Academic Journal of Suriname 2014, 5, 456-460 Full-length paper 1 Julie Péneau et al. Biomedicine

Genetic diversity of Trypanosoma cruzi circulating in mammals and triatomines collected in urban areas, in

Julie Péneau1, Denis Blanchet2, Benoît de Thoisy3, 4 and Christine Aznar1, 2

1Faculté de Médecine Hyacinthe Bastaraud de l’Université des Antilles et de la Guyane, Épidémiologie des Parasitoses Tropicales (EPaT), , French Guiana. 2Laboratoire Hospitalier et Universitaire de Parasitologie et Mycologie Médicale, Centre hospitalier Andrée Rosemon, Cayenne, French Guiana. 3Laboratoire des Interactions Virus-Hôtes, Institut Pasteur de la Guyane, Cayenne, French Guiana. 4Association Kwata “Study and Conservation of Guianan Wildlife”, Cayenne, French Guiana

Abstract

Trypanosoma cruzi, the etiological agent of Chagas disease is a parasitic protozoan endemic to Latin America. This parasite is highly diverse, with several divergent and discrete major genotypes reported: TcI to TcVI. In this study, we report genetic diversity of T. cruzi circulating in mammals and triatomines (85 samples) collected in Cayenne and its surroundings , after amplification of the mini-exon gene. Two distinct groups TcI (55,3 %), TcIII-TcIV (36,5 %) and co-infection (8,2 %) were defined in 58 triatomines, 13 wild mammals, 12 dogs and 2 human samples.

Keywords: Genetic diversity, Trypanosoma cruzi, mammals, triatomines, French Guiana

Introduction prevalent in the Brazilian Amazon, Venezuela, Colombia, and Central and North America (Miles et Trypanosoma cruzi is a protozoan parasite of al., 2009). the order Kinetoplastida, and causative agent of The miniexon gene has been widely used as a Chagas disease (Rassi, Rassi, & Marin-Neto, 2010). taxonomic marker in the diversity of kinetoplastids Natural cycles of T. cruzi transmission are (Thomas, Westenberger, Campbell, & Sturm, complex in the Amazon, involving a great diversity 2005). of wild mammal and triatomines (Aguilar, Abad- In this study, we characterize T. cruzi from Franch, Dias, Junqueira, & Coura, 2007). human cases, triatomines and mammals in four In French Guiana, fourteen triatomines species have cities of French Guiana. been reported (Bérenger, Pluot-Sigwalt, Pages, Blanchet, & Aznar, 2009). Globally, in the whole Guiana shield, the most frequent triatomine species 1. Materials and methods are Panstrongylus geniculatus, Rhodnius pictipes and Rhodnius robustus (Oostburg, Anijs, Oehlers, 1.1 Study area Hiwat, & Burke-Hermelijn, 2003; Rambajan, The investigation was realized in Cayenne, 1984). which is the Capital of French Guiana (57 318 Trypanosoma cruzi is genetically diverse: six inhabitants), and in 3 surrouding cities: lineages, named TcI to TcVI have been identified (26 639 inhabitants), Rémire Montjoly (19 260 (Zingales et al., 2009). TcII, TcV and TcVI inhabitants) and Macouria (9 202 inhabitants) predominate in the domestic transmission cycle, (INSEE, 2011). These four cities represent nearly and are present in the South Cone of South half (49.6%) of the French Guiana population. Out America. TcIII and TcIV are preferentially of 224 samples, 112 samples were collected in associated with the sylvatic transmission cycle. TcI Rémire Montjoly, 75 in Cayenne, 22 in Matoury is associated with different life cycles, and it is and 15 in Macouria.

Corresponding author: Julie Péneau. Faculté de Médecine Hyacinthe Bastaraud de l’Université des Antilles et de la Guyane, Épidémiologie des Parasitoses Tropicales (EPaT), Cayenne, French Guiana. Email :[email protected]

Available on-line Februari 20, 2014

Acad J Sur 2014 (5) 456-460

457 Julie Péneau et al.

1.2 Samples µM of each primer (Applied Biosystem) and 5 The different sources of samples used in this U/µL of HotStarTaq DNA Polymerase (Qiagen). study were: i) wild mammals (n = 40) captured in Amplification was performed by a GenAmp traps, ii) adults sylvatic triatomines (n = 170), PCR System 9700 (Applied Biosystems). The collected by private individuals inside or/and near following reaction cycle was implemented: a houses. Known positive samples from the same denaturation step of 15 min at 94 °C, 35 urban area, domestic animals (n = 12) and humans amplification cycles (94 °C for 1 min, 64 °C for 30 (n = 2) infected by T. cruzi, were also included in s, 72 °C for 20 s) and a final 5 min elongation step this study for the molecular characterization. at 72 °C. Final amplification products were revealed on an ultraviolet transilluminator after 1.3 T. cruzi culture electrophoresis on 1.5 % agarose gel stained with Cultures were done in Liver Infusion Tryptose ethidium bromide. (LIT) medium, supplemented with 10 % fetal bovine serum (FBS), at 26°C on the 54 blood 1.6 Mini exon intergenic region amplification samples from mammals. Amplification of the intergenic region of spliced leader genes (SL-IR): three independent 1.4 DNA extraction hot-start PCR reactions, named SL-IR I, SL-IRac Three types of materials were used for DNA and SL-IR II, were carried out for a first extraction: i) 100 µl from positive cultures (n = 32) classification of T. cruzi populations in three groups ii) rectal content from fresh triatomines (n = 78) iii) of lineages (Burgos et al., 2007). Each PCR Posterior part of insect’s abdomen from dry or mixture contained 3µL of DNA sample; 200 µM of frozen triatomines (n = 92). The lower part of the each deoxyribonucleotide triphosphate (dNTP), abdomen of these dry insects was macerated in 1.5µM of MgCl2, 0.2 µM of each primer (Applied 200µL of lysis buffer of Qiagen kit (ATL and Biosystem) and 5 U/µL of Taq’Ozyme (Ozyme). proteinase K) for 48 hours at 56°C in an incubator. Amplification cycles were performed in an Subsequent DNA extraction was done using the automatic thermocycler GenAmp PCR System DNeasy blood and Tissue kit (Qiagen, Hilden, 9700 (Applied Biosystems, Courtaboeuf, ), Germany) according to the manufacturer's as previously described (Burgos et al., 2007). instructions. DNA from 7 reference strains were included in the PCR assays: Teh strain (TcI), TU18 strain 1.5 T. cruzi molecular detection (TcII), M5631 strain (TcIII), CANIII strain (TcIV), Molecular detection was performed amplifying MN cl 2 (TcV), CL Brener strain (TcVI) and Tjoin the 330 bp variable region of kinetoplast DNA (Trypanosoma rangeli strain). (kDNA) using primers 121a (5’ AAATAATGTACGGGGGAGATGCATGA 3‘, 121b (5’ 2. Results AAATAATGTACGGGTGAGATGCATGA), and 122 (5’ GGTTCGATTGGGGTTGGTGTAATATA 2.1 T. cruzi molecular detection 3‘). Trypanosoma cruzi infection rates in Each PCR mixture (25 µL) contained 3 µL of DNA triatomines and wild mammals were high, reaching sample; 250 µM of each deoxyribonucleotide respectively 45.3 % and 45 % (Table 1). triphosphate (dNTP) (Sigma), 2.5mM of MgCl2, 0.2

Table 1: Infection rate of sylvatic triatomines and wild mammals with Trypanosoma cruzi in Cayenne, Macouria, Matoury and Rémire-Montjoly.

Triatomines Wild mammals host Location Number Number infected by T. Number Number infected by T. examined cruzi (% infection) examined cruzi(% infection) Cayenne 49 27 (55.1%) 21 9 (42.8%) Macouria 9 5 (55.5%) 6 1 (16.6%) Matoury 13 7 (53.8%) 3 2 (66.6%) Rémire-Montjoly 99 38 (38.3%) 10 6 (60%) total 170 77 (45.3%) 40 18 (45%)

Acad J Sur 2014 (5) 456-460 Trypanosoma cruzi in French Guiana 458

2.2 T. cruzi molecular characterization TcIII-TcIV and co-infection TcI/TcIII-TcIV The amplification of the mini-exon gene allows were found only in P. geniculatus which is the most the characterization of three distinct groups: TcI, frequent in the study area. In infected P. TcII-TcV-TcVI, and TcIII-TcIV (Table 2). Out of geniculatus, TcI was found isolated in 36.58 % of 27 mammals, 12 Canis familiaris were TcIII-TcIV, the cases. Other triatomines were all infected by 13 wild mammals and 2 humans were TcI. TcI. Overall, 55.3 % (n = 47) of the infection are due to TcI.

Table 2: Trypanosoma cruzi genotypes from different hosts

Host Species TcI TcIII-TcIV CoinfectionTcI- TcIII-TcIV

Triatomines Panstrongylus geniculatus 15 19 7 (n=58) Panstrongylus lignarius 1 Rhodnius pictipes 6 Rhodnius robustus 10

Mammals Canis familiaris 12 (n=27) Didephis marsupialis 7 Micaureus demerarae 1 Philander opossum 5 Humans 2

Total 47 31 7

The distribution of T. cruzi genotypes in the 4 cities Amazonia: association of Rhodnius and opossum studied is synthesized in table 3. with TcI and of Panstrongylus geniculatus with TcI and TcIII (Dedet et al., 1985; Lewicka, Brenière- Campana, Barnabé, Dedet, & Tibayrenc, 1995; Table 3: Distribution of Trypanosoma cruzi Miles et al., 1981; Miles et al., 1978; Póvoa et al., genotypes from wild mammals, humans, dogs and 1984; Yeo et al., 2005). Our data suggests a triatomines, in Cayenne, Macouria, Matoury and contamination of the dogs by Panstrongylus Rémire-Montjoly geniculatus. The study area is the most densely populated in French Guiana, and its natural biotope is shrinking year after year (Gardel, 2001). This Location TcI TcIII/TcIV CoinfectionTcI- Total phenomenon can explain the intensity of TcIII/TcIV transmission cycle of T. cruzi and the high infection rate in triatomines (45.3 %) and in wild mammals Cayenne 17 8 3 28 (45 %) (Holmes, 1996).

Macouria 2 5 - 7

Matoury 4 7 - 11 Acknowledgments

Rémire- 24 11 4 39 We are grateful to FEDER VIRUSES, which Montjoly enabled us to collect samples from mammals, as well as members of the SEAG who collected a part Total 47 31 7 85 of triatomines. Financial support: This work was supported by the PO-FEDER TIMGED (Trypanosomes d’Intérêt 3. Discussion Médical en Guyane française – Epidémiologie et Diagnostic), N°30195. The present work corroborates classic data about the sylvatic cycle in French Guiana and

Acad J Sur 2014 (5) 456-460

459 Julie Péneau et al.

References back and to the future. Parasitology, 136(12), 1509-1528. doi: Aguilar, H. M., Abad-Franch, F., Dias, J. C., 10.1017/S0031182009990977 Junqueira, A. C., & Coura, J. R. (2007). Miles, M. A., Povoa, M. M., de Souza, A. A., Chagas disease in the Amazon Region. Lainson, R., Shaw, J. J., & Ketteridge, D. S. Memórias do Instituto Oswaldo Cruz, 102 (1981). Chagas's disease in the Amazon Suppl 1, 47-56. Basin: II. The distribution of Trypanosoma Bérenger, J. M., Pluot-Sigwalt, D., Pages, F., cruzi zymodemes 1 and 3 in Pará State, Blanchet, D., & Aznar, C. (2009). The north Brazil. Transactions of the Royal Triatominae species of French Guiana Society of Tropical Medicine and Hygiene, (Heteroptera: Reduviidae). Memórias do 75(5), 667-674. Instituto Oswaldo Cruz, 104(8), 1111- Miles, M. A., Souza, A., Povoa, M., Shaw, J. J., 1116. doi: S0074-02762009000800007 Lainson, R., & Toye, P. J. (1978). Isozymic [pii] heterogeneity of Trypanosoma cruzi in the Burgos, J. M., Altcheh, J., Bisio, M., Duffy, T., first autochthonous patients with Chagas' Valadares, H. M., Seidenstein, M. E., . . . disease in Amazonian Brazil. Nature, Schijman, A. G. (2007). Direct molecular 272(5656), 819-821. profiling of minicircle signatures and Oostburg, B. F., Anijs, J. E., Oehlers, G. P., Hiwat, H. lineages of Trypanosoma cruzi O., & Burke-Hermelijn, S. M. (2003). Case bloodstream populations causing report: the first parasitologically congenital Chagas disease. International confirmed autochthonous case of acute Journal for Parasitology, 37(12), 1319- Chagas disease in Suriname. Transactions 1327. of the Royal Society of Tropical Medicine Dedet, J. P., Chippaux, J. P., Goyot, P., Pajot, F. X., and Hygiene, 97(2), 166-167. Tibayrenc, M., Geoffroy, B., . . . Jacquet- Póvoa, M. M., de Souza, A. A., Naiff, R. D., Arias, J. Vialet, P. (1985). Les hôtes naturels de R., Naiff, M. F., Biancardi, C. B., & Miles, Trypanosoma cruzi en Guyane française. M. A. (1984). Chagas' disease in the Endémicité élevée du zymodéme 1 chez Amazon basin IV. Host records of les Marsupiaux sauvages. Annales de Trypanosoma cruzi zymodemes in the Parasitologie Humaine et Comparée, states of Amazonas and Rondonia, Brazil. 60(2), 111-117. Annals of Tropical Medicine and Gardel, A. (2001). Les paysages urbains de l'île de Parasitology, 78(5), 479-487. Cayenne, Guyane française. Rambajan, I. (1984). The first autochthonous case Mappemonde, 63(3/2001), 16-21. of Chagas' disease with notes on possible Holmes, John C. (1996). Parasites as threats to vectors in Guyana. Tropical and biodiversity in shrinking ecosystems. Geographical Medicine, 36(1), 73-76. Biodiversity and Conservation, 5(8), 975- Rassi, A., Jr., Rassi, A., & Marin-Neto, J. A. (2010). 983. Chagas disease. Lancet, 375(9723), 1388- INSEE. (2011). Populations légales en vigueur à 1402. doi: 10.1016/S0140-6736(10)60061- compter du 1er janvier 2012. X Recensement de la population. Thomas, S., Westenberger, S. J., Campbell, D. A., & Arrondissements - cantons - communes. Sturm, N. R. (2005). Intragenomic spliced 973 - Guyane J. P. Cotis (Ed.) Retrieved leader RNA array analysis of kinetoplastids from http://www.insee.fr/fr/ppp/bases- reveals unexpected transcribed region de-donnees/recensement/populations- diversity in Trypanosoma cruzi. Gene, 352, legales/pages2011/pdf/dep973.pdf 100-108. doi: 10.1016/j.gene.2005.04.002 Lewicka, K., Brenière-Campana, S. F., Barnabé, C., Yeo, M., Acosta, N., Llewellyn, M., Sanchez, H., Dedet, J. P., & Tibayrenc, M. (1995). An Adamson, S., Miles, G. A., . . . Miles, M. A. isoenzyme survey of Trypanosoma cruzi (2005). Origins of Chagas disease: genetic variability in sylvatic cycles from Didelphis species are natural hosts of French Guiana. Experimental Parasitology, Trypanosoma cruzi I and armadillos hosts 81(1), 20-28. of Trypanosoma cruzi II, including hybrids. Miles, M. A., Llewellyn, M. S., Lewis, M. D., Yeo, M., International Journal for Parasitology, Baleela, R., Fitzpatrick, S., . . . Mauricio, I. 35(2), 225-233. L. (2009). The molecular epidemiology and Zingales, B., Andrade, S. G., Briones, M. R., phylogeography of Trypanosoma cruzi and Campbell, D. A., Chiari, E., Fernandes, O., . parallel research on Leishmania: looking . . Schijman, A. G. (2009). A new

Acad J Sur 2014 (5) 456-460 Trypanosoma cruzi in French Guiana 460

consensus for Trypanosoma cruzi 104(7), 1051-1054. doi: S0074- intraspecific nomenclature: second 02762009000700021 [pii] revision meeting recommends TcI to TcVI. Memórias do Instituto Oswaldo Cruz,

Acad J Sur 2014 (5) 456-460