lett, J.-M. (2012) Differential disease phenotype of begomoviruses associated with tobacco leaf curl disease in Comoros. Archives of Virology 157:545-550.

Tshiala, M.F. & Olwoch, J.M. (2010) Impact of climate variability on tomato production in Limpopo province, South Africa. African Journal of Agricultural Research 5:2945-2951.

Van der Walt, E., Palmer, K.E., Martin, D.P. & Rybicki, E.P. (2008) Viable chimaeric viruses confirm the biological importance of sequence specific maize streak virus movement protein and coat protein interactions. Virology Journal 5:61.

Varma, A. & Malathi, V.G. (2003) Emerging geminivirus problems: A serious threat to crop production. Annals of Applied Biology 142:145-164.

Varsani, A., Shepherd, D.N., Monjane, A.L., Owor, B.E., Erdmann, J.B., Rybicki, E.P., Peterschmitt, M., Briddon, R.W., Markham, P.G. Oluwafemi, S., Windram, O.P., Lefeuvre, P., Lett, J. & Martin D.P. (2008) Recombination, decreased host specificity and increased mobility may have driven the emergence of maize streak virus as an agricultural pathogen. Journal of General Virology 89:2063-2074.

Voigt, C.A., Martinez, C., Wang, Z.G. Mayo, S.L. & Arnold, F.H. (2002) Protein building blocks preserved by recombination. Nature Structural Biology 9:553-558.

Wyant P.S., Gotthardt, D., Scha¨fer, B., Krenz, B. & Jeske, H. (2011) The genomes of four novel begomoviruses and a new Sida micrantha mosaic virus strain from Bolivian weeds. Archives of Virology 156:347-352.

100 Zhou, X.P., Liu, Y.L., Calvert, L., Munoz, C., Otim-Nape, G.W., Robinson, D.J. & Harrison, B.D. (1997). Evidence that DNA-A of a geminivirus associated with severe cassava mosaic disease in Uganda has arisen by interspecific recombination. Journal of General Virology 78:2101-2111.

Zhou, X., Xie, Y., Tao, X., Zhang, Z., Li, Z., & Fauquet, C.M. (2003) Characterization of DNAβ associated with begomoviruses in China and evidence for co-evolution with their cognate viral DNA-A. Journal of General Virology 84:237-247.

101 3.0 Tomato curly stunt virus: demonstrating the monopartite nature of a mild and severe virus variant CHAPTER 3 Tomato curly stunt virus: Demonstrating the monopartite nature of mild and severe virus variants

Abstract

Tomato production in South Africa has been severely affected by begomovirus diseases, causing mild to severe yellow leaf curl symptoms and stunted and distorted growth. The disease is predominantly caused by variants of the Tomato curly stunt virus (ToCSV) that has been reported in the majority of tomato cropping systems in South Africa. We report here on the molecular and biological properties of two ToCSV isolates sharing 97.3% nucleotide identity, one being a newly described recombinant variant containing a recombination fragment spanning the V2 (pre-coat protein) coding region. Phylogenetic analyses grouped both ToCSV variants, namely ToCSV-I and ToCSV-II, in the African / South West Indian Ocean begomovirus clade, but they clustered into two ToCSV subgroups based on the presence (ToCSV-II) or absence (ToCSV-I) of the recombination fragment in V2 region. A PCR-RFLP that differentiates between isolates from the two variant clusters, indicated that ToCSV isolates from both variant clusters are widespread in South African tomato production regions, but ToCSV-I variants predominates, and mixed infection frequently occur. To assess the infectivity and symptom phenotype of the two viral variants, a 1.1-mer infectious construct of ToCSV-[ZA:Mks30:08] (variant I) and ToCSV-[ZA:Mks22:07] (variant II) was obtained. Both virus variant constructs were infectious by agroinoculation and were transmissible by B. tabaci type B, confirming the monopartite nature and completing Koch’s postulate for ToCSV. Using the agroinoculation system, it was further established that the recombinant ToCSV-II variant causes a distinctly milder symptom phenotype in tomato, in contrast to the severe symptoms phenotype induced by ToCSV-I. Using a chimaeric genome approach, it was shown that the recombination region within the V2 gene did not lead to alteration in DNA accumulation levels and was not responsible for the milder symptom phenotype induced by variant II.

102 3.1 Introduction

The family Geminiviridae constitute a diverse family of phytopathogens characterised by circular, single-stranded DNA (ssDNA) genomes, contained within a unique twinned icosahedral virion (Harrison, 1985). The Begomovirus genus comprises the largest, most diverse and economically important geminivirus genera, whose members are responsible for the worldwide devastation of many food crops such as bean, cassava, cotton, melon, pepper, potato and tomato (Varma & Malathi, 2003). These begomoviruses are transmitted by the whitefly, Bemisia tabaci (Gennadius) in a persistent, circulative manner to eudicot plants (Moriones & Navas-Castillo, 2000).

The Begomovirus genus can be subdivided into into two geographically separated subgroups, including the New World (NW, Western Hemisphere) and Old World (OW, Eastern Hemisphere) members (Rybicki, 1994; Padidam et al., 1999; Paximadis et al., 1999). NW members have a bipartite genome, with a DNA-A and DNA-B component, with both components needed for infectivity (Stanley et al., 2005). The DNA-A encodes all viral functions required for virus replication (Rep and Ren genes), regulation of gene expression (TrAP gene), encapsidation and vector transmission (CP gene). The DNA-B component encodes two proteins (MP and NSP genes) required for cell-to-cell movement and symptom development within the plant (Sanderfoot et al., 1996). In contrast, both bipartite and monopartite begomoviruses are present in the OW. Monopartite genomes have only a DNA-A component that encodes all the viral factors required for viral replication, encapsidation, transmission, and systemic spread (Padidam et al., 1996; Hanley–Bowdoin et al., 1999). To date, more than 133 monopartite begomovirus species that lack a DNA-B component have been reported (Briddon et al., 2010).

For some of the monopartite viruses (e.g. Tomato yellow leaf curl virus (TYLCV); Tomato yellow leaf curl Sardinia virus (TYLCSV) and Tomato leaf curl virus (TLCV)) (Kheyr-Pour et al., 1991; Navot et al., 1991; Dry et al., 1993; Bananej et al., 2004), the use of only the DNA-A component as infectious clones or through biolistic delivery cause wild-type disease symptoms. The majority of monopartite begomoviruses with only a DNA-A component, e.g. Ageratum yellow vein virus (AYVV), Cotton leaf curl Multan virus (CLCuMV), and Tomato yellow leaf curl China virus (TYLCCNV), are however infectious to their respective hosts, but unable to induce typical disease symptoms (Briddon et al., 2000; Saunders et al., 2000; Zhou et al., 2003). The vast majority of these monopartite begomoviruses are associated with additional single-stranded (ss) DNA components (satellites), termed alpha- or betasatellites (DNA-β), which are required to develop full disease symptoms (Briddon et al., 2003, Zhou et al., 2003; Briddon & Stanley, 2006; Briddon et al., 2010). The DNA-β permits the high levels of DNA-A accumulation required to induce disease and whitefly transmission (Saunders et al., 2000; Briddon et al., 2001).

103 This variability in viral genome organization makes fulfilling Koch’s postulates (i.e. showing that the cloned viral genome encodes all the information needed for virus replication and systemic infection) the primary aim when infectious agents are described (Grimsley et al., 1986).

Agroinoculation of infectious viral clones of begomoviruses and other members of the geminivirus family have proved to be a powerful molecular tool for studying aspects of their biology. It has been essential for functional analysis of the various viral components or satellites of mono- and bipartite viruses and viral genes products, as well as, investigating the viral host range and genetic determinants of symptom production (Grimsley et al., 1987; Sunter et al., 1993; Antignus & Cohen, 1994; Kheyr-Pour et al., 1994; Sung et al., 1995; Padidam et al., 1996; Boulton et al., 2001a,b; Bananej et al., 2002; Saunders et al., 2002; Bull et al., 2007; Mittal et al., 2008). Infectious clone construction relies upon delivering a full or partial-length repeat by Agrobacterium tumefaciens within the T-DNA of a binary vector (Grimsley et al., 1986). These constructs require a functional C1 gene, which encodes the viral replication initiator protein (Rep), and two copies of the viral origin of replication (ori) in order to recover functional circular viral genomes by replication release following agroinoculation (Stenger et al., 1991). The construction of such clones is often complex, time consuming and limited by the availability of restriction sites within the virus and cloning vectors. Ferreira et al. (2008) and Wu et al. (2008) recently describe simplified, one step procedures to construct agroinfectious genomic full dimer clones of begomovirus isolates using rolling circle amplification (RCA). Furthermore, the repeated region containing the nonanucleotide (TAATATTAC) that are highly conserved among geminiviruses, and can be limited to less than 50 nucleotides from the top of a stem-loop structure (SL) makes the tedious construction of a full dimeric construct unnecessary (Urbino et al., 2008).

In recent years, tomato production in South Africa has been severely limited by begomovirus infection. The predominant viral isolate, termed Tomato curly stunt virus- [South Africa:Onderberg:1998] (ToCSV-[ZA:Ond:98]), was identified as a new begomovirus species in 1997 (Pietersen et al., 2008) and has since been reported in seven of the nine provinces in South Africa (Chapter 2). This virus is transmitted by the whitefly vector, Bemisia tabaci biotype B in South Africa (Pietersen et al., 2000; 2008). Symptoms of ToCSV infection in tomato include a mild to severe form of upper leaf yellowing, reduction in leaflet area, upward curling margins, stunting and flower abortion that are associated with severe yield and quality losses (Pietersen & Smith, 2002). Koch’s postulate consists of four criteria designed to establish a causal relationship between a causative agent and a disease (Wege et al., 2000; Grimes, 2006). The first two Koch’s postulates were fulfilled for ToCSV when the virus was isolated from the diseased plant

104 and shown to be absent in symptomless plants as determined by PCR detection (Pietersen et al., 2008). Furthermore, repeated attempts to detect a DNA-B component or a satellite DNA molecule in ToCSV-infected tomato plant extracts have failed (Pietersen et al., 2008, Chapter 2). The aim of this study was therefore to fulfil the remaining Koch’s postulates and thereby demonstrate the monopartite nature of two ToCSV variants, including a recombinant ToCSV variant, which is involved in the tomato begomovirus disease outbreaks in South Africa.

3.2 Materials and methods

3.2.1 Sample collection, sequence and phylogenetic analyses of ToCSV isolates

During 2006-2010, tomato (Solanum lycopersicum) plants showing a range of mild to severe begomovirus-like symptoms were collected in tomato production regions in seven provinces in South Africa and the begomoviral genomes were sequenced (Chapter 2) Based on the presence or absence of a putative recombination fragment (event b in Figure 2.6, Chapter 2) in the V2 region of DNA-A component of 37 ToCSV isolates (Chapter 2), two ToCSV variant clusters were defined: ToCSV-I includes ToCSV isolates without the putative recombination fragment and ToCSV-II includes ToCSV isolates with the putative recombination fragment. Two ToCSV isolates, ToCSV-[ZA:Mks30:08] and ToCSV-[ZA:Mks22:07] from ToCSV variant cluster I and II, respectively were selected for further molecular and biological characterization. Phylogenetic analyses were performed using the neighbour-joining (NJ) and bootstrap option (1000 replicates) available in Mega4.1. The sequence identity for ToCSV-[ZA:Mks30:08] and ToCSV-[ZA:Mks22:07] and their closest viral relatives were determined by pairwise alignment with deletion of gaps, using Mega4.1.

3.2.2 Development of ToCSV-specific PCR

In order to design ToCSV-specific primers, the full genome sequence of 37 ToCSV isolates (Chapter 2) were aligned with other closely related monopartite begomoviruses, including Tobacco leaf curl Zimbabwe virus-[Zimbabwe] (TbLCZV-[ZW], AF350330), Pepper yellow vein virus (PepYVV; AY502935), Tomato yellow leaf curl virus-mild (TYLCV-Mld[IL:93], X76319), Tomato curly stunt Lanseria virus (ToCSLV- [ZA:Lan101:07]), Tomato curly stunt Noordoewer virus (ToCSNV-[ZA:Nwr06:09]) and Tomato curly stunt Mooketsi virus (ToCSMV-[ZA:Mks:07] (Chapter 2). A ToCSV-specific primer pair (Rep-F: 5′-GGAGTTTTTCCCTAATAATAGCC-3′ and CP-R: 5′-

105 TATATAGACAGACTTCACCACG-3′) was designed. In order to test the specificity of the ToCSV primers, TYLCV-Mld and ToCSLV-[ZA:Lan101:07] (Chapter 2) infected plants DNA were used as negative controls. The PCR was performed with ExSel high fidelity DNA polymerase (JMR Holdings) using an Eppendorf thermal cycler. Each PCR reaction

(25 µl) contained 1 X reaction buffer (JMR Holdings), 2 mM MgSO4, 0.2 mM dNTPs (Bioline), 0.2 µM of each primer, 0.08 U ExSel DNA polymerase and 2-3 µl total DNA extracted from infected plant material. The PCR cycling parameters consisted of an initial denaturation at 94 °C for 2 min, followed by 35 cycles of denaturation at 94 °C for 30 sec, annealing at 63 °C for 30 sec, and extension at 72 °C for 40 sec, followed by a final elongation step at 72 °C for 10 min. The PCR products were separated on a 1 % agarose gel, stained with ethidium bromide (EtBr) and visualized under UV light.

3.2.3 Differentiation between ToCSV variant cluster I and II using a ToCSV specific PCR- RFLP

A PCR-RFLP (PCR-restriction fragment length polymorphisms) that differentiate between isolates belonging to the ToCSV variant clusters I and II (as described in Chapter 2) was developed. Using a computer simulation (DistinctiEnz, www.bioinformatics.org /~docreza/cgi-bin/restriction/DistinctiEnz.pl), the HindIII (A/AGCTT) restriction site in ToCSV specific PCR fragment amplified by the Rep-CP primer pair was selected as it generated a clear polymorphism between the two variants. The amplified PCR product (10 µl) was digested with HindIII (Fermentas) (2.5 U) at 37 °C for 1 h. The PCR products were separated on a 1 % agarose gel, stained with etidium bromide (EtBr) and visualized under UV light.

3.2.4 Infectious clone construction

For the construction of infectious clones, the pCambia 2300 binary vector (http://www.cambia.org, AF234315) was modified as follows: a 84-bp dsDNA fragment containing the conserved stem-loop region of ToCSV and a unique SpeI restriction site (Figure 3.1a), was synthesized by Geneart (Regensburg) and subcloned into pCambia 2300 using the EcoRI and BamHI cloning sites (Figure 3.1b). This construct (pCAM100) allows direct cloning of infectious monomeric viral genomes amplified using the SpeI primer set (that incorporates a unique SpeI restriction site in the IR region) into the SpeI site. The full length genome of two ToCSV isolates, ToCSV-[ZA:Mks30:08] as ToCSV variant I and ToCSV-[ZA:Mks22:07] as ToCSV variant II, were amplified by PCR using the SpeI primer set (Spe-IF: 5’-ATAATAACTAGTCCCCACGCACTATTTTATGTCGAC-3’ and

106 Figure 3.1 Construction of 1.1-mer pCam30-VI and pCam22-VII ToCSV infectious clones. The sequence of 84-nucleotide fragment containing the stem-loop forming region (with underlined bold A nucleotide in the loop indicates the origin of replication) (pCAM100) (A) inserted in pCambia 2300 using the EcoRI and BamHI cloning sites (B). Structure of the 1.1-mer pCam30-VI and pCam22-VII ToCSV infectious clones (variant I and II), with SpeI site-directed mutagenesis at the end of the stem-loop in the ToCSV clones (C). LB and RB represent the left and right T-DNA border sequence of pCambia 2300 and the stem- loop forming region(ю) with the numbers show nucleotide positions (the first nucleotide at the 5’ end of the conserved sequence (TAATATT↓AC) in the stem-loop forming region is designated as nucleotide 1).

Spe-IR: 5’-ATAATAACTAGTTTTTTTTGGGGGCACGGCCATCCG-3’). The PCRs were performed with ExSel high fidelity DNA polymerase (JMR Holdings) as described above. The cycling parameters were as follows: Initial denaturation at 94 °C for 2 min, then 35 cycles of denaturation at 94 °C for 20 sec, annealing at 68 °C for 30 sec, and elongation at 72 °C for 3 min, followed by a final elongation step at 72 °C for 15 min to fill in incomplete strand ends. Amplified fragments were visualized in 1% agarose gels stained with 1μg/ml EtBr. The PCR amplified viral genomes (~2.7kbp) were cloned into the pGEM-T-Easy vector (Promega), resulting in a recombinant clone pGEMSpeIV30 (ToCSV variant I) and pGEMSpeIV22 (ToCSV variant II) and characterized using sequencing with primers listed in Table 2.1 (Chapter 2). The recombination clones pGEMSpeIV22 and pGEMSpeIV30 were digested with the SpeI restriction enzyme to release the full-length genomes and ligated to SpeI linearized and dephosphorylated pCAM100 (Figure 3.1a)

107 resulting in pCam30-VI and pCam22-VII binary plasmids containing the 1.1-mer of the two ToCSV variant genomes. The structure of the two 1.1-mer constructs is shown in Figure 3.1c. After checking for the sense orientation of the inserted genome, pCam30-VI and pCam22-VII binary plasmids were isolated using the alkaline lysis miniprep method (Sambrook et al., 1989).

3.2.5 Agroinoculation and analysis of symptoms

Chemically competent cells of Agrobacterium tumefaciens strain C58C1 (Van Larebeke et al., 1984) were prepared and transformed by the freeze-thaw method (Höfgen & Willmitzer, 1988), with the agroinfectious clones pCam30-VI and pCam22-VII, respectively. Transformed A. tumefaciens cultures were grown in LB agar plates containing 100 µg/ml rifampicin and 100 µg/ml kanamycin at 28 °C for 48 h. Ten to 15 tomato plants (cultivar ‘Rooikhaki’) were inoculated using the agro-prick method as described by Urbino et al. (2008). Briefly, for each 18 day old seedling, the stem was pricked three times at different levels with the tip of a sterile needle previously dipped into the 48 h plated culture. As a negative control, plants were inoculated with A. tumefaciens carrying the empty pCambia 2300 plasmid. All the agroinoculated plants were tested 21 days post inoculation (DPI) for the presence of viral DNA by PCR using the ToCSV specific primer set using PCR reaction and parameters as described above. The plants were transplanted 30 DPI in an insect proof greenhouse in January (experiment 1) and February (experiment 2) of Sakata Vegenetics RSA Pty (Ltd), Lanseria, South Africa and grown hydroponically through the summer and early autumn seasons employing standard pest and disease control spray schemes (insecticides, miticides, and fungicide). Each inoculated plant was inspected daily for symptoms of virus infection until 21 DPI and thereafter on a weekly basis until 120 DPI. Symptom severity on individual plants were evaluated according to the disease severity index (DSI) described before (Friedmann et al., 1998; Lapidot & Friedmann, 2002) consisting of 0 as no visible symptoms, inoculated plants show same growth and development as non-inoculated plants, 1 as slight yellowing of leaflet margins restricted to the apical part of the plant, 2 as some yellowing and minor curling of leaflet ends, 3 as wide range of leaf yellowing, curling and cupping, the plants showing some levels of reduction in size, yet plants continue to develop, and 4 as very severe plant stunting and yellowing, pronounced leaf cupping and curling, and plant ceased to grow. Average symptom severity scores for each construct at 30 and 50 DPI are reported for the two different experiments. The yielding ability of the agroinoculated plants were compared with mock-inoculated control plants which had been exposed to virus-free whiteflies. Fruits were picked in a single harvest, all mature-red and immature green fruits were collected. Total yield (kg) were taken per cultivar, inoculated and non- inoculated and were averaged per experiment.

108 3.2.6 Whitefly transmission of the virus progeny from agroinfected plants

The ability of B. tabaci to transmit viable progeny virus derived from pCam30-VI and pCam22-VII constructs, were evaluated by determining whether whiteflies could successfully transmit the virus from PCR positive agroinoculated tomato plants to healthy tomato plants. A non-viruliferous colony of B. tabaci (type B) was used for the transmission experiments. The colony was originally established from whiteflies collected in Trichardtsdal tomato fields, tested non-viruliferous, and maintained on cotton (Gossypium hirsutum) in whitefly-proof cages held in an insectary at Sakata Vegenetics Pty (Ltd), Lanseria. In each transmission test, twenty whiteflies were permitted a 48 h acquisition access period (AAP) on PCR positive, symptomatic agroinoculated tomato plants using clip cages. These insects were then transferred onto healthy tomato plants in an insect proof cage and allowed an inoculation access period (IAP) of 48 h. Replicated experiments were conducted with five plants each for the progeny virus originating from pCam30-VI and pCam22-VII constructs. Inoculated plants were sprayed with imidacloiprid (Confidor, Bayer) to kill whiteflies, maintained in an insect-free greenhouse and monitored for symptoms up to 8 weeks post-inoculation. The appearance of characteristic disease symptoms in tomato was monitored to confirm similar symptoms observed in agroinoculated plants. Twenty one days post-inoculation, DNA was extracted from the apex of the infected plants and tested using the ToCSV-specific PCR.

3.2.7 Southern blot analysis

Genomic DNA was extracted from 0.150 g of young, fully expanded leaf tissue of systemically infected plants 21 days post inoculation (Invisorb® Spin Plant Mini DNA extraction kit, Invitek GmbH). Leaves of five infected plants per construct were analysed. Total nucleic acid (5 μg) was electrophoresed in 1.2% agarose gel and transferred to a positively charged nylon membrane (Hybond N+; Amersham). Viral DNA was detected by hybridization with a digoxigenin-labeled probe synthesized by PCR using the XhoI abutting primer set that binds within the ToCSV coat protein (CP) and amplify the full viral genome (~2,7 kbp) as described in Chapter 5.

3.2.8 Construction of a chimaeric ToCSV-[ZA:Mks30:08] and ToCSV-[ZA:Mks22:07] infectious clone

In order to determine if the recombinant V2 protein encoded by ToCSV-II acts as an important symptom determinant, a chimaeric ToCSV-I and II infectious clone was

109 constructed by exchanging the V2 ORF between the pCam30-VI and pCam22-VII constructs. The V2 ORFs of the pCam30-VI and pCam22-VII constructs were released by digestion with BamHI and XhoI and the pCAM22-VII fragment was cloned into the corresponding position within the pCam30-VI construct. The cloned chimaeric construct, termed pCam30VI/VII were sequenced to confirm transfer of the V2 ORF from the pCam22-VII to pCam30-VI. The chimaeric construct was introduced into A. tumefaciens and used for agroinoculation. Ten tomato plants (Rooikhaki) were agroinoculated with the pCam30-VI, pCam22-VII and pCam30VI/VII constructs, respectively, as described above. The plants were transplanted in an insect proof greenhouse and symptom development induced by the 3 constructs inspected and compared regularly until 21 DPI and thereafter on a weekly basis up until 65 DPI.

3.3 Results

3.3.1 Molecular characterization and phylogenetic analysis of the two ToCSV variants

In the phylogenetic analyses performed with the complete DNA-A nucleotide sequences, the 37 ToCSV isolates sampled in this study grouped within the ToCSV cluster (SSI, Figure 3.2) and were most closely related to Tobacco leaf curl Zimbabwe virus (TbLCZV- [ZW], AF350330; AM701756, 81-82.7%). All the ToCSV isolates shared >94.9% identity (Table 2.2) and are regarded as variants of the ToCSV species (>93% nucleotide identity; Fauquet et al., 2008). Based on the presence or absence of a putative recombination fragment (event b, Figure 2.6, Chapter 2) in the V2 region, two ToCSV variant clusters were defined, namely ToCSV variant I (Figure 3.2, green box) without recombination fragment in V2 region and ToCSV variant II (Figure 3.2, orange box) with a recombination fragment in V2. Two ToCSV isolates, ToCSV-[ZA:Mks30:08] and ToCSV-[ZA:Mks22:07] from the ToCSV variant I and II clusters, were selected for further molecular and biological characterization.

As no DNA-B components was obtained (Chapter 2), ToCSV-[ZA:Mks30:08] and ToCSV- [ZA:Mks22:07] each consisted of 2768 nt DNA-A components with a genome organization typical of Old World monopartite begomoviruses that includes the six ORFs: V1 (CP), V2, C1 (replication-associated protein, Rep), C2, C3 and C4 and a 259 nt IR containing the invariant nonanucleotide motif (TAATATTAC) (Figure 2.3). Both isolates contain the two directly repeated sequences of GGTAC located at nucleotide coordinates 2624-2627 and 2663-2667, and two inverted repeats at coordinates 2624-2628 and 2664-2668, predicted to serve as Rep-binding sites (Paximadis et al., 1999).

110

Figure 3.2 Neighbour joining tree indicating the relationships between the tomato- infecting begomovirus isolates from South Africa, based on alignments of the complete genome sequence. The SAI subclade includes 37 ToCSV isolates sampled from the tomato production regions in South Africa. ToCSV-I (green box), that comprise the ToCSV isolates without the recombination fragment and ToCSV-II (orange box), that comprise the ToCSV isolates with the recombination fragment. The corresponding identifiers, numbers and abbreviations for the ToCSV sequences are listed in Table 2.2 (Chapter 2). Bootstrap values (1000 replicates) are shown above or under the horizontal line. Horizontal branch lengths represent genetic distances as indicated by the scale bar, vertical distances are arbitrary. As out-group, an isolate of Tomato leaf curl Bangalore virus-A [India:Bangalore 1] (ToLCBV, Z48182) was used. Representative begomovirus sequences obtained from Genbank are as follows: Tobacco leaf curl Zimbabwe virus-[Zimbabwe:2001] (TbLCZV- [ZW:01]; AF350330); Tobacco leaf curl Zimbabwe virus-[Comoros:Foumboudziouni:2005] (TbLCZV [KM:Fbz:05]; AM701756); Pepper yellow vein Mali virus-[Burkina Faso:Bazega: sweet pepper:2007] (PepYVMV-[BF:Baz:SPe:07]; FM876847); Pepper yellow vein Mali virus-[Mali:2003] (PepYVMV-[ML:03]; AY502935).

111 The sequence homology between ToCSV-[ZA:Mks30:08] (ToCSV-I), ToCSV- [ZA:Mks22:07] (ToCSV-II), and other closely related viral isolates are indicated in Table 3.1 and 3.2. The complete nucleotide sequence of ToCSV-[ZA:Mks30:08] was 97.3% identical to ToCSV- [ZA:Mks22:07], with V1, C1, C2, C3 and C4 coding regions 99.5- 100% identical (Table 3.1). The IR and V2 ORF sequences of ToCSV-[ZA:Mks30:08] and ToCSV-[ZA:Mks22:07] were much lower, 85.7-89.9% (Table 3.1), which supports the recombinant nature of the ToCSV-[ZA:Mks22:07] genome predicted in chapter 2. The nucleotide sequence of the ToCSV-[ZA:Mks22:07] V2 ORF was also 91.7% identical with an isolate of Tomato leaf curl Uganda virus-[Uganda:Iganga:2005], (ToLCUV, DQ127170) (Table 3.2), the viral isolate predicted as the source of the recombination fragment by recombination analysis (Chapter 2).

112 Table 3.1 Percentage identities for complete genome, intergenic region (IR) and open reading frame nucleotide and amino acid sequences of Tomato curly stunt virus [ZA:Mks30:08] (ToCSV-I) with selected begomoviruses. ToCSV variant I (ToCSV-[ZA:Mks30:08]) sequence comparison Begomoviruses* Genome IR V1 V2 C1 C2 C3 C4

nt aa Nt Aa nt aa nt aa nt aa nt aa ToCSV-[ZA:Mks22:07] 97 85.7 99 98.8 89.9 93.8 99.8 99.4 99.5 94.8 99.7 91.7 100 100 AF350330 TblCZV_ZW 82.7 77.3 75.9 81.3 80.5 77.5 93.2 92.2 80 68.1 79.6 76.1 97.6 95.2 AM701756 TbLCZV 81.9 78.4 76.7 82.5 81.1 77.5 90.1 86.2 79.5 68.1 79.3 75.3 96.8 92.9 AY502935 PEPYVV 79.5 60.8 80.2 87.2 84.3 84.4 86.1 84.1 82.4 72.5 83.8 79.1 89.4 77.6 AM701758 ToLCAnjV 77.3 49.2 81.7 87.2 83.4 81 79.6 66.5 83.7 73.3 84.8 76.1 81.9 47 AJ865341 ToLCKMV 77 54.2 81.3 89.9 84.6 82.7 79.1 79.9 83.4 78.5 83.5 79.8 81.1 50 AF271234 TYLCMaLV 76.8 56.9 76.8 81.7 77.5 80.1 79.2 81.6 81.2 71.1 84.3 79.1 79.2 45 DQ127170 ToLCUV 75.7 59.6 81.9 87.9 85.2 84.4 73.7 73.5 84.9 79.2 86 82.8 67.1 27 AJ489258 TYLCV-ALm 75.7 52.1 80.3 86.8 84.3 85.3 76.7 76.6 81.2 71.8 83.3 76.8 76.8 45.3 AY502936 ToLCMV 75.4 51.9 79.8 87.2 79.6 76.7 79.9 79.6 79.7 68.1 81 79.1 87.8 69.4 AB116629 TYLCV-IL 75 52.3 80.3 87.2 83.7 85.3 76.4 76.3 80.4 71.8 82.5 75.3 76.8 45.3 AM701765 ToLCDiaV 75.3 49 76 83.3 75.2 61.4 82.6 84.4 83.4 79.2 83.5 79.1 92.9 81.1 AF155806 SACMV 74.9 48.1 81.6 85.6 84.9 84.4 76.2 76.3 80.2 75.5 80.5 73.8 77.6 45.9

* Virus abbreviations: Tobacco leaf curl Zimbabwe virus-[Zimbabwe:2001] (TbLCZV-[ZW:01]; AF350330); Tobacco leaf curl Zimbabwe virus-[Comoros:Foumboudziouni:2005] (TbLCZV [KM:Fbz:05]; AM701756); Pepper yellow vein Mali virus-[Mali:2003] (PepYVMV-[ML:03]; AY502935); Tomato leaf curl Anjouan virus - [Anjouan:Ouani3:2004] (ToLCAnjV-[Anj:Oua3:04]; AM701758); Tomato leaf curl Comoros virus-[Mayotte:Dembeni:2003] (ToLCKMV-[YT:Dem:03]; AJ865341); Tomato yellow leaf curl Malaga virus-[Spain:421:1999] (TYLCMalV[ES:421:99]; AF271234); Tomato leaf curl Uganda virus-[Uganda:Iganga:2005] (ToLCUV-[UG:Iga:05]; DQ127170); Tomato yellow leaf curl virus-Israel-[Spain:Almeria:Pepper:1999] (TYLCV-IL[ES:Alm:Pep:99]; AJ489258); Tomato leaf curl Mali virus-[Mali:2003] (ToLCMLV-[ML:03]; AY502936); Tomato yellow leaf curl virus-Israel-[Japan:Miyazaki] (AB116629 TYLCV-IL[JR:Miy]; AB116629); Tomato leaf curl Diana virus-[Madagascar:Namakely5:2001] (ToLCDiaV-[MG:Nam5:01]; AM701765); South African cassava mosaic virus-[South Africa:1999] (SACMV-[ZA:99]; AF155806).

113 Table 3.2 Percentage identities for complete genome, intergenic region (IR) and open reading frame nucleotide and amino acid sequences of Tomato curly stunt virus [ZA:Mks22:07] (ToCSV-II) with selected begomoviruses. ToCSV variant II (ToCSV-[ZA:Mks22:07] sequence comparison Begomoviruses* Genome IR V1 V2 C1 C2 C3 C4

Nt aa Nt Aa nt aa nt aa nt aa nt aa AF350330 TblCZV-ZW 83.1 80 76.9 81.7 84 79.3 93.2 92.4 79 65.9 79.1 76.1 98 95.2 AM701756 TbLCZV 82.2 80.2 77.4 82.9 84 79.3 90.4 86.5 78.5 65.9 79.4 76.1 97.2 92.9 AY502935 PEPYVV 80 63.3 80.3 87.5 86.7 87 86.4 84.9 81.7 71.8 81.8 76.1 89.8 77.6 AM701758 ToLCAnjV 77.7 50.6 81.9 86.8 87.3 82.7 79.7 67.3 85.6 72.5 86.8 76.1 81.9 47 AJ865341 ToLCKMV 77.5 54.6 81.8 90.3 88.4 87 79.2 80.5 84.9 80.7 85.6 82.8 81.1 50 AF271234 TYLCMaLV 77.2 60.9 77.5 82.1 80.8 81.8 79.4 81.8 81.4 72.5 82.3 79.8 79.2 45 DQ127170 ToLCUV 76.3 58.9 82.3 88.3 91.7 88.7 74.1 74 83.9 77 84.8 83.5 76.8 27 AJ489258 TYLCV_ALm 75.8 54.7 80.6 87.2 86.4 87 76.9 76.8 81.9 73.3 82.1 76.8 67.1 45.3 AY502936 ToLCMV 75.3 50.3 80.9 87.2 86.4 87.9 77.2 78.2 81.9 72.5 80.6 76.1 92.9 69.4 AB116629 TYLCV-IL 75.3 50.5 82.1 86 86.1 85.3 76.8 76.8 80.9 74 80.6 73.8 75.6 45.3 AM701765 ToLCDiaV 75.1 55.3 80.6 87.5 86.4 87 76.4 76.6 80.7 73.3 80.8 75.3 76.8 81.1 AF155806 SACMV 74.7 49.3 76.6 83.7 72.9 62.2 82.6 84.1 83.7 80 85.3 83.5 77.6 45.9

114 3.3.2 Development of a ToCSV-specific PCR

Alignments of the ToCSV genome nucleotide sequences with most closely related begomoviruses, revealed a number of divergent regions amongst the begomovirus species (Figure 3.3a). A ToCSV-specific primer was designed in the C1 (Rep) ORF (Rep- F) and V1 (CP) ORF (CP-R) and amplified 1280 bp (Figure 3.3a). The Rep-CP ToCSV- specific amplified the ~1.3-kb fragment from ToCSV-infected tomato plants, but not from uninfected tomato plants, TYLCV-Mld, ToCSLV-[ZA:Lan101:07] (Figure 3.3b), and also not from ToCSNV-[ZA:Nwr06:09] and ToCSMV-[ZA:Mks:07] infected tomato plants (results not shown).

Figure 3.3 (a) The Rep-CP primer pair designed to bind to ToCSV only, amplifies a 1280bp fragment comprising of the Rep (replication initiator protein, C1), IR (intergenic region) and CP (coat protein, V1). (b) The Rep-CP ToCSV-specific PCR fragment (~1.3 kb) was only amplified from ToCSV-infected tomato plants (lane 1-4), with no amplification from uninfected tomato plants (lane 17), Tomato yellow leave curl virus mild (TYLCV-Mld) infected plants (lane 5) and Tomato curly stunt Lanseria virus (ToCSLV-[ZA:Lan101:07]) infected plants (lane 6). Rep-CP PCR-RFLP with HindIII differentiated ToCSV variant I (uncut) and II (cut): lane 7, ToCSV-[ZA:Mks30:08], (ToCSV-I) and lane 8, ToCSV- [ZA:Mks22:07] (ToCSV-II). The distribution of ToCSV isolates from variant cluster I and II in samples collected in affected tomato growing regions of South Africa were determined (only representative samples shown): lane 9, Mooketsi; lane 10, Komatipoort; lane 11, Vivo; lane 12, Mooketsi; lane 13, Tom Burke; lane 14, East London; lane 15, Mooketsi; lane 16, Trichardtsdal; lane 17, negative control; lane 18, non-template control and GeneRuler Express DNA Ladder indicated by M.

115 3.3.3 Differentiation between ToCSV variant cluster I and II using a ToCSV specific PCR- RFLP

A PCR-RFLP method was developed to differentiate ToCSV variant I and II found in South Africa. The PCR-RFLP employed the ToCSV specific Rep-CP primer pair to amplify the 1280 bp fragment that was digested with HindIII that enables differentiation of the ToCSV variant clusters I and II by yielding different sized products (Figure 3.3b). ToCSV variant I produced an uncut 1280-bp PCR fragment using the PCR-RFLP on ToCSV- [ZA:Mks30:08] (ToCSV-I), while the PCR-RFLP of ToCSV-[ZA:Mks22:07] (ToCSV-II) produced digested PCR products of ~574 bp and ~706 bp (Figure 3.3b, lane 7-8). All the ToCSV sequenced variants (37 ToCSV, chapter 2) could be accurately identified using the PCR-RFLP method, which were also consistent with genome sequence-based identification. The PCR-RFLP could also identify the ToCSV variants of the 529 samples collected from symptomatic plants in the affected tomato growing regions of South Africa. (Figure 3.3b, lane 9-18). ToCSV variant geographical distribution in South Africa. indicates that the majority of the viral samples belong to the ToCSV-I cluster (65%), whereas only 24% of the samples belong to the ToCSV-II cluster and 11% of the samples showed mixed infection by isolates from both clusters. The ToCSV-I viral isolates were distributed throughout the northern South African production regions, including the Limpopo, Mpumalanga and Kwazulu-Natal provinces and only a small number of samples were identified in the Western Cape (Figure 3.4). The ToCSV-II viral isolates were also widely distributed among the tomato production regions in the northern South African provinces and were identified as the only viral isolates responsible for a recent outbreak of the tomato curly stunt disease (ToCSD) in East London in the Eastern Cape (Figure 3.4).

3.3.4 Infectivity of the cloned ToCSV variant I and II DNA

To assess the infectivity and symptom phenotype of the two variants, namely ToCSV- [ZA:Mks30:08] (ToCSV-I) and ToCSV-[ZA:Mks22:07] (ToCSV-II) agroinfectious constructs of both the genomes were used for infectious studies using the agro-prick technique. The presence of ToCSV DNA in agro-inoculated plants was confirmed by PCR with the ToCSV-specific primer pair at 21 DPI, thus confirming that the clones were replication competent and infectious. Yellowing of the leaf lamina towards the apical part of the plant and slight upward leaf curling symptoms were observed around 17 DPI on plants inoculated by both constructs. By 30 DPI, tomato plants inoculated with ToCSV- [ZA:Mks30:08] (variant I) showed an average DSI of 2.18 (Table 3.3), with significant yellowing and curling of the leaflet margins and leaf surface reduction (Figure 3.5 a (centre)), whereas plants inoculated with ToCSV-[ZA:Mks22:07] (variant II) only showed

116 an average DSI of 1.19 (Table 3.3), with slight yellowing and curling, with no reduction in leaf surface area (Figure 3.5 a (right)) in comparison with the uninfected controls (Figure 3.5 a (left)).

Figure 3.4 Geographical distribution of ToCSV variant I ( ) and II ( ) in single and mixed infection ( ) in South Africa. The Rep-CP ToCSV-specific PCR-RFLP using HindIII digestion was used to differentiate ToCSV variant I and II isolates from tomato samples with typical begomovirus symptoms that were collected in tomato production regions in South Africa between 2006 and 2010.

By 50 DPI, plants inoculated with ToCSV-[ZA:Mks30:08] (variant I) were severely stunted (DSI = 3.82) (Table 3.3), with pronounced chlorosis, leaf cupping and curling and the plants were significantly stunted (Figure 3.5 b, c (centre)) in comparison with the uninfected controls (Figure 3.5 b, c (left)). Plants inoculated with ToCSV-[ZA:Mks22:07] at 50 DPI (DSI = 1.41) (Table 3.3) still only showed slight yellowing and curling, with no reduction in leaf surface area. These plants were still growing, flowering and producing fruit, although they were slightly stunted in comparison with the uninfected controls (Figure 3.5 b, c (right)). The symptoms induced by ToCSV-[ZA:Mks30:08] were much more severe than those induced by ToCSV-[ZA:Mks22:07] and ToCSV-[ZA:Mks30:08] infection resulted in an 90% reduction in yield, whereas infection by ToCSV-[ZA:Mks22:07] only resulted in a 42% reduction in yield (yield analysis results not shown).

117

Figure 3.5 Disease symptoms induced in susceptible tomato plants (cv. Rooikhaki) (a) at 30 days post-inoculation (DPI) with the empty vector (left), ToCSV-[ZA:Mks30:08] (ToCSV-I) (centre) and ToCSV-[ZA:Mks22:07] (ToCSV-II) (right) and (b) 50 DPI, with the empty vector (left), ToCSV-[ZA:Mks30:08] (centre) and ToCSV-[ZA:Mks22:07] (right). (c) Shows corresponding representative leaves at 50 DPI to reveal the differences in disease symptoms of empty vector (left), ToCSV-[ZA:Mks30:08] (centre) and ToCSV- [ZA:Mks22:07] (right).

3.3.5 ToCSV-[ZA:Mks30:08] and ToCSV-[ZA:Mks22:07] isolates are transmissible by B. tabaci

To test the transmissibility of the cloned ToCSV isolates by B. tabaci type B, an experiment was carried out using tomato plants agro-inoculated with ToCSV- [ZA:Mks30:08] (variant I) and ToCSV-[ZA:Mks22:07] (variant II) constructs, respectively. The progeny of both the infectious ToCSV isolates present in these plants were whitefly transmissible, and the tomato plants developed disease symptoms similar to agro-

118 inoculated plants at 17 DPI. Disease development and symptoms were confirmed by observation of symptoms and PCR (results not shown).

Table 3.3 Infectivity and symptoms induced by Tomato curly stunt virus (ToCSV)- [ZA:Mks30:08] and ToCSV-[ZA:Mks22:07] infectious clones through by agro-inoculation and number of PCR confirmed symptomatic plants.

ToCSV-[ZA:Mks30:08] ToCSV-[ZA:Mks22:07]

Symptomatic 11/18 17/18

plants/Inoculated

plantsa

Rep-CP PCR 11/18 17/18

DSIb 30 DPIc 2.18 ± 0.4 1.19 ± 0.4

DSIb 50 DPIc 3.82 ± 0.4 1.41 ± 0.5

a Number of plants infected/inoculated b Average disease severity index (DSI) indicated as follows: 1, slight yellowing of leaflet margins restricted to the apical part of the plant; 2 = some yellowing and minor curling of leaflet ends; 3, wide range of leaf yellowing, curling and cupping, the plants showing some levels of reduction in size, yet plants continue to develop; 4, very severe plant stunting and yellowing, pronounced leaf cupping and curling, and plant ceased to grow. c Time of symptom evaluation, in days post-inoculation (DPI).

3.3.6 Southern blot analysis

Southern blot analysis using a probe to the full ToCSV genome revealed the presence of the characteristic viral forms of begomovirus infection in agro-inoculated tomato plants, i.e., single-stranded genomic DNA and double-stranded replicative DNA forms (supercoiled, linear and open circular) (Figure 3.6, representative of results obtained in three independent experiments). Despite the substantial increase in symptom severity in plants infected with ToCSV-[ZA:Mks30:08], hybridization results revealed similar viral DNA levels infected by both viral isolates.

119

Figure 3.6 Southern blot analysis of viral DNA samples extracted agro-inoculated tomato plants with ToCSV-I (ToCSV-[ZA:Mks30:08]), ToCSV-II (ToCSV-[ZA:Mks22:07]) and ToCSV-I/II (V2 ORF of variant II replaced by V2 ORF of variant I; pCam30VI/VII). Similar amounts (5 μg) of total nucleic acids prepared from systemically infected leaves of a single plant were loaded in each lane and hybridised with DIG-labeled probes specific for ToSCV DNA-A. The positions of open-circular (OC), linear (lin), single-stranded (SS) DNA and supercoiled (SC) forms are indicated.

3.3.7 Infectivity and symptom phenotype of the chimaeric ToCSV clone

The possible role of the recombinant V2 protein encoded by ToCSV-II as a symptom determinant, was investigated by infecting ten tomato seedlings (cv. Rooikhaki) with the pCam30-VI (variant I), pCam22-VII (variant II) and pCam30VI/VII (deleting variant-I V2 ORF and inserting variant II V2 ORF) constructs, respectively and monitoring the symptom development and severity. As described above, the ToCSV-[ZA:Mks30:08] isolate (variant I) induced a severe symptom phenotype (Figure 3.7 a, b (left)) (DSI = 3.5 at 50 DPI, Table 3.4), whereas the ToCSV-[ZA:Mks22:07] isolate (variant II) induced a much more milder symptom phenotype (Figure 3.7 a, b (centre)) (DSI = 1.5 at 50 DPI, Table 3.4). The chimaeric construct induced a severe symptom phenotype (Figure 3.7 a, b (right)) (DSI = 4.0 at 50 DPI), similar to the ToCSV-[ZA:Mks30:08] isolate. The pCam30-VI (variant I) and pCam30VI/VII (chimaeric construct) induced a severe symptom phenotype compared to pCam22-VII (variant II), which induced a milder symptom phenotype in tomato plants.

120

Figure 3.7 Disease symptoms induced in susceptible tomato plants (cv. Rooikhaki) at 50 days post-inoculation (DPI) (a) with pCam30-VI (variant I) (left), pCam22-VII (variant II, centre) and pCam30VI/VII (variant I V2 ORF deleted and replaced by variant II V2 ORF, right). (b) The corresponding representative leaves below to reveal the disease symptoms at 50 DPI of pCam30-VI (variant I) (left), pCam22-VII (variant II, centre) and pCam30VI/VII (right).

Table 3.4 Infectivity and symptoms induced by pCam30-VI, pCam22-VII and pCam30VI/VII infectious clones by agroinoculation and PCR confirmed number of symptomatic plants.

pCam30-VI pCam22-VII pCam30VI/VII

Symptomatic 10/10 10/10 10/10 plants/inoculated plantsa

Rep-CP PCR 10/10 10/10 10/10

DSIb 50 DPIc 3.5 ± 0.5 1.5 ± 0.5 4.0 ± 0.5

121 3.4 Discussion

Molecular characterization of the South African ToCSV isolates has shown that ToCSV has a number of variants, sharing >94.9% nucleotide identity, with a typical old world monopartite organization (containing an AV2 gene) and no associated DNA-B or satellite components (Pietersen et al., 2008, Chapter 2). The results of this investigation demonstrated that two ToCSV clusters, one including newly described recombinant variants, are the most predominant and widespread representatives of the begomovirus genus causing the ToCSD in South Africa. Both virus variants were shown to be infectious by agroinoculation and transmissible by B. tabaci type B. Using the agroinoculation system, it was further established that the recombinant ToCSV variant (II) causes a distinctly milder symptom phenotype in tomato, in contrast to the severe symptoms phenotype induced by variant (I). Symptoms similar to those observed in naturally infected tomato plants were observed in experimentally infected plants, thus Koch’s postulates for ToCSV were fulfilled for the first time.

When considering genetic variability among the ToCSV variants, it is well known that members of the geminivirus family evolve/adapt by a number of mechanisms, the three major forces being mutation, recombination, and reassortment (Seal et al., 2006). Studies on the mutation frequencies of several different geminiviruses have indicated that their mutational rates are equivalent to that of RNA viruses (Isnard et al., 1998; Ge et al., 2007; Duffy & Holmes, 2009). It is also believed that recombination among different DNA-A components between co-infecting viruses is a major contributor to molecular variation among geminiviruses (Lazarowitz & Lazdins, 1991; Harrison et al., 1997; Zhou et al., 1997; Padidam et al., 1999; Harrison & Robinson, 1999; Sanz et al., 2000; Pita et al., 2001; Monci et al., 2002; Ribeiro et al., 2003; Morilla et al., 2004). The genetic diversification/diversity of this ToCSV begomovirus population (>94.9%) can be attributed to both the intrinsic high substitution rate observed in geminiviruses as well as recombination (Pietersen et al., 2008, Chapter 2). Several ToCSV isolates, including ToCSV-[ZA:Mks22:07], (variant II) had high levels of nucleotide sequence identity to ToLCUV (DQ127170) in the V2 ORF, indicating that these isolates are intraspecific recombinants. Phylogenetic analysis of the SAI ToCSV isolates supported the recombinant nature of these isolates, by revealing two ToCSV variant clusters based on the absence (ToCSV-I) or presence (ToCSV-II) of the recombination fragment in the V2 ORF (Figure 3.2). A ToCSV-specific PCR-RFLP was developed and enabled differentiation of the two ToCSV variant groups in this study. ToCSV isolates from both variant clusters are widespread in the northern and southern tomato production regions of South Africa, although ToCSV-I variants predominates, and mixed infection frequently occur (Figure 3.4).

122 Knowledge of the identity and biology of the ToCSV variants in a given region is essential for effective disease management, specifically in terms of selecting appropriate detection methods or developing resistant cultivars (Pico et al., 1996). To date, no infectious clone has been produced and Koch’s postulate has not been completed for any of the ToCSV variants. In this study agroinfectious clones of two ToCSV variants that share 97.5% nucleotide identity were constructed and Koch’s postulates were confirmed. Two isolates from the ToCSV-I and II variant groups, namely ToCSV-[ZA:MKS30:08]) and ToCSV- [ZA:Mks22:07], respectively were selected for biological characterization using infectious clones and agroinoculation to proof Koch’s postulates. A similar strategy to Urbino et al. (2008) was used in this study to produce agroinfectious clones. The 50 nucleotide, highly conserved stem-loop region of ToCSV was used to facilitate rapid infectious clone production from any monomeric viral genomes, provided that the same restriction site at the corresponding nucleotide position in the origin of replication was used. Two 1.1-mer partial dimeric clones of the ToCSV variant I (ToCSV-[ZA:MKS30:08]) and II (ToCSV- [ZA:Mks22:07]) were constructed. Both clones were shown to be infectious in tomato plants and also whitefly transmissible. Sequence and biological analysis therefore indicate that both ToCSV-[ZA:MKS30:08] and ToCSV-[ZA:Mks22:07] variants are typical Old World begomoviruses, requiring only a DNA-A component to establish systemic infections (true monopartite genome), and thereby completing Koch’s postulate for ToCSV.

Interestingly, a contrasting pattern of symptoms was observed with the two ToCSV variants. ToCSV-[ZA:MKS30:08] (variant I) induced severe chlorotic, curling and stunting symptoms in tomato plants, whereas ToCSV-[ZA:Mks22:07] (variant II) induced milder symptom phenotype. Severe and mild curling and stunting symptoms have been reported by Pietersen and Smith (2002) and also observed during this study for tomato in field and greenhouses from which the different ToCSV variants were isolated. It is well known that a number of factors can influence symptom exhibition under field conditions, including virus species or strain, presence of absence of satellites, time of infection, plant genotype and seasonal conditions (Polston & Anderson, 1997; Fondong et al., 2000; Lapidot et al., 2006). However, the results of this study demonstrate that the difference in disease response seen under natural field infection may, in part also be due to the presence of the severe ToCSV variant and recombinant mild ToCSV variant.

Mutation studies, where genetic components are altered, deleted or exchanged between virulent and benign viral isolates, are often employed in an attempt to identify the genetic components acting as determinants of the pathogen’s phenotype (Briddon et al., 1990; Padidam et al., 1996; Liu et al., 1999; Martin & Rybicki, 2002; Rouhibakhsh et al., 2011). The variation in symptom phenotype produced by variant I and II prompted us to address the question whether the recombination within the centre of the virion sense gene (V2

123 ORF), that includes 44 nucleotide and seven amino acid changes, had any effects on viral (viability) fitness and infectivity and were therefore responsible for the attenuated symptoms produced by ToCSV variant II. The pre-coat protein (V2) has previously been shown to act as a pathogenicity determinant, possibly via the regulation of ss- and ds- DNA levels (Padidam et al., 1996) and mutations in this gene resulted in disturbance of the ssDNA/dsDNA ratio and altered symptom expression in the plant (Rigden et al., 1993; Wartig et al., 1997; Rojas et al., 2001; Bull et al., 2007; Rouhibakhsh et al., 2011). Furthermore, directed mutagenesis studies on the V2 gene of various begomoviruses, including Tomato leaf curl virus - Australia (Rigden et al., 1993), Tomato yellow leaf curl virus - Sardinia (Wartig et al., 1997); Tomato yellow leaf curl virus - Israel (Zrachya et al., 2007) and Tomato leaf curl Java virus (Sharma & Ikegami, 2009), indicated that disruption of the V2 does not affect the systemic spread of the virus, but symptoms induced by the mutants were noticeably attenuated. In certain cases, the attenuated symptoms were attributed to the loss of post-transcriptional gene silencing (PTGS) activity (Zrachya et al., 2007; Glick et al., 2008). Therefore, the relationship between viral DNA accumulation and symptom severity was investigated in our study firstly, by using southern blot analysis. In contrast to the study by Chatterji et al. (1999) where higher viral titres in plants infected with the severe strain of Tomato leaf curl New Delhi virus - India [India:New Delhi:Severe:1992] (ToLCNDV, U15015) compared to the mild strain (Tomato leaf curl New Delhi virus-India [India:New Delhi:Mild:1992] (U15016)) were observed, similar ss- and dsDNA titres for the mild and severe ToCSV variants were observed in this study. There was therefore no correlation between the observed symptom severity and virus accumulation levels. Furthermore, the experiment where the V2 ORF were exchanged between the severe variant (ToCSV-[ZA:MKS30:08]) and the mild variant (ToCSV- [ZA:Mks22:07]), indicated that the region encompassing the putative recombinant fragment did not affect the viral infectivity and replication ability and that variations in the V2 ORF were not responsible for the altered symptom phenotype.

A detailed comparison of the individual ORF nucleotide and amino acid sequences, demonstrated that the two variants had 41 single nucleotide substitutions or insertions and 22 amino acid substitutions in the genome, in addition to the substitutions and deletions in the V2 ORF due to the recombination fragment. These nucleotide changes were responsible for 35 nucleotide changes in the 3’ end of the intergenic region (IR) region as well as three, two, seven and eleven amino acid changes in the V1, C1, C2 and C3 ORFs, respectively. It has been shown that changes in only a few nucleotides can cause major phenotypic differences (Boulton et al., 1991a). Chatterji et al. (1999; 2000) showed that only two mutations among the 127 variable nucleotides between the DNA-A components of a mild and severe variant of ToLCNDV, a point mutation in one iteron in the common region and one in the N-terminus of the Rep protein, were responsible for the phenotype

124 alteration. Future site-directed mutagenesis experiments targeting all the remaining variable nucleotide positions in the ToCSV variants, should allow identification of the dysfunctional coding and/or non-coding sequences, responsible for the phenotype alteration. Likely candidates encoded by the DNA-A include: C2 that encode a multifunctional protein (TrAP) involved in viral transcription regulation and RNA silencing suppression (Sunter & Bisaro, 1997; Selth et al., 2004; Vanitharani et al., 2004; Wang et al., 2005; Amin et al., 2011); C4, which has been implicated in virus movement in plant tissues (Rojas et al., 2001; 2005) and in RNA silencing suppression (Vanitharani et al., 2004; 2005) or C3 protein (Ren), an auxiliary replication enhancing protein that may modulate Rep activity and is required for high levels of viral DNA accumulation (Settlage et al., 1996; 2001). Disruption of any of these activities could account for the mild and severe symptom phenotypes induced by the two ToCSV variants.

The infectious clones constructed in this study preserve the viral species and provide a convenient viral source that can be used to screen tomato varieties for disease resistance using defined viral isolates. Future resistance screening to ToCSV should focus on the severe virus variant (I) in order to identify resistance sources that could effectively limit the damage caused by ToCSV variant I that are apparently responsible for much of the begomovirus-induced economic losses in South Africa. (Chapter 5). The agroinfectious clones may also provide the opportunity to analyze the effects of site-directed mutagenesis on the infectivity and symptom development of the viral variants in the natural host. Finally, it is clear that, although a low level of genetic variability was observed among the tomato-infecting ToCSV variants in this study, their biological properties do vary. This might complicate virus identification and the development of resistance cultivars. The establishment of effective management strategies in future will therefore depend on the understanding of the virus biology and disease aetiology of all the tomato-infecting begomovirus species prevalent in South Africa.

125 3.5 References

Amin, I., Husain, K., Akbergenov, R., Yadav, J.S., Qazi, J., Mansoor, S., Hohn, T., Fauquet, C.M. & Briddon, R.W. (2011) Suppressors of RNA silencing encoded by the components of the cotton leaf curl Begomovirus-Betasatellite complex. The American Phytopathological Society 24:973-983.

Antignus, Y. & Cohen, S. (1994) Complete nucleotide sequence of an infectious clone of a mild isolate of Tomato yellow leaf curl virus (TYLCV). Phytopathology 84:707-712.

Bananej, K., Ahoonmanesh, A. & Kheyr-Pour, A. (2002) Host range of an Iranian isolate of Watermelon chlorotic stunt virus as determined by whitefly-mediated Inoculation and agroinfection, and its geographical distribution. Journal of Phytopathology 150:423-430.

Bananej, K., Kheyr-Pour, A., Salekdeh, H. & Ahoonmanesh, A. (2004) Complete nucleotide sequence of Iranian Tomato Yellow Leaf Curl virus isolate: further evidence for natural recombination amongst begomoviruses. Archives of Virology 149:1435-1443.

Boulton, M.I., King, D.I., Donson, J. & Davies, J.W. (1991a) Point substitutions in a promoter-like region and V1 gene affect the host range and symptoms of maize streak virus. Virology 183:114-121.

Boulton, M.I., King, D.I., Markham, P.G., Pinner, M.S., & Davies, J.W. (1991b) Host range and symptoms are determined by specific domains of the Maize streak virus genome. Virology 181:312–18.

Briddon, R.W. (2003) Cotton leaf curl disease, a multicomponent begomovirus complex. Molecular Plant Pathology 4:427-434.

Briddon, R.W. & Stanley, J. (2006) Subviral agents associated with plant single-stranded DNA viruses. Virology 344:198-210. Briddon, R.W., Pinner, M.S., Stanley, J. & Markham, P.G. (1990) Geminivirus coat protein gene replacement alters insect specificity. Virology 177:85-94.

Briddon, R.W., Mansoor, S., Bedford, I.D., Pinner, M.S. & Markham, P.G. (2000) Clones of cotton leaf curl geminivirus induce symptoms atypical of cotton leaf curl disease. Virus Genes 20:19-26.

Briddon, R.W., Mansoor, S., Bedford, I.D., Pinner, M.S., Saunders, K., Stanley, J., Zafar, Y., Malik, K.A. & Markham, P.G., (2001) Identification of DNA components required for induction of cotton leaf curl disease. Virology 285:234-243.

126 Bull, S.E., Briddon, R.W., Sserubombwe, W.S., Ngugi, K., Markham, P.G. & Stanley, J. (2007) Infectivity, pseudorecombination and mutagenesis of Kenyan cassava mosaic begomoviruses. Journal of General Virology 88:1624-1633.

Chatterji, A., Padidam, M., Beachy, R.N. & Fauquet, C.M. (1999) Identification of replication specificity determinance in Tomato leaf curl virus from New Delhi. Journal of Virology 73:5481-5489.

Chatterji, A., Chatterji, U., Beachy, R.N. & Fauquet, C.M. (2000) Sequence parameters that determine specificity of binding of the replication-associated protein to its cognate in two strains of Tomato leaf curl virus-New Delhi. Virology 273:341-350.

Dry, I.B., Rigden, J.E., Krake, L.R., Mullineaux, P.M. & Rezaian, M.A. (1993) Nucleotide sequence and genome organization of tomato leaf curl geminivirus. Journal of General Virology 74:147-147.

Duffy, S. & Holmes, E.C. (2009) Validation of high rates of nucleotide substitution in geminiviruses: Phylogenetic evidence from east African cassava mosaic viruses. Journal of General Virology 90:1539-1547.

Ferreira, P.T.O., Lemos, T.O., Nagata, T. & Inoue-Nagata, A.K. (2008) One-step cloning approach for construction of agroinfectious begomovirus clones. Journal of Virological Methods 147:351-354.

Fondong, V.N., Pita, J. S., Rey, M.E.C., De Kochko, A., Beachy, R.N. & Fauquet, C.M. (2000) Evidence of synergism between African cassava mosaic virus and a new double- recombinant geminivirus infecting cassava in Cameroon. Journal of General Virology 81:287-297.

Friedmann, M., Lapidot, M., Cohen, S. & Pilowsky, M. (1998) Novel source of resistance to tomato yellow leaf curl virus exhibiting a symptomless reaction to viral infection. Journal of the American Society for Horticultural Science 123:1004-1007.

Ge, L.M., Zhang, J.T., Zhou, X.P. & Li, H.Y. (2007) Genetic structure and population variability of Tomato yellow leaf curl China virus. Journal of Virology 81:5902-5907.

Grimes, D.J. (2006) Koch's postulates-Then and now. Microbe 1:223-228.

Grimsley, N., Hohn, B., Hohn, T. & Walden, R. (1986) Agroinfection an alternate route for viral infection of plants by using the Ti plasmid. Proceedings of the National Academy of Sciences 83:3282-3286.

127 Grimsley, N., Hohn, T., Davies, J. W., and Hohn, B. (1987) Agrobacterium-mediated delivery of infectious maize streak virus into maize plants. Nature 325:177-79.

Hanley-Bowdoin, L., Settlage, S.B., Orozco, B.M., Nagar, S. & Robertson, D. (1999) Geminiviruses: Models for plant DNA replication, transcription, and cell cycle regulation. Critical Reviews in Plant Sciences 18:71-106.

Harrison, B.D. (1985) Advances in geminivirus research. Annual Review of Phytopathology 23:55-82.

Harrison, B.D. & Robinson, D.J. (1999) Natural genomic and antigenic variation in whitefly-transmitted geminiviruses (begomoviruses). Annual Review of Phytopathology 37:369-398.

Höfgen, R. & Willmitzer, L. (1988) Storage of competent cells for Agrobacterium transformation. Nucleic Acids Research 16:9877.

Kheyr-Pour, A., Bendahmane, M., Matzeit, V., Accotto, G.P., Crespi, S. & Gronenborn, B. (1991) Tomato yellow leaf curl virus from Sardinia is a whitefly transmitted monoparatite geminivirus. Nucleic Acids Research 19:6763-6763.

Kheyr-Pour, A., Gronenborn, B., & Czosnek, H. (1994) Agroinoculation of Tomato yellow leaf curl virus (TYLCV) overcomes the virus resistance of wild Lycopersicon species. Plant Breeding 112:228-233.

Lapidot, M. & Friedmann, M. (2002) Breeding for resistance to whitefly-transmitted geminiviruses. Annals of Applied Biology 140:109-127.

Lapidot, M., Ben-Joseph, R., Cohen, L., Machbash, Z. & Levy, D. (2006) Development of a scale for evaluation of Tomato yellow leaf curl virus resistance level in tomato plants. Phytopathology 96:1404-1408.

128 Lazarowitz, S.G. & Lazdins, I.B. (1991) Infectivity and complete nucleotide-sequence of the cloned genomic components of a bipartite squash leaf curl geminivirus with a broad host range phenotype. Virology 180:58-69.

Liu, L., Pinner, M.S., Davies, J.W. & Stanley, J. (1999) Adaptation of the geminivirus bean yellow dwarf virus to dicotyledonous hosts involves both virion-sense and complementary- sense genes. Journal of General Virology 80:501-506.

Martin, D.P. & Rybicki, E.P. (2002) Investigation of Maize streak virus pathogenicity determinants using chimaeric genomes. Virology 300:180-188.

Mittal, D., Kumar, B. & Dasgupta, I. (2008) Agroinfection of cloned Sri Lankan cassava mosaic virus DNA to Arabidopsis thaliana, Nicotiana tabacum and cassava. Archives of Virology 153: 2149-2155.

Morilla, G., Krenz, B., Jeske, H., Bejarano, E.R. & Wege, C. (2004). Tête à tête of Tomato Yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus in single nuclei. Journal of Virology 78:10715-10723.

Moriones, E. & Navas-Castillo, J. (2000) Tomato yellow leaf curl virus, an emerging virus complex causing epidemics worldwide. Virus Research 71:123-134.

Navot, N., Pichersky, E., Zeidan, M., Zamir, D. & Czosnek, H. (1991) Tomato yellow leaf curl virus: a whitefly-transmitted geminivirus with a single genomic component. Virology 185:151-161.

Padidam, M., Beachy, R.N., & Fauquet, C.M. (1996) The role of AV2 (‘‘precoat’’) and coat protein in viral replication and movement in tomato leaf curl geminivirus. Virology 224:390- 404.

Padidam, M., Sawyer, S. & Fauquet, C.M. (1999) Possible emergence of new geminiviruses by frequent recombination. Virology 265:218-225.

Paximadis, M., Idris, A.M. Torres-Jerez, I., Villarreal, A., Rey, M.E.C. & Brown, J.K. (1999) Characterization of tobacco geminiviruses in the old and new world. Archives of Virology 144:703–717.

Pico, B., Diez, M.J. & Nuez, F. (1996) Viral diseases causing the greatest economic losses to the tomato crop .2. The Tomato yellow leaf curl virus - A review. Scientia Horticulturae 67:151-196.

129 Pietersen, G., Idris, A. M., Krüger, K. & Brown, J. K. (2000) Tomato curly stunt virus, a new begomovirus of tomato within the Tomato yellow leaf curl virus-Is cluster in South Africa. Plant Disease 84:810.

Pietersen, G. & Smith, M.F. (2002) Tomato yellow leaf curl virus resistant tomatoes show resistance to Tomato curly stunt virus. Plant Disease 86:528-534.

Pietersen, G., Idris, A.M., Kruger, K. & Brown, J.K. (2008) Characterization of Tomato curly stunt virus: A new tomato-infecting begomovirus from South Africa. Plant Pathology 57:809-818.

Pita, J.S., Fondong, V.N., Sangare, A., Kokora, R.N.N. & Fauquet, C.M. (2001) Genomic and biological diversity of the african cassava geminiviruses. Euphytica 120:115-125.

Polston, J.E. & Anderson, P.K. (1997) The emergence of whitefly-transmitted geminiviruses in tomato in the western hemisphere. Plant Disease 81:1358-1369.

Ribeiro, S.G., Ambrozevicius, L.P., Avila, A.C., Bezerra, I.C., Calegario, R.F., Fernandes, J.J., Lima, M.F., de Mello, R.N., Rocha, H. & Zerbini, F.M. (2003) Distribution and genetic diversity of tomato-infecting begomoviruses in Brazil. Archives of Virology 148:281-295.

Rigden, J.E., Dry, I.B., Mullineaux, P.M. & Rezaian, M.A. (1993) Mutagenesis of the virion-sense open reading frames of tomato leaf curl geminivirus. Virology 193:1001-1005.

Rojas, M.R., Jiang, H., Salati, R., Xoconostle-Cazares, B., Sudarshana, M.R., Lucas, W.J. & Gilbertson, R.L. (2001) Functional analysis of proteins involved in movement of the monopartite begomovirus, Tomato yellow leaf curl virus. Virology 291:110-125.

Rojas, M.R., Hagen, C., Lucas, W.J. & Gilbertson, R.L. (2005) Exploiting chinks in the plant's armor: Evolution and emergence of geminiviruses. Annual Review of Phytopathology 43:361-394.

Roossinck, M.J. (1997) Mechanisms of plant virus evolution. Annual Review of Phytopathology 35:191-209.

Rouhibakhsh, A., Haq, Q. & Malathi, V.G. (2011) Mutagenesis in ORF AV2 affects viral replication in Mungbean yellow mosaic India virus. Journal of Biosciences 36:329-340.

Rybicki, E.P. (1994) A phylogenetic and evolutionary justification for three genera of Geminiviridae. Archives of Virology 139:49-77.

Sambrook, J., Fritsch, E. & Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbour Laboratory Press, Cold Spring Harbour, USA.

130 Sanderfoot, A.A., Ingham, D.J. & Lazarowitz, S.G. (1996) A viral movement protein as a nuclear shuttle - The geminivirus BR1 movement protein contains domains essential for interaction with BL1 and nuclear localization. Plant Physiology 110:23-33.

Saunders, K., Bedford, I.D., Briddon, R.W., Markham, P.G., Wong, S.M. & Stanley, J. (2000) A novel virus complex causes Ageratum yellow vein disease. Proceedings of the National Academy of Science 97:6890-6895.

Saunders, K., Salim, N., Mali, V.R., Malathi, V.G., Briddon, R., Markham, P.G. & Stanley, .J. (2002) Characterization of Sri Lankan cassava mosaic virus and Indian cassava mosaic virus: evidence for acquisition of a DNA B component by a monopartite begomovirus. Virology 293:63-74.

Seal, S.E., Van den Bosch, F. & Jeger, M.J. (2006) Factors influencing begomovirus evolution and their increasing global significance: Implications for sustainable control. Critical Reviews in Plant Sciences 25:23-46.

Selth, L.A., Randles, J.W. & Rezaian, M.A. (2004) Host responses to transient expression of individual genes encoded by Tomato leaf curl virus. Molecular Plant-Microbe Interactions, 17:27-33.

Settlage, S.B., Miller, B. & HanleyBowdoin, L. (1996) Interactions between geminivirus replication proteins. Journal of Virology 70:6790-6795.

Sharma, P. & Ikegami, M. (2010) Tomato leaf curl Java virus V2 protein is a determinant of virulence, hypersensitive response and suppression of posttranscriptional gene silencing. Virology 396:85-93.

Stenger, D.C., Revington, G.N., Stevenson, M.C. & Bisaro, D.M. (1991) Replicational release of geminivirus genomes from tandemly repeated copies: evidence for rolling-circle replication of a plant viral DNA. Proceedings of the National Academy of Science 88:8029- 8033.

131 Sung, Y., & Coutts, R. (1995) Mutational analysis of potato yellow mosaic geminivirus Journal of General Virology 76:1773-1780.

Sunter, G. & Bisaro, D.M. (1997) Regulation of a geminivirus coat protein promoter by AL2 protein (TrAP): Evidence for activation and derepression mechanisms. Virology 232:269-280.

Sunter, G., Hartitz, M.D. & Bisaro, D.M. (1993) Tomato golden mosaic virus leftward gene expression: autoregulation of geminivirus replication protein. Virology 195:275-280.

Urbino, C., Thébaud, G., Granier, M., Blanc, S. & Peterschmitt, M. (2008) A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses. Virology Journal 5:135.

Varma, A. & Malathi, V.G. (2003) Emerging geminivirus problems: A serious threat to crop production. Annals of Applied Biology 142:145-164.

Van Larebeke, N., Engler, G., Holsters, M., Van den Elsacker, S., Zaenen, I., Schilperoort, R.A. & Schell. J. (1984) Large plasmid in Agrobacterium tumefaciens essential for crown gall inducing ability. Nature 252:169-170.

Vanitharani, R., Chellappan, P. & Fauquet, C.M. (2005) Geminiviruses and RNA silencing. Trends in Plant Science 10:144-151.

Wartig, L., KheyrPour, A., Noris, E., DEKouchkovsky, F., Jouanneau, F., Gronenborn, B. & Jupin, I. (1997) Genetic analysis of the monopartite tomato yellow leaf curl geminivirus: Roles of V1, V2, and C2 ORFs in viral pathogenesis. Virology 228:132-140.

Wege, C., Gotthardt, R.-D., Frischmuth, T. & Jeske, H. (2000) Fulfilling Koch’s postulates for Abutilon mosaic virus. Archives Virology 145:2217–2225.

Wu, C.Y., Lai, Y.C., Lin, N.S., Hsu, Y.H., Tsai, H.T., Liao. J.Y. & Hu, C.C. (2008) A simplified method of constructing infectious clones of begomovirus employing limited restriction enzyme digestion of products of rolling circle amplification. Journal of Virological Methods 147:355-359.

132 Zhou, X., Liu, Y., Calvert, L., Munoz, D., Otim-Nape, G.W., Robinson, D.J., & Harrison, B.D. (1997) Evidence that DNA-A of a geminivirus associated with severe cassava mosaic disease in Uganda has arisen by interspecific recombination. Journal of General Virology 78:2101-2111.

Zhou, X.P., Xie, Y., Tao, X.R., Zhang, Z.K., Li, Z.H. & Fauquet, C.M. (2003) Characterization of DNA beta associated with begomoviruses in china and evidence for co-evolution with their cognate viral DNA-A. Journal of General Virology 84:237-247.

Zrachya, A., Glick, E., Levy, Y., Arazi, T., Citovsky, V. & Gafni, Y. (2007) Suppressor of RNA silencing encoded by Tomato yellow leaf curl virus-Israel. Virology 358:159-165.

133 4.0 Genetic identification of members of the Bemesia tabaci cryptic species complex in South Africa reveals native and introduced haplotypes CHAPTER 4 Genetic identification of members of the Bemisia tabaci cryptic species complex from South Africa reveals native and introduced haplotypes

Abstract

The whitefly Bemisia tabaci cryptic species complex contains some important agricultural pest and virus vectors. Members of the complex have become serious pests in South Africa because of their feeding habit and their ability to transmit begomovirus species. Despite their economic importance, studies on the biology and distribution of B. tabaci in South Africa are limited. To this end, a survey was made to investigate the diversity and distribution of B. tabaci cryptic species in eight geographical locations (provinces) in South Africa, from 2002-2009, using the mitochondrial cytochrome oxidase I (mtCOI) sequences. Phylogenetic analysis revealed the presence of members from two endemic sub-Saharan Africa (SSAF) subclades co-existing with two introduced putative species. The SSAF-1 subclade includes cassava host-adapted B. tabaci populations, whereas the whiteflies collected from cassava and non-cassava hosts formed a distinct subclade, referred to as SSAF-5, and represent a new subclade among previously recognized southern Africa clades. Two introduced cryptic species, belonging to the Mediterranean and Middle East-Asia minor 1 clades were identified and include the B and Q types. The B type showed the widest distribution, being present in five of the eight provinces explored in South Africa, infesting several host plants and predominating over the indigenous haplotypes. This is the first report of the occurrence of the exotic Q type in South Africa alongside the more widely distributed B type. Furthermore, mtCOI PCR-RFLP was developed for the South African context to allow rapid discrimination between the B, Q and SSAF putative species. The capacity to manage pests and disease effectively relies on knowledge of the identity of the agents causing the damage. Therefore, this study contributes to the understanding the South African B. tabaci species diversity, information needed for the development of knowledge-based disease management practices.

134

NOTE:

This chapter has been published in a slightly modified form as:

Esterhuizen, L.L., Mabasa, K.G., van Heerden S.W., Czosnek, H., Brown, J.K., van Heerden, H. & Rey, M.E.C. (2012) Genetic identification of members of the Bemisia tabaci cryptic species complex from South Africa reveals native and introduced haplotypes. Journal of Applied Entomology DOI: 10.1111/j.1439-0418.2012.01720.x

135 4.1 Introduction

The whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) is a cryptic species complex containing some of the most destructive and invasive pests of vegetable, ornamental and field crops worldwide. Some members of this species complex have a global distribution and cause damage directly through feeding and indirectly through the transmission of plant pathogenic viruses, primarily begomoviruses (Byrne & Bellows, 1991; Moriones & Navas-Castillo, 2000; De Barro et al., 2011).

Bemisia tabaci was formerly thought to be a sibling species group whose members are morphologically indistinguishable while exhibiting a range of genetic, biological and behavioural variation (Brown et al., 1995b). Approximately 33 ‘biotypes’ have been classified based on the mtCOI gene sequences and a suite of concomitant phenotypic behaviours (Brown, 2010; Gill & Brown, 2010; Hadjistylli et al., 2010). Although evidence emphasises the existence of biological variants for the B. tabaci group, there is a lack of a definitive set of biological data that can be applied across the whole group (De Barro et al., 2011). There has been considerable debate about whether this diversity indicates the existence of different species or diversity within a single species (Campbell, 1993; Perring, 2001; Boykin et al., 2007; Brown, 2010). Recently Dinsdale et al. (2010) analysed B. tabaci globally and proposed subdividing B. tabaci in different cryptic species based on 3.5% pairwise genetic divergence. The 3.5% pairwise genetic divergence is further supported by complete or partial mating isolation between a number of the putative B. tabaci species (Dinsdale et al., 2010; Xu et al., 2010, Wang et al., 2011). Bemisia tabaci is now considered as composed of a complex of at least 24 cryptic species that barely interbreed and form different phylogenetic clades (Dinsdale et al., 2010; Xu et al., 2010; De Barro et al., 2011). The 24 putative species identified by Dinsdale et al. (2010) are (names of associated biotypes are placed in parentheses): Mediterranean (Q, J, L, Sub- Saharan Africa Silverleaf); Middle East-Asia minor 1 (B, B2); Middle East-Asia minor 2; Indian Ocean (MS); Asia I (H, M, NA); Australia/Indonesia; Australia (AN); China 1 (ZHJ3); China 2; Asia II 1 (K, P, ZHJ2); Asia II 2; Asia II 3 (ZHJ1); Asia II 4; Asia II 5 (G); Asia II 6; Asia II 7 (Cv); Asia II 8; Italy (T); Sub-Saharan Africa 1; Sub-Saharan Africa 2 (S); Sub- Saharan Africa 3; Sub-Saharan Africa 4; New World (A, C, D, F, Jatropha, N, R, Sida); and Uganda.

Two members of this cryptic species complex, referred to by Dinsdale et al. (2010) as Middle East - Asia minor 1 (also called B. argentifolii, herein referred to as B type) and Mediterranean (herein referred to as Q type), are known worldwide as invasive. The B and Q types invasion can largely be attributed to the trade in ornamental plant species (Frohlich et al., 1999; Dennehy et al., 2005; Bethke et al., 2009; Mckenzie et al., 2009; Dennehy et al., 2010), high fitness parameters, broad host ranges and propensity to

136 develop insecticide resistance (Horowitz et al., 2003; Dennehy et al., 2005; Horowitz et al., 2005; Prabhaker et al., 2005; Chu et al., 2006; Dennehy et al., 2006, 2010). The introduction of these invasive B. tabaci types into non-native habitats has resulted in the displacement of some innocuous B. tabaci indigenous to Australia, China, Central and South America, Mexico, Turkey, and the USA (Costa & Brown, 1991; Costa et al., 1993; Brown et al.,1995a, b; Bird & Brown, 1998; Lima et al., 2002; Bayhan et al., 2006; Zang et al., 2006; Liu et al., 2007; Chu et al., 2010a, b; Hu et al., 2011). The recent spread of Q type in regions already invaded by B has, in some locations, resulted in the rapid displacement of B by Q (Chu et al., 2010a, b; Luo et al., 2010). In many regions of the world, epidemics of plant diseases caused by begomoviruses transmitted by B. tabaci occurred soon after the invasion of the B and Q types (Varma & Malathi, 2003; Seal et al., 2006; Hogenhout et al., 2008). Where the Q type has shown resistance to pyriproxyfen and neonicotinoid insecticides, management of whitefly and associated viral diseases are more complicated (Dennehy et al., 2010). Therefore, where the B and Q types have established sympatrically, proactive monitoring of B. tabaci diversity and spread contribute to management strategies based on whitefly biology, behaviour and responses to agri- chemicals (Ellsworth & Martinez-Carrillo, 2001; Nauen & Denholm, 2005; Sequeira & Naranjo, 2008).

In addition to the invasive-like members of the Mediterranean and Middle East-Asia minor clades, the sub-Saharan African region harbours indigenous and possibly less invasive B. tabaci types that vector many begomoviruses (Legg et al., 2002; De La Rua et al., 2006). They cluster in the major sub-Saharan Africa non-silverleafing clade (SSAF), into four subclades (SSAF1-4) (Boykin et al., 2007, Dinsdale et al., 2010). The extent to which B. tabaci populations vary genetically and biologically throughout Africa have yet to be fully explored. Bemisia tabaci members within the SSAF major clade have been documented colonizing vegetable crops of which the majority associate with cassava (Manihot esculenta) (Legg et al., 2002; Abdullahi et al., 2003; Berry et al., 2004; Maruthi 2004; Brown & Idris 2005; Sseruwagi et al., 2005; De La Rua et al., 2006; Sseruwagi et al., 2006; Brown 2010; Carabali et al., 2010). The cassava associated types transmit at least 7 species of begomoviruses to cassava that is a major staple food in sub-Saharan Africa (Legg, 1996; Legg et al., 2002; Abdullahi et al., 2003; Carabali et al., 2010). The SSAF-1 subclade represents B. tabaci collections from 8 African countries and currently represents the dominant haplotype associated with cassava in Africa (Berry et al., 2004; De La Rua et al., 2006). SSAF-2 correspond to B. tabaci individuals previously collected in Uganda on cassava and identified as an invasive Uganda II population that was associated with severe cassava mosaic disease epidemics (Legg et al., 2002, Sseruwagi et al., 2004; De La Rua et al., 2006) as well as individuals collected from Spain on Ipoema species (De Barro et al., 2005). SSAF-3 and SSAF-4 contains 2 divergent populations

137 collected from cassava in Cameroon (Berry et al., 2004). Bemisia tabaci collected from cassava in Cameroon, Ghana, Ivory Coast, Nigeria and Zimbabwe grouped within the Mediterranean silverleafing clade rather than with other cassava associated collections in the SSAF (Berry et al., 2004).

The presence of the B. tabaci in South Africa has been recorded since the 1960s when it was associated with Tobacco leaf curl disease in tobacco-producing areas in the Gauteng and North West provinces (Hill, 1967; Thatcher, 1976). Hill (1967) and Thatcher (1976) differentiated the whitefly species, Trialeurodes vaporariorum (Westwood) and B. tabaci using mainly morphological characteristics. The B. tabaci type or species was only determined several decades later by Bedford et al. (1994) and Berry et al. (2004). Cassava associated B. tabaci collections from Mozambique, South Africa (Kwazulu-Natal) and Swaziland examined by Berry et al. (2004) were closely related to other cassava colonizing types from sub-Saharan Africa and grouped within the SSAF-1 subclade. The exotic B type was first reported from South Africa from potato (Solanum tuberosum) in 1992 (Bedford et al., 1994). Subsequently it emerged as an important agricultural pest with the appearance of Tomato curly stunt virus (ToCSV-[ZA:Ond:98]) in South Africa in 1997 (Pietersen et al., 2002; 2008).

In South Africa, studies on the host range and distribution of B. tabaci types have been limited, despite their economic importance in vegetable crops, including cassava. This study aimed at updating the information regarding the different B. tabaci types present in the country. The objective of this study was to establish the identity, locality and host association of B. tabaci in selected vegetable- and cassava-producing regions in South Africa. Adult B. tabaci, collected between 2002 and 2009 in several locations within eight provinces, were identified using the mtCOI sequences. To facilitate rapid identification in follow-on field studies in South Africa, a PCR-RFLP method was developed to differentiate between the B type, Q type, and indigenous sub-Saharan subclades SSAF-1 and SSAF- 5.

4.2 Materials and methods

4.2.1 Whitefly collection

Field collections of South African B. tabaci were made during 2002-2009. Adult whiteflies were collected from field and greenhouse-grown crops, as well as, non-cultivated species that include Ipomoea batatas, Solanum lycopersicum, Cucurbita species, Phaseolus vulgaris, Salvia tiliifolia, and Manihot esculenta (Table 4.1 and Figure 4.1). In each location, whiteflies were collected from several plants within the same field. Samples were collected directly into 70% ethanol and stored at -20˚C until analysis.

138 Table 4.1 Representative Bemisia tabaci collected in South Africa and identified by sequencing the mtCOI gene fragment. Code ‡ Area and province in South Africa Host plant Year mtCOI haplotype• 1† Onderberg, Mpumalanga 2002 B Unknown 2† Cedara, KwaZulu-Natal 2002 B Unknown 3† Kwalini, KwaZulu-Natal 2002 B Unknown 4† Tzaneen, Limpopo 2002 B Unknown 5- 10 # Bushbuckridge, Mpumalanga Manihot esculenta 2004 SSAF-1/ SSAF -5 11-16# Mariti, Mpumalanga M. esculenta 2005 SSAF -1/ SSAF -5 17-21# Tonga, Mpumalanga M. esculenta 2006 SSAF -1 22-23 Mooketsi, Limpopo Solanum 2006 B lycopersicum 24-26 Trichardsdal, Limpopo S. lycopersicum 2006 B 27-28 Tom Burke, Limpopo S. lycopersicum 2007 B 29-31 Mooketsi, Limpopo S. lycopersicum 2007 B 32-33 Pongola, KwaZulu-Natal S. lycopersicum 2008 B 34-35 Mooketsi, Limpopo S. lycopersicum 2008 B 36 Tom Burke, Limpopo S. lycopersicum 2008 B 37-38 Brits, North West S. lycopersicum 2008 SSAF-5 39-40 Brits, North West Ipoema spp. 2008 SSAF-5 41-42 Sterkfontein, Gauteng Cucurbita spp. 2008 SSAF-5 43-45 Tarlton, Gauteng Cucurbita spp. 2008 SSAF-5 46-47 Lanseria, Gauteng S. lycopersicum, 2009 SSAF-5 Malva parviflora, Phaseolus vulgaris. Datura stramonium 48-51 East London, Eastern Cape S. lycopersicum * 2009 Q 52-54 Vredendal, Western Cape Ipomoea batatas 2009 B

55-57 Van Rhynsdorp, Northern Cape Unknown 2009 B

58-59 Klawer, Western Cape Unknown 2009 B 60-64 Noordoewer, border of northern Cape S. lycopersicum 2009 B and Namibia 65-69 Komatipoort, Mpumalanga S. lycopersicum 2009 B

70-74 Mussina, Limpopo S. lycopersicum; 2009 B Cucurbita sp.

139 ‡ Codes 1-74 correspond to B. tabaci individuals collected from field and identified by sequencing the mtCOI gene fragment as indicated in Figure 4.1. B. tabaci samples 22-74 collected by L. Esterhuizen (JN104702-JN104716). † Samples collected by Kirsten Kruger, department of Entomology and Zoology, University of Pretoria, South Africa in 2002 from unknown host plants. # B. tabaci samples collected by K. Mabasa (JN104718-JN104726). * Samples collected in greenhouse. • mtCOI haplotype designation based on mtCOI sequenced samples, where B type refers to the Middle East-Asia minor 1 clade, Q type refer to the Mediterranean clade and SSAF- 1 and SSAF-5 refer to two sub-Saharan subclades, using the B. tabaci mtCOI phylogenetic designation (Dinsdale et al., 2010).

4.2.2 Nucleic acid extraction

Genomic DNA was extracted from individual whiteflies as described by Frohlich et al. (1999) with modifications. Single whiteflies were placed on a Petri dish covered by a piece of parafilm and the round end of a 0.5 ml microfuge tube was used to grind the whiteflies in 35 µl lysis buffer containing 50 mM NaCl, 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 0.5% Triton-X 100 and 3 mg/ml proteinase K. The extracts were incubated at 65˚C (15 min) and 95˚C (10 min) prior to 5 min centrifugation (9600 xg) to pellet debris. Nucleic acid extracts were stored at -20˚C until further use.

4.2.3 mtCOI PCR amplification and sequencing

The mtCOI gene (850 bp) (Frohlich et al., 1999) was amplified by PCR from 5 or more adult whiteflies per field collection, using the universal COI primers C1-J-2195 (5’- TTGATTTTTTGGTCATCCAGAAGT-3’) and TL2-N-3014 (5’-TCCAATGCACTAATCT GCCATATTA-3’) (Simon et al., 1994). The 25 µl PCR reaction contained 1X buffer (JMR

Holdings); 0.2 mM dNTPs, 2.5 mM MgCl2, 1.2 mM of each primer, 1U DNA Taq polymerase (JMR Holdings) and 5 µl DNA. The PCR conditions consisted of 94°C for 3 min followed by 35 cycles of 94 °C for 30 s, 52 °C for 1 min and 72 °C for 2 min, with a

140

Figure 4.1 South Africa map showing the areas where representative Bemisia tabaci samples were collected. The numbers on the map correspond to sample numbers in Table 4.1. Only representative B. tabaci samples (n=74) reflecting the collective haplotype identification and distribution were further identified by sequencing the mtCOI gene fragment. The whitefly mtCOI haplotypes are indicated as follows: ● Middle East/Asia minor 1 (B type), ◘ Mediterranean (Q type), ■SSAF-1 and ▲ SSAF-5.

final 10 min at 72 °C. The mtCOI amplicon from 2-3 samples per field collection was sequenced bi-directionally using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems) and Applied Biosystems 3730XL DNA Analyzer (Applied Biosystems). Sequence fragments were assembled using ChromasPro (www.technelysium.com.au/chromas.html) and edited manually to obtain a consensus sequence. The B. tabaci putative species for each sample was initially assigned by homology determination using BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi), and then by phylogenetic analysis of the mtCOI sequences using ClustalW alignments of each sequence (Boykin et al., 2007; Brown, 2010; Dinsdale et al., 2010).

141 4.2.4 Phylogenetic analysis

In addition to sequences obtained in the present study, mtCOI sequences of B. tabaci from Genbank were selected to represent major geographical regions (Dinsdale et al., 2010) and included in the analyses. Outgroups included in the alignment were B. afer (GU220055) and B. subdecipiens (GU220056). The mtCOI sequences were aligned using MUSCLE implemented in CLC Sequence Viewer 6.5 (Edgar, 2004). The portion (634 bp) of the B. tabaci mtCOI gene sequence (AY521259) used in this analysis is located between nucleotide 806 and 1439 (Thao et al., 2004). The optimal nucleotide substitution model determined by MrModeltest 2.3 (Nylander 2004) and PAUP 4.0b10 were used for phylogenetic reconstruction (GTR+I+G). Phylogenetic analysis was performed using MrBayes 3.1.2 (Ronquist & Huelsenbeck, 2003). The Markov chain Monte Carlo analyses were run in four independent analyses with one cold and three heated chains with 10 million generations each. Chains were sampled every 500 generations. To assess the mixing, convergence and a suitable burn-in for the chains we used Tracer 1.5 (Rambaut & Drummond, 2007). Burn-in was set to 1 million and the trees represent 50% majority rule consensus trees. Node values represent posterior probabilities. The percentages of shared nucleotide identity within and among the major clades based on the mtCOI sequence (634 bp) were determined using Mega 4.1. Genetic distances based on the 634 bp mtCOI sequences were calculated based on the Kimura-2-paramater model using Mega 4.1 (Table 4.2). In this study, the term haplotype was taken to mean a genetically distinct mtCOI sequence or group of genetically related sequences.

4.2.5 mtCOI PCR-RFLP marker

A mtCOI PCR-RFLP method was developed to differentiate between the observed mtCOI haplotypes found in South Africa. A computer simulation was performed to identify polymorphisms in restriction sites for the mtCOI sequence of representative members from the Mediterranean (Q type); Middle East-Asia minor 1 (B type) and the SSAF-1 and SSAF-5 subclade (this study). Selected sequences were aligned and trimmed to 732 bp using Bioedit and restriction fragment pattern determined using DistinctiEnz (www.bioinformatics.org/~docreza/cgi-bin/restriction/DistinctiEnz.pl). BfaI (C/TAG) was selected for use as it generated a clear polymorphism between the B type, Q type and SSAF subclades (SSAF-1 and SSAF-5). Four or more samples per field collection were mtCOI haplotyped using the PCR-RFLP method. The same PCR reaction and conditions as described above were used. The amplified mtCOI PCR product (10 µl) was digested with BfaI (Fermentas) (2.5 U) at 37 °C for 1 h. The fragments were visualized in a 2%

142 agarose gel using Gelgreen (Anatech). Reference B and Q type provided by Prof H. Czosnek were included as controls.

4.3 Results

4.3.1 mtCOI sequences and analysis

A total number of 384 Bemisia tabaci samples were collected during 2002 to 2009 from various host plants throughout South Africa (Table 4.1). The 74 mtCOI sequences (Genbank JN104702 - JN104726), representative of samples per collection were blasted to determine the mtCOI haplotype of each collection and are represented in the phylogenetic trees depicted in this study. The Bayesian trees (Figure 4.2) grouped the South African and reference mtCOI haplotypes into 3 of the 11 major phylogeographic clades reported by Boykin et al. (2007) and Dinsdale et al. (2010). The South African haplotypes, grouped either in the Middle East-Asia minor 1, Mediterranean or the SSAF clades (Figure 4.2).

Table 4.2 Mean distance estimates calculated using Kimura-two parameter method. Along the diagonal is the genetic distance among the haplotype within each clade. Population* % Middle Mediterranean Sub-Saharan Africa shared East nt id # Asia Minor 1 I 2 3 4 5 Middle East 96-99 -0.004 Asia Minor 1 (19) Mediterranean 97-99 0.053 -0.01 (18) SubSahAf 1 97-99 0.167 0.177 -0.014 (n=12) SubSahAf 2 97-99 0.173 0.181 0.082 -0.014 (n=4) SubSahAf 3 n/c 0.168 0.178 0.075 0.065 (n/c) (n=1) SubSahAf 4 99 0.176 0.181 0.091 0.075 0.071 -0.01 (n=4) SubSahAf 5 99 0.174 0.179 0.061 0.081 0.067 0.081 -0.003 (n=6) * The number of haplotype B. tabaci individuals included in each clade for analysis. # The within-clade variation based on the percentage of shared nucleotide identity (nt.id) is also indicated. n/c: Not computable

143

Figure 4.2 Phylogenetic tree estimated using Bayesian inference for Bemisia tabaci mtCOI haplotypes collected in South Africa (JN104702-JN104726) showing their relationship to each other and to reference B. tabaci from representative locations worldwide. Bootstrap results after 1000 replicates are noted at each branch node.

144 The majority of the South African B. tabaci populations from S. lycopersicum, I. batatas and Cucurbita sp. were identified as the B type based on 99% shared nucleotide identity and therefore clustered within the Middle East-Asia minor 1 subclade (Table 4.2 and Figure 4.2). Whitefly collections from greenhouses in the Eastern Cape province (Figure 4.1) grouped with the Spanish Q and other Q-like reference sequences in the Mediterranean subclade, with which they shared 99% nucleotide identity. Whitefly samples collected from cassava plants in Mpumalanga province (Figure 4.1) were most closely related at 97-99% sequence identity (Table 4.2) to subgroup SSAF-1 members, which represent haplotypes previously collected in the southern Africa. Finally, whitefly collections from various vegetable and weed species in North West and Gauteng provinces and from cassava plants in Mpumalanga province (Figure 4.1), formed a distinct subclade, herein identified as SSAF-5 (Figure 4.2 and 4.3), and represented a new subclade among southern Africa clades. The latter subgroup haplotypes shared 99% nucleotide identity with each other, and 92-94.4% with haplotypes in the other southern Africa subclades (SSAF 1, 2, 3 and 4) (Table 4.2). In addition, the new haplotype was found to colonize tomato, Malva parviflora and Datura stramonium plants in the Gauteng province that were infected with a newly discovered begomovirus that is closely related to ToCSV-[ZA:Ond:98] (at 83% nucleotide identity) (Pietersen et al., 2000, 2008). The new begomovirus show similar symptoms to ToCSV-[ZA:Ond:98] (Esterhuizen et al., 2010).

The nomenclature system used to refer to the SSAF haplotypes by Berry et al. (2004) and De La Rua et al. (2006) and later by Dinsdale et al. (2010) are indicated in the Bayesian phylogenetic tree (Figure 4.3). The African B. tabaci populations grouped into subgroups referred to as SSAF I-V by Berry et al. (2004), and as SSAF I-VI by De La Rua et al. (2006), with the addition of a subclade (VI) containing haplotypes from West Africa (Cameroon) and Spain. The system employed by Boykin et al. (2007) and Dinsdale et al. (2010) grouped the sub-Saharan Africa B. tabaci populations as SSAF 1-4 and Uganda sweet potato, with the exclusion of the haplotypes from Benin (ABA, AF1106930, Frohlich et al., 1999) and Ivory Coast (AY057135, Brown unpublished) and the addition of the distinct sweet potato clade from Uganda (Legg et al., 2002; Maruthi et al., 2004). Herein, the Dinsdale et al. (2010) nomenclature system is followed (SSAF 1-4) (Figure 4.3), with the addition of the new SSAF-5 subclade, that represents a new subclade among previously recognized southern Africa clades. The whitefly samples examined and considered to be indigenous to sub–Saharan Africa, grouped either with the SSAF-1 (n=5) or SSAF-5 (n=11) subclade.

145

Figure 4.3 Phylogenetic tree estimated using Bayesian inference of sub-Saharan Africa Bemisia tabaci mtCOI haplotypes indicating the different classification of subclades as named firstly by Berry et al., (2004) (subclades I – V) and De La Rua et al., (2006) (subclades I – VI) and later by Dinsdale et al., (2010) (subclades 1-4) with the addition of the newly reported subclade SSAF-5 described in this study. Bootstrap results after 1000 replicates are noted at each branch node.

146 4.3.2 Genetic distance analysis

The genetic distance estimates within and among the South African members of B. tabaci based on mtCOI sequence characterization are shown in Table 4.2. The genetic distance among the haplotypes within the Middle East-Asia minor 1 clade (n=19) and Mediterranean clade (n=18) is 0.004 and 0.01 respectively, whereas the genetic distance between these two closely related invasive types is 0.053. The distance among the haplotypes within the 5 different sub-Saharan Africa subclades are 0.014, 0.014, 0.005 and 0.003 respectively for subclades 1 (n=12), 2 (n=4), 4 (n=4) and 5 (n=6). When considering the genetic distance among the 5 subclades, the lowest values were observed between those haplotypes corresponding to subgroup 1 and 5 (0.061) and subgroup 2 and 3 (0.065) and the highest value between subgroup 1 and 4 (0.091).

4.3.3 mtCOI PCR-RFLP analysis

A PCR-RFLP method was developed based on the mtCOI gene sequence, to distinguish the genotypic clusters present in South Africa. The PCR-RFLP employed the mtCOI C1-J- 2195 and TL2-N-3014 primers to amplify the 850 bp mtCOI fragment, followed by digestion with BfaI that enables differentiation of the B, Q, SSAF-1 and SSAF-5 haplotypes by yielding different sized products (Figure 4.4). The PCR-RFLP analysis of B and Q types yielded a distinctive restriction fragment of ~500 bp and ~700 bp respectively, and a unique RFLP pattern for both the SSAF-1 and SSAF-5 with distinctive restriction fragments of ~200, ~190 and ~100 bp (Figure 4.4). Identification of 384 whitefly samples from different South African locations using the PCR-RFLP method, grouped individuals into the Middle East-Asia minor 1 clade (B type), Mediterranean (Q type), SSAF-1 and SSAF-5 subclades, yielding results that were consistent with mtCOI sequence-based identification.

147 Figure 4.4 PCR-RFLP profile of mtCOI amplicon (879bp) (uncut, Lane 1) using the universal COI primers sequence C1-J-2195 and TL2-N-3014 and digested with BfaI (digested, Lane 2-13). Lane 2: B type control; lane 3, Q type control; lane 4, native SSAF-1 from South Africa; lane 5, native SSAF-5 from South Africa; Lane 6-14, samples of B. tabaci populations from various locations in South Africa (lane 6-8 samples from Limpopo province (B type); lane 9-11 samples from East-London (Q type), Eastern Cape and; lane 12-14 samples from Gauteng and Mpumalanga (SSAF 1 and 5) and lane 14, 50bp DNA Ladder (Fermentas).

4.4 Discussion

In a survey between 2002 - 2009, we elucided B. tabaci whitefly haplotype diversity in eight provinces in South Africa on several host plant species, using mtCOI sequences and a PCR-RFLP method which distinguished between the B type, Q type and SSAF subclades (SSAF-1 and SSAF-5) (Figure 4.4). The survey consisted of two specific detailed studies on cassava and tomato hosts, respectively, that were undertaken from 2004-2009. Whitefly samples collected in 2002 from unknown hosts in several locales (Table 4.1) were also included for identification to broaden the sample base. The B. tabaci collected in South Africa clustered into the Middle East-Asia minor 1 comprising of B. tabaci endemic to the Middle Eastern / North African region consisting of the B type. The B type (Middle East-Asia minor 1 clade) was first reported in 1992 from South Africa on potato (Bedford et al., 1994), and was later associated with the outbreak of a newly described begomovirus (Geminiviridae), ToCSV, that emerged in 1997 (Pietersen et al., 2002, 2008). The most widely prevalent haplotype was the B type that shared 99% identify with the mtCOI sequences for other Middle East-Asia minor 1 members, irrespective of the extant geographical sites of collection. The results of this study demonstrated that the B type, is currently widely established in 5 of the 8 provinces explored in this study. Interestingly, the results indicated that the B type has not yet

148 become established in Gauteng and North West province, even though vegetables are produced in that region. The exotic Q type within the Mediterranean clade endemic to the Mediterranean and the Arabian Peninsula was also identified (Frohlich et al., 1999; Guirao et al., 1997). This is the first report of the Q type in South Africa. Indigenous B. tabaci clustered in the sub-Saharan Africa (SSAF) clade in two subgroups namely SSAF 1 and a new haplotype (SSAF-5) presumed to be endemic to South Africa.

Given the global occurrence of the Q type mainly through ornamental trade, the identification of the Q type in South Africa is perhaps not unexpected. The mtCOI sequences for the Q type from this study were highly invariant, at 99-100% shared nucleotide identity (Table 4.2), indicating high homogeneity and therefore could have originated from a single introduction. The identification of the Q type in East London in 2009 is the first report of the exotic Q type in South Africa and poses a new threat to agriculture production throughout South Africa. The Q, like the B type, transmits ToCSV to tomatoes (Esterhuizen et al., 2010) and since the first detection of the Q type in the Eastern Cape in 2009, it has also been detected in vegetable production regions in Mozambique (Rey & Nuaila, personal communication). We therefore expect that the Q type, similar to the B type, has already spread to other regions, possibly through the movement of ornamental hosts and vegetable seedlings infested with B. tabaci. Wider geographical sampling, and inclusion of more host plants in future, will provide useful information on the spread and distribution of this Q type. Given the current wide scale use of neonicotinoids and pyrethroids to manage B. tabaci in tomato-producing regions in South Africa, the differential susceptibility of the invasive B and Q types to these compounds is expected to ensure the survival and spread of the latter (Dennehy et al., 2006; Horowitz et al., 2003, 2005; Nauen & Denholm, 2005; Prabhaker et al., 2005; Chu et al., 2010a, b; Luo et al., 2010). Further spread and establishment of the Q type in the major tomato producing regions in South Africa could lead to difficulties controlling the Q type, and therefore also to the increased incidence and damage caused by ToCSV infection of tomato crops.

Whitefly samples collected from cassava plants in Mpumalanga province (Figure 4.1) were most closely related at 97-99% sequence identity to subclade SSAF-1 members, which were previously collected in Africa. The SSAF-1 subclade, with B. tabaci collections from 8 African countries, is the largest and most widely established haplotype associated with cassava in Africa. Bemisia tabaci collections from vegetable- and weed species from the Gauteng and North Western province, as well as from cassava in Mpumalanga, clustered in a separate subclade, herein identified as SSAF-5. The assignment of this new putative cryptic species is supported by the 5.6-6.5% divergence between subclade SSAF-5 and its closest sister clade, SSAF-1, in accordance with the 3.5% pairwise

149 genetic divergence identified by Dinsdale et al. (2010) as being the boundary separating different species (Table 4.2). This is the first report of this subclade in the sub-Saharan Africa, which is robustly supported at a bootstrap value of 100% (Figure 4.2).

Although B. tabaci is primarily a polyphagous ‘species’, evidence exists for host specialization in certain B. tabaci populations including the monophagous JAT-PR type on Jatropa gossypifolia (Brown & Bird, 1992), the T type colonizing Euphorbia characias (Simon et al., 2003) and the cassava colonizing B. tabaci from sub-Saharan Africa (Burban et al., 1992; Legg, 1996; Legg et al., 2002; Abdullahi et al., 2003; Sseruwagi et al., 2005, 2006). Despite reports that some members of the SSAF 1-5 subclades prefer cassava (indicated as ‘cassava-associated’), recent studies have suggested that haplotypes within the SSAF have a broader host distribution (Legg, 1994; Thompson, 2003; Sseruwagi et al., 2005, 2006). Sseruwagi et al. (2006) found that cassava- associated SSAF-1 whiteflies also colonize M. glaziovii (tree cassava), J. gossypifolia (jatropa), Abelmoschus esculentus (okra) and E. heterophylla (Mexican fireplant). In our study, the SSAF-1 haplotype was only collected in Mpumalanga province where cassava is grown. The SSAF-5 haplotype occurred with SSAF-1 in Mpumulanga and individually in the bordering provinces of Gauteng and North West (Figure 4.1 and Table 4.1) The subclade SSAF-5 consists of broadly polyphagous individuals collected on cassava in Mpumalanga and non-cassava species in Gauteng and North West province (since cassava is not cultivated in Gauteng and North West provinces). SSAF-5 has a broader host distribution that includes cassava and other host plants suggesting that adaptation is necessary for local haplotypes to survive in some regions, apparently reflecting dependency, in part, on host plant availability.

Bosco et al. (2006) and Sartor et al. (2008) described an mtCOI PCR-RFLP diagnostic tool using Tru9I restriction enzyme to differentiate 5 haplotypes belonging to different clades. The same PCR product was employed in this study to develop a PCR-RFLP using BfaI restriction enzyme to rapidly distinguish between the native and introduced haplotypes present in South Africa. The PCR-RFLP results were in agreement with mtCOI sequence results, and facilitated differentiation between members of the Middle East-Asia minor 1 (B type), Mediterranean clade (Q type), SSAF-1 and SSAF-5 subclade (Figure 4.4). This method was developed to allow rapid differentiation between the invasive B and Q types from the indigenous sub-Saharan Africa clade, as members of SSAF-1 and SSAF-5 subclade produce a similar restriction fragments. The advantage of this approach is that it allows rapid identification of a large number of specimens without the added cost and time required to sequence the mtCOI fragment and will aid in studies to monitor haplotype distribution, insecticide resistance and begomovirus outbreaks.

150 The results of this study have provided new evidence regarding the B. tabaci types present in the country during the study period. Several distinct endemic and introduced haplotypes of B. tabaci co-existing in South Africa were identified. The identification of the cassava-associated SSAF-1 and the more polyphagous SSAF-5 haplotypes provide evidence for the occurrence of two phenotypes among haplotypes that group in the SSAF clade. In addition, two other haplotypes belonging to the major Middle East-Asia minor 1 and Mediterranean clades were identified, and include the B type and Q type. The B type has been identified previously in South Africa, however, our results show that it has become established there and is more widespread than previously known. The exotic Q type, which is endemic to Spain and known to be distributed nearly worldwide, was not previously identified in South Africa. The continued monitoring of B. tabaci haplotype distribution in southern Africa, together with studies to elucidate key phenotypic characteristics of these two endemic B. tabaci haplotypes, particularly in relation to host range, insecticide resistance and gene flow between one another and the non-native B and Q types, will be crucial to designing sustainable approaches for the management of B. tabaci as a pest and vector of plant viruses in South African agriculture.

151 4.5 References

Abdullahi, I., Winterm S., Atirim G.I. & Thottappillym G. (2003) Molecular characterization of whitefly, Bemisia tabaci (Hemiptera: Aleyrodidae) populations infesting cassava. Bulletin of Entomological Research 93:97-106.

Bayhan, E., Ulusoy, M. & Brown, J. (2006) Host range, distribution, and natural enemies of Bemisia tabaci `B biotype' (Hemiptera: Aleyrodidae) in Turkey. Journal of Pest Science 79:233-240.

Bedford, I.D., Briddon, R., Brown, J.K., Rosell, R.C. & Markham, P.G. (1994) Geminivirus- transmission and biological characterisation of Bemisia tabaci (Gennadius) biotypes from different geographic regions. Annals of the Entomological Society of America 125:311- 325.

Berry, S.D., Fongdong, V.N., Rey, M.E.C., Rogan, D., Fauquet, C. & Brown, J.K. (2004) Molecular evidence for five distinct Bemisia tabaci (Homoptera: Aleyrodidae) geographic haplotypes associated with cassava plants in sub-Saharan Africa. Annals of Entomology Society of America 97:852-859.

Bethke, J.A., Byrne, F.J., Hodges, G.S., McKenzie, C.L. & Shatters, R.G., (2009) First record of the Q biotype of the sweetpotato whitefly, Bemisia tabaci, in Guatemala Phytoparasitica 37:61-64.

Bird, J. & Brown, J.K. (1998) Displacement of the Sida race of Bemisia tabaci by the B biotype of the B. tabaci complex in Puerto Rico. In: Proceedings of the second international whitefly and geminivirus workshop, San Juan, Puerto Rico, June 8-12, 1998.

Brown, J.K. (2010) Phylogenetic biology of the Bemisia tabaci sibling species group. In: Bionomics and management of a global pest. Ed. by Stansly PA, Naranjo SE, Springer, Amsterdam, 31-67.

Brown, J.K. & Bird, J. (1992) Whitefly-transmitted geminiviruses in the Americas and the Caribbean basin. Plant Disease 76:220-225.

Brown, J.K., Coats, S.A., Bedford, I.D., Markham, P.G., Bird, J. & Frohlich, D.R. (1995a) Characterization and distribution of esterase electromorphs in the whitefly, Bemisia tabaci (Genn.) (Homoptera: Aleyrodidae). Biochemical Genetics 33:205-214.

Brown, J.K., Frohlich, D.R. & Rosell, R.C. (1995b) The sweet potato / silverleaf whiteflies: biotypes of Bemisia tabaci Genn., or a species complex? Annual Review of Entomology 40:511-534.

Brown, J.K. & Idris, A.M., (2005) Genetic differentiation of whitefly (Bemisia tabaci) mitochondrial cytochrome oxidase I, and phylogeographic concordance with the coat protein of the plant virus genus Begomovirus. Annals of Entomology Society of America 95:827-837.

152

Bosco, D., Loria, A., Sartor, C. & Cenis, J.L. (2006) PCR-RFLP Identification of Bemisia tabaci biotypes in the Mediterranean basin. Phytoparasitica 34:243-251.

Boykin, L.M., Shatters, R.G., Rosell, R.C., McKenzie, C.L., Bagnall, R.A., De Barro, P.J. & Frohlich, D.R. (2007) Global relationships of Bemisia tabaci (Hemiptera: Aleyrodidae) revealed using Bayesian analysis of mitochondrial COI DNA sequences. Molecular Phylogenetics and Evolution 44:1306-1319.

Byrne, D.N. & Bellows, T.S.J. (1991) Whitefly biology. Annual Review of Entomology 36:431-457.

Burban, C., Fishpool, L.D.C., Fauquet, C., Fargette, D. & Thouvenel, J.C. (1992) Host associated biotypes within West African populations of the whitefly Bemisia tabaci (Genn.) (Aleyrodidae). Journal of Applied Entomology 113:416-423.

Carabalí, A., Bellotti, A.C. & Montoya-Lerma, J. (2010) Biological parameters of Bemisia tabaci (Gennadius) biotype B (Hemiptera: Aleyrodidae) on Jatropha gossypiifolia, commercial (Manihot esculenta) and wild cassava (Manihot flabellifolia and M. carthaginensis) (Euphorbiaceae). Neotropical Entomology 39:562-567.

Campbell, B. (1993) Congruent evolution between whiteflies and their bacterial endosymbionts based on the respective 18S and 16S rDNAs. Current Microbiology 26:129-132.

Costa, H.S. & Brown, J.K. (1991) Variation in biological characteristics and in esterase patterns among populations of Bemisia tabaci (Genn.) and the association of one population with silverleaf symptom development. Entomologia experimentalis et applicata 61:211-219.

Costa, H.S., Brown, J.K., Sivasupramaniam, S. & Bird, J. (1993) Regional distribution, insecticide resistance and reciprocal crosses between the A and B biotypes of Bemisia tabaci. Insect Science and Its Application 14:127-138.

Chu, D., Wan, F.H., Zhang, Y.J. & Brown, J.K. (2010a) Change in the biotype composition of Bemisia tabaci in Shandong province of China from 2005 to 2008. Environmetal Entomology 39:1028-1036.

Chu, D., Zhang, Y.J. & Wan, F.H. (2010b) Cryptic Invasion of the Exotic Bemisia tabaci Biotype Q occurred widespread in Shandong province of China. Florida Entomologist 93:203-207.

153 De Barro, P.J., Trueman, J.W. & Frohlich, D.R. (2005) Bemisia argentifolii is a race of B. tabaci (Hemiptera: Aleyrodidae): the molecular genetic differentiation of B. tabaci populations around the world. Bulletin of Entomological Research 95:193-203.

De Barro, P.J., Liu, S.S., Boykin, L.M. & Dinsdale, A.B. (2011) Bemisia tabaci: A Statement of Species Status. Annual Review of Entomology 56:1-19.

Dennehy, T.J., Degain, B.A., Harpold, V.S., Brown, J.K., Morin, S., Fabrick, J.A., Byrne, F.J. & Nichols, R.L. (2005) New challenges to management of whitefly resistance to insecticides in Arizona. The University of Arizona College of Agricultural and Life Sciences, 2005, Vegetable Report. Available from http://cals.arizona.edu/pubs/crops/az1382/az1382_2.pdf.

Dennehy, T.J., Degain, B.A., Harpold, V.S., Brown, J.K., Byrne, F.J., Morin, S. & Nichols, R.L. (2006) First new world report of Q biotype of Bemisia tabaci (Gennadius) reveals high levels of resistance to insecticides. Resistance Pest Management Newsletter 5: 18-19. Available from http://whalonlab.msu.edu/Newsletter/pdf/15_2.pdf.

De La Rua, P., Simon, B., Cifuentes, D., Martinez-Mora, C. & Cenis, J.L. (2006) New insights into the mitochondrial phylogeny of the whitefly Bemisia tabaci (Hemiptera Aleyrodidae) in Mediterranean basin. Journal of Zoological Systematics and Evolutionary Research 44:25-33.

Dinsdale, L., Cook, C., Riginos, Y., Buckley, M. & De Barro, P.J. (2010) Refined global analysis of Bemisia tabaci (Hemiptera: Sternorrhyncha: Aleyrodoidea: Aleyrodidae) mitochondrial cytochrome oxidase I to identify species level genetic boundaries. Annals of Entomology Society of America 103:196-208.

Edgar, R.C. (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32:1792-1797.

Ellsworth, P.C. & Martinez-Carrillo, J.L. (2001) IPM for Bemisia tabaci: a case study from North America. Crop Protection 20:853-869.

Esterhuizen, L.L., Van Heerden, S.W., Rey, M.E.C. & Van Heerden, H. (2010) Epidemiology and molecular characterization of Tomato curly stunt virus and its insect vector Bemisia tabaci in South Africa. Abstract of the 6th international geminivirus symposium, Guanajuato, Mexico, 7-12 November 2010.

Frohlich, D.R., Torres-Jerez, I.I., Bedford, I.D., Markham, P.G. & Brown, J.K. (1999) A phylogeographical analysis of the Bemisia tabaci species complex based on mitochondrial DNA markers. Molecular Ecology 8:1683-1691.

154

Gill, R. & Brown, J.K. (2010) Systematics of Bemisia and Bemisia relatives: can molecular techniques solve the Bemisia tabaci complex conundrum-a taxonomist’s viewpoint. In: Bionomics and Management of a Global Pest. Ed. by Stansly PA, Naranjo SE, Springer, Amsterdam, 5-29.

Guirao, P., Beitia, F. & Cenis, J.L. (1997) Biotype determination in Spanish populations of Bemisia tabaci (Hemiptera: Aleyrodidae). Bulletin of Entomological Research 87:587-593.

Hadjistylli, M., Brown, J.K. & Roderick, G.K. (2010) Tools and recent progress in studying gene flow and population genetics of the Bemisia tabaci sibling species group. In: Bionomics and Management of a Global Pest. Ed. by Stansly PA, Naranjo SE, Springer, Amsterdam, 69-103.

Hill, B.G. (1967) A study of Trialeurodes vaporariorum and Bemisia tabaci on tobacco, with special references to the transmission of the leaf curl disease. M.Sc thesis, University of Pretoria, South Africa.

Hogenhout, S.A., Ammar, E., Whitfield, A.E. & Redinbaugh, M.G. (2008) Insect vector interactions with persistently transmitted viruses. Annual Review of Phytopathology 46:327-359.

Horowitz, A.R., Gorman, K., Ross, G. & Denholm, I. (2003) Inheritance of pyriproxyfen resistance in the whitfly, Bemisia tabaci (Q biotype). Archives of Insect Biochemistry and Physiology 54:177-186.

Horowitz, A.R., Kontsedalov, S., Khasdan, V. & Ishaaya, I. (2005) Biotypes B and Q of Bemisia tabaci and their relevance to neonicotinoid and pyriproxyfen resistance. Archives of Insect Biochemistry and Physiology 58:216-225.

Hu, J., De Barro, P., Zhao, H., Wang, J., Nardi, F. & Liu, S.S. (2011) An extensive field survey combined with a phylogenetic analysis reveals rapid and widespread invasion of two alien whiteflies in China. PLoS ONE 6:e16061. doi:10.1371/ journal.pone.0016061.

Legg, J.P. (1994) Genetic polymorphisms amongst Ugandan populations of Bemisia tabaci (Gennadius) (Homoptera: Aleyrodidae), vector of African cassava mosaic geminivirus. Bioinformatics 34:73-81.

Legg., J.P. (1996) Host-associated strains within Ugandan populations of the whitefly Bemisia tabaci (Genn.) (Hom, Aleyrodidae). Journal of Applied Entomology 120:523-527.

Legg, J.P., French, R., Rogan, D., Okao-Okuja, G. & Brown, J.K. (2002) A distinct Bemisia tabaci (Gennadius) (Hemiptera: Sternorrhyncha: Aleyrodidae) genotype cluster is associated with the epidemic of severe cassava mosaic virus disease in Uganda. Molecular Ecology 11:1219-1229.

155 Lima, L.H.C., Campos, L., Moretzsohn, M.C., Návia, D. & De Oliveira, M.R.V. (2002) Genetic diversity of Bemisia tabaci (Genn.) populations in Brazil revealed by RAPD markers. Genetics and Molecular Biology 25:217-223.

Liu, S.S., De Barro, P.J., Xu, J., Luan, J., Zang, L., Ruan, Y. & Wan, F. (2007) Asymmetric mating interactions drive widespread invasion and displacement in a whitefly. Science 318:1769-1772.

Luo, C., Jones, C.M., Devine, G., Zhang, F., Denholm, I. & Gorman, K. (2010) Insecticide resistance in Bemisia tabaci biotype Q (Hemiptera: Aleyrodidae) from China. Crop Protection 29:429-434.

Maruthi, M.N., Colvin, J., Thwaites, R.M., Banks, G.K., Gibson, G. & Seal, S. (2004) Reproductive incompatibility and cytochrome oxidase I gene sequence variability amongst host-adapted and geographically separate Bemisia tabaci populations (Hemiptera: Aleyrodidae). Systematic Entomology 29:560-568.

McKenzie, C.L., Hodges, G., Osborne, L.S., Byrne, F.J. & Shatters, Jr, R.G. (2009) Distribution of Bemisia tabaci (Hemiptera: Aleyrodidae) biotypes in Florida – investigating the Q invasion. Journal of Economic Entomology 102:670-676.

Moriones, E. & Navas-Castillo, J. (2000) Tomato yellow leaf curl virus, an emerging virus complex causing epidemics worldwide. Virus Research 71:123-134.

Nauen, R. & Denholm, I. (2005) Resistance of insect pests to neonicotinoid insecticides: current status and future prospects. Archives of Insect Biochemistry and Physiology 58:200-215.

Nylander, J.A.A. (2004) MrModeltest v2. Department systematic zoology, Evolutionary Biology/Centre, Uppsala University, Sweden. Available from http://www.abc.se/ ~nylander/mrmodeltest2/mrmodeltest2.html.

Perring, T.M. (2001) The Bemisia tabaci species complex. Crop Protection 20:725–737.

Pietersen, G., Idris, A.M., Krüger, K. & Brown, J.K. (2000) Tomato curly stunt virus, a new begomovirus of tomato within TYLCV-Is cluster in South Africa. Plant Disease 84:810.

Pietersen, G., Idris, A.M., Krüger, K. & Brown, J.K. (2008) Characterization of Tomato curly stunt virus, a new tomato-infecting begomovirus from South Africa. Plant Pathology 57:809-818.

Prabhaker, N., Castle, S., Henneberry, T.J. & Toscano, N.C. (2005) Assessment of cross- resistance potential to neonicotinoid insecticides in Bemisia tabaci (Hemiptera: Aleyrodidae). Bulletin of Entomological Research 95:535-543.

156 Rambaut, A. & Drummond, A.J. (2007) Tracer v1.4, Available from http://beast.bio.ed.ac.uk/Tracer.

Ronquist, F. & Huelsenbeck, J.P. (2003) MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572-1574.

Sartor, C., Demichelis, S., Cenis, J.L., Coulibaly, A.K. & Bosco, D. (2008) Genetic variability of Bemisia tabaci in the Mediterranean and Sahel Regions. Bulletin of Insectology 61:161-162.

Sequeira, R.V. & Naranjo, S.E. (2008) Sampling and management of Bemisia tabaci (Genn.) biotype B in Australian cotton. Crop Protection 27:1262-1268.

Simon, C., Frati, F., Beckenbach, A., Crespi, B., Lui, H. & Flook, P. (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of Entomological Society of America 87:651-701.

Simon, B., Cenis, J.L., Demichelis, S., Rapisarda, C., Caciagli, P. & Bosco, D. (2003) Survey of Bemisia tabaci (Hemiptera: Aleyrodidae) biotypes in Italy with the description of a new biotype (T) from Euphorbia characias. Bulletin of Entomological Research 93:259- 264.

Sseruwagi, P., Rey, M.E.C., Brown, J.K. & Legg, J.P. (2004) The cassava mosaic geminiviruses occurring in Uganda following the 1990s epidemic of severe cassava mosaic disease. Annals of Applied Biology 145:113-121.

Sseruwagi, P., Legg, J.P., Maruthi, M.N., Colvin, J., Rey, M.E.C. & Brown, J.K. (2005) Genetic diversity of Bemisia tabaci (Gennadius)(Hemiptera: Aleyrodidae) populations and presence of the B biotype and non-B biotype that can induce silverleaf symptoms in squash, in Uganda. Annals of Applied Biology 147:253-265.

Sseruwagi, P., Maruthi, M.N., Colvin, J., Rey, M.E.C., Brown, J.K. & Legg, J.P. (2006) Colonization of non-cassava plant species by whiteflies (Bemisia tabaci) in Uganda. Entomologia experimentalis et applicata 119:145-153.

Thao, M.L., Baumann, L. & Baumann, P. (2004) Organization of the mitochondrial genomes of whiteflies, aphids, and psyllids (Hemiptera: Sternorrhyncha). BMC Evolutionary Biology 4:25-33.

Thatcher, J. (1976) Whitefly transmission and etiology of Tobacco leaf curl disease. M. Sc thesis, University of Natal, South Africa.

157

Thompson, W.M.O. (2003) A new host plant species for the cassava biotype of Bemisia tabaci (Gennadius) (Hom., Aleyrodidae). Journal of Applied Entomology 127:374-376.

Varma, A. & Malathi, V.G. (2003) Emerging geminivirus problems: A serious threat to crop production Annals of Applied Biology 142:145-164.

Wang, P., Sun, D., Qiu, B. & Liu, S.S. (2011) The presence of six cryptic species of the whitefly Bemisia tabaci complex in China as revealed by crossing experiments. Insect Science 18:67-77.

Zang, L.S., Chen, W.Q. & Liu, S.S. (2006) Comparison of performance on different host plants between the B biotype and a non-B biotype of Bemisia tabaci from Zhejiang, China. Entomologia experimentalis et applicata 121:221-227.

158 5.0 Screening of Solanum species with pyramided resistance towards Tomato curly stunt virus

CHAPTER 5 Screening of Solanum species with pyramided resistance genes towards Tomato curly stunt virus

Abstract

The tomato curling and stunting disease, caused by Tomato curly stunt virus (ToCSV) and several other begomoviruses, are a severe threat to tomato crops grown throughout South Africa and Mozambique. Host plant resistance is considered to be the best control alternative for this whitefly (Bemisia tabaci) transmitted disease. In this study, two commercial cultivars and thirty-two tomato hybrids with combined resistance from Solanum chilense, S. pimpinellifolium, S. peruvianum and S. habrochaites were assessed for their responses to a severe variant of ToCSV, using whitefly-mediated inoculation. Following infection the accessions were transplanted and evaluated for disease symptom severity (DSI), virus accumulation and yield reduction. The resistance phenotype was also correlated with the presence of known resistance loci (Ty-1, Ty-2, Ty-3, Ty-3a, Ty-4 and Ty-5). None of the accessions were immune, with virus accumulating in all the plants, but various degrees of partial resistance were observed. The two TYLCV resistant commercial varieties currently used in South Africa, Tovistar and Tyler, showed a high (± DSI of 0.5 ±0.35) and moderate (± DSI of 2.4 ±0.01) level of resistance respectively, but lost 31% and 46% of their yield upon infection. Among the hybrids with combined resistance from different wild type progenitors, three hybrids (644, 618 and 643) that showed the highest level of resistance were identified as future breeding sources. The resistance in these accessions expressed as attenuation of leaf curl disease symptoms (DSI 0.8-1.1), delay in time of symptom development, a decrease in viral presence (0- 33%) and a small reduction in yielding ability (14-31%). These hybrids resulted from crosses between S. peruvianum and S. chilense or S. habrochaites and showed a higher level of resistance compared to the corresponding accession with resistance from only one parent. The three hybrids contained a combination of the Ty-1, Ty-3 and Ty-3a resistance introgressions and emphasize the combining ability of the different resistance sources. The results of this study show that, although currently used commercial hybrids with TYLCV resistance reduce the impact of ToSCV infection in South Africa, breeding commercial hybrids with a combined resistance from S. peruvianum, S. chilense and S. habrochaites might enhance virus resistance levels and improve the yielding ability upon

159 infection. The PCR based molecular markers are useful tool that simplify and facilitate rapid selection and combination of these resistance loci in a marker-directed phenotyping approach.

160 5.1 Introduction

Tomato belongs to the Solanaceae family which includes the cultivated tomato, Solanum lycopersicum L. (formerly Lycopersicon esculentum Miller), and more than 10 related wild species (Foolad, 2007; Diez & Nuez; 2008). Tomato production worldwide is under the constant threat of Begomoviruses (family Geminiviridae) transmitted by the whitefly Bemisia tabaci cryptic species complex (De Barro et al., 2011). Tomato-infecting begomoviruses comprise a complex of about 60 monopartite and bipartite viruses. They all induce a severe tomato disease characterized by yellowing and cupping of apex leaves and stunted plant growth coupled with significant yield losses (Fauquet et al., 2000; Jones, 2003). During the last three decades, begomoviruses have emerged worldwide following the spread of their insect vector and have become one of the major constraints to tomato production (Polston & Anderson, 1997; Lapidot & Friedmann, 2002).

Tomato production in South Africa is severely limited by the presence of Tomato curly stunt virus (ToCSV), a monopartite begomovirus transmitted by B. tabaci (Gennadius) type B (Pietersen et al., 2008). In recent years, an increase in the incidence of begomovirus diseases has been observed in most of the tomato production regions throughout the country, with severe yield and quality losses. Since first reported in 1997 (Pietersen et al., 2000) in Mpumalanga province, ToCSV along with its whitefly vector has spread north- and south-wards and is now prevalent in most of the major tomato producing areas in South Africa (Chapter 2; Chapter 4). In addition, sequence analysis of geographically distinct isolates revealed the presence of more than three provisional new begomovirus species (Chapter 2). The rapid build-up of whitefly populations in the summer months and the presence of several distinct viral species that coexists in the same geographical area, pose a serious challenge to the management of this disease.

Management of begomovirus-induced diseases is mainly based on the use of insecticides to reduce the vector population. Chemical control methods have only been partially effective and in addition to the deleterious environmental consequences of excessive insecticide applications (Horowitz et al., 2007; Dennehy et al., 2010), the vector has been shown to develop resistance to the insecticides used (Nauen & Denholm, 2005; Dennehy et al., 2010). Cultural practices, including the use of virus-free seedlings, the use of 50- mesh screens and UV-absorbing plastic sheets (Antignus et al., 2001) and implementing a whitefly-host-free period have also been used to reduce infection levels (Salati et al., 2002). These measures however add significantly to production costs. Furthermore, under conditions of high whitefly pressure, none of these control measures are sufficient (Antignus, 2007; Polston & Lapidot, 2007). The most cost effective way to reduce begomovirus spread and to inhibit its deleterious effects is by breeding plants resistant or tolerant to the virus (Lapidot et al., 2001). Genetic resistance in the host plant requires no

161 chemical input and/or plant seclusion, if wide spectrum, durable resistance against begomoviruses can be obtained.

The establishment of a systemic begomoviral infection is mediated by interactions between viral and host proteins (Castillo et al., 2003; 2004; Hanley-Bowdoin et al., 2004; Selth et al., 2005), which interfere with host-cell proliferation (Gutierrez, 2000) and overwhelm host defense mechanisms (Chellappan et al., 2004). It is believed that domestication of tomato from the wild and selection for high yield and good fruit quality has resulted in the loss of part of the gene networks that respond to biochemical triggers induced by virus inoculation, including many of the alleles conferring begomovirus resistance (Foolad, 2007). Considerable effort has therefore been made to identify resistance genes to begomoviruses through extensive screening of germplasm from cultivated and wild Solanum species. Most of the work accomplished to date has focused on resistance to the monopartite begomovirus, Tomato yellow leaf curl virus (TYLCV) and the bipartite Tomato mottle virus (ToMoV) (Scott & Schuster, 1991; Scott et al., 1995; Griffiths & Scott, 2001; Scott, 2001). Quantitative trail loci (QTL) controlling resistance to TYLCV have since been identified and introgressed from several wild type genetic backgrounds including: S. chilense (Zamir et al., 1994; Scott et al., 1995), S. peruvianum (Lapidot et al., 1997; Friedmann et al., 1998; Vidavsky & Czosnek, 1998), S. pimpinellifolium (Vidavsky et al., 1998), S. habrochaites (Vidavsky & Czosnek, 1998; Hanson et al., 2000; Vidavski, 2007) and S. cheesmaniae (Pico et al., 1996; Ji et al., 2007a). The inheritance of the QTL controlling TYLCV resistance originating from nearly all of the above mentioned wild species has been characterized using classical genetic methodologies. In most cases the sources of TYLCV resistance appeared to be controlled by multiple genes (Pico et al., 1999; Anbinder et al., 2009). Some of the resistance introgressions have also been mapped to the tomato genome and is identifiable with polymorphic DNA markers. Currently, five different begomovirus resistance loci (Ty-1 through Ty-5) from different wild tomato accessions have been identified (Zamir et al., 1994; Chague et al., 1997; Agrama & Scott, 2006; Ji et al., 2007a; Anbinder et al., 2009; Ji et al., 2009).

Variable levels of resistance were localized in the different wild type Solanum species (Ji et al., 2007b) and a number of commercial cultivars with adequate resistance have since been released (Lapidot & Friedmann, 2002). Upon infection, their yields are far higher than those of susceptible cultivars and disease symptoms are absent or very mild. However, in all the reported breeding programs, resistance were introgressed from a single wild tomato species at a time and the lines show different behavior in response to different virus species (Ji et al., 2007b). Most lines bred for TYLCV resistance have been susceptible to bipartite viruses such as ToMoV (Ji et al., 2007a) and the bipartite

162 begomoviruses complex present in Brazil (García-Cano et al., 2008). Given the diversity of geminiviruses worldwide and regionally within South Africa, the breeding of cultivars with stable, broad spectrum resistance poses a great challenge to tomato breeders. It has been proposed that combining multiple resistance genes from different origins will improve the degree of resistance and will broaden the resistance against a wider range of begomoviruses. Indeed, in a F1 diallele analysis, Vidavski et al. (2008) crossed TYLCV- resistant lines that originated from different wild tomato progenitors and reported that several of these Ty resistance genes were complementary and, in some cases, resulted in hybrid plants displaying higher TYLCV resistance compared with their parental lines. The future stability and durability of a viral resistance will therefore strongly depend on the use of multiple resistance genes with different mechanisms to control a range of disease- associated viruses. This will also prevent the selection of recombinant viral strains which could eventually result in resistance breaking (Seal et al., 2006; García-Andrés et al., 2009).

In this study, breeding lines partially resistant to TYLCV were evaluated for their resistance against the monopartite begomovirus, ToCSV. Thirty-two tomato hybrids with resistance pyramided from four different wild tomato species (S. chilense, S. pimpinellifolium, S. peruvianum and S. habrochaites) and two commercial cultivars were assessed for their responses to ToCSV infection using whitefly-mediated inoculation.

5.2 Materials and methods

5.2.1 Virus and whitefly maintenance

The ToCSV isolate used in inoculations was collected from an infected tomato plant in Mooketsi, South Africa (clonal isolate of ToCSV-[ZA:Mks30:08], severe variant, Chapter 3). The viral isolate was maintained in tomato plants (S. lycopersicum cv. ‘Florida Lanai’) in whitefly-proof cages and propagated by whitefly-mediated transmission. Whitefly colonies consisted of B. tabaci type B originated from nymphs that were collected on S. lycopersicum in Trichardtsdal. The specific B. tabaci cryptic species was determined using the mitochondria cytochrome oxidase marker (mtCOI) (Chapter 4). Insects were reared in a growth chamber (14 h light / 10 h night photoperiod, 26 ± 2 °C, 50% relative humidity) on tomato (Florida Lanai) in 50-mesh net-covered cages.

163 5.2.2 Plant material

Seeds of two TYLCV resistant commercial tomato cultivars currently used by farmers in South Africa (Tovistar (Siegers Seed Co.) and Tyler (Hazera Seeds Inc)), 35 hybrids with resistance to TYLCV and one susceptible control cv. ‘Rooikhaki’ previously reported to be ToCSV susceptible (Pietersen & Smith, 2002), were obtained. The 35 hybrids were provided by H. Czosnek (Institute of Plant Sciences and Genetics, Hebrew University of Jerusalem, Israel) and F. Vidavski. (Tomatech R&D Israel). They were produced using eight well characterized determinate inbred lines; seven resistant and one susceptible to TYLCV as parents, and crossed in all combinations (Table 5.1) (Vidavski et al., 2008) These were not limited to those having acceptable agronomic traits and included plants with different sized and shaped fruits.

5.2.3 Viral transmission efficiency

In order to screen plant material for ToCSV resistance, a controlled whitefly-mediated inoculation protocol was developed and the optimal number of whiteflies needed to ensure 100% infection was determined. Non-viruliferous whiteflies were caged on infected tomatoes (ToCSV-[ZA:Mks30:08] infected Florida Lanai variety plants) for 24 h acquisition access period (AAP). Following the acquisition feeding period, a single whitefly or groups of 3, 5, 10 and 20 whiteflies were transferred to a single healthy tomato seedling (5 replicates for each number of whiteflies) and given a 24 h inoculation feeding period. Whiteflies were caged in a plastic cylinders (diametre: 10 cm, height: 20 cm) containing one plant at the two-leaf stage (18 days after sowing, DAS). The cylinder lid had a square opening covered by 50 mesh netting to allow evaporation and airflow. A piece of filter paper was placed within each cylinder to absorb extra humidity. AAPs and inoculation access periods (IAPs) of 24 h were used based on previous studies showing that 24 h is sufficient to transmit the related begomovirus, TYLCV (Picó et al., 1998; Czosnek et al., 2001). At the end of the IAP, whiteflies were removed manually and plants treated with the systemic pesticide imidacloprid (Confidor®, Bayer) and placed into an insect proof cage. Viral infection was confirmed 21 days post inoculation (DPI) by a squash blot assay (Navot et al., 1989).

5.2.4 Whitefly-mediated inoculation

For each trial, 20 seeds of each variety were sown in individual cells of 200-cell seedling trays in randomized block design. A susceptible tomato cultivar, Rooikhaki, was also

164 included to determine the infection efficiency. All experiments were conducted in 50 mesh net-covered wooden cages housed within a growth chamber (14 h/10 h photoperiod, 26 ± 2 °C, 50% relative humidity). The 18-day-old seedlings were place in an insect proof-cage containing virifulerous whiteflies and were provided a 72 h IAP.

To ensure 100% infection, inoculation was performed at a density of about 30-50 whiteflies per plant (Lapidot et al., 1997). The seedlings were disturbed daily by hand to ensure an even distribution of the whiteflies on all seedlings. Control, mock-inoculated seedlings of the same varieties was exposed to virus-free whiteflies for similar IAP. Thereafter, whiteflies were killed by treating all seedlings with a systemic insecticide, imidacloprid (Confidor®, Bayer). Viral infection was confirmed by monitoring symptom development and a dot blot assay at 21 and 60 DPI. The experiment was replicated twice, during the summer and autumn seasons in 2008 and 2009. All the seedlings were transplanted 30 DAS in an insect proof greenhouse in paired rows in 8 l planting bags in sawdust and grown hydroponically throughout the summer and early autumn seasons, employing standard pest and disease control spray schemes (insecticides, miticides, and fungicide). A single plant served as a replica, and 10-15 inoculated plants and 4-5 non- inoculated (control) were randomly distributed in the glasshouse. The within-row and between-row spacing were 0.3 and 1.5 m, respectively.

Table 5.1 Parent lines used in the non-reciprocal dialelle set of crossings to produce the 35 F1 hybrids used in this experiment. Parental Source of Fruit size Abbreviation Reference lines resistance (grams) TY-172 S. peruvianum 40-70 72-PER Lapidot et al., (1997); Friedmann et al., (1998) TY-197 S. peruvianum 40-70 97-PER Lapidot et al., (1997) H-902 S. habrochaites 100-120 HAB Vidavski & Czosnek (1998) GF3 S. habrochaites GF3 - HABGF3 Vidavski (unpublished) TY-52 S. chilense (LA1969) 40-60 52-CHIL Zamir et al., (1994) Fla-595-2 S. chilense (LA2779) 100-120 CHIL-GS9 Griffiths & Scott (2001) PIMHIR S. pimpinellifolium 40-60 PIM Laterrot (1992)

B-117 S. lycopersicum 150 SUS Vidavski (unpublished)

165 5.2.5 Detection of viral DNA via squash or dot-blot analysis

Plants inoculated with viruliferous whiteflies were tested for ToCSV by squash and dot blot assay 21 DPI, to confirm infection (Rodríguez et al., 2003) and 60 DPI to monitor disease progression. For the dot blot assay, a total of six leaf disks (6 mm in diametre) were removed from the top, middle and bottom leaves of each plant. Genomic DNA was extracted following a modified Dellaporta et al. (1983) extraction method in high- throughput 96-well format using a TissueLyser II bead-milling system (Qiagen) for tissue homogenising. The leaf disk was placed into the 96-well deep well plate (2 ml round deep well plate, Axygen Scientific) containing 3 stainless steel beads (3 mm diametre). A volume of 500 µl extraction buffer (100 mM Tris pH 8, 50mM EDTA, 500mM NaCl, 10 mM beta-mercaptoethanol) was added to each well and homogenized by shaking in the TissueLyser for 6 min at 25 Hz. Following a brief centrifugation (3220 xg for 30 sec), 66 µl 10% SDS was added, vortexed and incubated at 65 °C for 25 min, where after the lysate was centrifuged at 3220 xg (4 °C) for 5 min. A volume of 160 µl 5 M potassium acetate was added to each well and mixed by repeated inversion. The plate was incubated at 4 °C for 10 min and again centrifuged at 3220 xg (4 °C) for 10 min. Approximately 400 μl of cleared lysate was transferred into a new deep well plate and 0.5 volume ice-cold 100% isopropanol (2-propanol) was added for precipitation. The solution was then mixed very gently and centrifuged at 4 °C at 3220 xg for 5 min. Plates were centrifuged at 3220 xg (4 °C) for 10 min, and the resulting DNA pellet was washed twice with 500 µl of 70% ethanol. The pellet was dried at room temperature and resuspended in 110 µl double-distilled water containing 10µl RNase (10 mg/ml; Fermentas). After incubating for 10 min at 37 °C samples were stored at -20 °C until further use. The DNA quality was tested by electrophoresis in 1.0% agarose gels. Healthy tomato plant samples were used as negative controls for hybridization and leaves from infected susceptible plants served as positive controls.

For viral detection, a DIG labelled probe able to detect ToCSV was made with a PCR digoxygenin (DIG) Probe Synthesis Kit (Roche Diagnostics), according to the manufacturer‘s instructions. The amplification reaction was carried out with the following abutting primer set that binds within the ToCSV coat protein (CP) and amplify the full viral genome (~2,7 kbp): Xho-F 5’-GTCTCGAGGTTGTGAAGGCCCATGTAAGATCCAG-3’ and Xho-R 5’-GTCTCGAGGGACATCAGGGCTTCTATACATTCTG-3’. The PCR was performed with ExSel high fidelity DNA polymerase (JMR Holdings) using an Eppendorf thermal cycler. Each PCR was carried out in 25 µl volumes and contained a final

concentration of 1 X reaction buffer containing 2 mM MgSO4, 0.2 mM dNTPs (Bioline), 0.2 µM of each primer, 0.08 U ExSel DNA polymerase and 2-3 µl of total DNA extracted from infected plant material. The cycling conditions were as follows: initial denaturation at 94 °C

166 for 2 min, followed by 35 cycles of denaturation at 94 °C for 20 sec, annealing at 68 °C for 30 sec, extension at 72 °C for 3 min, followed by a final elongation step at 72 °C for 15 min.

For the squash blot assay (Navot et al., 1989), a young leaf from the shoot apex was squashed, in duplicate, onto a positively charged nylon membrane (Hybond N+ Amersham) using the bottom of an Eppendorf tube. For dot blot hybridization assay, DNA samples (7 µl each) were spotted on positively charged nylon membranes as described by Rom et al. (1993). Two positive and negative controls were blotted on each membrane. DNA was cross-linked to the membrane by exposure to ultraviolet light. Hybridization was carried out according to the manufacturer’s instructions (Roche) using the DIG-labeled probe and chemiluminescent detection. Membranes were prehybridized in standard hybridization buffer for 30 min at 68 °C. Subsequent hybridization was done at 68 °C overnight in fresh prehybridization solution containing 20 ng/ml denatured probe. The detection of the membrane was carried out with a DIG Luminescence Detection Kit (Roche) according to manufacturer’s instructions. Four washes, the first two with 2 X SSC (3 M NaCl, 0.3 M sodium citrate, pH 7) at room temperature for 5 min and the second two with 0.5 X SSC (3 M NaCl and 0.3 M sodium citrate, pH 7) were carried out at 68 °C for 15 min. Detection was carried out with 1:100 CSPD chemiluminescent substrate in detection buffer. The membrane was exposed to AGFA CP-BU X-ray film (AGFA) and developed successively with 20% (v/v) development solution (AGFA), 3% (v/v) acetic acid and 20% (v/v) rapid fixer solution (AGFA).

5.2.6 Disease severity scoring

Following inoculation, the ToCSV symptoms were recorded on individual plants for the first time 21 DPI and thereafter on a weekly basis up until termination of the trail at 120 DPI. Symptom severity was evaluated according to the disease severity index (DSI) described before (Friedmann et al., 1998; Lapidot & Friedmann, 2002): 0, no visible symptoms, inoculated plants show same growth and development as non-inoculated plants; 1, slight yellowing of leaflet margins restricted to the apical part of the plant; 2, some yellowing and minor curling of leaflet ends; 3, wide range of leaf yellowing, curling and cupping, the plants showing some levels of reduction in size, yet plants continue to develop; 4, very severe plant stunting and yellowing, pronounced leaf cupping and curling, and plant ceased to grow. In accordance with similar studies by Pico et al. (2001), Lapidot et al. (2006) and Vidavski et al. (2008), where symptom severity scores was reported between 28 and 35 DPI, the average symptoms severity recorded in this study at 36 DPI was used to compare the resistance response between the lines and hybrids. The

167 average symptoms severity for 36, 52 and 73 DPI is also indicated to show the disease progression (Table 5.3).

5.2.7 Greenhouse trail for yield estimation

Following whitefly-mediated inoculation and transplanting into the greenhouse, the different cultivars and hybrids were evaluated for ToCSV-induced yield reduction, which is considered the ultimate test for viral resistance and the most important criteria for growers. The yielding ability of the inoculated plants of each genotype was compared with mock-inoculated control plants of each genotype, which had been exposed to virus-free whiteflies. Fruits were picked in a single harvest 120 DPI, all mature-red and immature green fruits were collected. Total yield (kg) were taken per cultivar, inoculated and non- inoculated and were averaged per trail.

5.2.8 PCR amplification of Ty resistance markers

In an attempt to correlate the observed ToCSV resistance phenotype with the presence of known resistance introgressions from wild type parents, all cultivars and hybrids were screened for the presence of the five major TYLCV resistance loci. This included Ty-1, Ty- 3, Ty-3a and Ty-4 that marks different resistance introgressions from S. chilense accessions (Zamir et al., 1994; Agrama & Scott, 2006; Ji et al., 2007a; 2008), Ty-2 from S. habrochaites (Hanson et al., 2006; Ji et al., 2007b) and Ty-5 from S. peruvianum (Anbinder et al., 2009). The restriction enzymes used for the different cleavage amplified polymorphic sequence (CAPS) and sequence characterized amplified region (SCAR) markers are indicated in Table 5.2. The PCRs were performed with ExSel high fidelity DNA polymerase (JMR Holdings) using an Eppendorf thermal cycler. Each PCR was carried out in 25 µl volumes and contained a final concentration of 1 X reaction buffer with

2 mM MgSO4, 0.2 mM dNTPs (Bioline), 0.2 µM of each primer, 0.08 U ExSel DNA polymerase and 2-3 µl of total DNA extracted from infected plant material. The cycling conditions were as follows: initial denaturation at 94 °C for 3 min, followed by 35 cycles of denaturation at 94 °C for 30 sec, annealing at 55 °C for 60 sec, extension at 72 °C for 60 sec, followed by a final elongation step at 72 °C for 10 min. CAPS based markers (Ty-1 (TG97), Ty-2 and Ty-5; 10 µl PCR product) were digested with TaqI or RsaI (Fermentas) (2.5 U) at 37 °C for 1 h, as indicated in Table 5.2. The PCR fragments for the SCAR and CAPS markers were visualized in a 2.5 % agarose gel stained with ethidium bromide and visualized under UV light. A total of three to four plants per cultivar or hybrid were

168 screened for each resistance marker. The genotypes were scored as homozygous (+), homozygous (-) or heterozygous (±) for each of the markers (Table 5.5).

Table 5.2 CAPS and SCAR markers used to genotype the 35 tomato cultivars and hybrids screened for ToCSV resistance. PCR primers, restriction enzymes and expected band sizes are indicated. Marker Marker Resistance source Restriction Reference source of typea enzyme primers Ty-1 CAPS S. chilense TaqI Zamir et al., (1994)

Ty-2 CAPS S. habrochaites RsaI Hanson et al., (2006)

Ty-3/3a SCAR S. chilense Ji et al., (2007a)

Ty-4 SCAR S. chilense Ji et al., (2008)

Ty-5 CAPS S. peruvianum TaqI Anbinder et al., (2009)

aSCAR: Sequence characterized amplified region; CAPS: Cleaved amplified polymorphic sequence.

5.2.9 Data analysis

To test for significant difference between the trails as well as differences between accessions a non-parametric Mann-Whitney test was performed in both trials on DSI scores obtained at 36, 55 and 75 DPI and total yield parameter. The relative yield losses were determined as a percentage of the yield of the control plants and the significance level of this determined. ToCSV-inoculated plants in which virus could not be detected by dot blot analysis were excluded from the analysis.

5.3 Results

5.3.1 Infection efficiency of vector mediated inoculation

One viruliferous whitefly per plant ensured 20% infection (Figure 5.1). Infection levels of about 50-75% were obtained when susceptible plants were exposed to between 3 and 10 viruliferous whiteflies per plant and 100% when 20 viruliferous whiteflies were used. Based upon the results obtained in this assay, between 20-30 viruliferous whiteflies were used in later screenings for response to ToCSV.

169 The infection efficiency for mass inoculation used in the two ToCSV screenings was determined for the 20 susceptible controls (Rooikhaki) included in each seedling tray and all the resistant cultivars and hybrids, respectively. As a high inoculation pressure was used (20-30 whiteflies per plant), the infection efficiency represented the rate of escape from infection in the two ToCSV mass inoculations. In both inoculations, infection of the susceptible control was much more efficient compared with the wild-derived S. lycopersicum species. In the first and second inoculation, ToCSV was detected by dot blot assay in 98% and 100% of susceptible controls, whereas only 82% and 90% of the resistant cultivars and hybrids showed detectable levels of ToCSV 21DPI. The plants that tested negative in dot blot assay 21 DPI, also tested negative in the dot blot assay 60 DPI and did not show disease symptoms when monitored up until 120 DPI. The absence of detectable viral DNA in ToCSV inoculated plants, as analysed by dot blot at 21DPI, resulted in the removal of the plant from further analysis.

Figure 5.1 Percentage (%) of susceptible tomato plants (cv. ‘Rooikhaki’) with ToCSV DNA as detected by squash blot analysis, after individual cage inoculations with 0, 3, 4, 10 and 20 viruliferous whiteflies per plant.

170 5.3.2 Resistance assessment - detection of viral DNA and monitoring symptom severity

The results of two separate inoculations with ToCSV are summarized in Table 5.3 and 5.4. Since viral DNA was detected 21 DPI in all plant material tested, none of the cultivars or hybrids are immune or resistant to ToCSV. Various degrees of partial resistance, i.e. detectable levels of viral DNA and attenuated symptoms were displayed.

By 21 DPI all susceptible controls (Rooikhaki) had a symptom severity rating of 2 and showed strong hybridization signal, indicating systemic infection by ToCSV. The first symptoms started to appear 13 DPI in the susceptible control and culminated in a disease symptom severity rating of 4 and complete stunting at 36 DPI (Figure 5.2). For the two TYLCV resistant commercial varieties currently used in South Africa, Tovistar showed a high level of resistance (average DSI of 0.5 ±0.35 at 36 DPI), whereas Tyler was intermediately resistant (average DSI of 2.4 ±0.01 at 36 DPI).

There were fundamental differences both in the onset and the degree of symptom development among the different hybrids with combined resistance from different wild type progenitors. Most of the hybrids exhibited a mild to high level of resistance to ToCSV after mass inoculation, even under the high inoculum pressure conditions in which they were assayed. Table 5.3 show the ranking of the cultivars and hybrids according to average DSI scored at 36 DPI. The entries were considered as highly resistant (DSI of 0- 1.5), moderately resistant (DSI of 1.5-2.5) and susceptible (DSI of 2.6-4).

The highest resistance levels (lowest average DSI) were found in the following hybrids: 644, 618, 705, 617, 616, 632, 643, 631, 626, 612, 619, 611, 620, 624 and 625, with an average DSI of between 0.5 ±0.35 and 1.4 ±0.1. They all showed delayed infection and mild symptoms 36 DPI and continued to develop normally, with flowering and fruit setting appearing similar to non-inoculated controls.

A moderate level of resistance, with an average DSI of between 1.6 ± 0.2 to 2.4 ±0.3 and showing minor yellowing and cupping of the apical leaflet margins, was observed in the following cultivars and hybrids: 701, 627, 703, 649, 606, 603, 610, 608, 607, Tyler and 704. Based on phenotypic evaluation, the remaining hybrids (702, 609, 601, 602) were susceptible and developed severe ToCSV symptoms (upper leaf yellowing, reduction in leaflet area, upward curling margins and moderate to severely stunted internodes compared to non-inoculated controls) and had an average symptom severity rating of between 2.5 ± 0.3 to 3.2.

Except for 649 and 610, all the hybrids with combined resistance from two resistant parents showed a higher resistance level to ToCSV than the corresponding hybrid with resistance from only one resistant parent (Table 5.3). Considering the level of resistance (expressed as DSI) of all the cultivars and hybrids, the commercial line, Tovistar showed

171 the highest level of resistance, with an average DSI of 0.5 ± 0.35 (Table 5.3). Among the hybrids, entry 644, 618 and 643, that resulted from a cross between HAB X 72-PER, CHIL-G69 X 97-PER and HAB X 97-PER respectively, showed the highest level of resistance with an average DSI of 0.8 ±0.1, 0.95 ±0.2 and 1.1 ±0.2, respectively (Table 5.3).

5.3.3 Disease progression between 21 and 75 days post inoculation

In order to monitor disease progression, the symptoms severity (DSI scores) for individual plants were recorded for 21, 28, 36, 42, 52, 59 and 73 DPI, and the inoculated plants tested for virus by dot blot hybridization analysis 21 and 60 DPI. The plants tested negative in dot blot assay 21 DPI, were considered to have escaped infection, and therefore excluded from further analysis.

Between 28 and 36 DPI, the susceptible variety (Rooikhaki) reached a DSI level of 4 and continued to display severe ToCSV symptoms until termination of the trial. All Rooikhaki plants showed a strong hybridization signal in dot blot analysis 60 DPI. The hybrids considered as susceptible (DSI 2.5-4) reached a maximum DSI score at about 52 DPI, and maintained the DSI value up until 73 DPI (P >0.05) and ToCSV DNA could be detected in between 87-100% of the infected plants in dot blot analysis 60 DPI. The change in disease severity score between 52 and 73 DPI was not significant for these entries (Table 5.3).

In contrast, some of the cultivars and hybrids with high and moderate levels of resistance, showed a delay in the onset of disease symptoms and reached a maximum DSI score at about 52 DPI. After 52 DPI they showed a progressive recovery from ToCSV symptoms, with a slight decrease in the average DSI score up until 73 DPI. In some, the recovery phenotype was accompanied by decrease in detectable viral DNA in dot blot analysis 60 DPI (Table 5.3). For example, Tovistar showed an average decrease of -0.72 in the DSI score between 52 and 73 DPI (P = 0.002), and viral DNA could only be detected in 50% of the infected plants at 60 DPI.

The hybrid with the highest resistance level, 644, showed an average decrease in DSI of - 0.43 (P = 0.038) and viral DNA could only be detected in 33% of the infected plant material at 60 DPI. Similarly, 618, 617 and 643 showed an average disease severity decrease of -0.38 (P = 0.024), -0.73 (P = 0.041) and -0.64 (P = 0.026), and viral DNA could not be detected at 60 DPI.

172 Table 5.3 Tomato curly stunt virus-induced symptom severity and yield reduction of the different cultivars and hybrids. The tomato accessions are ranked by average mean symptom severity (DSI) indices scored 36 days past inoculation (DPI). The DSI scores for 36, 52 and 75 DPI, average yield for mock-inoculated and inoculated plants, average yield loss as well as the percentage plants with detectable viral DNA 60 DPI, are indicated.

1 2 3 Detectible viral Cultivar / Hybrid Treatment DSI Average yield Yield loss 4 DNA 60 DPI Code 36 DPI 52 DPI 75 DPI kg/plant % % Tovistar Non-Inoculated 4.7 (0.8) Inoculated 0.5 (0.35) 1.2 0.5(0.1) 3.3 (0.8) 31# 50 P* 0.007 644 Non-Inoculated 3.8 (0.3) HAB X 72-PER Inoculated 0.8 (0.1) 1.35 1 (0.1) 2.9 (0.9) 22# 33 P* 0.115 618 Non-Inoculated 3.7 (0.2) CHILG69 X 97-PER Inoculated 0.95 (0.2) 1.75 1.4 (0.1) 3.2 (0.5) 14 0 P* 0.102 705 Non-Inoculated 4.6 (1.2) HAB X CHIL X PER Inoculated 1 2.2 1.55 2.1±0.7 55# 10 P* 0.004 617 Non-Inoculated 4.6 (0.6) PIM X CHIL-GS9 Inoculated 1 2.15 (0.5) 1.45 2.4 (0.8) 47# 0 P* 0.025 616 Non-Inoculated 3.7 (0.3) PIM X 52-CHIL Inoculated 1 2.2 2.05 (0.2) 2.3 (0.4) 38 55 P* 0.011 632 Non-Inoculated 3.2 (0.3) HABGF3 X 72-PER Inoculated 1.1 (0.1) 2.1 1.75 (0.3) 2.6 (0.5) 18# 72 P* 0.245 643 Non-Inoculated 4.1 (0.3) HAB X 97-PER Inoculated 1.1 (0.2) 2.15 (0.35) 0.95 2.8 (0.1) 31 0 P* 0.064

173 1 2 3 Detectible viral Cultivar / Hybrid Treatment DSI Average yield Yield loss 4 DNA 60 DPI Code 36 DPI 52 DPI 75 DPI kg/plant % % 631 Non-Inoculated 3.9 (0.1) HABGF3 X 97-PER Inoculated 1.2 (0.3) 1.65 0 .9 (0.1) 2.6 (0.5) 33# 22 P* 0.03 626 Non-Inoculated 4.1 (1.0) 52-CHIL X 72-PER Inoculated 1.3 (0.2) 2.3 1.9 (0.4) 2.2 (0.5) 47# 78 P* 0.011 612 Non-Inoculated 2.8 (0.0 PIM X HAB Inoculated 1.3 (0.2) 2.25 (0.3) 1.9 (0.2) 1.6 (0.1) 43# 40 P* 0.025 619 Non-Inoculated 2.7 (0.1) CHILG69 X 72-PER Inoculated 1.4 (0.1) 1.95 (0.2) 1.7 (0.4) 2.0 (0.3) 26# 60 P* 0.004 611 Non-Inoculated 3.4 (0.1) PIM X 72-PER Inoculated 1.4 (0.3) 1.95 (0.4) 1.7 (0.1) 1.9 (0.6) 43* 100 P* 0.02 620 Non-Inoculated 3.3 (0.7) CHILG69 X HAB Inoculated 1.4 (0.4) 1.95 1.15 (0.3) 1.7 (0.5) 49# 14 P* 0.003 624 Non-Inoculated 3.6 (0.1) CHILG69 X 52-CHIL Inoculated 1.4 (0.4) 2 1.55 (0.3) 2.6 (0.8) 28# 20 P* 0.03 625 Non-Inoculated 3.9 (0.6) 52-CHIL X 97-PER Inoculated 1.4 (0.1) 2 (0.28) 1.55 (0.3) 3.1 (0.9) 21# 44 P* 0.066 701 Non-Inoculated 2.6 (0.1 SUS X HAB Inoculated 1.6 (0.2) 2.7 1.95 (0.2) 1.8 (0.6 29# 50 P* 0.128

174 1 2 3 Detectible viral Cultivar / Hybrid Treatment DSI Average yield Yield loss 4 DNA 60 DPI Code 36 DPI 52 DPI 75 DPI kg/plant % % 627 Non-Inoculated 3.5 (0.4) 52-CHIL X HAB Inoculated 1.6 (0.1) 2.1 1.35 (0.4) 1.8 (0.6) 48# 17 P* 0.046 703 Non-Inoculated 3.4 (1.0) SUS X HAB Inoculated 1.6 (0.5) 2.7 2.2 (0.1) 1.9 (0.7) 43# 44 P* 0.014 649 Non-Inoculated 4.1 (0.7) 72-PER X 97-PER Inoculated 1.7 (0.4) 2.85 (0.6) 2.15 (0.2) 2.5 (0.3) 39# 100 P* 0.053 606 Non-Inoculated 2.4 (0.3) SUS X HABGF3 Inoculated 1.87 2.55 (0.6) 1.9 1.2 (0.3) 67# 50 P* 0.053 603 Non-Inoculated 2.5 (0.3 SUS X HAB Inoculated 1.9 2.75 2.4 (0.1) 1.4 (0.3) 44# 50 P* 0.003 610 Non-Inoculated 3.5 (0.9 PIM X 97-PER Inoculated 1.9 2.5 1.9 (0.5) 2.6 (0.8 26# 100 P* 0.047 608 Non-Inoculated 3.5 (0.7 SUS X CHILG69 Inoculated 1.9 2.85 2.75 1.8 (0.5)) 49# 50 P* 0.003 607 Non-Inoculated 3.6 (0.7) SUS X 52-CHIL Inoculated 2.1 (0.2) 3 (0.5) 2.75 (0.9) 1.3 (0.5) 63# 100 P* 0.013 Tyler Non-Inoculated 3.6 (0.1) Inoculated 2.4 2.7 (0.28) 2.1 (0.2) 1.9 (0.4) 46# 50 P* 0.01

175 1 2 3 Detectible viral Cultivar / Hybrid Treatment DSI Average yield Yield loss 4 DNA 60 DPI Code 36 DPI 52 DPI 75 DPI kg/plant % % 704 Non-Inoculated 2.8 (0.5) SUS X HAB Inoculated 2.4 (0.3) 3.25 2.55 1.6 (0.5) 44# 41 P* 0.001 702 Non-Inoculated 3.6 (0.9) SUS X HAB Inoculated 2.5 (0.3) 2.7 2 (0.2) 1.7 (0.6) 51# 11 P* 0.003 609 Non-Inoculated 3.2 (0.1) SUS X PIM Inoculated 2.6 (0.2) 3.35 (0.2) 2.7 (0.1) 0.9 (0.2) 72# 87 P* 0.04 601 Non-Inoculated 3.7 (0.4) SUS X 97-PER Inoculated 3.0 (0.2) 3.5 3.05 (0.4) 1.5 (0.4) 60# 100 P* 0.003 602 Non-Inoculated 3.3 (0.2) SUS X 72-PER Inoculated 3.2 (0.2) 3.65 (0.35) 3.75 1.0 (0.3) 63# 90 P* 0.031 Rooikhaki Non-Inoculated 2.4 (0.6) Inoculated 4 4 4 0 100 100 P* 0

Per genotype, 10-15 plants for inoculation and 4-5 for mock-inoculation were evaluated in each replicate experiment. DSI, disease severity index scored from 0 (no symptoms) to 4 (severe symptoms). 1Tovistar and Tyler represent two TYLCV resistant commercial cultivars currently used in S.A.; Rooikhaki (RK) included as a ToCSV susceptible control. 701 to 704 are F1 hybrids produced by crossing H-902 and B-117; 705 are an F2 hybrid produced by crossing of H-902, S. peruvianum and S. chilense. 2In parenthesis is the standard deviation (SD) based on the average of the two inoculations. 3The relative yield losses determined as a percentage of the yield of the control mock-inoculated plants. 4ToCSV inoculated plants with undetectable levels of viral DNA 21 DPI were excluded from analysis. Percentage of plants indicated with detectable levels of ToCSV DNA 60 DPI. #Average yield (kg) means between trail 1 and trail 2 differ significantly at P < 0.05 when analyzed by Mann-Whitney test. *Average yield (kg) means between inoculated and mock-inoculated differ significantly at P < 0.05 when analyzed by Mann-Whitney test.

176 Table 5.4 Average disease severity scores to Tomato curly stunt virus at 36 days post inoculation of hybrids produced in dialelle crossing*. SUS PIM 52-CHIL CHIL-GS9 HAB HABGF3 72-PER 97-PER 3.0 (0.2) 1.8 1.4 (0.1) 0.95 (0.2) 1.1 (0.2) 1.2 (0.3) 1.7 (0.4)

72-PER 3.2 (0.2) 1.4 (0.3) 1.3 (0.2) 1.4 (0.1) 0.8 (0.1) 1.1 (0.1) HABGF3 1.87 - - - - HAB 1.9 1.3 (0.2) 1.6 (0.1) 1.4 (0.4)

CHIL-GS9 1.9 1 1.4 (0.4)

52-CHIL 2.1 (0.2) 1 PIM 2.6 (0.2)

* Per genotype, 10-15 plants for inoculation were evaluated in each replicate; standard deviation (SD) of means in parenthesis; SD values less than 0.1 not indicated; (-) indicate hybrids not tested due to poor germination.

The change in disease severity score between 52 and 73 DPI was significant for these entries (Table 5.3). However, this correlation was not always valid, because hybrid 626 showed an average decrease of -0.45 in the DSI score between 52 and 73 DPI (P = 0.023) and viral DNA could be detected in 78% of the infected plant material at 60 DPI. Similarly, 611 showed an average decrease of -0.23 in the DSI score between 52 and 73 DPI (P = 0.009) and viral DNA could be detected in 100% of the infected plant material at 60 DPI.

A clear difference in disease progression and evolution of symptom severity was observed for the hybrids with intermediate levels of resistance. Most hybrids showed a peak in symptom severity at 52 DPI followed by a decrease in symptom severity up until 73 DPI. However, only in some of the hybrids the recovery was correlated to decreased detectable viral DNA at 60 DPI. There was also no direct correlation between resistance level, yield loss, detectable viral DNA levels at 60 DPI and recovery.

5.3.4 Resistance assessment – Effect of ToCSV infection on yield

The decrease in yield due to ToCSV infection was determined (Table 5.3). When comparing the yield potential between mock-inoculated cultivars and hybrids, all except 705, showed no significant difference in yield between the two inoculation experiments (P < 0.05; Table 5.3). Of all the resistant varieties tested, Tovistar showed the highest yield potential at 4.7 ± 0.8 kg, followed by 617 (PIM X CHILG69), 626 (52-CHIL x 72-PER) and 626 (HAB X 97-PER), with an average yield of 4.6 ± 0.6 kg, 4.6 ± 1.2 kg and 4.1 ± 1.0 kg, respectively. The highest yield was provided by hybrids when 72-PER or 97-PER was

177

Figure 5.2 Reaction of Solanum lycopersicum (cultivar ‘Rooikhanki’) to whitefly inoculation of Tomato curly stunt virus (30 days post inoculation) in infected plant showing curling and stunting (a) and yellowing and curling of the leaflet margins, and reduced leaflet size (b) compared to symptomless healthy plant of the same age (c and d).

used as a parent, suggesting dominance for yield. In fact, nine of the thirteen top yielding hybrids had 72-PER or 97-PER as one of the parents.

When the average yield loss for the inoculated versus mock-inoculated plants was compared, the infection-related yield losses of cultivars and hybrids were variable. The yield loss in all the entries was significantly lower than the susceptible control that lost100% of its yield due to ToCSV infection. The highly resistant entries (DSI of 0-1.5) lost between 14% and 55% of their yield, the moderately resistant entries (DSI of 1.5-2.5) lost between 26% and 67% and the susceptible entries (DSI of 2.6-4) lost between 63%

178 and 72%. The most resistant accessions (based on the lowest disease severity scores), Tovistar, 644 and 618 were nearly symptomless upon ToCSV infection (with a DSI of 0.5, 0.8 and 0.95), but they lost 31%, 22% and 14% yield due to ToCSV infection, respectively. Furthermore, the highly resistant hybrids, 705, 617 and 616, with a DSI of 1.0 showed a yield reduction of 55%, 47% and 38%, respectively. The average disease-severity score at 36 DPI could not be correlated to yield reduction observed between inoculated and mock-inoculated plants.

A number of the hybrids performed better than the commercial resistant cultivars tested. Tovistar and Tyler produced 31% and 46% of the total yield of their respective mock- inoculated control plants, whereas the top nine hybrids showed a yield reduction of between 14-29 % (Table 5.3). The highest level of resistance, as reflected by the lowest yield reduction induced by ToCSV, was expressed by the hybrid 618, 632 and 625, with an average yield reduction of between 14-18% (Table 5.3).

5.3.5 Resistance assessment – Detection of resistance markers

The cultivars and hybrids were scored as homozygous (+), homozygous (-) or heterozygous (±) for the Ty-1, Ty-2 , Ty-3, Ty-3a and Ty-4 and Ty-5 markers (Table 5.5). None of the cultivars or hybrids tested positive for the Ty-2 or Ty-4 markers that indicate introgression from S. habrochaites and S. chilense (Table 5.5). The Ty-1 marker that indicates the resistance introgression from S. chilense accession LA1969 was present in all the hybrids with 52-CHIL and CHILG69 as one of the parents. The resistance introgression marked by Ty-1 was also present in all the hybrids with S. habrochaites (HAB) as one of the parents, but not in those with S. habrochaites HABGF3 as a parent. All the hybrids with 52-CHIL, CHILG69, HAB and HABGF3 as one of the parents were positive for the presence of the Ty-3 and Ty-3a allele that indicates the resistance introgression from S. chilense accession LA2779 and LA1932, respectively. The hybrids with PIM, 72-PER and 97-PER as one of the parents did not contain the Ty-3 allele but contained the Ty-3a allele. For the hybrids with 72-PER and 97-PER as parent, all except 601, 602, 649, 625, 632 and 643 were heterozygous for the Ty-5 loci. The Ty-5 marker is linked to a recessive resistance introgression characterized from S. peruvianum. The commercial resistant cultivar, Tovistar and Tyler, were heterozygous for the presence of the Ty-1 and Ty-3 introgressions, respectively.

179 Table 5.5 Marker genotype of the different cultivars and hybrids, ranked by mean disease severity indices (DSI) scored 36 days post infection with Tomato curly stunt virus. Cultivar/ Parent Parent DSI2 Resistance marker genotype Hybrid 11 21 Ty-1a Ty-2b Ty-3c Ty-3ad Ty-4e Ty-5f Tovistar 0.5 ± - - - - ± (0.35) 644 Hab 72-PER 0.8 ± - ± ± - ± (0.1) 618 CHIL- 97-PER 0.95 ± - ± ± - ± G69 (0.2) 617 PIM CHIL- 1 + - ± ± - - G69 616 PIM 52-CHIL 1 + - ± ± - - 632 HABGF3 72-PER 1.1 (0.1) - - ± ± - - 643 Hab 97-PER 1.1 ± - ± ± - - (0.2) 631 HABGF3 97-PER 1.2 (0.3) - - ± ± - ±

626 52-CHIL 72-PER 1.3 (0.2) ± - ± ± - ± 612 PIM Hab 1.3 (0.2) + - ± ± - - 619 CHIL- 72-PER 1.4 (0.1) ± - ± ± - ± G69 611 PIM 72-PER 1.4 (0.3) - - - + - ± 620 CHIL- Hab 1.4 (0.4) + - + - - - G69 624 CHIL- 52-CHIL 1.4 (0.4) + - + - - - G69 625 52-CHIL 97-PER 1.4 (0.1) ± - ± ± - - 627 52-CHIL Hab 1.6 (0.1) + - + - - - 649 97-PER 72-PER 1.7 (0.4) - - - + - - 606 SUS HABGF3 1.87 - - ± - - ± 603 SUS Hab 1.9 ± - ± - - - 610 PIM 97-PER 1.8 - - - + - ± 608 SUS CHIL- 1.9 ± - ± - - - G69 607 SUS 52-CHIL 2.1 (0.2) ± - ± - - - Tyler 2.4 - - ± - - - 609 SUS PIM 2.6 (0.2) - - - ± - - 601 SUS 97-PER 3.0 - - - ± - - (0.2) 602 SUS 72-PER 3.2 (0.2) - - - ± - - RK 4 ------

180 1Parents abbreviated as indicated in Table 5.1. 2Results are displayed as average DSI at 36DPI and SD in parenthesis, based on the average of the two inoculations For each of the assayed markers: a +, Homozygous for the S. chilense (LA1969) allele; -, homozygous for the S. lycopersicum allele; ±, heterozygous b +, Homozygous for the S. habrochaites allele; -, homozygous for the S. lycopersicum allele; ±, heterozygous c +, Homozygous for the S. chilense (LA2779) allele; -, homozygous for the S. lycopersicum allele; ±, heterozygous d +, Homozygous for the S. chilense (LA1932) allele; -, homozygous for the S. lycopersicum allele; ±, heterozygous e +, Homozygous for the S. chilense allele; -, homozygous for the S. lycopersicum allele; ±, heterozygous f +, Homozygous for the S. peruvianum allele; -, homozygous for the S. lycopersicum allele; ±, heterozygous

5.4 Discussion

Potential sources of natural resistance to begomoviruses are present in wild types of Solanum (Pico et al., 1996; Morales, 2001). While numerous studies reported resistance against a range of begomoviruses in different regions, only one study analysed the response to ToCSV (Pietersen & Smith, 2002). Here we report on the identification of additional sources of commercially useful resistance to a severe variant of ToCSV and the potential for improved resistance by combining resistance introgression (sources) from multiple sources.

In the ToCSV resistance screening, a heavy inoculation pressure, using between 20 and 30 viruliferous whiteflies per plant were used, as it was found that using 20 or more viruliferous whiteflies ensured 100% infection efficiency. Similar results were obtained by Santana et al. (2001) for TYLCV, where 20 whiteflies were needed to ensure 100% infection. Furthermore, to ensure that none of the plants escaped infection during mass inoculation, the presence or absence of the begomovirus was confirmed using dot blot analysis, and the absence of detectable viral DNA 21 DPI resulted in the removal of the plants from further analysis. Despite the heavy inoculation pressure used, the infection efficiency of the resistance and susceptible sources during mass inoculation varied. In experiment 1 and 2 respectively, 98% and 100% of the susceptible control Rooikhaki tested positive for ToCSV infection, while only 82% and 90% of the resistant cultivars and hybrids tested positive for ToCSV infection. The difference in response between the resistant and susceptible material during mass inoculation might be attributed to the non- preference mechanisms associated with resistance from wild type Solanum species, as shown previously by Pico et al., (1998). The higher infection rate in susceptible versus resistant plant material might therefore indicate the presence of vector resistance in some of the genotypes (Channarayappa et al., 1992, Lapidot et al., 2001; Ji et al., 2007a, Rodríguez-López et al., 2011). This type of resistance can be further studied by graft

181 inoculation with ToCSV and compared to whitefly inoculation (as indicated by Delatte et al. (2006)).

According to Bruening (2006) and Lapidot & Polston (2006) resistance refers to a system in which the plant displays no symptoms or amelioration of symptom development and displays a reduction in virus titer. In this study, visual scoring of symptom severity, yield reduction and viral detection was used as the parameters to differentiate levels of resistance against begomovirus infection (Rom et al., 1993; Lapidot et al., 1997; Picó et al., 1999). All of the resistant material screened was at best partially resistant to ToCSV. Although yields and symptoms were much improved compared with the susceptible cultivar, all the plants accumulate detectable levels of viral DNA (21 PDI) and none of the entries were completely resistant/immune (no symptoms, no virus). The most resistant entry in this study was the commercial TYLCV resistant variety, Tovistar that showed a DSI of 0.5 ±0.35 and viral DNA were detected in 50% of the infected plants at 60 DPI. The most resistant hybrids in this study were 644, 618 and 643, that resulted from a cross between HAB X 72-PER, CHIL-G69 X 97-PER and HAB X 97-PER respectively, with an average DSI of 0.8 ± 0.1, 0.95 ± 0.2 and 1.1 ± 0.2, and ToCSV could be detected in 0- 33% of the plants at 60 DPI. When considering yield reduction as criteria, the three hybrids performed much better than Tovistar, since the three hybrids presented yield loss between 14-31%, compared to the 50% yield loss by Tovistar (Table 5.3). Similar to the findings by Vidavski et al. (2008), the hybrids with the highest level of partial resistance were those with combined resistance from more than one source. Except for 649 and 610, all the hybrids with combined resistance from two resistant parents showed a higher resistance level to ToCSV than the corresponding hybrid with resistance from only one resistant parent. The highest level of resistance was achieved by combining together the resistant line 72-PER (derived from S. peruvianum) and HAB (derived from S. habrochaites). The 72-PER x HAB hybrid (644) showed a DSI of 0.8 ±0.1. Our results thus emphasize the combining ability of the different resistance sources. This was especially evident in the hybrids with resistance from S. pimpinellifolium. All of the hybrids with PIM (S. pimpinellifolium) and another resistant parent (PER, HAB and CHIL) showed higher levels of resistance, despite the fact that crosses between the SUS and PIM or SUS and the other resistant parent, showed much lower levels of resistance. For example, all of the hybrids between PIM and S. chilense-derived resistant lines exhibited milder symptoms (DSI of 1.0) than the hybrids between SUS and either PIM (DSI of 2.6), CHIL-GS9 or 52-CHIL (DSI of 1.9-2.1). The possibility of achieving higher levels of resistance by combining S. chilense- and S. pimpinellifolium-derived resistance has previously been reported by Vidavsky et al. (1998) and De Castro et al. (2007). Our results thus supports the utility of combined resistance, especially resistance derived from

182 S. pimpinellifolium in combination other resistance sources, in increasing the level of resistance to ToCSV.

The ultimate test for viral resistance and the most important criteria for growers are retaining the ability to yield (Lapidot et al., 1997). In this study, the overall yield losses could not be directly correlated with the disease severity. This is in agreement with previous studies where infected plants with mild symptoms suffer a yield reduction similar to plants with more severe symptoms (Ladidot et al., 2006; Vidavsky et al., 2008). For example, the hybrid PIM x CHIL-GS9 (617) with a DSI of 1 suffered a yield loss of 47%, whereas the hybrid PIM x 97 PER (610) with a DSI of 1.9 lost only 26% of its yield. Furthermore, although Tovistar showed the highest resistance in terms of disease severity, a number of the hybrids performed much better in terms of ToCSV-induced yield reduction. Tovistar presented a 33% yield loss, whereas the top nine hybrids showed a yield reduction of between 14% and 29%. It is also worthwhile to consider that ToCSV inoculation in this study was carried out under very high infection pressure conditions at a very early stage in the seedling development. This is far from the field situation in which the grower transplant seedlings only after about 40 days past sowing and chemically controls vector populations. It has been shown that infection 45 days after sowing greatly reduces yield loss to between 0 and 20% in resistant genotypes (Levy & Lapidot, 2008). Most of the hybrids that remained highly resistant under these excessive inoculums levels, provide evidence for the stability of the resistance described here and will therefore be useful under natural inoculum levels.

A number of studies in the past have used decreasing virus accumulation rates in plant tissue as an indicator for resistance (Rom et al., 1993; Lapidot et al., 1997; Pilowsky & Cohen, 2000; Pico et al., 2001) In the present study, the absence of or reduced amounts of detectable viral DNA at 60 DPI could not be used as an indicator or resistance level as there was no clear correlation between symptom severity, yield ability, symptom(s) recovery shown by some lines and the detection of ToCSV DNA at 60 DPI. Some of the highly resistant accessions (Tovistar) showing mild symptoms (DSI of 0.5) still accumulated detectable levels of viral DNA (50%) at 60 DPI, whereas some of the mildly resistant hybrids, such as 627 with a DSI of 1.6, limited viral DNA accumulation and virus could only be detected in 17% of the infected plants at 60DPI. The absence of or reduced amounts of detectable viral DNA at 60 DPI was however an indication of the presence of a virus resistance mechanisms in plant that limit virus accumulation. A number of highly and moderately resistant hybrids, including 618, 617 and 643 showed no detectable viral DNA at 60 DPI, and ToCSV could only be detected in 14-22% of the plants from hybrid 631, 320, 324 and 327 at 60 DPI. The mechanism of resistance in these hybrids is still unknown, but the lower accumulation levels of viral DNA may reflect either a reduction in

183 the capacity of the virus to replicate and/or spread in the infected tissue. Under standard inoculation conditions, the relative accumulation of ToCSV DNA in tomato plants may therefore serve as a reliable tool to complement visual scoring of symptoms severity in the selection of resistant tomato genotypes. The selection of resistant accessions with restricted viral accumulation might serve as valuable sources of resistance that can further reduce virus availability for vectors, and therefore effectively reduce virus incidence and spread (Lapidot et al., 2001).

From the combined results on these hybrids, in this work and the study done by Vidavski et al. (2008), it is clear that the combined resistance genes are complementary, provide broad spectrum resistance and might even have different resistance mechanisms. Furthermore, the previously released Ty (CAPS and SCAR) markers correlated the observed ToCSV resistance phenotype within the hybrids, with the presence of known molecular markers that mark resistance introgressions from S. chilense and S. peruvianum, but not from S. habrochaites. Although different accessions of S. habrochaites were used as parents for some of the hybrids, the presence of the Ty-2 or Ty-4 introgression could not be confirmed in any of the hybrids. The presence of the Ty-1 resistance loci was confirmed in all the hybrids with 52-CHIL, CHIL-G69 and HAB as one of the parents, but not in the hybrids with HABGF3 as the parent. The Ty-1 loci has been used worldwide in many breeding programs for TYLCV resistance and has been reported as the best source of resistance to tomato yellow leaf curl disease complex when compared with resistance found in other wild tomato relatives (Zakay et al., 1991; Pilowsky & Cohen, 2000). In previous studies, the Ty-1 locus was found to be incompletely dominant since resistance in heterozygotes was slightly lower than in homozygotes (Zamir et al., 1994). Similarly, in our experiments, the heterozygous CHIL X SUS cross had more severe symptoms (DSI 1.9-2.1) than homozygous CHIL X CHIL cross (DSI 1.4), supporting the incomplete dominance of the Ty-1 loci. Most of the commercial cultivars resistant to TYLCV used today, such as Boludo and Anastasia (Seminis Vegetable Seeds Iberica) carry the S. chilense Ty-1 introgression (De Castro et al., 2007; Garcia-Cano et al., 2008). Similarly, the commercial resistant cultivar Tovistar was also positive (heterozygous) for the presence of the Ty-1 introgression.

The presence of the Ty-3 resistance loci were also confirmed in all the hybrids with 52- CHIL, CHIL-G69, HAB and HABGF3 as one of the parents. The large S. chilense introgression from LA2779 marked by the Ty-3 marker also contains the Ty-1 introgression and is thought to be genetically linked (Ji et al., 2007a). In this study, the 52- CHIL and CHIL-G69, HAB parent contained both the Ty-1 and Ty-3 introgressions, whereas HABGF3 contains only the Ty-3 introgression. The commercial resistant cultivar, Tyler was also positive for the presence of the Ty-3 loci. The co-dominant SCAR marker

184 Ty-3a, detect the alternative allele from S. chilense LA1932 at the Ty-3 locus (Ji et al., 2007a; Jensen et al., 2007a,b; Maxwell et al., 2007). The presence of the Ty-3a resistance allele was confirmed all the hybrids with PER-97, PER-72 and PIM as one of the parents. Although the use of Ty-3 resistance genes in commercial cultivars has not been reported to date, S. chilense accessions LA1932 and LA2779 have a been found to have high levels of resistance to mono- and bipartite begomoviruses and is currently being used in the tomato breeding program in Florida (Scott & Schuster 1991; Scott et al., 1995; Scott, 2001). The Ty-5 marker has recently been reported to be linked to a major recessive resistance introgression from S. peruvianum. It has also been found to have high levels of resistance to mono- and bipartite begomoviruses and is being used in a tomato breeding program at the Volcani Center in Israel (Mejía et al., 2005; Maxwell et al., 2007; Levy & Lapidot, 2008). In this study, only certain hybrids with S. peruvianum as parent tested as heterozygous for the Ty-5 resistance allele. The contribution of this recessive resistance gene in the heterozygous state to total resistance level is unknown and need to be further evaluated.

The results of this work, regarding evaluation of hybrids with different resistance gene combinations for their effectiveness against ToCSV, have allowed us to select three partially resistant hybrids (644, 618 and 643), with combined resistance from S. chilense, S. habrochaites and S. peruvianum already in the S. lycoperiscum genetic background. The resistance of these sources expressed as attenuation of leaf curl disease symptoms (DSI 0.8-1.1), delay in time of symptom development, a decrease in viral presence (0- 33%) and a small reduction in yielding ability (14-31%). Furthermore, the most resistant hybrids contained a combination of the Ty-1, Ty-3 and Ty-3a resistance introgressions. These hybrids and resistance loci, especially those associated with the Ty-1 and Ty-3/Ty- 3a introgressions, have shown a broad spectrum resistance, being effective in other regions of the world against a number of monopartite and bipartite begomoviruses (Maruthi et al., 2003; Mejia et al., 2005; Bain et al., 2007; Vidavski et al., 2008). These resistance sources could therefore be effective in not only limiting the damage caused by the widely prevalent ToCSV, but also other tomato-infecting begomovirus species recently identified in South Africa. The restricted virus accumulation in these plants might further reduce virus availability for vectors, and therefore effectively reduce virus incidence and spread. These lines are thus base line for the development of commercial hybrids highly resistant to ToCSV with horticultural characteristics appropriate for the South African market. Furthermore, future selection and combination of these resistance loci in a marker-directed phenotyping approach should significantly improve the efficiency of breeding for resistance to begomoviruses in South Africa and may result in cultivars with prolonged resistance. The molecular CAPS and SCAR markers can be used for predicting

185 begomovirus-resistance in a tomato breeding program and will allow breeders to dissect the contributions of each individual resistance loci to begomovirus resistance.

186 5.5 References

Agrama, H. A. & Scott, J. W. (2006) Quantitative trait loci for Tomato yellow leaf curl virus and Tomato mottle virus resistance in tomato. Journal for the American Society for Horticultural Sciences 131:267-272.

Antignus Y. (2007). The management of Tomato yellow leaf curl virus (TYLCV) in greenhouses and the open field, a strategy of manipulation. In: Tomato yellow leaf curl virus disease: Management, molecular biology, breeding for resistance. Ed. by Czosnek, H. Springer, Netherlands, pp 263-278.

Antignus, Y., Nestel, D., Cohen, S. & Lapidot, M. (2001) Ultraviolet-deficient greenhouse environment affects whitefly attraction and flight-behavior. Environmental Entomology 30:394-399.

Bian, X.-Y., Thomas, M. R., Rasheed, M. S., Saeed, M., Hanson, P., De Barro, P. J., & Rezaian, M. A. (2007) A recessive allele (tgr-1) conditioning tomato resistance to geminivirus infection is associated with impaired viral movement. Phytopathology 97:930- 937.

Bruening, G. (2006). Resistance to infection. In: Natural resistance mechanisms of plants to viruses. Ed. by Loebenstein, G. & Carr, J.P. Springer, Netherlands, pp. 211-240.

Castillo, A. G., Collinet, D., Deret, S., Kashoggi, A., & Bejarano, E. R. (2003a) Dual interaction of plant PCNA with geminivirus replication accessory protein (Ren) and viral replication protein (Rep). Virology 312:381-394.

Castillo, A. G., Kong, L. J., Hanley-Bowdoin, L. & Bejarano, E. R. (2004). Interaction between a geminivirus replication protein and the plant sumoylation system. Journal of Virology 78: 2758-2769.

Channarayappa, Muniyappa, V., Schwegler-Berry, D. & Shivashankar, G. (1992) Ultrastructural-changes in tomato infected with tomato leaf curl virus, a whitefly- transmitted geminivirus. Canadian Journal of Botany-Revue Canadienne de Botanique 70:1747-1753.

187 Chellappan, P., Masona, M.V., Vanitharani, R., Taylor, N.J. & Fauquet, C.M. (2004). Broad spectrum resistance to ssDNA viruses associated with transgene-induced gene silencing in cassava. Plant Molecular Biology 56:601-611.

Czosnek, H., Ghanim, H., Morin, S., Rubinstein, G., Fridman, V. & Zeidan, M. (2001) Whiteflies: vectors, and victims (?), of geminiviruses. Advances in Virus Research 56:291- 322.

De Barro, P.J., Liu, S.S., Boykin, L.M. & Dinsdale, A.B. (2011) Bemisia tabaci: A statement of species status. Annual Review of Entomology 56:561-519.

De Castro, A.P., Díez, M. J. & Nuez, F. (2007) Inheritance of Tomato yellow leaf curl virus resistance derived from Solanum pimpinellifolium UPV16991. Plant Disease 91:879-885.

Delatte, H., Holota, H., Reynaud, B. & Dintinger, J. (2006) Characterisation of a quantitative resistance to vector transmission of Tomato yellow leaf curl virus in Lycopersicon pimpinellifolium. European Journal of Plant Pathology 114:245–253.

Dellaporta, S.L., Wood, J. & Hicks, J.B. (1983) A plant DNA minipreparation version II. Plant Molecular Biology Reporter 1:19-21.

Diez, M.J. & Nuez, F. (2008) Tomato. In: Handbook of plant breeding: Vegetables II. Ed. by Prohens, J., Nuez, F & Carena, M.J., Springer, New York. pp. 249-323.

Fauquet, C.M., Maxwell, D.P., Gronenborn, B. & Stanley, J. (2000) Revised proposal for naming geminiviruses. Archives of Virology 145:174-1761.

Foolad, M.R. (2007) Genome mapping and molecular breeding of tomato. International Journal of Plant Genomics 64358:1-52.

188 García-Andres, S., Tomas, D.M., Navas-Castillo, J. & Moriones, E. (2009) Resistance- driven selection of begomoviruses associated with the tomato yellow leaf curl disease. Virus Research 146:66-72.

Griffiths, P.D. & Scott, J.W. (2001) Inheritance and linkage of tomato mottle virus resistance genes derived from Lycopersicon chilense accession LA 1932. Journal for the American Society for Horticultural Sciences 126:462-467.

Gutierrez, C. (2000) Geminiviruses and the plant cell cycle. Plant Molecular Biology 43:763-772.

Hanley-Bowdoin, L., Settlage, S.B. & Robertson, D. (2004) Reprogramming plant gene expression: A prerequisite to geminivirus DNA replication. Molecular Plant Pathology 5:149-156.

Hanson, P.M., Bernacchi, D., Green, S., Tanksley, S.D., Muniyappa, V., Padmaja, S., Chen, H.M., Kuo, G., Fang, D. & Chen, J.T. (2000). Mapping a wild tomato introgression associated with Tomato yellow leaf curl virus resistance in a cultivated tomato line. Journal of the American Society for Horticultural Science 125:15-20.

Hanson, P., Green, S.K. & Kuo, G. (2006) Ty-2, a gene on chromosome 11 conditioning geminivirus resistance in tomato. Tomato Genetics Cooperative Report 56:17-18.

Jensen, K.S., Van Betteray, B., Smeets, J., Ji, Y., Scott, J.W. & Mejia, L. (2007a) Co- dominant SCAR Marker, P6-25, for Detection of the ty-3, Ty-3, and Ty-3a alleles at 25 cM of Chromosome 6 of Tomato. http://www.plantpath.wisc.edu/GeminivirusResistantTomatoes/Markers/MAS- Protocols/Ty3a-allele.pdf.

Jensen, K. S., Martin, C. T. & Maxwell, D. P. (2007b). A CAPS marker, FER-G8, for detection of Ty3 and Ty3a alleles associated with S. chilense introgressions for begomovirus resistance in tomato breeding lines. http://www.plantpath.wisc.edu/GeminivirusResistantTomatoes/Markers/MAS- Protocols/Ty3a-CAPS.pdf.

189 Management, molecular biology, breeding for resistance. Ed. by Czosnek, H. Springer, Netherlands, pp. 343-362.

Ji, Y., Scott, J. W., Maxwell, D. P. & Schuster, D. J. (2008) Ty-4, a Tomato yellow leaf curl virus resistance gene on chromosome 3 of tomato. Tomato Genetics Cooperative Report 58:29-31.

Ji, Y.F., Scott, J.W., Schuster, D.J. & Maxwell, D.P. (2009) Molecular mapping of Ty-4, a new tomato yellow leaf curl virus resistance locus on chromosome 3 of tomato. Journal of the American Society for Horticultural Science 134:281-288.

Jones, D.R. (2003) Plant viruses transmitted by whiteflies. European Journal of Plant Pathology 109:195-219.

Laterrot, H. (1992) Resistance genitors to tomato yellow leaf curl virus (TYLCV). Tomato Leaf Curl Newsletter. 1:2-4.

Lapidot, M. & Friedmann, M. (2002) Breeding for resistance to whitefly-transmitted geminiviruses. Annals of Applied Biology 140:109-127.

Lapidot, M. & Polston, J.E. (2006) Resistance to Tomato yellow leaf curl virus in Tomato. In: Natural Resistance Mechanisms of Plant Viruses. Ed. by Loebenstein, G & Carr J.P. Springer. Netherlands. pp. 503-520.

Levy, D. & Lapidot, M. (2008) Effect of plant age at inoculation on expression of genetic resistance to tomato yellow leaf curl virus. Archives of Virology 153:171-179.

Maruthi, M.N., Czosnek, H., Vidavski, F., Tarba, S.Y., Milo, J., Leviatov, S., Venkatesh, H.M., Padmaja, A.S., Kulkarni, R.S. & Muniyappa, V. (2003) Comparison of resistance to Tomato leaf curl virus (India) and Tomato yellow leaf curl virus (Israel) among Lycopersicon wild species, breeding lines and hybrids. European Journal of Plant Pathology 109:1-11.

190

Maxwell, D.P., Martin, C.T., Garcia, B.E., Salus, M.S., Jensen, K.S, Havey, M.J. & Mejia, L. (2007) Markers for tomato chromosomes. www.plantpath.wisc.edu/Geminivirus ResistantTomatoes.

Morales, F.J. (2001) Conventional breeding for resistance to Bemisia tabaci-transmitted geminiviruses. Crop Protection 20:825-834.

Nauen, R., & Denholm, I. (2005) Resistance of insect pests to neonicotinoid insecticides: current status and future prospects. Archives of Insect Biochemistry and Physiology 58:200-215.

Navot, N., Ber, R. & Czosnek, H. (1989) Rapid detection of tomato yellow leaf curl virus in squashes of plants and insect vectors. Phytopathology 79:562-568.

Pico, B., Díez, M.J. & Nuez, F. (1996) Viral disease causing the greatest economic losses to tomato crop II. The Tomato yellow leaf curl virus: a review. Scientia Horticulturae 67:151-196.

Pico, B., Díez, M.J. & Nuez, F. (1998) Evaluation of whitefly mediated inoculation techniques to screen Lycopersicon esculentum and relatives for resistance to Tomato yellow leaf curl virus. Euphytica 101:259-271.

Pico, B., Ferriol, M., Díez, M.J. & Nuez, F. (1999) Developing tomato breeding lines resistant to tomato yellow leaf curl virus. Plant Breeding 118:537-542.

Pico, B., Ferriol, M., Díez, M. J. & Vinals, F. N. (2001) Agroinoculation methods to screen wild Lycopersicon for resistance to Tomato yellow leaf curl virus. Journal of Plant Pathology 83:215-220.

Pietersen, G., Idris, A. M., Krüger, K. & Brown, J. K. (2000) Tomato curly stunt virus, a new begomovirus of tomato within the Tomato yellow leaf curl virus-Is cluster in South Africa. Plant Disease 84:810.

Pietersen, G. & Smith, M.F. (2002) Tomato yellow leaf curl virus resistant tomatoes show resistance to Tomato curly stunt virus. Plant Disease 86:528-534.

Pietersen, G., Idris, A.M., Kruger, K. & Brown, J.K. (2008) Characterization of Tomato curly stunt virus: A new tomato-infecting begomovirus from South Africa. Plant Pathology 57:809-818.

191 Pilowsky, M., & Cohen, S. (2000) Screening additional wild tomatoes for resistance to the whitefly-borne Tomato yellow leaf curl virus. Acta Physiologiae Plantarum 22:351-353.

Polston, J.E. & Anderson, P.K. (1997) The emergence of whitefly-transmitted geminiviruses in tomato in the western hemisphere. Plant Disease 81:1358-1369.

Rodríguez, R, Ramos, P.L., Doreste, V., Velázquez, K., Peral, R., Fuentes, A. & Pujol, M. (2003) Establishment of a non-radioactive nucleic acid hybridization technique for begomovirus detection. Biotecnología Aplicada 20:164-169.

Rodríguez-López, M.J., Garzo, E., Bonani, J.P., Fereres, A., Fernández-Muñoz, R. & Moriones, E. (2011) Whitefly resistance traits derived from the wild tomato Solanum pimpinellifolium affect the preference and feeding behavior of Bemisia tabaci and reduce the spread of Tomato yellow leaf curl virus. Phytopathology 101:1191-1201.

Rom, M., Antignus, Y., Gidoni, D., Pilowsky, M. & Cohen, S. (1993) Accumulation of Tomato yellow leaf curl virus DNA in tolerant and susceptible tomato lines. Plant Disease 77:253-257.

Santana, F.M., Ribeiro, S.G., Moita, A.W., Moreira, D.J. & Giordano, L.B. (2001) Sources of resistance in Lycopersicon spp. to a bipartite whitefly-transmitted geminivirus from Brazil Euphytica 122:45-51.

Scott, J.W. & Schuster, D.J. (1991) Screening of accessions for resistance to Florida tomato geminivirus. Report Tomato Genetics Cooperative 41:48-50.

Scott, J.W., Stevens, M.R., Barten, J.H.M., Thome, C.R., Polston, J.E., Schuster, D.J. & Serra. C.A. (1995) Introgression of resistance to whitefly transmitted geminiviruses from Lycopersicon chilense to tomato. In: Bemisia: Taxonomy, biology, damage control, and management. Ed. by Gerling D. & Mayer. R.T. Intercept Ltd., Andover, U.K. pp. 357-367.

192 Seal, S.E., Van den Bosch, F. & Jeger, M.J. (2006) Factors influencing begomovirus evolution and their increasing global significance: Implications for sustainable control. Critical Reviews in Plant Sciences 25:23-46.

Selth, L.A., Dogra, S.C., Rasheed, M.S., Healy, H., Randles, J.W. & Rezaian, M.A. (2005) A NAC domain protein interacts with Tomato leaf curl virus replication accessory protein and enhances viral replication. Plant Cell 17:311-325.

Vidavsky, F. & Czosnek, H. (1998) Tomato breeding lines resistant and tolerant to Tomato yellow leaf curl virus issued from Lycopersicon hirsutum. Phytopathology 88:910-914.

Vidavsky, F., Leviatov, S., Milo, J., Rabinowitch, H.D., Kedar, N. & Czosnek, H. (1998) Response of tolerant breeding lines of tomato, Lycopersicon esculentum, originating from three different sources (L. peruvianum, L. pimpinellifolium and L. chilense) to early controlled inoculation by Tomato yellow leaf curl virus (TYLCV). Plant Breeding 117:165- 169. Vidavsky, F. (2007) Exploitation of resistance genes found in wild tomato species to produce resistant cultivar; pile up of resistant genes. In: Tomato yellow leaf curl virus disease: Management, molecular biology, breeding for resistance. Ed. by Czosnek, H. Springer, Dordrecht, The Netherlands, pp. 363-372.

Zakay, Y., Navot, N., Zeidan, M., Kedar, N., Rabinowitch, H., Czosnek, H., & Zamir, D. 1991. Screening of Lycopersicon accessions for resistance to Tomato yellow leaf curl virus: presence of viral DNA and symptom development. Plant Disease 75:279-281.

Zamir, D., Ekstein-Michelson, I., Zakay, Y., Navot, N., Zeidan, M., Sarfatti, M., Eshed, Y., Harel, E., Pleban, T., Vanoss, H., Kedar, N., Rabinowitch, H.D. & Czosnek, H. (1994) Mapping and introgression of a Tomato yellow leaf curl virus tolerance gene, Ty-1. Theoretical and Applied Genetics 88:141.

193 6.0 General Discussion

CHAPTER 6 General discussion

194 Whitefly-transmitted begomoviruses (family Geminiviridae) rank among the most devastating pathogens on a variety of crops, including cassava, cotton, grain legumes and vegetables (Polston & Anderson, 1997; Rybicki & Pietersen, 1999; Morales & Anderson, 2001; Varma & Malathi, 2003; Hanssen et al., 2010; Navas-Castillo et al., 2011). With more than 117 recognized species to date, begomoviruses are considered as emerging plant viruses, whose increasing appearance are linked to the global spread of the more invasive members of their insect vector, Bemisia tabaci (Polston & Anderson, 1997). This necessitates the investigation of the vector/begomovirus/tomato-host pathosystem, specifically aiming to understand vector diversity and the role in promoting viral diversity. The aim of this study was to investigate the South African whitefly vector/begomovirus/tomato-host pathosystem, within this context.

Human activities and modern agricultural practices appear to be the major contributory factors for the increased prevalence of existing begomoviruses or frequent appearance of new begomovirus species/strains around the world. Changing cropping systems that play a pivotal role in promoting virus adaptation include agricultural intensification and diversification, introduction of vulnerable cultivars that are grown in all-year-round mono- cropping systems, international trade in vegetable and horticultural products, as well as the excessive use of chemical control measures (Morales & Anderson, 2001; Anderson et al., 2004; Morales, 2006; Seal et al., 2006b). In addition, new disease epidemics have also been linked to their capability to rapidly evolve via mutation and recombination and their association with other single-stranded replicons, all of which lead to virus diversification (e.g. satellite DNAs) (Polston & Anderson 1997; Rojas et al., 2005; Briddon & Stanley 2006; Seal et al., 2006a, Duffy & Holmes, 2008).

Since the early 1980s, B. tabaci whiteflies have caused escalating problems in agricultural crops and ornamental plants worldwide, leading to an explosion in new haplotype or species identification (Brown, 2010; De Barro et al., 2011). In many cases the whitefly problem only received attention after dramatic increased whitefly populations resulted in increased feeding damage or the outbreak of begomovirus diseases (Polston & Anderson, 1997; Anderson et al., 2004). This phenomenon has later been linked to the invasion of more fecund and polyphagous whitefly types, particularly the invasive B and Q types, in many countries around the world (Varma & Malathi, 2003; Seal et al., 2006a; Hogenhout et al., 2008).

A similar situation has been observed in South Africa, where the presence of the B. tabaci was only documented after the first report of a tobacco leaf curl disease in the 1960s (Hill, 1967; Thatcher, 1976) and cassava mosaic disease in the 1980s (Trench & Martin, 1985). Efforts to identify the B. tabaci halotypes (cryptic species) only came several decades later, when the exotic B. tabaci B type was reported from potato (Solanum

195 tuberosum) in 1992 (Bedford et al., 1994) as well as the cassava colonizing types from sub-Saharan Africa on cassava (Berry et al., 2004). Despite their economic importance, further studies on the identity and distribution of B. tabaci in South Africa have been limited. Chapter 4 describes the results of a survey to investigate the diversity and distribution of B. tabaci haplotypes in eight geographical locations (provinces) in South Africa, from 2002-2009, using the mitochondrial cytochrome oxidase I (mtCOI) sequences. The study revealed the presence of members from two endemic sub-Saharan Africa (SSAF-1 and SSAF-5) haplotypes co-existing with the exotic B and Q type.

SSAF-1 type members are the most widely distributed haplotype associated with cassava (Manihot esculenta) in Africa, and with seven distinct cassava-infecting begomoviruses (Fauquet et al., 2008). In this study, whiteflies belonging to the SSAF-1 haplotype were collected from cassava in only two provinces, where the crop is grown. In Africa, cassava is the second most important staple food crop after maize. However, in South Africa it is mostly grown by small-scale farmers in the KwaZulu-Natal, Limpopo and Mpumalanga provinces as a secondary food choice and/or for sale in the local markets (Daphne, 1980; Berrie et al., 2001), possibly explaining the limited geographical range of the SSAF-1 members. However, the status of cassava cultivation today is changing from subsistence farming to industrialized production, with the growing interest to produce cassava for the production of starch, sago grains, flour, chips, animal feed and biofuel (Thresh, 2006). It is therefore expected that, with increased cassava production, the situation with SSAF-1 type members will be quite dynamic, and will be marked by a population increases accompanied by higher incidences of begomovirus diseases.

A whitefly population with a broader host distribution, collected from cassava as well as non-cassava hosts in South Africa, appeared genetically dissimilar to populations previously described in sub-Saharan Africa. This whitefly type, termed SSAF-5, is thought to be indigenous to the southern Africa region and represent a new subclade among previously recognized SSAF clades. Furthermore, the identification of the SSAF-5 haplotype provide evidence supporting the assumption that, haplotypes within the SSAF clades that were traditionally considered as host specialized or monophagous on cassava (Burban et al., 1992; Legg, 1996; Legg et al., 2002; Abdullahi et al., 2003; Sseruwagi et al., 2005; 2006), might have a broader host distribution. In some regions, adaptation of local haplotypes might have been necessary, reflecting a dependency in part on host plant availability. In addition, the broader host range within the SSAF might lead to further opportunities for interspecific recombination amongst cassava infecting viruses and other mono- and bipartite African begomoviruses, as recently shown for a isolate of African cassava mosaic virus (ACMV) in Burkina Faso (Tiendrébéogo et al., 2012). Such

196 recombination events may promote viral adaptation, further impacting on begomovirus epidemics in the region.

The almost worldwide expansion of the B. tabaci B type since the 1980s, closely followed by the expansion of the Q type over the last decade, are well documented (Brown et al., 1995a,b; Chu et al., 2006; De La Rua et al., 2006; Dennehy et al., 2006; Brown, 2007; Bethke et al., 2009; Mckenzie et al., 2009; Chu et al., 2010a,b; Dennehy et al., 2010; Luo et al., 2010). The successful invasion of these exotic types has been linked to their enhanced capacity for adaptation to different hosts and environments, compared to indigenous haplotypes (Varma & Maluthi, 2003). The B and Q types are far more polyphagous and aggressive in terms of fecundity, readily develop insecticide resistance and have a shorter life cycle, thus reaching very high populations and becoming a plague in a short time (Bedford et al., 1994; Prabhaker et al., 2005; Chu et al., 2006; Dennehy et al., 2006, 2010). The results of this study have shown that the B type is now the most prevalent haplotype in South Africa, found to be widely established in five of the eight provinces explored.

The study also provided the first report of the exotic Q type in South Africa, in the Eastern Cape, a situation that poses a new threat to agriculture production throughout the country. Both the Q and B type are highly fecund, polyphagous and transmit begomoviruses, but have shown differential susceptibility to the neonicotinoids and pyrethroids currently used to manage B. tabaci in producing regions (Dennehy et al., 2006; 2010). If the Q type spreads to other tomato production regions in Southern Africa, it could possibly result in difficulties controlling this whitefly haplotype, and therefore lead to increased incidence and damage by whitefly-transmitted begomoviruses in a variety of susceptible crops. Wider geographical sampling, and inclusion of more host plants in future, will provide useful information on the spread and distribution of this exotic species.

Both indigenous and exotic whitefly types were found to be responsible for transmission of distinct begomovirus species and are contributing to the spread of begomovirus infection in South Africa. However, the relative distribution and proportion of the whitefly types were far from uniform or constant. The B type was found to infest several host plants and predominate over the indigenous haplotypes, but was more dominant on vegetable crops. In contrast, the indigenous SSAF-1 was associated exclusively with cassava and the SSAF-5 type predominant associated with indigenous plants (weeds), although it did colonize vegetable crops at a much lower rate compared to the B and Q types. To determine the exact impact that each B. tabaci type will have on the future begomovirus distribution and evolution, especially considering the potential for recombination resulting from mixed virus infection, future studies should focus on elucidation of key phenotypic characteristics of each haplotype, particularly in relation to host range, insecticide

197 resistance and gene flow between one another. Such information will be crucial to designing sustainable approaches for the management of B. tabaci as a pest and vector of plant viruses in the South African agriculture.

In order to identify the different populations of B. tabaci present in South Africa, analysis and sequencing of the cytochrome oxidase I gene was performed and an mtCOI PCR- RFLP that discriminates between the B, Q and SSAF types was developed. Currently, the working strategy for classification and identification of B. tabaci relies on estimates of the degree of genetic relatedness using the mtCOI gene sequence as a molecular marker, a technique that is very reliable but too expensive for extensive screenings. The advantage of the mtCOI PCR-RFLP technique developed for the South African context, is the rapid identification of a large number of specimens without the added cost and time required to sequence the mtCOI fragment. This method will aid in the continued monitoring of B. tabaci haplotype distribution, as well as studies on host range and possible development of insecticide resistance in South Africa.

Tomato curly stunt virus (ToCSV), transmitted by the B type, was first identified in 1997 as a new begomovirus species affecting tomato production in South Africa (Pietersen et al., 2000; 2008). In Chapter 2, the analysis of the distribution and genetic diversity of the tomato-infecting begomoviruses in South Africa revealed the existence of three new begomovirus species in addition to ToCSV. Phylogenetic analysis clustered the four tomato-infecting species in three distinct subclades (SAI, SAII and SAIII), apart from other African and South West Indian Ocean begomoviruses (SWIO), indicating that these viruses only share a distant common ancestor and might be indigenous to Southern Africa. The increasing incidence of begomovirus infection in tomato production regions of South Africa seems to coincide with the dispersal of the B type in the country. This is a situation similar to what has been reported in other parts of the world, where the introduction of the B type, within a few years, lead to the appearance of previously unreported geminiviruses (Morales & Anderson, 2001; Polston & Anderson, 1997; Varma & Malathi, 2003; Seal et al., 2006b).

The SAI subclade consisted of a number of ToCSV variants/strains, sharing >94.9% nucleotide identity. The ToCSV variants were the predominant viral isolates, responsible for most of the recent epidemics in the tomato cropping systems in South Africa. Subclade SAII and SAIII consisted of eight isolates that represent three distinct new begomovirus species, namely Tomato curly stunt Mooketsi virus (ToCSMV), Tomato curly stunt Lanseria virus (ToCSLV) and Tomato curly stunt Noordoewer virus (ToCSNV). Although the results from this survey showed a limited geographical distribution for these isolates, the isolation of different variants of the new species in production regions which are up to

198 1000 km apart, suggests that either dissemination of these viruses are rapidly taking place, or are more widely distributed than indicated by the current survey.

The worldwide spread of begomoviral diseases is mostly due to importation of infected ornamentals or seedlings (Polston & Anderson, 1997), but phylogenetic analysis indicated that these tomato-infecting begomovirus species are most likely indigenous to Southern Africa. A possible explanation for their relatively recent emergence in cropping systems all over the country would be the transfer of these viruses from local wild hosts to tomatoes by the polyphagous B. tabaci B type, followed by rapid host adaptation by mechanisms like mutation or recombination. Numerous reports of begomovirus infection in weeds in literature support the notion that weed species act as natural hosts or begomovirus reservoirs, supporting mixed infections that lead to recombination, diversity, and subsequent evolution of these viruses. (Bedford et al., 1998; Ambrozevicius et al., 2002; García-Andrés, et al., 2006; Varsani et al., 2008; Azhar et al., 2011). In this study, several weed species were confirmed as symptomless begomovirus reservoirs, supporting their role in emerging begomovirus epidemics, both as inoculum source and/or as possible sources of novel viruses.

Genomic recombination in geminiviruses are major driving forces contributing to their evolution and diversity (Harrison & Robinson, 1999; Padidam et al., 1999; Rojas et al., 2005) and might add to the emergence of new virulent virus variants capable of host range expansion or better adaptation to local ecological conditions (Padidam et al., 1999). From the disease point of view, a number of particularly virulent variants have developed through recombination, such as those associated with cassava mosaic disease (Pita et al., 2001; Zhou et al., 1997) and tomato yellow leaf curl disease (Monci et al., 2001; Monci et al., 2002). All the tomato-infecting begomovirus species described in this study appear to be complex recombinants. Several recombination events were detected amongst the four South African begomovirus species, as well as with other African begomoviruses. This suggests that they have evolved within the sub-Saharan Africa region, along with other African begomoviruses and that recombination might have played a role in their emergence. ToCSV, a recombinant between TbLCZV and another unidentified virus species, seems to be particularly virulent and very well adapted to its host, S. lycopersicum, and transmission by its virus vector B. tabaci. It is possible that this virus became better adapted to its new host and is better fit, with regards to replication efficiency, movement and vector transmission, compared to the less adapted species. A broader virus diversity study, particularly aimed at non-crop hosts, might identify additional viral sequences that would facilitate a broader recombination study, in order to investigate this possibility (of viral evolution) further.

199 In recent years, two catagories of monopartite begomoviruses have been seen to emerge. Firstly, monopartite viruses with only a DNA-A component that are infectious to their respective hosts and capable of inducing wild-type disease symptoms (considered as true monopartite viruses) (Kheyr-Pour et al., 1991; Navot et al., 1991; Dry et al., 1993; Bananej et al., 2004, and secondly, monopartite viruses that require an additional ssDNA component termed alpha- or betasatellites (DNA-β) to develop full disease symptoms (Briddon et al., 2003; Zhou et al., 2003; Briddon & Stanley, 2006; Briddon et al., 2010). Using infectious clones and agroinoculation, Koch’s postulate for ToCSV was fulfilled and the true monopartite nature of two of the most predominant and widespread ToCSV variants was confirmed in chapter 3. It was also established that some of the variation observed in disease response (symptom severity) under natural field infection are, in part, due to the presence of severe and mild ToCSV variants, termed ToCSV variant (I) and ToCSV variant (II). Although both ToCSV variants are widespread in South African tomato production regions, the severe ToCSV-I variants was found to predominate. The agroinfectious clones constructed in this study therefore provide a convenient means to screen tomato varieties for disease resistance against the severe variant that is apparently responsible for much of the begomovirus-induced economic losses in South Africa.

Control measures of begomovirus-induced diseases are mainly based on vector control using pesticides, or physical barriers (Antignus et al., 2001; Horowitz et al., 2007; Dennehy et al., 2010). However, under conditions of high whitefly pressure, none of these control measures are sufficient (Antignus, 2007; Polston & Lapidot, 2007). The most cost effective way to reduce begomovirus spread and to inhibit its deleterious effects is by breeding plants resistant or tolerant to the virus (Lapidot et al., 2001). Host genetic resistance requires no chemical input and/or plant seclusion and wide spectrum, durable resistance against begomoviruses can be obtained (Pico et al., 1996; Lapidot & Friedmann, 2002). Faced with the high incidence of begomoviruses infection in tomato production regions in South Africa, the generation of resistant cultivars has thus become a priority.

As the domesticated tomato is susceptible to most whitefly-transmitted begomoviruses, screening for resistance has focused on wild Solanum species (Foolad, 2007). Various wild type genetic backgrounds have been used to select quantitative trail loci (QTL) controlling resistance to begomoviruses, particularly resistance to Tomato yellow leaf curl virus (TYLCV) and the bipartite Tomato mottle virus (ToMoV). (Zamir et al., 1994; Scott et al., 1995; Pico et al. 1996; Lapidot et al., 1997; Friedmann et al., 1998; Vidavsky & Czosnek, 1998; Hanson et al., 2000; Ji et al., 2007b; Vidavski, 2007) In most cases the source resistance appeared to be controlled by multiple genes (Pico et al., 1999; Anbinder

200 et al., 2009). Some of the resistance introgressions have also been mapped to the tomato genome and are identifiable with one of five polymorphic DNA markers (Ty-1 through Ty- 5) (Zamir et al., 1994; Chague et al., 1997; Agrama & Scott, 2006; Anbinder et al., 2009; Ji et al., 2009).

In chapter 5, tomato cultivars were screened for resistance to the severe variant of ToCSV (predominant begomovirus species in South Africa). None of the thirty-two tomato hybrids tested was immune, but a few accessions appeared to be good candidates for enhanced resistance. Among the hybrids with pyramided resistance from different wild type progenitors, three hybrids were selected for future breeding purposes. The resistance in these accessions were expressed as attenuation of leaf curl disease symptoms, delay in time of symptom development, a significant decrease in viral presence and a only small reduction in yielding ability, particularly compared to the current commercial lines used in South Africa. Marker analysis also indicated that the three hybrids contained a combination of the Ty-1, Ty-3 and Ty-3a resistance introgressions and emphasizes the combining ability of the different resistance sources. Lines associated with the Ty-1 and Ty-3/Ty-3a resistance loci, have shown a broad spectrum resistance, being effective in other regions of the world against a number of monopartite and bipartite begomoviruses (Maruthi et al., 2003; Mejia et al., 2005; Bain et al., 2007; Vidavski et al., 2008). The selected resistance sources could therefore be effective in not only limiting the damage caused by the widely prevalent ToCSV variants, but against other tomato-infecting begomovirus species recently identified in South Africa. This situation however requires further investigation. Future selection and combination of these resistance loci in a marker-directed phenotyping approach could therefore significantly improve the efficiency of breeding for resistance to begomoviruses in South Africa and may result in cultivars with prolonged resistance.

By identifying the most relevant begomovirus lineages currently infecting tomatoes in South Africa, this study provides valuable information critical to the development of control strategies based on host resistance against these pathogens. These results also emphasize the potential for the emergence of novel begomoviruses by interspecies genetic recombination. Future efforts should therefore focus on the identification of broad spectrum resistance by conventional breeding or genetic engineering that will not break down with the emergence of novel viral variants. This study also highlights the need for future monitoring of begomovirus diversity among crops and weed viruses within and outside the regions selected in the present study.

201 References

Antignus, Y., Nestel, D., Cohen, S. & Lapidot, M. (2001) Ultraviolet-deficient greenhouse environment affects whitefly attraction and flight-behavior. Environmental Entomology 30:394-399.

202 Bedford, I.D., Kelly, A., Banks, G.K., Briddon, R.W., Cenis, J.L. & Markham, P.G. (1998) Solanum nigrum: an indigenous weed reservoir for a tomato yellow leaf curl geminivirus in southern Spain. European Journal of Plant Pathology 104:221-222.

Berrie, L.C., Rybicki E.P. & Rey, M.E.C. (2001) Complete nucleotide sequence and host range of South African cassava mosaic virus: further evidence for recombination amongst begomoviruses. Journal of general Virology 82:53-58.

Bethke, J.A., Byrne, F.J., Hodges, G.S., McKenzie, C.L. & Shatters, R.G., (2009) First record of the Q biotype of the sweetpotato whitefly, Bemisia tabaci, in Guatemala Phytoparasitica 37:61-64.

Briddon, R.W. & Stanley, J. (2006) Subviral agents associated with plant single-stranded DNA viruses. Virology 344:198-210.

Brown, J.K., Frohlich, D.R. & Rosell, R.C. (1995b) The sweet potato / silverleaf whiteflies: biotypes of Bemisia tabaci Genn., or a species complex? Annual Review of Entomology 40:511-534.

Brown, J.K. (2007) The Bemisia tabaci Complex: Genetic and Phenotypic Variation and Relevance to TYLCV-Vector Interactions. In: Tomato yellow leaf curl virus disease: Management, molecular biology, breeding for resistance. Ed. by Czosnek, H. Springer, Dordrecht, The Netherlands, pp. 25-56.

203 Brown, J.K. (2010) Phylogenetic biology of the Bemisia tabaci sibling species group. In: Bionomics and management of a global pest. Ed. by Stansly, P.A. & Naranjo, S.E., Springer, Amsterdam, pp. 31-67.

Chu, D., Wan, F.H., Zhang, Y.J. & Brown, J.K. (2010a) Change in the biotype composition of Bemisia tabaci in Shandong province of China from 2005 to 2008. Environmental Entomology 39:1028-1036.

Chu, D., Zhang, Y.J. & Wan, F.H. (2010b) Cryptic invasion of the exotic Bemisia tabaci biotype Q occurred widespread in Shandong province of China. Florida Entomologist 93:203-207.

Daphne, P.E. (1980) Cassava, A South African venture. Optima 1:61-68.

De Barro, P.J., Liu, S.S., Boykin, L.M. & Dinsdale, A.B. (2011) Bemisia tabaci: A Statement of Species Status. Annual Review of Entomology 56:1-19.

204 Dry, I.B., Rigden, J.E., Krake, L.R., Mullineaux, P.M. & Rezaian, M.A. (1993) Nucleotide- sequence and genome organization of tomato leaf curl geminivirus. Journal of General Virology 74:147-151.

Duffy, S. & Holmes, E.C. (2008) Phylogenetic Evidence for Rapid Rates of Molecular Evolution in the Single-Stranded DNA Begomovirus Tomato Yellow Leaf curl virus. Journal of Virology 82:957-965.

Fauquet, C.M., Briddon, R.W., Brown, J.K., Moriones, E., Stanley, J., Zerbini, M. & Zhou, X. (2008) Geminivirus strain demarcation and nomenclature. Archives of Virology 153:783-821.

Foolad, M.R. (2007) Genome mapping and molecular breeding of tomato. International Journal of Plant Genomics 64358:1-52.

Hanssen, I.M., Lapidot, M. & Thomma B.P.H.J. (2010) Emerging Viral Diseases of Tomato Crops. Molecular Plant Microbe Interaction 23:539-548.

Harrison, B.D. & Robinson, D.J. (1999) Natural genomic and antigenic variation in whitefly-transmitted geminiviruses (begomoviruses). Annual Review of Phytopathology 37:369-398.

Hogenhout, S.A., Ammar, E., Whitfield, A.E. & Redinbaugh, M.G. (2008) Insect vector interactions with persistently transmitted viruses. Annual Review of Phytopathology 46:327-359

Horowitz, R., Denholm, I. & Morin, S. (2007) Resistance to insecticides in the TYLCV whitefly vector Bemisia tabaci. In: Tomato yellow leaf curl virus disease: Management,

205 molecular biology, breeding for resistance. Ed. by Czosnek, H. Springer, Dordrecht, The Netherlands, pp. 305-325.

Ji, Y., Schuster, D.J. & Scott, J.W. (2007a) Ty-3, a begomovirus resistance locus near the Tomato yellow leaf curl virus resistance locus Ty-1 on chromosome 6 of tomato. Molecular Breeding 20:271-284

Lapidot, M. & Friedmann, M. (2002) Breeding for resistance to whitefly-transmitted geminiviruses. Annals of Applied Biology 140:109-127.

Legg, J.P. (1996) Host-associated strains within Ugandan populations of the whitefly Bemisia tabaci (Genn.) (Hom, Aleyrodidae). Journal of Applied Entomology 120:523-527.

Luo, C., Jones, C.M., Devine, G., Zhang, F., Denholm, I. & Gorman, K. (2010) Insecticide resistance in Bemisia tabaci biotype Q (Hemiptera: Aleyrodidae) from China. Crop Protection 29:429-434.

Maruthi, M.N., Colvin, J., Thwaites, R.M., Banks, G.K., Gibson, G. & Seal, S. (2004) Reproductive incompatibility and cytochrome oxidase I gene sequence variability amongst

206 host-adapted and geographically separate Bemisia tabaci populations (Hemiptera: Aleyrodidae). Systematic Entomology 29:560-568.

Monci, F., Navas-Castillo, J., & Moriones, E. (2001) Evidence of a naturally occurring recombinant between Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus in Spain. Plant Disease 85:1289.

Morales, F.J. & Anderson, P.K. (2001) The emergence and dissemination of whitefly- transmitted geminiviruses in Latin America - brief review. Archives of Virology 146:415- 441.

Morales, F.J. (2006) History and current distribution of begomoviruses in Latin America. Advances in Virus Research 67:127-162.

Navas-Castillo, J., Fiallo-Olive, E. & Sanchez-Campos, S. (2011) Emerging virus diseases transmitted by whiteflies. Annual Review of Phytopathology 49:15.1-15.30.

Navot, N., Pichersky, E., Zeidan, M., Zamir, D. & Czosnek, H. (1991) Tomato yellow leaf curl virus - a whitefly-transmitted geminivirus with a single genomic component. Virology 185:151-161.

Padidam, M., Sawyer, S. & Fauquet C.M. (1999) Possible emergence of new geminiviruses by frequent recombination Virology 265:218-225.

Pico, B., Diez, M.J. & Nuez, F. (1996) Viral diseases causing the greatest economic losses to the tomato crop .2. The Tomato yellow leaf curl virus - A review. Scientia Horticulturae 67:151-196.

Pico, B., Ferriol, M., Dı´ez, M.J. & Nuez, F. (1999) Developing tomato breeding lines resistant to tomato yellow leaf curl virus. Plant Breeding 118:537-542.

207 Pietersen, G., Idris, A.M., Krüger, K. & Brown, J.K. (2000) Tomato curly stunt virus, a new begomovirus of tomato within the Tomato yellow leaf curl virus-Is cluster in South Africa. Plant Disease 84:810.

Pietersen, G., Idris, A.M., Kruger, K. & Brown, J.K. (2008) Characterization of Tomato curly stunt virus: A new tomato-infecting begomovirus from South Africa. Plant Pathology 57:809-818.

Pita, J.S., Fondong, V.N., Sangare, A., Kokora, R.N.N. & Fauquet, C.M. (2001) Genomic and biological diversity of the African cassava geminiviruses. Euphytica 120:115-125.

Polston, J.E. & Anderson, P.K. (1997) The emergence of whitefly-transmitted geminiviruses in tomato in the Western Hemisphere. Plant Disease 81:1358-1369.

Rojas, M.R., Hagen, C., Lucas, W.J. & Gilbertson, R.L. (2005) Exploiting chinks in the plant's armor: Evolution and emergence of geminiviruses. Annual Review of Phytopathology 43:361-394.

Scott, J.W., Stevens, M.R., Barten, J.H.M., Thome, C.R., Polston, J.E., Schuster, D.J. & Serra. C.A. (1995) Introgression of resistance to whitefly transmitted geminiviruses from Lycopersicon chilense to tomato. In: Bemisia 1995: Taxonomy, biology, damage control, and management. Ed. by Gerling D. & Mayer. R.T. Intercept Ltd., Andover, U.K. pp. 357- 367.

Seal, S.E., Jeger, M.J. & Van den Bosch, F. (2006a) Begomovirus evolution and disease management. Plant Virus Epidemiology 67:297-316.

208 Sseruwagi, P., Maruthi, M.N., Colvin, J., Rey, M.E.C., Brown, J.K. & Legg, J.P. (2006) Colonization of non-cassava plant species by whiteflies (Bemisia tabaci) in Uganda. Entomologia experimentalis et applicata 119:145-153.

Thatcher, J. (1976) Whitefly transmission and etiology of Tobacco leaf curl disease. M. Sc thesis, University of Natal, South Africa.

Thresh, J.M. (2006) Control of tropical plant virus diseases. Advances in Virus Research 67:245-295.

Tiendrébéogo, F., Lefeuvre, P., Hoareau, M., Harimalala, M.A., De Bruyn, A., Villemot, J., Traoré, V.S.E., Konaté, G., Traoré, A.S., Barro, N., Reynaud, B., Traoré, O. & Lett, J.-M. (2012) Evolution of African cassava mosaic virus by recombination between bipartite and monopartite begomoviruses. Virology Journal 9:67.

Trench T.N. & Martin M.M. (1985) An assessment of cassava African mosaic disease in South Africa and Swaziland. South African Journal of Plant and Soil 2:169-170.

Varma, A. & Malathi, V.G. (2003) Emerging geminivirus problems: A serious threat to crop production. Annals of Applied Biology 142:145-164.

Varsani, A., Shepherd, D. N., Monjane, A. L., Owor, B. E., Erdmann, J. B., Rybicki, E. P., Peterschmitt, M., Briddon, R. W., Markham, P. G. Oluwafemi, S., Windram, O.P., Lefeuvre, P., Lett J., & Martin D.P. (2008) Recombination, decreased host specificity and increased mobility may have driven the emergence of maize streak virus as an agricultural pathogen. Journal of General Virology 89:2063-2074.

Vidavsky, F. & Czosnek, H. (1998) Tomato breeding lines resistant and tolerant to Tomato yellow leaf curl virus issued from Lycopersicon hirsutum. Phytopathology 88:910-914.

Zhou, X. P., Liu, Y. L., Calvert, L., Munoz, C., Otim-Nape, G. W., Robinson, D. J. & Harrison, B. D. (1997). Evidence that DNA-A of a geminivirus associated with severe

209 cassava mosaic disease in Uganda has arisen by interspecific recombination. Journal of General Virology 78:2101-2111.

210

ADDENDUM A – Genetic identification of two sweet potato-infecting begomoviruses in South Africa ADDENDUM A Genetic identification of two sweet potato-infecting begomoviruses in South Africa

Summary

The complete genome sequence of two monopartite begomovirus isolates (genus Begomovirus, family Geminiviridae) that occurred either alone or in mixed infection in sweet potato (Ipomoea batatas) plants collected in Waterpoort, South Africa is presented. One of the isolates corresponds to that of Sweet potato mosaic associated virus (SPMaV; SPMaV-[ZA:WP:2011]) with which it shared 98.5% nucleotide identity, whereas the second isolate corresponds to a new variant of Sweet potato leaf curl Sao Paulo virus (SPLCSPV; SPLCSPV-[ZA:WP:2011]) with which it shared 91.4% nucleotide identity. The phylogenetic and recombination relationships of these isolates to other monopartite Ipomoea-infecting begomoviruses were also investigated. SPLCSPV- [ZA:WP:2011] was found to be a natural recombinant of swepoviruses consisting of two distinct parental genomic sequences from SPLCSPV and sweet potato leaf curl Georgia virus (SPLCGV).

NOTE:

This chapter has been accepted for publication as an annotated sequence record in Archives of Virology as:

Esterhuizen, L.L., Van Heerden S.W., Rey, M.E.C. & Van Heerden, H. Genetic identification of two sweet potato infecting begomoviruses in South Africa.

211 Geminiviruses are plant-infecting viruses causing severe economic losses to agricultural production worldwide. Viruses belonging to the family Geminiviridae are unique in having either monopartite or bipartite genomes of circular, single-stranded DNA (ssDNA) components, contained within twinned icosahedral virions (Harrison, 1985). Based on the considerable diversity in terms of their genome structure, sequence, host range and insect vectors, the family Geminiviridae has been divided into four different genera, including: Mastrevirus, Curtovirus, Topocuvirus, and Begomovirus (Fauquet & Stanley, 2003).

In recent years, a number of begomoviruses infecting Ipomoea species in the family Convolvulaceae have been identified in various parts of the world (Lotrakul et al., 1998; Banks et al., 1999; Fuentes & Salazar, 2003; Lotrakul et al., 2003; Briddon et al., 2006; Miano et al., 2006; Luan et al., 2006, 2007; Lozano et al., 2009; Paprotka et al., 2010; Albuquerque et al., 2011; Wasswa et al., 2011). Geminiviruses infecting sweet potato (Ipomoea batatas Lam.) are all monopartite, are phylogenetically distinct from other Begomovirus species and have been named ‘swepoviruses’ (Fauquet & Stanley, 2003). The symptoms caused by swepovirus infection may vary depending on the different Ipomoea species or cultivar and usually consist of leaf curling and/or vein yellowing, but asymptomatic infections are also common (Briddon et al., 2006; Clark & Hoy, 2006; Ling et al., 2010). Their main modes of distribution include transmission by the insect vector, Bemisia tabaci and propagation through vine cuttings (Banks et al., 1999; Lozano et al., 2009). Vegetative propagation allows accumulation of these viral species and the absence of effective diagnostic tools assists in their global dissemination.

Sweet potato is an important subsistence and food security crop in many tropical parts of the world and is also widely cultivated in subtropical and temperate regions. In 2009, South Africa produced an average of 63 000 metric tons of sweet potato (Luan et al., 2006, 2007). Although swepoviruses have recently been reported in sub-Saharan Africa, Kenya and Uganda, the only viruses currently known to infect the crop in South Africa, belong to the genus Crinivirus, family Closteroviridae and Potyviridae family (Domola, 2003; Rännäli et al., 2008, 2009). This paper provides the first report of two sweet potato- infecting begomoviruses in South Africa.

Leaf samples from 31 sweet potato plants (var. ‘Bosbok’ and ‘Blesbok’) showing symptoms of chlorosis, malformation, curling leaflet margin and overall stunting, were collected from a commercial field at Waterpoort, Limpopo Province (S 22.82380°’; E 029.61026°) with more than 80% of the plants showing symptoms of infection in March 2009 and March 2011. To confirm possible begomovirus infection, a strategy of rolling- circle amplification - restriction fragment length polymorphism (RCA-RFLP) and sequencing of the full genome was employed (Paprotka et al., 2010). Genomic DNA was isolated from plant material using the DNA extraction kit Invisorb® Spin Plant Mini Kit

212 (Invitek GmbH) according to the manufacturer’s instructions. Genomic DNA was amplified using phi29 DNA polymerase (TempliPhi, GE Healthcare) as described previously (Haible et al., 2006). The RCA genomes were digested with five different restriction enzymes (BamHI, EcoRI, HindIII, PstI, and SacI). RCA genomes digested with PstI, produced linear fragments putatively corresponding to monomeric genome components of approximately 3.0 kbp and were cloned into pUC19 and sequenced. Multiple sequence alignment was performed with ClustalW and the sequence identity was determined by pairwise alignment with deletion of gaps using Mega4.1. Phylogenetic analyses was performed with Mega4.1 using the neighbour-joining (NJ) and bootstrap option (1000 replicates).

The full-length genomes of the two sweet potato-infecting begomovirus samples, SA-PstI- 01 and SA-PstI-02, consisted of 2783 and 2769 nucleotides (nt), respectively. Both samples had a genome organization typical of monopartite begomoviruses, including four open reading frames (ORFs) in the complementary and two ORFs in the viral sense DNA and a 259-nt intergenic region (IR) containing the invariant nonanucleotide motif (TAATATTAC). Within the IR, the iterative elements surrounding the C1 ORF TATA box represented the consensus sequence core GGWGD. For the SA-PstI-01 sample, three imperfect direct repeats (AATTGGAGA, AATTGGATA and GGAGTA) on the 5’ end side of the TATA box and one inverted repeat (TCTCCAA) on the 3’ end side were found. For SA-PstI-02, three direct repeats of an iterative element (TGGTGTC) on the 5’ end side and one inverted repeat (GACACCA) on the 3’ end, identical to those reported for sweet potato leaf curl Georgia virus (SPLCGV), were found (Lotrakul et al., 1998; Argüello- Astorga & Ruiz-Medrano, 2001).

The homology of the viral sequences from SA-PstI-01 and SA-PstI-02 samples was compared with sweet potato-infecting begomoviruses available in GenBank. These two South African sequences were most similar to two begomovirus species recently proposed as novel begomovirus species in Brazil (Paprotka et al., 2010; Albuquerque et al., 2011). The complete genome of SA-PstI-01 (GenBank JQ621843) was most similar (98.5%) to that of sweet potato mosaic associated virus (SPMaV, FJ969831) which was obtained from a sweet potato plant in the germplasm bank in Brazil (Ling et al., 2010). SA- PstI-02 (GenBank JQ621844) was most similar (91.4%) to sweet potato leaf curl Sao Paulo virus (SPLCSPV, HQ393477) (Albuquerque et al., 2011). Following the guidelines proposed by the International Committee on Taxonomy of Viruses (ICTV), SA-PstI-01 represent an isolate of SPMaV, designated sweet potato mosaic associated virus-[South Africa:Waterpoort:2011] (SPMAV-[ZA:WP:2011]) (Paprotka et al., 2010). The SA-PstI-02 sequence represent a new variant of SPLCSPV and was designated sweet potato leaf curl Sao Paulo virus-[South Africa:Waterpoort:2011] (SPLCSPV-[ZA:WP:2011]). Phylogenetic analysis using NJ showed clustering of the SPMaV-[ZA:WP:2011] isolate

213 with the Brazil isolate of SPMaV, whereas SPLCSPV-[ZA:WP:2011] clustered with the Brazil isolate of SPLCSPV (Fig 1).

RCA-RFLP results also demonstrated that mixed infections with both viral species occurred in some of the infected sweet potato plants. The coexistence of different genomes in a single plant often results in genomic fragment exchange by recombination and we therefore searched for evidence of recombination using the Recombination Detection Program (RDP3). It was apparent from the pairwise nucleotide identity data on individual ORF’s that the SPLCSPV-[ZA:WP:2011] isolate contains evidence of at least one past recombination event within the C1 ORF (data not shown). A recombinatorial fragment spanning nucleotide 2150-2767 in the SPLCSPV-[ZA:WP:2011] genome was identified (Martin et al., 2010). SPLCSPV-[ZA:WP:2011] presumably obtained the 3’ end of the C1 ORF and 5’end of the intergenic region from a unknown virus (minor parent) whereas the rest of their genome resembles that of SPLCSPV (HQ393477) (major parent). This recombination event was well supported by 6 of the detection methods used in RDP3 with a P value ranging from 1.57x10-18 to 9.14x10-6. The recombination breakpoint also has some similarity to the recombination hot spots (nt 2250), identified in several other swepovirus recombinants by Paprotka et al. (2010) and lies within one of the reported recombination hot spot for begomoviruses at the centre of the C1 ORF (Lefeuvre et al., 2007). SimPlot and bootscanning analysis using the putative recombinant sequence as a query, identified SPLCGV as a minor parents. This is supported by the iteron sequences in SPLCSPV-[ZA:WP:2011] being identical to those found in SPLCGV and not those in the putative major parent, SPLCSPV (HQ393477). Figures 2a and 2b respectively, show the results obtained with SimPlot and Bootscanning analysis (Lole et al., 1999), using the sequence of SPLCSPV-[ZA:WP:2011] as query.

This is the first report of begomoviruses infecting Ipomoea spp. in South Africa. This study reported the presence of two swepoviruses infecting commercial sweet potato crops in South Africa. A comprehensive survey of all sweet potato production regions might yield more swepoviruses and will results in a more accurate picture of the ecological situation in the country. With significant adverse effects of swepoviruses on crop yield, the constant geographical expansion of the virus vector (B. tabaci) and the lack of resistant cultivars, sweet potato leaf curl disease is anticipated to have a significant impact on the sweet potato industry in South Africa in the future. Further studies require fulfilling Koch’s postulates for these viruses and an understanding of the relationships between coexisting viral species, including criniviruses and/or potyviruses, known to infect sweet potato in South Africa.

214

Figure 1 Neighbour joining phylogenetic relationship of the complete genomes of sweet potato mosaic associated virus (SPMaV-[ZA:WP:2011]) and sweet potato leaf curl Sao Paulo virus (SPLCSPV-[ZA:WP:2011]) isolates with other representative sweet potato begomoviruses. Bootstrap results after 1000 replicates are noted at each branch node. Tomato yellow leaf curl virus (TYLCV, X76319) and Tomato curly stunt virus (ToCSV, AF261885) were included as outgroups. Genbank accession numbers and the countries of origin for each virus isolate are indicated. The acronyms for the viruses used are as follows: IYVV: ipomoea yellow vein virus; SPGVaV: sweet potato golden vein-associated virus; SPLCCaV: sweet potato leaf curl Canary virus; SPLCCV: sweet potato leaf curl China virus; SPLCESV: sweet potato leaf curl Spain virus; SPLCGV: sweet potato leaf curl Georgia virus; SPLCLaV: sweet potato leaf curl Lanzarote virus; SPLCV: sweet potato leaf curl virus. SPLCSCV: sweet potato leaf curl South Carolina virus; SPMaV: sweet potato mosaic associated virus; SPLCPSV: sweet potato leaf curl Sao Paulo virus.

215 Figure 2 Mapping of recombination amongst sweet potato mosaic associated virus-[ZA:WP:2011]) and SPLCSPV (HQ393477) and SPLCGV (AF326775) using (a) Simplot analysis. Similarity (x-axis, indicated as percentage identity) of compared begomoviruses genomes with genome position indicated in nucleotides on the y-axis within a sliding window 200 bp wide centred on the position plotted, with a step size between points of 20 bp. The red vertical lines show the recombination points at nucleotide position 2150–2767, between positions 2233 and 2929 in the alignment. (b) Bootscan analysis amongst sweet potato mosaic associated virus-[ZA:WP:2011]) and SPLCSPV (HQ393477) and SPLCGV (AF326775) sequences. The probability of permutated trees indicated in percentage on x-axis at genome position indicated in nucleotides on y-axis between compared begomoviruses using a sliding window of 200 bp wide centered on the position plotted, with a step size between points of 20 bp. Mosaicism is suggested by the high levels of phylogenetic relatedness between the query sequence and SPLCSPV (HQ393477) and SPLCGV (AF326775) in different regions of the genome.

216 References

Albuquerque, L.C., Inoue-Nagata, A.K., Pinheiro, B., Ribeiro, S.G., Resende, R.O., Moriones, E. & Navas-Castillo, J. (2011) A novel monopartite begomovirus infecting sweet potato in Brazil. Archives of Virology 156:1291-1294.

Argüello-Astorga, G.R., & Ruiz-Medrano, R. (2001) An iteron-related domain is associated to Motif 1 in the replication proteins of geminiviruses: identification of potential interacting amino acid-base pairs by a comparative approach. Archives of Virology 146:1465-1485.

Banks, G.K., Bedford, I.D., Beitia, F.J., Rodriguez-Cerezo, E. & Markham, P.G. (1999) A novel geminivirus of Ipomoea indica (Convolvulacae) from Southern Spain. Plant Disease 83:486.

Briddon, R.W., Bull, S.E. & Bedford, I.D. (2006) Occurrence of Sweet potato leaf curl virus in Sicily. Plant Pathology 55:286-286.

Clark, C.A. & Hoy, M.W. (2006) Effects of common viruses on yield and quality of Beauregard sweet potato in Louisiana. Plant Disease 90:83-88.

Fuentes, S. & Salazar, L.F. (2003) First report of Sweet potato leaf curl virus in Peru. Plant Disease 87:98.

Domola, M.J. (2003) Survey and characterization of sweet potato viruses in South Africa. M. Sc thesis, University of Pretoria, South Africa.

Fauquet, C.M. & Stanley, J. (2003) Geminivirus classification and nomenclature: Progress and problems. Annals of Applied Biology 142:165-189.

Fauquet, C.M., Briddon, R.W., Brown, J.K., Moriones, E., Stanley, J., Zerbini, M. & Zhou, X. (2008) Geminivirus strain demarcation and nomenclature. Archives of Virology 153:783-821.

Haible, D., Kober, S. & Jeske, H. (2006) Rolling circle amplification revolutionizes diagnosis and genomics of geminiviruses. Journal of Virological Methods 135:9-16.

Harrison BD (1985) Advances in geminivirus research. Annual Review of Phytopathology 23:55-82.

Lefeuvre, P., Martin, D.P., Hoareau, M., Naze, F., Delatte, H., Thierry, M., Varsani, A., Becker, N., Reynaud, B. & Lett, J.M. (2007) Begomovirus ‘melting pot’ in the south–west Indian Ocean islands: molecular diversity and evolution through recombination. Journal of General Virology 88:458–3468.

217 Ling, K.-S., Jackson, D.M., Harrison, H., Simmons, A.M. & Pesic-VanEsbroeck, Z. (2010) Field evaluation of yield effects on the U.S.A. heirloom sweet potato cultivars infected by Sweet potato leaf curl virus. Crop Protection 29:757-765.

Lotrakul, P., Valverde, R.A., Clark, C.A., Sim, J. & De La Torre, R. (1998) Detection of a geminivirus infecting sweet potato in the United States. Plant Disease 85:1253-1257.

Lotrakul, P., Valverde, R.A., Clark, C.A., Fauquet, C.M. (2003) Properties of a begomovirus isolated from sweet potato (Ipomoea batatas (L.) Lam.) infected with Sweet potato leaf curl virus. Revista Mexicana Fitopatología 21:128-136.

Lozano, G., Trenado, H.P., Valverde, R.A. & Navas-Castillo, J. (2009) Novel begomovirus species of recombinant nature in sweet potato (Ipomoea batatas) and Ipomoea indica: taxonomic and phylogenetic implications. Journal of General Virology 90:2550-2562.

Luan, Y.S., Zhang, J. & An, L.J. (2006) First Report of Sweet potato leaf curl virus in China. Plant Disease 90:1111.

Luan, Y.S., Zhang, J., Liu, D.M. & Li, W.L. (2007) Molecular characterization of Sweet potato leaf curl virus isolate from China (SPLCV-CN) and its phylogenetic relationship with other members of the Geminiviridae. Virus Genes 35:379-385.

Martin, D.P., Lemey, P., Lott, M., Moulton, V., Posada, D. & Lefeuvre, P. (2010) RDP3: a flexible and fast computer program for analyzing recombination. Bioinformatics 26:2462- 2463.

Miano, D.W., LaBonte, D.R., Clark, C.A., Valverde, R.A., Hoy, M.W., Hurtt, S. & Li, R. (2006) First report of a begomovirus infecting sweet potato in Kenya. Plant Disease 90:832.

NDA, (2010). A profile of the South African sweet potato market value chain 2010. Department of Agriculture, Forestry and Fisheries, Republic of South Africa. http://www.daff.gov.za/docs/AMCP/SweetPotatoVCP2010-11.pdf

NDA, (2011) Abstract of agricultural statistics 2011. Department of Agriculture, Forestry and Fisheries, Republic of South Africa. http://www.daff.gov.za/docs/statsinfo/Abstract_2011.pdf.

Rännäli, M., Czekaj, V., Jones, R.A.C., Fletcher, J.D., Davis, R.I., Mu, L., Dwyer, G.I., Coutts, B.A. & Valkonen, J.P.T. (2008) Molecular genetic characterization of Sweet potato

218 virus G (SPVG) isolates from areas of the Pacific Ocean and southern Africa. Plant Disease 92:1313-1320.

Rännäli, M., Czekaj, V., Jones, R.A.C., Fletcher, J.D., Davis, R.I., Mu, L. & Valkonen, J.P.T. (2009) Molecular characterization of Sweet potato feathery mottle virus (SPFMV) isolates from Easter Island, French Polynesia, New Zealand, and southern Africa. Plant Disease 93:933-939.

Paprotka, T., Boiteux, L.S., Fonseca, M.E., Resende, R.O., Jeske, H., Faria, J.C. & Ribeiro, S.G. (2010) Genomic diversity of sweet potato geminiviruses in a Brazilian germplasm bank. Virus Research 149:224-233.

Prasanth, G. & Hegde, V. (2008) Occurrence of Sweet potato feathery mottle virus and Sweet potato leaf curl Georgia virus on sweet potato in India. Plant Disease 92:311.

Wasswa, P., Otto, B., Maruthi, M.N., Mukasa, S.B., Monger, W. & Gibson, R.W. (2011) First identification of a sweet potato begomovirus (swepovirus) in Uganda: characterization, detection and distribution. Plant Pathology 60:1030-1039.

219