INFORMATION TO USERS
This manuscript has been reproduced from the microfilm master. UMI films the text directly fi-om the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer.
The quality of this reproduction is dewndent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely afifect reproductiorL
In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.
Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, b^inning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back of the book.
Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6” x 9” black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order. UMI A Bell & Howell Infbrmaiion Company 300 North Zeeb Road, Ann Arbor MI 48106-1346 USA 313/761-4700 800/S21-0600
NOTE TO USERS
The original manuscript received by UMI contains pages with indistinct print. Pages were microfilmed as received.
This reproduction is the best copy available
UMI
PHYLOGENY, EVOLUTION, AND BIOGEOGRAPHY OF THE DARTER SUBGENUS ULOCENTRA (GENUS ETHEOSTOMA. FAMILY PERCIDAE)
DISSERTATION
Presented in Partial Fulfillment of the Requirements for
the Degree Doctor of Philosophy in the Graduate
School of the Ohio State University
By
Brady A. Porter, B.A.
*****
The Ohio State University 1999
Dissertation Committee: Approved by
Professor Ted M. Cavender, Co-Advisor Professor Paul A. Fuerst. Co-Advisor cxTy Professor Thomas E. Hetherington Co-Advisors Graduate program in Zoology UMX N um ber: 9919902
UMI Microform 9919902 Copyright 1999, by UMI Company. All rights reserved.
This microform edition is protected against unauthorized copying under Title 17, United States Code.
UMI 300 North Zeeb Road Ann Arbor, MI 48103 ABSTRACT
The phylogenetic relationships of the 20 described species of snubnose darters, subgenus Ulocentra, and 11 members of the proposed sister subgenus Etheostoma were investigated with 1033 base pairs of mitochondrial DNA sequence data and 54 osteological characters. Three hypotheses on the interrelationships and monophyly of these two subgenera were evaluated. Monophyly for the subgenus Ulocentra was supported, but the subgenus Etheostoma appears to be polyphyletic. Mitochondrial DNA sequence data from the entire control region, tRNA Phe gene, and partial 12S rRNA gene, were analyzed for 78 population samples of species within the subgenera Ulocentra and Etheostoma, producing species-level resolution of phylogenetic relationships.
Population analysis of select darter species was performed using the heteroduplex method. Phylogeography was used to interpret the genetic variation between populations and species of Ulocentra on maps of their geographic distributions, indicating that vicariance events from the Late Pleistocene through the Holocene were important in forming four major clades of snubnose darters. Most Ulocentra species are allopatric.
Recent secondary dispersal seems to best explain the cases of the syntopic distributions.
Osteological analysis of 54 phylogenetic characters was performed on cleared and stained specimens of the subgenera Ulocentra and Etheostoma. Monophyly of the
II subgenus Ulocentra was supported in the strict consensus cladogram by four osteological characters. Several osteological apomorphies united members of the subgenus Ulocentra and £. histrio. Additional apomorphic characters united members of the E. simoterum species group with E. duryi and E. flavum, and were shared with E. blennioides. Many of the osteological apomorphies for Ulocentra species resulted from specialization for benthic feeding in slow moving stream habitats.
Both the molecular and morphological data sets supported the monophyly of the subgenus Ulocentra. The banded darter, E. zonale, and its sister E. lynceum, were not the closest relatives to the snubnose darters and may be best classified apart from other members of the subgenus Etheostoma by resurrecting the subgenus Nanostoma. The sister group to the subgenus Ulocentra contained a restricted assembly of species within the subgenus Etheostoma comprised of E. blennioides, E. rupestre, E. blennius, the thalassinum species group, and E. histrio.
Ill Dedicated to Mom and Dad
IV ACKNOWLEDGMENTS
A special thanks to the volunteer field assistance of Charlotte A. Adams, Michelle
I. Carter, Ted M. Cavender, Robin D. Clipson, Christine M. Demko, Marc Kibbey,
William J. Polly, John W. Provance IV., Chris Roberts, Jay Studebaker, James VanDyne, and the OSU Zoology 626 classes from 1992-1996. Additional samples were kindly provided by Mark Binkley, Noel M. Burkhead, Neil H. Douglas, David A. Etnier,
William J. Polly, and Stephen J. Walsh. Collection localities, including those that would become the type localities of undescribed snubnose darter species were generously provided by Reeve M. Bailey, Herbert T. Boschimg, David A. Etnier, and Ted M.
Cavender.
Technical laboratory consultation was freely provided by Greg Booton. Jill
Diedrich, Wenrui Dwan, Jeannette Kreiger, Brian Mark, Wilson Mwanja, Malcolm
Schug, Diane Stothard, and Lizhao Wu. Preliminary biochemical analysis of darter pigments was performed in the College of Pharmacy under the direction of Robert W.
Curley, who provided me with analytical materials and superior guidance. Assistance with data manipulation, figures, and tables was provided by Greg Booton, Brian Mark, and Michelle Carter. Cladistic analysis, Bremmer support and Jackknife analysis was assisted by John W. Wenzel. Assistance with rangemaps and phylogeographic figures was kindly provided by Heather and Chris Caprette. Cataloguing of specimens was assisted by Tom Nickel, Mark Kibbey, Jason Ferguson, Ted Cavender, and Jeannette
Kreiger. A special thanks to Michelle Carter, who assisted with the fieldwork, figures. and formatting of the dissertation document, and provided moral support during the completion of this project.
I applaud the outstanding efforts of the library staff at the OSU Biology and
Pharmacy Branch Library, who went to great efforts to provide me with articles relating to my studies. Assistance in locating topographic and county maps to collection localities was provided by Charles Dowdy, Map Librarian in the Museum of Biological Diversity.
This project benefited from discussions with Lawrence M. Page, David A. Etnier,
Reeve M. Bailey, Royal D. Suttkus, and William J. Poly. A special thanks to my co advisors Drs. Ted M. Cavender and Paul A. Fuerst for assisting in the initiation and development of this project and to Drs. Thomas E. Hetherington. John W. Wenzel, and
John Condit for their valuable comments on the manuscript. This project would not have been possible without their continued support and guidance throughout the entire process of my graduate studies. This project was supported by the Ohio State University College of Biological Sciences, Departments of Zoology and Molecular Genetics, the OSU
Graduate Student Alumni Research Award, and the Presidential Fellowship.
VI VITA
February 8, 1968 ...... Bom - Lakewood, OH
1990 B.A. Zoology Ohio Wesleyan University Delaware, OH
1990-1991 ...... Biochemistry Technician, Battelle Memorial Institute Columbus, OH
1992-1996 Teaching Associate, Department of Zoology, The Ohio State University
1995-1998 ...... Research Associate, Department of Molecular Genetics and Zoology The Ohio State University
1996 Presidential Fellow, Department of Zoology The Ohio State University
vu PUBLICATIONS
1. Porter, B.A., M.D. Schug, L. Wu, T.M. Cavender, P.A. Fuerst. 1997. DNA Fingerprinting (multilocus VNTRs) and microsatellites used to study population differences in Lake Sturgeon in the Great Lakes. Abstract from 59th Midwest Fish and Wildlife Conference, Milwaukee, WI.
2. Porter, B. A. 1997. Molecular phytogeny and the evolution of male nuptial pigments in the darter subgenus Ulocentra (Perciformes: Percidae). Abstracts from ASIH, Seattle, WA.
3. Cavender, T., B. Porter, T. Nickell, and P. Fuerst. 1997. Morphological and Karyological characteristics of the Lake Erie population of round goby. In The Round Goby, Neogobius melanostomus (Pallas), A Review of European and North American Literature. (Charlebois et. al. Eds.) IL-IN Sea Grant Program and IL Nat. Hist. Survey. INKS Special Pubhcadon No. 20.
4. Porter, B., T. Cavender, P. Fuerst, and T. Nickell. 1995. The genetic status of lake sturgeon in Lake Erie and other populations from the Laurendan Great Lakes. Sturgeon News. 1995:5.
5. Porter, B.A., M.D. Schug, P.A. Fuerst, and T.M. Cavender. 1994. Allozyme variadon in wild and capdve stock populadons of ± e lake sturgeon. Acipenser Julvescens. The Ohio Journal of Science. 94(2):28.
6. Schug, M.D., B.A. Porter, P.A. Fuerst, P. Parker, and T.M. Cavender. 1994. Molecular genedc differendadon between natural and stock populadons of the endangered lake sturgeon {Acipenser fulvescens) revealed using VNTR DNA markers. Ohio Journal of Science 94(2):27-28.
7. Burtt, E.H., J.A. Swanson, B.A. Porter, and S.M. Waterhouse. 1994. Wing-flashing in Mockingbirds of the Galapagos Islands. Wilson Bulletin 106(3): 559-562.
FIELDS OF STUDY
Major Field: Zoology.
Specializadons: Ichthyology and Molecular systemadcs.
vm TABLE OF CONTENTS
Page Abstract...... ii
Dedication...... iv
Acknowledgments ...... v
Vita...... vii
List of Tables...... xi
List of Figures...... xii
Chapters:
1. Molecular Phylogeny, Systematics, and Phylogeography of the Darter Subgenera Ulocentra, Nanostoma, and Etheostoma (Genus Etheostoma, Family Percidae)
Introduction...... 1 Materials and Methods ...... 9 Sample Collection ...... 9 DNA Extraction, PCR Amplification, and DNA Sequencing...... 14 Polymorphism Screening ...... 19 DNA Analysis ...... 23 Results...... 25 DNA Regions Examined ...... 25 Structure of the mtDNA Control Region...... 25 Structure of the Mitochondrial tRNA Phe gene....30 Structure of the Partial 12S rRNA Gene...... 33 The Combined mtDNA Data Set ...... 33 Tests for Nucleotide Saturation...... 34 Phylogenetic Analysis of the Combined mtDNA Data Set...... 37
IX Intraspecific Variation ...... 47 Phylogeography ...... 49 Discussion...... 56 Systematics and Classification ...... 56 Phylogeography of the Subgenus Ulocentra ...... 58 Legitimacy of the Described Ulocentra species.. ..69
2. Osteological Analysis of the Darter Subgenera Ulocentra. Nanostoma, and Etheostoma (Genus Etheostoma. Family Percidae) 71
Introduction...... 71 Methods and Materials ...... 72 Sample Collection ...... 72 Clearing and Staining ...... 73 Phylogenetic Analysis ...... 74 Osteological Character Descriptions ...... 74 Cranial Skeleton...... 77 Jaws...... 77 Suspensorium...... 82 Opercular Series...... 86 Branchiohyoid Apparatus ...... 90 Infraorbital Series...... 92 Cranium...... 96 Appendicular Skeleton...... 100 Pectoral Girdle ...... 100 Pelvic Girdle ...... 103 Axial Skeleton...... 106 Results...... 108 Discussion...... 109 Summary...... 117
Appendix A ...... 121
Appendix B ...... 142
Appendix C ...... 169
Literature Cited...... 170 LIST OF TABLES
Table Page
1.1 Summary of morphological classifications of Ulocentra and Etheostoma Darters...... II
1.2 Abbreviated collecting information organized by site number and species restricted to the samples used in mtDNA analysis ...... 12
1.3 Primer sequences for PCR amplification, heteroduplex, and DNA sequencing of the mtDNA control region, tRNA Phe gene, and partial I2S rRNA gene in darters ...... 18
1.4 Haplotypes revealed by screening 355bp PCR amplifications from a portion of the mtDNA control region proper ...... 48
1.5 Percent nucleotide sequence divergence between robust clades. sister species, and intraspecific haplotypes. Only nucleotides with a fixed difference between the two groups were counted ...... 55
2.1 Osteological character matrix for phylogenetic analysis ...... 75
XI LIST OF FIGURES
Figure
1.1 Three hypotheses on the interrelationships of darters in the subgenus Etheostoma. (a) Arrangement proposed by Collette (1962) based on tuberculation. (b) Morphological investigation by Richards (1966). (c) Morphological study of Tsai (1966) ...... 4
1.2 Three competing hypotheses on the phylogenetic associations between species in the subgenera Etheostoma and Ulocentra. (a) Page (1981). (b) Bailey and Etnier (1988). (c) Wood (in Boschung et al., 1992) ...... 6
1.3 A cartoon comparing the structure of a portion of mtDNA for two darter species. The linear diagram represents a scaled map of the tRNA Thr gene, tRNA Pro gene, control region, tRNA Phe gene, and partial 12S rRNA gene. Each centimeter is approximately equal to 1 OObp. The location of primers used for PCR amplification, heteroduplex analysis, and DNA sequencing are illustrated in black and labeled with a primer name (see Table 1.3) and an arrow indicating orientation. The difference in mtDNA sequence length between the darter species is due to variation in the number of tandem repeats and the size of the degraded repeat ...... 16
1.4 Ditribution of variation in the aligned mtDNA sequence of darters in the Etheostoma group (Bailey and Etnier, 1988). The control region proper (tandem repeat excluded) is in black, the tRNA Phe gene in white, and the partial 12S rRNA gene in gray ...... 28
1.5 Secondary structure of the tRNA Phe gene in darters inferred firom mtDNA sequence data, (a) Members of the subgenus Etheostoma. (b) Members of the E. cossae-E. scotti group of the subgenus Ulocentra. (c) Members of the E. simoterum species group. (d) Members of the remaining E. duryi-E. flavum group and Coastal Plains species group ...... 3 1
XU 1.6 A plot of the frequencies of transitions (open circles) and transversions (solid circles) against pairwise nucleotide-sequence divergence ...... 35
1.7 Frequency of unambiguous nucleotide changes evaluated on a strict consensus maximum parsimony tree...... 36
1.8 Maximum Parsimony strict consensus cladogram of 78 darter taxa representing the subgenera Etheostoma and Ulocentra as inferred from mtDNA sequence data. Statistical support is shown with jackknife values (above the node) and Bremmer support values below. Taxon names are followed by the colleciton site number and haplotype code. The indicates that the sample came from the type locality ...... 38
1.9 Neighbor-joining phenogram of 78 darter taxa representing the subgenera Ehteostoma and Ulocentra as inferred from mtDNA sequence data. Statistical support is shown with bootstrap values from 1000 replicates. Taxon names are followed by the collection site number and haplotype code. The indicates that the sample came from the type locality ...... 41
1.10 Maximum Likelihood tree of 78 darter taxa representing the subgenera Etheostoma and Ulocentra as inferred from mtDNA sequence data constructed with PHYLIP. Taxon names are followed by the colleciton site number and haplotype code. The indicates that the sample came from the type locality ...... 43
1.11 Maximum Likelihood tree of 78 darter taxa representing the subgenera Etheostoma and Ulocentra as inferred from mtDNA sequence data constructed with PUZZLE. Taxon names are followed by the colleciton site number and haplotype code. The indicates that the sample came from the type locality ...... 45
1.12 Distribution of the twenty described species of the subgenus Ulocentra. Black dots identify collection sites labeled with site number (in reference to Table 2)...... 50
1.13 Distribution and phylogeography of the £. simoterum group of the subgenus Ulocentra. Haplotypes are identified by site number and haplotype number. Tick marks represent 4 bp fixed differences between haplotypes or haplotype groups ...... 52
xm 1.14 Distribution of £ duryi-E. flavum group (in the Tennessee, Duck, and Cumberland Rivers) and the E. coosae-E. scotti group (in the Coosa and Etowha Rivers) of the subgenus Ulocentra. Haplotypes are identified by site number and haplotype number. Tick marks represent 4 bp fixed differences between haplotypes or haplotype groups ...... 53
1.15 Distribution and phylogeography of the Coastal Plains group of the subgenus Ulocentra. Haplotypes are identified by site number and haplotype number. Tick marks represent 4 bp fixed differences between haplotypes or haplotype groups ...... 54
1.16 Hypothetical distribution of ancestral members of the subgenus Ulocentra in the early Pleistocene. Two populations, one in the Cumberland, Duck, and Tennessee Rivers, and the other in the Coastal Plains, Tennessee, and Duck had limited genetic exchange in portions of the Tennessee and Duck Systems ...... 61
2.1 Lateral view of left premaxillae and maxillae of (a) E. tetrazonum (b) E. baileyi, (c) E. coosae, (d) E. rafinesquei. Hyphenated numbers refer to transformation series and character state. Scale bar equals 1mm...... 78
2.2 Lateral view of left dentary and anguloarticular of (a) E. tetrazonum. (b) E. zonale, (c) E. coosae, and (d) E. baileyi. Mandibular pores are numbered anterior to posterior. Hyphenated numbers refer to transformation series and character states. Scale bar equals 1mm ...... 80
2.3 Lateral view of left suspensorium of (a) Etheostoma tetrazonum. (b) E. zonale, (c) E. rafinesquei. Hyphenated numbers refer to transformation series and character state. Scale bar equals 2mm ...... 83
2.4 Lateral view of left hyomandubular, opercle and subopercle form (a) Etheostoma thalassinum, (b) E. zonale. (c) E. atripinne. Hyphenated numbers refer to transformation series and character states...... 87
2.5 Lateral view of left preopercle from (a) Etheostoma tetrazonum (b) E. histrio. Hyphenated numbers refer to transformation series and character states. Scale bar equals 1mm.
2.6 Dorsal view of the lower branchial apparatus and ventral view of the upper branchial apparatus from (a) Etheostoma tetrazonum (b) E. simoterum. Hyphenated numbers refer to transformation (c) series and character states. Scale bar equals 1mm ...... 91
xiv 2.7 Lateral view of left inft-aorbital series from (a) Etheostoma tetrazonum, (b) E. lynceum, (c) E. swannanoa, (d) E. histrio, (e) E. blennioides, (f) E. blennius, (g) E. coosae, (h) E. flavum, (i) E. baileyi, (j) E. barrenense, (k) E. simoterum, (I)E. atripinne. The enlarged lacrimal is infraorbital number I. Hyphenated numbers refer to transformation series and character states. Scale bar equals 1mm...... 93
2.8 Lateral view of cranium...... 97
2.9 Frontal view of right lateral ethmoid of (a) Etheostoma zonale (b) E. flavum showing variation in the closure of the olfactory foramen. Hyphenated numbers refer to transformation series and character state. Scale bar equals 1mm...... 99
2.10 Lateral view of left pectoral girdle of (a) Etheostoma tetrazonum. (b) E. swannanoa, (c) E. simoterum. Hyphenated numbers refer to transformation series and character states. Scale bar equals 1mm ...... 101
2.11 Ventral view of the pelvic girdle from (a) Etheostoma tetrazonum, (b) E. zonale, (c) E. etnieri. Hyphenated numbers refer to transformation series and character states. Scale bar equals 1mm...... 104
2.12 Lateral view of the enlarged and flattened distal portion of epineural 1 that articulates with postcleithrum 2 (removed) in Etheostoma tetrazonum. Hyphenated number refers to transformation series and character states. Scale bar equals ..1mm...... 107
2.13 Maximum Parsimony strict consensus cladogram of 14 equally parsimoneous trees of 196 evolutionary steps for 54 osteological characters coded for members of the subgenera Etheostoma and Ulocentra ...... 109
XV CHAPTER 1
Molecular Phylogeny, Systematics, and Phylogeography of the Darter
Subgenera Ulocentra, Nanostonm, and Etheostoma
(Genus Etheostoma, Family Percidae).
INTRODUCTION
The genus Etheostoma is subdivided into 17 or 18 subgenera with around 120 taxa, making it the largest genus of North American freshwater fish. The snubnose darters, subgenus Ulocentra, are considered one of the largest and most rapidly expanding subgenera of Etheostoma, with 20 described species and several
undescribed forms. Ulocentra species have tremendous morphological overlap in meristic counts (Page and Burr, 1982; Suttkus and Etnier, 1991; Suttkus and Bailey,
1993) and principal component analyses (Boschung et ai., 1992; Suttkus et al.,
1994). New species are primarily described on variations of pigmentation and coloration of the male during a three month breeding season, but throughout the remainder of the year males converge on a cryptic coloration that makes species
identity problematic. Despite the extreme morphological similarities between Ulocentra species, there are surprisingly few synapomorphies uniting all members of the group. The diagnosis and redescription of the subgenus Ulocentra was performed by Bouchard
(1977) and appended by Bailey and Etnier (1988). In light of present knowledge on the character states in all 20 Ulocentra species, none of the eight '‘diagnostic” characters of Bouchard (1977) can still be considered as synapomorphies shared by all members of the subgenus. Only one character proposed by Bailey and Etnier
(1988) still has potential for being a synapomorphy of the group. In the nine
Ulocentra species studied to date, females lay eggs individually on vertical rock faces [E. rafinesquei, E. barrenense UfJiim., 1958; Stiles, 1974; Weddle, 1990), E. coosae (O’Neil, 1981); E. simoterum atripinne (Page and Mayden, 1981, Porterfield.
1997) £. duryi (Page et al., 1982, Porterfield. 1997a), E. baileyi (Page, 1985), E. zonistium, E. pyrrhogaster (Camey and Burr, 1989), and E. flavum (Keevin et al,
1989, Porterfield, 1997a)], a reproductive strategy not known from any other group of darters.
The subgenus Ulocentra has been divided into two major species groups.
Members of the plesiomorphic E. duryi species group lack a premaxillary frenum, and retain vomerine teeth, while the members of the E. simoterum species group retain a ffenum and lack vomerine teeth (Bouchard, 1977; Bailey and Etnier, 1988). The plesiomorphic species E. coosae (and a newly described sister species E. scotti) form a primitive subgroup within the duryi species group (Bailey and Etnier, 1988;
Baueret et al., 1995), and a second subgroup has been proposed for five coastal plains species (Suttkus et al., 1994).
The subgenus Etheostoma, with its 15 species, has been proposed as the sister subgenus to Ulocentra based on available morphological evidence (Richards, 1966;
Bouchard, 1977). Features that unite these two subgenera include a rounded snout, long expansive pectoral fins, broadly connected branchiostegal membrane, and an elongation of the female urogenital tube (Bouchard, 1977; Bailey and Etnier, 1988).
Additional systematic studies of the subgenus Etheostoma have been performed using tuberculation (Collette, 1962), and other morpholological characters (Richards.
1966; Tsai and Raney, 1974) Figures l.la-c. The close affiliation between subgenera Ulocentra and Etheostoma has provided grounds to combine them into the
Etheostoma group (Bailey and Etnier, 1988), however none of the proposed characters can be considered as independent synapomorphies.
Three competing ideas have been proposed regarding the association between species in the subgenera Etheostoma and Ulocentra. Several authors (Page 1981 ;
Page and Burr, 1982; Burr and Warren, 1986) support the idea that the banded darter,
E. zonale, is more closely related to the snubnose darters than to members of the subgenus Etheostoma (Figure 1.2a). Since E. zonale was designated as the type species of the subgenus Nanostoma Jordan 1877, a senior name to the subgenus Figure 1.1. Three hypotheses on the interrelationships of darters in the subgenus Etheostoma. (a) Arrangement proposed by Collette (1962) based on tuberculation. (b) Morphological investigation by Richards (1966). (c) Morphological study of Tsai (1966). U locentra sp . sellare euzonum tetrazonum variatum kanaw hae o sb u m i blennius zonale rupestre histrio blennioides thalassinum sw annanoa inscriptum
Ulocentra sp. euzonum tetrazonum variatum kanaw hae o sb u m i blennius sella re blennioides zon ale rupestre histrio thalassinum sw annanoa ëroup inscriptum
U locentra sp . sellare euzonum tetrazonum variatum kanaw hae o sb u m i blennioides zonale rupestre I hixtrin-hlf-nnhK! blennius h istrio sw annanoa thalassinum inscriptum
Figure 1.1. Three proposed Etheostoma çhyXogenies.
5 Figure 1.2. Three competing hypotheses on the phylogenetic associations between species in the subgenera Etheostoma and Ulocentra. (a) Page (1981). (b) Bailey and Etnier (1988). (c) Wood (in Boschung et al., 1992). Etheostom a(s.s.)
E. coosae
N anostom a AU o th er 'Ulocentra"
L itocara E. sagitta E. nianguae E. sellare variatum group E inscriptum E. thalassinum E blennius E swannanoa E. blennioides E. zonale E. lynceum E. rupestre E. histrio sim oterum group E. coosae U locentra duryi group
E theostom a grou p 1
E theostom a U locentra grou p l
E theostom a grou p 2
U locentra group 2
Figure 1.2. Three hypothesized phylogénies on Etheostoma and Ulocentra. Ulocentra Jordan 1878, the valid subgeneric name of snubnose darters inclusive of
E. zonale would be the subgenus Nanostoma (International Code of Zoological
Nomenclature, 1985).
Bailey and Etnier (1988) claim that the morphological similarities between E. zonale and snubnose darters are merely examples of convergent evolution and that the reproductive behavior of the banded darter is more similar to that seen in the members of the subgenus Etheostoma. These researchers support the views of
Richards (1966) and Bouchard (1977), by placing £. zonale within the subgenus
Etheostoma and regarding Ulocentra as the monophyletic sister subgenus (Figure
1.2b). Recent allozyme studies cited via personal communication with Robert M.
Wood (Boschung et al., 1992) are said to provide evidence that the snubnose darters are biochemically indistinguishable from various members of the subgenus
Etheostoma and therefore should all be combined into the subgenus Etheostoma
(Figure 1.2c). This hypothesis however, is not supported by the actual allozyme data
published to date (Wood and Mayden, 1997).
Despite these numerous taxonomic studies on the Etheostoma group and the
subgenus Ulocentra, systematists currently take opposing views on the total number
of snubnose species / subspecies, the importance of various characters in defining the
group, and the validity of subgeneric names. New Ulocentra / Nanostoma species
continue to be described on the evaluation of male ephemeral breeding coloration;
however color itself is not a traditional morphological character as it is reliant on the
subjective perception of an observer, and not necessarily on a quality possessed by
8 the organism. Aside fix>m the delineation of a few sister species pairs, the species- level relationships of Ulocentra darters have remained unknown.
This study combines DNA sequence data from the rapidly evolving mtDNA control region with more conserved sequences from the tRNA Phe gene and portions of the 12S rRNA gene to infer phylogenetic relationships of snubnose darters and
their allies. Tests for reciprocal monophyly of subgenera Ulocentra, Nanostoma. and Etheostoma will be employed to evaluate the three competing hypotheses on the
interrelationships of the Etheostoma group. Species-level relationships of the group
will be investigated, including an analysis of intrapopulation variation, and
correlations between meristic and molecular characters sets will be discussed for
snubnose species. Phylogenetic relationships and estimations of divergence times
will be overlaid on geographic distribution data using the phylogeographic method
(Avise et al., 1987) to provide insight into the evolutionary processes of spéciation.
MATERIALS AND METHODS
Sample Collection
Taxa were selected to test current hypotheses regarding the monophyly of the
subgenera Ulocentra, Nanostoma, and Etheostoma (Page, 1981; Bailey and Etnier,
1988, Wood and Mayden, 1997). A taxonomic summary of species important to this
study is presented in Table 1.1. Efforts were made to collect snubnose species from
their type localities in breeding season, or from localities known to only have one species of snubnose darter, to help diminish questions of species identification.
Samples were taken by kick seining into a downstream “common sense” seine (1.8 x
2.4 meter fine mesh nylon). Each collection locality was given a site number (Table
1.2) and each collection was assigned a unique field number. Specimens were sorted to species lots and assigned a unique catalogue number for voucher in The Ohio
State University Museum of Zoology (OSUM) collections. An extended Table of the darter species included in this analysis, collection localities, sample size, site number, and OSUM number is provided in Appendix A.
DNA samples were frozen on liquid nitrogen in the field for transportation to the OSUM where they were stored at —70° C. Additional DNA samples were generously supplied by Mark Binkley, Noel Burkhead, Neil Douglas, David Etnier,
William Poly, and Steve Walsh and arrived either live, on dry ice. in 95% ethanol, or in high salt buffer. All specimens were dehydrated with two treatments of absolute ethanol and stored in that condition for at least twenty-four hours prior to DNA extraction. DNA specimens stored in 95% ethanol were deposited in the OSUM
DNA Archive.
10 Gtnns Etheostoma Rafinesaque, 1819
Etheostoma group Bailey and Etnier. 1988
Subgenus Etheostoma Rafinesque. 1819 E. setlare (RadclifTe and Welsh), 1913 E variatum species group (Hubbs and Trautman). 1932 E variatum KÀtûand, 1838 E ostom i (Hubbs and Trautman). 1940 E tetrazonum Hubbs and Black), 1940 E euzonum (Hubbs and Black). 1940 E kanatvhae (Raney), 1941 E thalassinum species group Richards. 1966 E inscriptum (Jordan and Brayton), 1878 E thalassinum loràan and Brayton). 1878 E swannanoa Jordan and Evermann. 1889 E blennioides species group Porter. 1998 E blennioides blennioides Rafinesque. 1819 E blennioides newmani (.Agassiz). 1854 E blennioidespholidotum Miller. 1968 E blennius blennius (Gilbert and Swain). 1887 E blennius sequatchiense Burr. 1979 E rupestre Gilbert and Swain, 1887 E histrio (Gilbert and Swain), 1887 Subgenus yVoRos/oma Pumam. 1877 E zonale (Cope), 1868 E lynceum (Hay), 1885 Subgenus Ulocentra Jordan. 1878 £. simorenun species group Bouchard. 1977 E baileyi Page and Burr. 1982 Erafinesquei Burr and Page, 1982 E barrenense Burr and Page. 1982 E simoterum (Cope), 1868 E atripinne iox&an, 1877 £1 rfuiyt species group Bouchard. 1977 E duryi Henshall. 1889 E flavum Etnier and Bailey, 1989 E pyrrhogaster Bailey and Etnier. 1988 E zonistium Bailey and Etnier. 1988 E etnieri Bouchard, 1977 E chermocki Bouschung, Mayden. and Tomelleri. 1992 E bellator Suttkus and Baileyi. 1993 E brevirostrum Suttkus and Etnier. 1991 £1 coosae subgroup Bailey and Etnieri. 1988 E coosae (Fowler), 1945 E scotti Bauer, Etnier. and Burkhead. 1995 "E taUapoosae” subgroup Suttkus. Bailey, and Bart, 1994 E taUapoosae Suttkus and Etnier, 1991 E ram sqfi Suttkus and Bailey, 1994 E raneyi Suttkus and Bart 1994 E lachneri Suttkus and Bailey, 1994 E colorosum Suttkus and Bailey, 1993
Table 1.1. Summary of morphological classifications of Ulocentra and E theostom a darters. II Site Locality Species #
2 Little Trammel Creek, Allen Co., KY £. barrenense, E. zonale 4 Wiggington Creek. Logan Co., KY E rqfinesquei 5 Pleasant Run Creek, Logan Co., KY £ fla v tm 6 Red River, Powell/ Menifee Co., KY £ zonale 7 Gladie Creek, Menifee Co., KY £ baileyi, £ variatum 8 Pleasant Run Creek, Logan Co., KY £ fla vu m 9 Caney Valley Creek, Claibom Co., TN £ sim oterum 10 Little Sycamore Creek, Claiborne Co., TN £ sim oterum 11 Mill Creek, Pumam Co., TN £ etnieri, £ blennioides newmani 12 Duck River, Marshall Co., TN £ atripinne 13 Defeated Camp Creek, Hickman Co., TN £ fla vu m 14 Sycamore Creek, Benton Co., TN £ zonistium 15 West Sandy Creek Drainage CanaL Henry Co., TN £ zonistium 16 Clear Creek, Henry Co., TN £ pyrrhogaster, £ lynceum 17 Terrapin Creek, Henry Co., TN £ pyrrhogaster 23 Butler Creek, Cobb Co., GA £ sco tti 24 Butler Creek, Cobb Co., GA £ sco tti 27 Lake Creek, Floyd Co., GA £ coosae 30 Shoal Creek. Cleburne Co., AL £ brevirostrum (type local), £ coosae 31 Turkey Creek, Jefferson Co., AL £ cherm ocki 32 Turkey Creek, Jefferson Co., AL £ cherm ocki (type locality) 33 Gurley Creek, Blount Co., AL £ bellator 34 Bledsoe Creek, Sumner Co., TN £ atripinne 37 McWilliams Creek, Sequatchie Co., TN £ duryi, £ blennius sequatchiense 38 Running Water Creek, Marion Co., TN £ duryi (type locality) 40 Jumpin In Creek, Carroll Co., GA £ taUapoosae 41 Hurricane Creek, Lafayette Co., MS £ raneyi (type locality) 42 Graham Mill Creek, Lafayette Co., MS £ raneyi 43 Pumpkin Creek, Lafayette Co., MS £lynceum 44 Wolf Creek, Choctaw Co., AL £ lachneri (type locality), £ rupestre 45 Little Creek, Merengo Co., AL £ ram seyi 46 Jordan Creek, Conecuh Co., AL £ colorosum 48 Enitachopco, Clay Co., AL £ taUapoosae 49 Verdin Creek, Cleburne Co., AL £ taUapoosae 50 Murphy Creek, Blount Co., AL £ bellator (type locality) 51 Pine Barren Creek, Escambia Co., FL £ colorosum 52 Little Sexton Creek, Clay Co., KY £ baileyi (type locality) 53 Little River, Blount Co., TN £ sim oterum 56 Cahaba River, Jefferson Co., AL £ ram seyi 57 North Fork Blue Creek, Giles Co., TN £ sim oterum 58 Cane Creek, Lincoln Co., TN £ duryi 61 Cherry Creek, White Co., TN £ etnieri (type locality) continued
Table 1.2. Abbreviated collecting information organized by site number and species restricted to the samples used in mtDNA analysis.
12 Site Locality Species #
63 Pomme de Terre River, Polk Co., MO E. tetrazonum, E. blennioides p. 65 West Prong Little Pigeon River, Sevier Co., TN £. sim oterum , E. sw annanoa 66 South Saluda River, Pickens/Greenville C., SC E. thalassinum 68 Little Eastatoe Creek, Pickens Co., SC E inscriptum 69 Barren Run, LaRue Co., KY E. barrenense (type locality) 70 Clear Creek, Rockcastle Co., KY E. b aileyi 71 Elliotts Creek, Hale Co., AL E. lachneri 74 Clifty Creek, Morgan/Roane Co., TN E simoterum 75 Mountaintown Creek, Gilmer Co., GA E. brevirostrum 76 Conasauga River, Polk Co., TN E coosae, E brevirostrum 77 Etowah River, Dawson Co., GA E brevirostrum 78 Cochrans Creek, Dawson Co., GA E brevirostrum 79 Trout Creek, LaSalle Co., LA E. histrio 80 Marrowbone Creek, Cumberland Co., KY E. atripinne 81 Mosley Springs, Chatooga Co., GA E coosae 82 Minnewauga Creek, Polk Co., TN £. coosae 84 Indian Creek, Hardin Co., TN E blennius blennius 85 Big Walnut Creek, Franklin Co., OH E zo n a le 86 Big Darby Creek, Franklin Co.. OH E. blennioides blennioides 87 Big Darby Creek, Pickaway Co., OH E. variatum 88 Rocky River, Cuyahoga Co., OH E. blennioides pholidotum
Table 1.2 Continued. Abbreviated collection localities continued.
13 DNA Extraction, PCR Amplification, and DNA Sequencing
A portion of muscle tissue from the right caudal peduncle was removed from each sample, blotted dry of ethanol, and minced into small pieces. DNA was extracted in 500 ul of ABI lysis buffer (0. IM Tris, 0.2 M NaCl, 4 M Urea, 0.01 M
CDTA, and 0.5% n-lauroylsarcosine) while incubating at 55°C for 12 to 24 h in the presence of 1% w/v protinase K. Genomic DNA was isolated from the extract through a series of equai-volume partitions with phenol-chloroform-isoamyl alcohol
(20:19:1) and ultracentrifugation. A final partition with 500 ul chloroform-isoamyl alcohol (19:1) assured the removal of phenol. Precipitation of the DNA was induced with cold absolute ethanol, and ultracentrifugation. The DNA pellets were washed with cold 70% ethanol and dried at room temperature before suspending in 1 X TE buffer.
The polymerase chain reaction (PCR) was utilized to amplify double stranded DNA products (1450 to 1600 bp in length) representing the entire mtDNA control region and tRNA Phe gene, along with partial tRNA Pro and 12S rRNA genes from each genomic template under the following conditions: lOO-lOOOng genomic DNA template, 2.5mM MgCE, 2mM of each dNTP, 0.5 units Taq DNA polymerase, a pair of oligonucleotide primers “Lpro”
5'AACTCTCACCCCTAGCTCCCAAAG3' (forward) and “12Sa-rev”
5TAGTGGGGTATCTAATCCCAG3’ (reverse) 5pM each, and reaction buffer
(Promega, or Gibco BRL) to a final IX concentration. PCR amplifications were
14 conducted in a Perkin Elmer Cetus thermal cycler under the following profiles: 2 min
hot start @ 93°C followed by 32 cycles of 45 sec @ 93°C, 1 min @ 58®C and 2 min
@ 72°C. Negative controls were included for each amplification experiment.
PCR products firom several species were cloned (TA Cloning Kit, Invitrogen
Corp., LaJolla, CA) following the direction of the manufacturer. Positive clones
were directly sequenced (Sequenase, USB Cleveland, OH) using the universal
primers for the vector. From these initial sequence data, nine new internal primers
were designed specifically for darters in the conserved portions of the control region.
tRNA Phe gene, and 12S rRNA gene (Figure 1.3, Table 1.3). These internal primers
were end-labeled with ATP in order to sequence the double-stranded PCR
products from each species using the dideoxy chain-termination procedure (dsDNA
Cycle Sequencing System, Gibco BRL). Sequence reactions were run for 3000 to
12000 volt hours through 6-8% polyacrylamide gels. Sequences were visualized by
autoradiography following a 12 to 168 hour exposure time to x-ray film.
15 Figure 1.3. A cartoon comparing the structure of a portion of mtDNA for two darter species. The linear diagram represents a scaled map of the tRNA Thr gene, tRNA Pro gene, control region, tRNA Phe gene, and partial 12S rRNA gene. Each centimeter is approximately equal to lOObp. The location of primers used for PCR amplification, heteroduplex analysis, and DNA sequencing are illustrated in black and labeled with a primer name (see Table 1.3) and an arrow indicating orientation. The difference in mtDNA sequence length between the darter species is due to variation in the number of tandem repeats and the size of the degraded repeat.
16 £, lonate
IKNA^ M itochondfM C om tot R«ok>n ^ tRNA \2 S iRNA (6 4 7 b p ) Phe l ? $ f# v tPh#m tZS.t t#v t26t-rtv TOKO TTT I
iT h f IPA O iA P O .2 RAPDJ I2 S 1 I 2 S 2 OHIT.I 0A PO 1 •«tRN A P(o
iRNA»^ lO'fnir*» MiochootfrM Control Roplon IRNA 12 S rRNA < Thf R tp M Il 126 re v (1 0 S 7 bp) (1 7 0 bp) TOKO t P n t r t i « » t re 1 2 6 # re v i ~ n I 126.1 126 2
« IRNA Pio Key; f. flavum ■ PC» prtmtt lilt - Control Region 12 S i»NA g«iw I III lO m e r Tirtdem Re peel
M - |»NA IlKtonlnt g«n« - Dincinn ol - Control Region coding gtiw Diceyed Repcet (V 10 !•)
- tRNA ProUno p i n t ' ConlxH Riglon OOfcllon ol 01 tRNA M #n y lil# n in t I D P io p tr pdmcr ompOIKollon O ' 10 1 1
Figure 1.3 A cartoon comparing the structure of a portion of mtDNA for two darter species. Prim er Sequence Direction and Use tThr 5’AGAGCGCCGGTCTTGTAATCC3’ Forward PCR primer LPro 5’AACTCTCACCCCTAGCTCCCAAAG3’ Forward PCR primer DHET.l 5’ACACCATACATTTATATTAACCAT3’ Forward heteroduplex primer BAPD.l 5ATCTCGTCATACCTCAAAATCTT3' Forward sequencing primer BAPD.2 5’ACGGTTATTGAAGGTGAGGGAC3 ’ Forward sequencing primer TDKD 5’CCTGAAGTAGGAACCAGATG3’ Reverse sequencing primer/ heteroduplex primer BAPD.3 5’GAACCACATATTAGGATATCATG3’ Forward sequencing primer BAPD.4F 5TGAAAACCCCCCGGAAAC AGG3 ’ Forward sequencing primer TPhen R 5’CTAGGGCCCATCTTAACATCTTCAG3’ Reverse sequencing primer I2S.l-rev 5’GGGTGTGGCTTAGCAAGGCGT3’ Reverse sequencing primer 12S.I 5’GCCTAGCCACACCCCCACGG3’ Forward sequencing primer 12S.2 5’GGTCAATTTCGTGCCAGCCA3’ Forward sequencing primer 12Sa-rev 5TAGTGGGGTATCTAATCCCAG3 ’ Reverse PCR primer H12S-rev 5’GACATCCCGTAAGAGTGCCCC3’ Reverse PCR primer
Table 1.3. Primer sequences for PCR amplification, heteroduplex, and DNA sequencing of the mtDNA control region, tRNA Phe gene, and partial 12S rRNA gene in darters.
18 Polymorphism Screening
Due to the cost and time associated with DNA sequencing, many species- level studies have limited the number of individuals under analysis. This practice can compromise a phylogenetic study when sufficient intraspecific variation is present. To help alleviate this potential problem, intraspecific variation was investigated in select snubnose darter taxa using the heteroduplex method (Schug,
1995) as an efficient means of screening darter populations for sequence variation.
The heteroduplex method involves mixing a standard PCR product from a representative individual (the driver) with an orthologous PCR product from an individual who’s sequence is unknown. The two PCR products are denatured at
95®C. The single stranded DNA is then allowed to slowly cool causing a random annealing of complimentary strands. If the hybridized PCR products are identical, they will appear as a homoduplex on a polyacrylamide gel. If however, the hybrid molecule contains a mismatch (resulting from a point mutation between the driver and the imknown sample), a small bulge forms at that site. The migration of this heteroduplex product through a polyacrylamide MD sequagel is delayed in comparison to the homoduplex, resulting in a multiple banded pattern on the gel. In practice, the driver sequence is first determined by cycle sequencing before it is independently mixed with the PCR products from other individuals in the population. The precise number of mismatches between the driver and unknown samples is not revealed through the heteroduplex method, however individuals that
19 share the same type of mutation will produce similar patterns when mixed with the same driver and run adjacently on a gel. When the PCR products from the same mutant type are mixed together in a subsequent analysis, they will migrate homogeneously to reveal their sequence identity. Progressive use of the heteroduplex method can therefore reveal both the number of haplotv-pes within a population and their frequency. Mitochondrial DNA is ideal for heteroduplex screening because it is maternally inherited and nonrecombining, however the drivers were run by themselves to check for heteroplasmy and a standard I bp mismatch was run on each gel to assure the quality of electrophoresis separation.
Pilot studies indicate that the heteroduplex method is capable of detecting mutations as small as a single base when the size of the PCR product is limited to
300-400 bases (Dwan. personal communication). The PCR products generated for sequence analysis in this study are over three times the recommended size, but the large number of variable sites across the left domain of the mtDNA control region make it a good representative area for partial heteroduplex analysis. The left domain of the control region begins with a tandem repeat, which causes replication slippage during PCR amplification and results in the production of various sized products that are unsuitable for heteroduplex analysis. This region was eliminated from the analysis by designing the internal primer "DHET.l” which generates a clean PCR fragment o f 355 base pairs when coupled with "TDKD” (Figure 1.3).
The DNA extraction method was abbreviated for the heteroduplex samples by modifying the sodium hydroxide procedure of Zhang and Tiersch ( 1994). Each
20 specimen was blotted dry of ethanol and the right pelvic and pectoral fins of each specimen were removed, placed into a screw top microfuge tube containing lOOul of
O.IN NaOH, and boiled for 20 min. Tubes were centrifuged at 17,000 rpm for 10 minutes and the supernatants were transferred to new microfuge tubes. The supernatants were diluted 1:1 with deionized water and brought to a final concentration of 1 X TE. One microliter of extraction mixture was used for PCR.
The general PCR reaction conditions for the heteroduplex method is described in the PCR section, however the annealing temperature was raised to 60*^C. a final extension step of 10 min @ 72 °C was added, and the reactions volumes were often scaled down to 25ul. The concentration of DNA in the PCR amplifications was measured by spectroscopy in order to assure the equal mixing of 2.5ug of driver with 2.5ug of unknown in a final volume of 15ul of 5mM EDTA. The mixture is heated for 5 min @ 96 °C, then cooled in a thermal cycler for 1 Omin @ 55 °C. 10 min
@ 45 °C. 1 Omin @ 37 °C, and 15 min at 25 °C before adding 3ul of triple dye loading buffer (National Diagnostics Inc.. Atlanta, GA).
Vertical SequaGel MD (National Diagnostics Inc., Atlanta GA) with Urea was cast between two plates measuring 17 X 16.5 cm by scaling down the proportion listed in the manufacturer’s instructions (National Diagnostics Inc., 1996). Spacers
(1.0 mm) are added to the sides and bottom of the plates, and the edges of the plates are sealed with 1% agarose. A 17 tooth standard well-type comb is inserted in the
21 top and the gel is allowed to polymerize for 2-4 hours. Following polymerization, the comb and bottom spacer are removed and the spacer void is filled with 1% agarose in IX TBE.
Heteroduplex gels were pre-run in a vertical electrophoresis apparatus with
IX TBE buffer for 45 min at 400V. Urea was flushed from the wells with a s\Tinge and 6 ul (-1.7 ug) of each sample were applied. At least three lanes were reserved for standards on each gel; a homoduplex control consisting of the driver alone, a heteroduplex control consisting of a 1 bp mismatch (mixing blennioides haplotype #
4 with blennioides haplotype # 6) and 3ui of a DNA ladder mixture consisting of 1.5 ul 1 kb DNA ladder [Gibco BRL, Bethesda. MD], 3.5 ul IX TBE, and 1.0 ul triple dye loading buffer [National Dioagnostics Inc., Atlanta, GA]. The gel is run for 4 to
5 hours @ 350-400 volts until the middle dye runs off the bottom of the gel. A second loading of new samples can be performed 45 minutes after the first loading.
Following the completion of the run, the plates are disassembled and the gel is stained with Ethidium Bromide in IX TBE and visualized under a UV transilluminator. All samples producing heteroduplexes were treated to subsequent runs with each other until the number and frequency of each haplotype was determined for the population. A representative of each haplotype was then amplified with the “LPRO” and “ 12Sa-rev” primers and sequenced in its entirety following the procedure outlined above.
22 DNA Analysis
DNA sequences were read and aligned by eye to previously determined percid (Genbank sequences U90617 - U90624, Faber and Stepien, 1997) and teleost
(Lee et al., 1995) sequences using the Eyeball Sequence Editor (ESEE3S ver.3.0s;
Cabot and Beckenback, 1989). The distribution of variable sites along the control region, tRNA Phe gene, and partial 128 rRNA gene was represented by plotting the base position (with a sliding 20 base frame) versus the percent of variable
nucleotides.
The aligned sequence data from the control region, tRNA Phe gene, and partial 128 rRNA gene were combined and subjected to three methods of phylogenetic reconstruction. A pairwise matrix of genetic distance was generated
under the Jukes-Cantor and Kimura 2-parameter (T8:TV 2:1) models using MEGA
(version 1.01, Kumar, Tamura, and Nei) and a neighbor-joining tree was constructed
with 1000 bootstrap replicates. Maximum likelihood analyses were performed in
PHYLIP using the DNAML program (version 3.572c, Felsenstein, 1993) with the
observed empirical base frequencies (T8:TV parameter 1.589082) and PUZZLE with
the quartet puzzling option and 5000 replicates. Cladistic analysis was performed in
HENNIG86 (version 1.5, Farris) using a branch and bound heuristic search, and in
NONA (version 1.6, Goloboff, 1993) using 1000 randomly seeded replicates.
Bremmer support for each node was calculated in NONA based on 10510 trees up to
23 5 steps away from the most parsimonious trees. Additional support for cladistic nodes was investigated with 10,000 jackknife replicates in Random Cladistics
(version 2.1.1 Siddall) using the program JACK.
Examinations of substitution patterns were conducted by plotting percent transitions and percent transversions against pairwise percent nucleotide-sequence divergence to evaluate the potential for saturation. In addition, the frequency of unambiguous changes were evaluated on the strict consensus tree by plotting the
TS:TV ratio for well supported clades (obtained from MacClade version 3.04,
Maddison and Maddison, 1992) versus the observed number of nucleotide changes per site.
Phylogenetic clusters with bootstraps above 50%, jackknife values above
65%, and Bremmer support above 1 (Bremmer 1988) were analyzed using the phylogeographic method (Avise et al., 1987) to infer the evolution of the group.
Percent sequence divergence between major clades, sister species pairs, and conspecific haplotypes were calculated and used in a relative manor to provide temporal guidelines for evolutionary events.
24 RESULTS
DNA Regions Examined
The PCR amplification products for Etheostoma and Ulocentra species ranged from 1537 to 1698 bp and contained the partial tRNA Pro gene (48 bp), entire mtDNA control region (921-1082 bp), entire tRNA Phe gene (68 bp), and partial 12S rRNA gene (500 bp) as illustrated in the scaled cartoon (Figure 1.3). Numerous internal primers were designed specifically for darters and utilized to sequence the entire mtDNA control region, tRNA Phen gene, plus a 120 base segment of the 12S rRNA gene. The complete aligned sequence for all 78 darter taxa investigated is presented in Appendix B. Each DNA region was independently analyzed for structural considerations, but the entire data set was combined for phylogenetic analysis in a total evidence approach (Kluge, 1989).
Structure o f the mtDNA Control Region
The control region varied drastically in size depending on the length of the hypervariable portion that directly followed the tRNA Pro gene and consisted of two elements; a tandem repeat element and a degraded repeat element (Figure 1.3). The tandem repeat was composed of a perfect 10-mer repeat motif in all snubnose darter
25 species. Variation in both the primary sequence and number of repeat copies occurred at the conspecific level. Additional conspecific variation was present in the degraded repeat element, which also varied in primary sequence and length, but contained elements that were clearly identifiable as portions of disrupted repeat sequence. Repeat copy number varied from 7 copies in E. rqfinesquei to 23 copies in
£. raneyi. The degraded repeat varied in size from 29 bases in E. zonale to 5 bases
in E. colorosum, E. atripinne, and E. brevirostrum. Variation in the number of
repeat copies and the length of the degraded repeat was most responsible for the
length heterogeneity in the PCR amplification products for the various darter
individuals. This hypervariable region appears to evolve under a concerted
evolutionary model (Faber and Stepian, 1997), with mutations in the sequence being
shared throughout all copies of the repeat. However, several individuals had
compound repeats containing two adjacent repeat motifs that differed in primary
sequence.
Since the extreme amount of variation in the hypervariable region produced
potential homology problems, the variation in this region was ignored and
phylogenetic analysis was performed on the remainder of the control region proper.
The control region proper varied in length from 830 bases in E. tetrazonum to 836
bases in E. thalassinum, E. colorosum, and E. chermocki. The average length of the
control region proper for species in the subgenus Etheostoma was 833 ± 1.33 SD
bases and did not significantly differ from Ulocentra species 833.81 ± 0.840 bases.
Alignment of the 78 darter sequences was accomplished by placing gaps at 12
26 inferred indel positions, resulting in a total of 845 bp for the aligned control region sequences. The control region proper appears to have evolved by the accumulation of simple point mutations and these small insertion / deletion events (Appendix B).
Comparison of the aligned darter sequences from the control region proper with orthologous regions from multiple percid (Faber and Stepien, 1997) and teleosts taxa (Lee et al., 1995) revealed a common pattern in the distribution of variation across the sequences. Excluding the hypervariable region, the remaining control region proper can be conceptually divided into three general sections as illustrated in
Figure 1.4. A depression in the percentage of variable sites near the middle of the control region delineates the central conserved region (CCR), which divides the control region proper into left and right domains (Figure 1.4). The CCRs of darters share great sequence similarity to other acanthopterygean fishes throughout the 167 bp region, but darter CCRs are difficult to align to the mammalian sequences of
Southern et al. (1988) and Saccone et al. (1991). Of the six conserved sequence block (CSB) reported from mammals (Southern et al., 1988), only blocks “E‘‘ and
"D” were recognizable in the darter sequences. Only a small portion of the CSB-E could be identified by locating the GTGGG-box near its 3’ end. In contrast, the entire CSB-D was easily located in darters, with 95% sequence similarity between darters and the mammalian consensus sequence. These two blocks of highly conserved sequences are responsible for the two major depressions of variation within the CCR of Figure 1.4, and contrast with the somewhat elevated levels of variation upstream. An analysis of genetic variation within the CCR of darters
27 I l 1
^^ ^ ^ ^ ^ ^ oT> ^ Nucleotide
Figure l .4. Distribution of variation in the aligned mtDNA sequence of darters in the Etheostoma group (Bailey and Etnier, 1988). The control region proper (tandem repeat excluded) is in black, the tRNA Phe gene in white, and the partial 12S rRNA gene in gray.
28 reveals only 35 variable sites, producing a low nucleotide polymorphism (p„ = 0.210) for this region. The CCR is slightly AT rich with A 25%, T 33.7%, C 19.5% and G
21.8 %.
The variable left domain is flanked by the hypervariable region upstream, and the central conserved region downstream. This 258 bp section contains 85 variable sites, making it the most rapidly evolving portion in this study (p„ = 0.329). A large spike in nucleotide variation occurs from position 148 to 160 (Figure 1.4) resulting from a complex cluster of multiple point mutations and three indel events (Appendix
B). The left domain has the largest AT bias in nucleotide composition with A
38.1%, T 31.6%, C 20.0%, and G 10.4%.
The right domain of the control region proper is the largest section, containing 422 bases with 131 variable sites. The slightly diminished level of nucleotide diversity' for the right domain (p„ = 0.310) may reflect the retention of two short, but highly conserved regions. Two conserved sequence blocks orthologous to
CSB-2 and CSB-3 in mammals (Saccone et al., 1991) and teleosts fishes (Lee et al..
1995) have been identified in the darter sequences and are located near the end of the right domain. These two CSBs spatially correlate with two major valleys of decreased nucleotide variation in Figure 1.4. In addition to these featiues, the right domain contains a Pyrimidine rich “tract”(Lee et al., 1995; Faber and Stepien, 1997) containing substantial variation in the form of point mutations. Base composition is
AT biased with A 27.7%, T 31.3%, C 23.0%, and G 18.0%.
29 Structure o f the Mitochondrial tRNA Phe Gene
The remaining portion of the darter sequences were aligned and compared to the complete mtDNA sequence of the rainbow trout, Oncorhynchus mykiss (Zardoya et ai-, 1994), common carp, Cyprinus carpio (Chang et al., 1994), and loach,
Crossostoma lacustre (Tzeng et al., 1992) to delineate the size and structure of the coding regions. The mitochondrial tRNA Phe gene in darters directly follows the control region and is coded for by a 68 base region containing the characteristic isoacceptor GAA. Nucleotide diversity was lower than the CCR of the control region (p„= 0.147), and there is little bias in nucleotide constituents (A 35.5%. T
21.3%, C 19.9%, and G 23.3%). The sequence of each tRNA transcription product was inferred from the DNA sequence and folded to provide the classic cloverleaf structure using the Cyprinus carpio sequence (Chang et al., 1994) as a model. The typical tRNA Phe secondary structure is illustrated for members of the subgenus
Etheostoma, members of the coosae subgroup, members of the simoterum species group, and members of the remaining duryi species group (Figure 1.5a-d).
30 Figure 1.5. Secondary structure of the tRNA Phe gene in darters inferred from mtDNA sequence data, (a) Members of the subgenus Etheostoma. (b) Members of the E. coosae-E. scotti group of the subgenus Ulocentra. (c) Members of the £. simoterum species group, (d) Members of the remaining E. duryi-E. flavum group and Coastal Plains species group.
31 u C:G G:C A C U C C :G u G:C U u c :G C :GGAACU c G :C A : : : : u A U CUUGG U U^AAGC A G c G (36% ) A G U G:C U u AuttÛÛCG u uC C zGGAGCU c A:U U CCCGG u U:A U^AAGC A G U:A (30% ) G G:C U U:A A ttÙ Ù C G u uC G U A:U A C U:A a. ÇUU U: A G:C U: A G U A C U b. ÇUU C :G G:C A U *U C (3 S % ) Ç • G (19%) u (10%) AG :C G u u C :G C zGGAACU C G:C A A C u()3%) U CCCGG U A U (48%) G U Uc(50%) U^AAGC y (23%) ^ (13%) u c :G a(6%) (I9 % ) g A A^ÛÙCG C G :C U U U UC(6%) C zGGAACU C A:U CÛÛGG U U: A U^^AAGCrU A c c (19%) G U : A (38%) A G U (6%) G ;C AttUUCG C U:A U U U G u A:U A c (6%) c U : A ÇUU U :A G :C U :A G U A C d. CUU
Figure 1.5. Secondary structure of the tRNA Phe gene in darters.
32 As with other teleost, darter tRNA Phe structures would not fit into the typical canonical tRNA alignments of Sprinzl et al. (1998). For each darter species, the variable loop region is comprised of only five bases, the anticodon domain is highly conserved, and the loops in the D-domain and T-domain are invariant in size, comprised of five and eight bases respectively. Variation is spread throughout the molecule, but most changes occur in the accept stem. Surprisingly, there was little tendency for compensatory stem changes (Figure 1.5).
Structure o f the Partial 128 rRNA Gene
Sequence encoding the 12S rRNA gene directly follows the tRNA Phe gene in darters. Since only a small portion (120 bp) of the 12S rRNA gene was sequenced and aligned for darter in this study, modeling of the rRNA secondary structure was not possible. Three indel events were needed to align the 12S rRNA gene for the 78 taxa. The gene contained 17.5% variable sites, and no significant nucleotide bias was detected.
The Combined mtDNA Data Set
An analysis of the distribution of variable sites across the control region,
tRNA Phe gene, and partial 12S rRNA gene for the 78 darter taxa (Figure 1.4),
reveals that the control region is evolving 1.5 to 1.75 times faster than the two coding genes. This elevated rate of molecular evolution in the control region is expected,
given the importance of secondary structure to the two coding RNA genes versus the
33 non-coding control region. The control region in a wide variety of organisms is considered to be the most rapidly evolving portion of the mtDNA molecule, and given the large amount of variation involved with the tandem repeat, darters are not likely to be an exception. Comparisons between the control region proper and the cytochrome b gene in darters however reveals that the control region proper is evolving approximately three times slower than the adjacent cytochrome b gene in
Etheostoma (Song 1994) and Ulocentra taxa (Noel Burichead and Anna Bass unpublished data; Porterfield. 1997b).
Tests for Nucleotide Saturation
Saturation tests were performed on the combined data set by plotting percent transitions and percent transversions against pairwise nucleotide-sequence divergence (Figure 1.6). A random correlation would place transitions (TS) two times more frequent than transversions (TV), but Figure 1.6 indicates that these ratios are closer to 1.25:1 TS:TV. favoring transversions. The %TV' plot does not deviate substantially from a linear fit. but %TS may show some tailing off above
4.5% nucleotide divergence indicating a limited saturation effect for distantly related taxa. The maximal nucleotide sequence divergence within Ulocentra is 7.6%. indicating that saturation of transition sites may be a minor consideration in phylogenetic analyses with the combined DNA data set. The frequency of unambiguous changes were evaluated on the strict consensus tree with a plot of
34 g 3 s O" 2 u.
2 -
0 1 3 4 5 6 7 10 % Nucleotide Divergence
Figure 1.6. A plot of the frequencies of transitions (open circles) and transversions (solid circles) against pairwise nucleotide-sequence divergence.
35 3.5
3
2.5
5 6 üÔ 1.5 E-
0.5
G 0.05 0.1 0.15 0.2 0.25 0.3 0.35 0.4 0.45 0.5 Observed # o f nucleotide changes / site
Figure 1.7. Frequency of unambiguous nucleotide changes evaluated on a strict consensus maximum parsimony tree.
36 TS.TV ratios for well supported clades against the observed number of nucleotide changes (Figure 1.7). A strong negative correlation between TS:TV ratio and the observed number of nucleotide changes per site would be expected if transitions sites were saturated, however this trend is not apparent in Figure 1.7 indicating that saturation of bases is not a serious concern for the combined DNA data set.
Phylogenetic Analysis o f the Combined mtDNA Data Set
Aligned sequence data from the mtDNA control region proper, tRNA Phen gene and partial 12S rRNA gene were combined in one 1033 bp long data set for phylogenetic analysis using Etheostoma tetrazonum as the outgroup for the 78 taxa.
The data contained 284 variable sites, 224 of which were informative for maximum parsimony.
The strict consensus tree of a branch and bound maximum parsimony search from 10 equally parsimonious trees with 808 steps is shown in Figure 1.8 with
Bremmer support and jackknife values above 50%. Taxa comprising the subgenus
Ulocentra form a weakly supported monophyletic group, containing two subgroups corresponding to the classic division of the simoterum species group and the duryi species group sensu Bouchard (1977). A second large clade comprised of E. histrio, the thalassinum species group sensu Richards (1966), and E rupestre-E. blennius-E. blennioides, forms a sister clade to the subgenus Ulocentra. The week support for the Ulocentra clade and restricted subgenus Etheostoma clade results from the
37 Figure 1.8. Maximum Parsimony strict consensus cladogram of 78 darter taxa representing the subgenera Etheostoma and Ulocentra as inferred from mtDNA sequence data. Statistical support is shown with jackknife values (above the node) and Bremmer support values below. Taxon names are followed by the collection site number and haplotype code. The indicates that the sample came from the type locality.
38 teSnaonum 63/TZl var&ftim 87/VI variatum INT. fyitceum 43/LYl fynceum I6/LY2 zonale 2/Z2 zottote 85/1 zonale 6/Z3 hiOno 79/Hî swannanoa 65/SWl Ihttlassinum 66/THI iiacripliutt $8/11 fupeâw 44/RUl bUnnioides blennioides 86/B4 blennioides phoUdoütm 88/B7 blennioides phoUdoOim 63/B5 blennioides newmani 11/B6 blenniusseqaalcblense 37/BU I bknnUa blennlus 84/BU2 baileyiSim2,*7IBV4 baileynoisn banenense 2/BAl rafitesquei 4/R2 rafinesquei • 69/R3 rafinesquei* 69/R12 simoterum 57/S6 simotemm I0/S4 simoterum S7I^ simoterum 74/S89 simoterum 9/S9 simoterum $5/591 simoterum 12/55 tttripinne I2/A3 atrminne 3AIA2 atnpinneWIWS coosaeZllCOn coosae 30/CO2 coosae 30/CO15 coosae 30/CO11 coosae 30/C010 coosae 81/C03 coosae 82/C05 coosae 7$/C028 sco/tf 24/SC2 SC0Ë/24/5C3 1/0 1 7 / 3 7 /0 1 rfjoy/ * 38/04 1/1117/58/08 flavum 13/F$ ' flavum ilFS flavum 5/F7 etnieri * 61IE2 eOi/eri 11/Ell zonisdum I4/ZI2 zouistium ISIZD pyrrkogaster 17/Pl pyrrhoeaster \b m raneyt* 4I/Y1 laney/ 42/Y2 bellaltor33lBL3 chermocki3llCtl2 chermocki* 32/CH3 colorosum *51/C1 colorosum 46IC2 beUator * 50/BL2 lacbneri * 44/12 lachnerillfL3 ramseyi 4SIW AI ramseyi 561^41 tallapoosae 49/Tl talliipoosae 48/T2 tallapoosae 4/bH3 brevirostrum * 30/BRl brevirostrum * 30/BR27 brevirostrum 78/BR-al brevirostrum 75/BR-w2 Figure 1.8. Maximum Parsimony Tree. brevirostrtim 77/BR-e23 brevirostrum 7$/BR-g37
39 problematic placement of E. histrio, which has a tendency to form the basal member of either of these groups. Two progressive outgroups, one formed by E. zonale-E. lynceum samples, and the other by the two E. variatum samples, robustly cluster outside the other members of the subgenus Etheostoma.
A neighbor-joining tree with 1000 bootstrap replicates is presented as Figure
1.9. Members comprising the subgenus Ulocentra form a unified assemblage, containing two subgroups corresponding to the classic division o f the simoterum species group and the duryi species group, however E. histrio is present as the basal member of the simoterum group with low bootstrap support. A second large assemblage comprised from members of the thalassinum species group plus E nipestre, E. blennius, and E. blennioides, forms a sister assemblage to Ulocentra +
£. histrio group. Two progressive out groups, one formed by E. zonale and E. lynceum populations, and the other by the two E. variatum samples, cluster far away from the other members of the subgenus Etheostoma, producing the largest branch lengths on the phenogram.
Maximum likelihood trees generated by PHYLIP (Figure 1.10) and PUZZLE
(Figure 1.11) largely agree with the neighbor-joining and maximum parsimony trees, but produced slightly different topologies from one another in respect to the placement of E. histrio. The maximum likelihood program in PHYLIP places E. histrio with members of the restricted subgenus Etheostoma, while PUZZLE positions it as the outgroup to the subgenus Ulocentra.
40 Figure 1.9. Neighbor-joining phenogram of 78 darter taxa representing the subgenera Etheostoma and Ulocentra as inferred from mtDNA sequence data. Statistical support is shown with bootstrap values from 1000 replicates. Taxon names are followed by the collection site number and haplot)"pe code. The ”*’* indicates that the sample came from the type locality.
41 .tOnzmwm&fTZl
lynceum 4 3 ^ 1 .fymiamWiSl .ZPnmeVI2 .zauktsm .ilMIIIMIIMfiS/SWlSSgS blennioides blennioUes 86 /B4 blemhUespkoSdotmWKJ blamioUespkoBdoùm€3/iBS bloodies n£wmadWV6 Uaaûm seauteUense 37/BUl
simoterum 10/S4 simoterum 53ISJ sim oterwn 9IS 9 àm oterum lH &%9 simoterum 65/S91 simoterum 12/S5 CatrbbauiUAi j i m e i i k î OirfomïiêSO/AlS coosoeilKlOVJ caasve30/CO2 C0OHk3WCX)15 ****** eoMoe 30/10 ctN»oe8 iyC 0 3 9 9 eooMe 82 /COS Lraosoe 76/C028 9 9 fcMfi 24/SC2 ie»ttr24/SC3 2aCÜ!^*38®4 <#^58/D8 / 2avaail3/F6 flanmVK flm m m S/FI
zonMrai 14/212 9
oeflator * 50/BL2 colorosum * 51/Cl
ladtaeriTULS mise)v4S/RMl^ .nmsegn 5(i/RM2 tallm oosae 49f n talbgoosaeWtl brevirosbum * 30/BRl brevirostrum * 30/BR27 OrnwnsOioK 78 /BR-al brevirostrum 7S/BR-w2 ^^brevirostrum 77/BRre23 Figure 1.9. Neighbor-joining tree. brevirostrum 76/BR-g 37
42 Figure 1.10. Maximum Likelihood tree of 78 darter taxa representing the subgenera Etheostoma and Ulocentra as inferred from mtDNA sequence data constructed with PHYLIP. Taxon names are followed by the collection site number and haplot^^pe code. The indicates that the sample came from the type locality.
43 • tdhzwneeSyrZI iwmtamtuni ^vanatmim ljncam43/lS\ p -IJÜlymcam a 16/LY2 L f—ÎBMfciz a u U V T l T _ J "— 09 Mtr8 S/Zl ZWU6/73 •ktlrw W H l — nwi»BW«65 /SWl ■ t6«/cnHEM66/THl — ùucfÿdM»6Ml cSàgB£ar^®“n^csfreiVRDl N am ieulef ______UemmdespMidaùmâtES UanBaJautimmUIBi htnamaelJUi
SDMferm 74/S89 sm oknm 9l& suu len m 6SIS 9l simatenm 12/S5
«hpoo»8 M5 eatsuJVCOn cooskM/COI üMW WC015
eoasuSl/CjK eoasu S 2/C0S 5 5 W Kotf 24/sa
— AqiaiD» • /2fnDRl3/F6
flkûri 61* Æ2 ■eAdmll/EU
Lc0/«nmatt46/C2 • Mltor*5Q/BL2 W »m *44/L 2 0.01 —»mg?56/RM2 < /f//tpaa«e49/n -nMqw*w4S/T2 l—Mqw«Mr40/T3 I— hn w astnm. * 30/BRl * 30/BR27 _ — b m ^u in m 78 /BR-al — hm m stnm 7S/BR-w2 .imàvstm 77/BR-eÜ 76/BR-^ 7 Figure 1.10. Maximum likelihood tree from PHYLIP.
44 Figure 1.11. Maximum Likelihood tree of 78 darter taxa representing the subgenera Etheostoma and Ulocentra as inferred from mtDNA sequence data constructed with PUZZLE. Taxon names are followed by the collection site number and haplotype code. The indicated that the sample came from the type locality.
45 • taroainamiSfrZl varmtansîlVl vm ttw nlN l lyneem lt/LY2 UHUUVtl mmymeteSSIZl -h»»bmiio«6SSW1 rtabs^unt 66/THI • üaaiptumÿSni blautttBsem^uaaeyJISOl blaniiabunmBîSMiSl — nmaOeWRDI bleuiwUes Namioién U/Bi UammitspkoBiotmnfXIKI
iàtrid 79/Hl
2 IS2/BY2 - y 3 àmolerum lO/S* suuriemmSilSJ simolenan74JSS9 âmçlerwn —amotenm — r . ^ s a ® ' a tn p im ie 80/A15 — cooM 27/CO 17 caosteiOICOl coosêelülCOlS “l ~ f c eoeste 82/COS coosu 76/C028
37/DI (bini* • ^ u m 13/F6 •pmnmSIVS JlavwnSIFI r — eOderi * 6IÆ2
amisùum IS/ZD ^pmhogasUr 17/Pl
durmacU*SllCS3 colorosum * SI/Cl atlorosum 46/C2 WWw*50/BL2 /u6/Kn*44/L2 /ociiien71/L3 rams^'45/RMl raMK^ii 56/RM2 O/ZqNNnoe 48/T2 tallapoosae 49/Tl 0.01 Ca/bpoane 4Q/T3 b re m a stn m * 30/BRl b m in s tttm 78/BR-al brevirostrm 7S/BR-wZ irevÂtistniB! * 30ÆR27 brevin stium 76/BR-e37 facynraanm 77/BR-c23
Figure 1.11. Maximum likelihood tree from PUZZLE.
46 This conflict may result from the low number of replicates used for the PUZZLE tree
(5000 instead of the recommended 500,000), and reflects the enigmatic placement of the harlequin darter.
Intraspecific Variation
The heteroduplex method was applied in a progressive manor to provide information on the number and frequency of haplotypes in select population samples of darters (Table 1.4). A total of 165 individuals representing 11 darter species were analyzed for intraspecific variation. Additional haplotypes revealed by the heteroduplex analysis were sequenced and added to the phylogenetic database, however most population samples appear to have only one haploty pe (within sample frequency =1.0 in Table 1.4). The 355bp region examined by heteroduplex is located in the left domain of the mtDNA control region proper, one of the most variable portions of the total sequence (see Figure 1.4 and Appendix B). Although this method was efficient in detecting Ibp mismatches between PCR products, it fails to reveal the total number of haplotypes in the population sample since it only compares 355bp o f the 1033bp total sequence. This analysis therefore provides only a limited assurance that the sequences utilized in the phylogenetic analyses are representative of the variation present within the population from which they were sampled.
47 Species Site N Driver Haplotype Size of Frequency # mismatch in sam ple £. blennioides 86 7 84 B4 0 bp LOG E. histrio 79 12 HI H1 G bp l.GG E. atripinne 34 24 A2 A2 G bp l.GG 40 5 A I5 A15 G bp l.GG E barrenense 2 24 BA2 BA2 G bp l.GG E. rafinesquei 69 17 R3 R3 G bp Unknown 69 R3 R12 G bp Unknown 4 16 R2 R2 G bp l.GG 4 R3/R12 4 bp G.GG E. duryi 58 12 0 8 08 G bp 1.00 E. etnieri 11 2 E2 E2 G bp l.GG 11 E3 E3/E11 1 bp G.GG 61 16 E2 E2 G bp G.87 61 E2 E3/E11 1 bp G.13 E. coosae 30 8 C 02 C 02 G bp <.0.44 30 C 02 COlO 8 bp G.IGG 30 C 02 CO U G bp Unknown 30 C 02 C015 G bp Unknown £. sco tti 24 5 SC2 SC2 G bp 0.8G 24 SC2 SC3 3 bp G.2G E brevirostrum 30 4 BRI BRI G bp Unknown 30 BRI BR27 G bp Unknown 78 2 BRI BR-al G bp l.GG 75 2 BRI BR-w2 1 bp l.GG 77 4 BRI BR-e23 G bp l.GG 76 1 BRI BR-g37 G bp Unknown £. raneyi 41 2 Y1 Y1 G bp LOG 44 2 Y1 Y2 3 bp 1.00
Table 1.4. Haplotypes revealed by screening 355bp PCR amplifications from a portion of the mtDNA control region proper. The “Site refers to the collection site location for the population samples, “N” is the sample size, “Driver” is the haplotype code for the driver PCR product used in heteroduplex analysis, “Haplotype” refers to the code for any new haplotypes found in a given species, “Size of mismatch” refers to the number of bp mismatches in the heteroduplex (0 indicates no heteroduplex, revealing that the driver and the samples are identical), “Frequency” denotes the proportion of a given haplotype in a given population sample.
48 Phylogeography
Snubnose darters inhabit gentle riffles and runs in small to medium-sized streams throughout the Tennessee River drainage, including the Cumberland and
Duck rivers; the Kentucky, Green, and Barren Rivers of the Lower Ohio system; direct eastern tributaries to the Mississippi, including the Obion, Forked Deer,
Hatchie, and Yazoo rivers; all major tributaries to the Mobile Bay system including the Coosa, Cahaba, Tallapoosa, Black Warrior, Alabama, and Tombigbee drainages, and gulf coastal drainages east of Mobile Bay to the Choctawhatchee system
(Bouchard, 1977). They are conspicuously absent from the Atlantic Coast drainages, as well as regions west of the Mississippi River and north of the river systems in
Kentucky, making them a geographically condensed group of fish. The members of
Ulocentra are apparently rather poor at dispersal, being the only specious subgenus of Etheostoma unable to transgress the Mississippi River (Figure 1.12).
The distribution of each Ulocentra species is illustrated in Figure 1.12 with collection localities from this study indicated by black dots and labeled with collection site numbers (in reference to Table 1.2 and Appendix A). Although most snubnose species are allopatric, the sympatric species in the Tennessee, Duck,
Cumberland and Coosa River systems generally occur between members of divergent species groups. One exception to this condition is the distribution of the sister group E. atripinne-E. simoterum, which are foimd together in the Duck River.
49 Figure 1.12. Distribudoa of the twenty described species of the subgenus U locentra. Black dots identify collection sites labeled with site number (in reference to Table 2).
50 The phylogeographic study is divided into three diagrams that reflect the four major evolutionary clades (Figures 1.13-15). The location of each haplotypes is indicated by a black dot and labeled with a site number (Table 1.1 and Appendix A) and haplotype code (reflecting the species and individual number from which the new haplotype was discovered). Oval and irregular shapes are drawn around robust clades. A circle drawn around a single collection dot either denotes multiple haplotypes from a single collection site, or haplotypes from two closely adjacent collection sites (consult the accompanying labels in these cases). Straight lines are used to connect closely related haplotypes or haplotype groups. Each red tick mark placed on a straight line represent a 4bp fixed difference between the haplotypes or haplotype groups connected by that line. The percent nucleotide sequence divergence between robust clades, sister species, and intraspecific haplotypes (Table
1.5) was used in temporal estimates of evolutionary events. Given the heterogeneity in evolutionary rates between the control region, tRNA Phen, and 12S rRNA genes, the ‘‘standard evolutionary rate” of molecular evolution for mammal mtDNA (2% nucleotide sequence divergence per million years) was not used to calculate darter divergence times. Attempts to measure the evolutionary rate for these mtDNA regions in darters were confounded by the inability to empirically establish the divergence time for percid taxa. Temporal estimates of darter divergence times must therefore be viewed as a relative index instead of a well-calibrated molecular clock.
51 L i
Figure 1.13. Distribution and phylogeography of the £. sim oterum group of the subgenus Ulocentra. Haplotypes are identified by site number and haplotype number. Tick marks represent 4 bp fixed differences between haplotypes or haplotype groups. 4/6C2
Figure 1.14. Distribution and phylogeography of the E. duryi- K flcman group (in the Tennessee, Duck, and Cumberland Rivers) and the E. coosae- E. scotti group (in the Coosa and Etowha Rivers) of the subgenus U locentra. Haplotypes are identified by site number and haplotype number. Tick marks represent 4 bp fixed differences between haplotypes or haplotype groups. 53 Figure 1.15. Distribution and phylogeography of the Coastal Plains group of the subgenus U locentra. Haplotypes are identified by site number and haplotype number. Tick marks represent 4 bp fixed differ ences between haplotypes or haplotype groups. 54 Tanon 1 Compared with Taxon 2 % E. ba ileyi Other members of the E simoterum group 1.45 E. coosae-E scotti clade Coastal Plains clade 1.25 £. rqfïnesquei-E barrenense clade Other members of the E simoterum group 1.16 Eduryi-E. flavum Members of the E simoterum species group 1.06 E.dwryi-E. flavum E coosae-E scotti clade 0.97 E. etn ieri Other members of the Coastal Plains group 0.87 E. pyrrhogaster £. zonistium 0.68 E. chermocki £. bellator BL3 0.10 E. duryi £ flavum 0.39 E barrenense E rafinesquei 0.19 E. chermocki E bellator BL2 1.55 E coosae £ sco tti 0.58 E brevirostrum E. tallapoosae 0.87 E. brevirostrum complex E. brevirostrum complex 0.19-1.50
Table 1.5. Percent nucleotide sequence divergence between robust clades, sister species, and intraspecific haplotypes. Only nucleotides with a fixed difference between the two groups were counted.
55 DISCUSSION
Systematics and Classification
All three tree building techniques reveal a unified Ulocentra assemblage sensu Bailey and Etnier (1988), as sister to a restricted subgenus Etheostoma comprised of E. blennioides-E. blennius-E. rupestre, and the three members of the E. thalassinum species group. The hypothesis that E. zonale-E. lynceum are the closest relatives to snubnose darters (Page, 1981) is clearly refuted, as neither species form a
Monophyletic clade with Ulocentra without including the more immediate relatives of the restricted subgenus Etheostoma. The hypothesis that all species in the subgenera Ulocentra and Etheostoma could be combined into the subgenus
Etheostoma (Wood in Boschimg et al., 1992) is not refuted by the data presented.
Nevertheless, the addition of orthologous sequence data from all other darter subgenera produce clades that intervene between either the E. variatum species group and E. zonale-lynceum group, or between E. zonale-E. lynceum and the
Ulocentra + restricted Etheostoma clade. The distant relationships of the £. variatum species group and E. zonale-E. lynceum to the members of the restricted subgenus Etheostoma is reflected in the large branch lengths on the phenograms between these groups and the remaining darter in this study (Figures 1.9-1.11). In an effort to keep darter subgenera monophyletic, the subgenus Nanostoma should be restricted to E. zonale and E. lynceum, as previously suggested by Clayton (1984). 56 The subgenus Poecilichthys Agassiz (1854) could be resurrected to include the members of the E. variatum species group as a distinct evolutionary clade.
The restricted subgenus Etheostoma consistently contains two strongly supported species groups with all tree building methods. Analysis of the £. thalassinum species group supports Richards (1966) with a sister relationship between E. thalassinum-E. inscriptum, and E. swannanoa as an outgroup. The E. blennioides species group in this analysis represents a novel systematic arrangement, restricting the group to £. blennioides-E. blennius-E. rupestre. Maximum parsimony and neighbor-joining methods present a sister relationship between E-blennioides-E.
blennius, but maximum likelihood pairs £. blennioides-E. rupestre as sister taxa.
The systematic position of the harlequin darter, £ histrio. is inconsistent and poorly
supported among trees built with various methods, but it should be placed as the
basal member of either subgenus Ulocentra or Etheostoma.
The subgenus Ulocentra contains two species groups consistent with the
arrangement of Bailey and Etnier (1988). The maximum parsimony cladogram and
the neighbor-joining phenogram place £ baileyi as the basal member of the £. simoterum group, while maximum likelihood techniques place £. baileyi as
intermediate between the two sister species pairs, £. rafinesquei-E. barrenense, and
£. simoterum-E. atripinne. There are two basal subgroups within the £. duryi
species group, one consisting of £. coosae-E. scotti, and the other £. duryi-E. flavum.
It is statistically unclear from the molecular analyses which one of these two
subgroups form the base of the £. duryi species group (Figure 1.13). The remaining
57 members of the E. duryi species group form a well-supported clade, but the basal
species of this clade is statistically unresolved and is comprised of either E. etnieri, or the sister taxa E. pyrrhogaster-E. zonistium. The "''tallapoosae" subgroup sensu
Suttkus, Bailey, and Bart (1994), is paraphyletic without the inclusion of the other
coastal plains species E. bellator, E. chermocki, and E. brevirostrum. Although the
members of this subgroup are intimately related, weak Bremmer support statistics
suggest E. raneyi and / or E.chermocki-E. bellator as outgroup taxa.
Phylogeography of the Subgenus Ulocentra
Phylogeography has been classically applied to studies of intraspecific
variation to reveal patterns of molecular variation at the population level within a
context of biogeography (Avise et al. 1987). Given the close relationships between
members of the subgenus Ulocentra, it seems appropriate to apply the
phylogeographic method to interpret the distribution of genetic variation for
snubnose darters. It could be argued that the 20 species of Ulocentra represent only
a few legitimate species with numerous polychromatic populations or color forms.
Most color forms / taxa are allopatric, and the primary support for naming new
Ulocentra species comes from geographic partitioning of the variation on male
breeding coloration and pigmentation. The taxa E. simoterum (Teimessee R.) and £.
atripinne (Cumberland R.) are sympatric in the Duck River system, where Etnier and
Starns (1993) notes a cline in the pigment characters that normally distinguish the
two sister taxa and suggest that they be given subspecific status. Hybridization
58 between E. flavum and its sister taxon E. duryi appears to be occurring in the Upper
Duck River following a recent headwater exchange with the Elk River System
(Etnier and Bailey, 1989). Additional '‘hybrids” between E. brevirostrum and E. coosae have been collected from the upper Coosa System (Noel Burkhead personal communication), raising further questions about the reproductive isolation among
Ulocentra taxa. This study investigates the taxa in the subgenus Ulocentra at both the population and species level, a necessary approach for a group that appear to sit at the interface between micro and mesoevolution. Phylogeography is the best available tool for evaluating the legitimacy of the described snubnose species and understanding the evolutionary processes involved with the group. Even if this study
marks an unorthodox application of the phylogeographic method at the species level, the only condition that would render it invalid is if macroevolutionary and
mesoevolutioary processes are completely independent.
Maximum parsimony, neighbor-joining, and maximum likelihood trees
constructed from the DNA sequence data support an early divergence of four main
groups of Ulocentra (Figures 1.8-1.11). The E. simoterum species group
encompasses species with more northern distributions in the Kentucky, Green /
Barren, Cumberland, Duck, and Termessee River systems. Members of the E. duryi-
E. flavum species group inhabit the Tennessee, Duck, and lower Cumberland River
systems and are more closely associated with Ulocentra species with more Southern
59 distributions. The E. coosae-E. scotti species group is distinct but closely associated with the remaining snubnose species that form the Mississippi Embayment / Coastal
Plains group.
The partitioning of genetic variation between and within these four clades
(Table 1.5), fits the phylogeographic “Category I” model of Avise et al. (1987). For the most part, these clades are still spatially separated (Figures 1.12-1.15), however
some secondary contact between the E. simoterum species group and the E. duryi-E. flavum group have resulted from recent range expansions (secondary dispersal). The
“Category I” Phylogeography model usually indicates long-term extrinsic barriers to
gene flow, or the presence of a widely distributed ancestral type with extinction of
intermediate genotypes (vicariance) followed by limited dispersal and gene flow
capabilities (Avise et al., 1987).
The distributions of these four species groups are best explained with a
consideration of the drainée evolution in the Eastern United States from the
Pleistocene to the present. The current distribution of snubnose species represents a
conglomerate of historical vicariance and dispersal events. Based on the present distribution of species, the ancestral stock of the subgenus Ulocentra probably
inhabited the Cumberland, Duck, Tennessee, and Coastal Plains drainages in the
early Pleistocene (Figure 1.16). The ancestral Ulocentra did not have access to the
Teays-Mahomet system, a factor that limited its present distribution East of the
Mississippi River. Two ancestral groups reflecting the ancestral £. simoterum and E. duryi species groups began to form through an isolation by distance scenario.
6 0 Figure 1.16. Ftypothedcal distribudon of ancestral members of the subgenus CyZoceR/ra in the early Pleistocene. Two populadons, one in the CumbCTland, Duck, and Tennessee Rivers, and the other in the Coastal Plains, Teimessee, and Duck had limited genetic exchange in portions of the Tennessee and Duck Systems.
61 This hypothesis would restrict the ancestral E. simoterum group to the
Cumberland River system, where it had extensive gene flow with ancestral E. duryi-
E. flavum populations in the Duck and Tennessee Rivers of the Preglacial Ohio
System (Figure 1.16). Limited genetic exchange occurred between these two populations and populations from the Coastal Plains and this exchange was primarily with the Tennessee / Duck populations (ancestral E. duryi-E. flavum populations) and not with the Cumberland ancestral population (ancestral E. simoterum species group).
The periodic interglaciation events of the Pleistocene, and the retreat of the
Wisconsin glacier in the Late Pleistocene / Early Holocene produced massive glacial outwash through the Mississippi valley, form in g embayments that extended as far north as Southern Illinois as is evident from a series of deltatic events near
Crowley’s Ridge and continued as late as 8,000 to 6,000 years ago (Autin et al.,
1991). At these times, the mouths of the Tennessee and Duck Rivers would have fed directly into the Mississippi embayment, isolating the Cumberland population and resulted in the E. simoterum species group (Figure 1.17).
Populations in the Tennessee and Duck systems ceased gene flow with populations from the Coastal Plains leading to the separation of the E. duryi-E. flavum species group and isolation of the ancestral E. etnieri-E. pyrrhogaster-E. zonistium population from the remaining Coastal Plains species group (Figure 1.17).
62 Rgure 1.17. t^pothedcal distribudon of ancestral members of the subgenus U locentra at interglacial periods and during the retreat of the Wisccmsin glacier (End of the Pleistocene). Glacial outwash through the Mississippi River produces a Mississippi Ernkgmaent to which the mouths of the Tennessee and Dude Rivers fed directly. The Cumberland River population is isolated from the Tennessee Duck systems.
63 This dual vicariance is consistent with the divergence times of the central E.
duryi-E. flavum group from the E. simoterum group of the North (1.06% nucleotide
divergence from Table 1.5) and the E. coosae-E. scotti group of the Southeast
(0.97%). Support for the vicariance of the ancestral E. etnieri-E. pyrrhogaster-E.
zonistium population from the remaining Coastal Plains population comes from
comparable nucleotide divergence value of 0.87% (Table 1.5), cladistic and phenetic
patterns (Figures 1.8-1.11) and present patterns of disjunct distributions of E. pyrrhogaster and E. zonistium to the West of the present Tennessee and Duck
systems (Figures 1.12 and 1.15).
In the late Holocene. the Madrid Seismic Zone created fault lines that
diverted the flow of the Tennessee River Northward, reconnecting the Tennessee and
Duck Rivers with the Cumberland (Rodbell, 1966). This permitted the expansion of
E. flavum northward into the lower Cumberland River, and the expansion of E.
atripinne southward into the Duck and Tennessee systems where it is still in the
process of speciating into E. simoterum (Figure 1.18). This scenario explains the
cladogenesis (Figure 1.8), branch lengths / patterns (Figure 1.9) and polarity of
evolutionary changes for E. flavum (Figure 1.14) and E. atripinne-E. simoterum
(Figure 1.13).
64 Figure 1.18. (fypothedcal distributicms of ancestral members of the subgenus U lo c e n tr a in the late Holocene. The Madrid Earthquake diverted the flow of the Tennessee, Duck, and Cumberland Systems northward to their present configuration, reconnecting the three systems and allowing the secondary dispersal of K fla v u m northward into the lower Cumberland, and E. atripinne southward into the Duck and Cumberland Systems.
65 Genetic partitioning developed independently within each of the four species groups. The gene pool for the E. simoterum group originated in the Cumberland
River system (Figure 1.13). Apparently, the isolation of the ancestral E. baileyi population was the first of the species isolation events with a nucleotide divergence of 1.45% (Table 1.5). This would have placed the isolation of E. baileyi populations back before the vicariance events that separated the Cumberland from the Duck /
Tennessee systems (before the physical isolation of the E. simoterum species group).
T his early isolation of E. baileyi from other snubnose darters accounts for its plesiomorphic coloration and extra properculo-mandibular canal. It may also explain why the E. simoterum group only loosely holds together as a clade (Figure 1.8). It seems most reasonable to conclude that the ancestral E. baileyi population became isolated within the middle or upper Cumberland System, perhaps in the South Fork, and did not inhabit the Kentucky River system until a much more recent stream capture event. If the ancestral E. baileyi population or members of the ancestral E. simoterum species group were historical inhabitants of the Teays-Mahomet System
(to which the Kentucky River was connected in the early Pleistocene), they would be expected to inhabit other Ohio River tributaries today. Additional evidence for a recent faimal exchange between the upper Kentucky and Cumberland Systems is
found in disjunct populations of the arrow darter, with Etheostoma sagitta sagitta in the upper Cumberland and E. sagitta spilotum in the upper Kentucky System
(Kuehne and Bailey, 1961). The ancestor to E. rafinesquei-E. barrenense speciated
66 from the E. simoterum species group independent from E. baileyi (Figure 1.13) at a later date (1.16% nucleotide divergence Table 1.5), but it is unclear if this marks a second drainage capture or a range fragmentation event.
Within the Coastal Plains. E. coosae-E. scotti terminated its gene flow with the remaining Coastal Plains population relatively early (nucleotide divergence of
1.25% Table 1.5) which accounts for its plesiomorphic morphology. The E. etnieri-
E. pyrrhogaster-E. zonistium group was isolated from its Coastal Plains relatives
(0.87% Table 1.5) following the vicariance events outlined above. The ancestral population o f E. etnieri was apparently involved in an ancient (1.06% Table 1.5) faunal exchange event between the upper Duck or Elk drainages and the headwaters of the Caney Fork, rendering a relict population of E. etnieri in the middle
Cumberland, well isolated from its closest relatives £. pyrrhogaster-E zonistium-E. raneyi (Figures 1.8, 1.15).
The partitioning of genetic variation among the remaining members of the
Coastal Plains group reflect a Phylogeographic Category III pattern of Avise et al.
(1987), indicating limited gene flow in the ancestral population (the Alabama and lower Tombigbee Systems) with small mutational events radiating out to semi isolated adjacent drainages (£. colorosum in the coastal drainages to the south, and
£. bellator-E. chermocki above the Fall Lines to the North. Thus it would appear that the Coastal Plains group recently speciated through range fragmentation events from a widely distributed ancestral population as is reflected by the close genetic relationships among species (Figure 1.8-1.10, 1.15). The Fall Line forms the
67 boundary between the ecoregion of unconsolidated sandy sediments of the Coastal
Plains from more northern bedrock exposures. In Alabama the Fall Line appears to be a sufficient extrinsic barrier to most snubnose species, keeping the species pairs E. chermocki-E. bellator, E. tallapoosae-E. brevirostrum, and E. coosae-E. scotti above the Fall Line, and E. lachneri, E. raneyi, and E. colorosum below. Although the
range of E. ramseyi spans the Fall Lines in the Cahaba system, in has been suggested that the upper Cahaba form may constitute an undescribed species (Royal D. Suttkus
personal communication).
The ancient event that isolated the E. coosae-E. scotti group from the
members of the Coastal Plains (1.26% from Table 1.5) is unknown, but seems to
predate the vicariance events that isolated the other major species groups in the
Tennessee and Cumberland (97%-1.06% Table 1.5). The sister species E. coosae-E. scotti are genetically distinct, but do not form monophyletic lineages. Headwater
populations of the Coosa {E. coosae) and Etowha (£. scotti) systems are more
closely related to one another than either is to the E. coosae populations downstream
(Figure 1.8-1.11). The darters in the headwaters of these two systems must have
extremely limited gene flow with the E. coosae populations in the mainstream Coosa
River (Figure 1.14).
68 Legitimacy o f the Described Ulocentra species
The phylogenetic analysis of closely related taxa (Figure 1.8) reveals that most sister species (E. coosae-E. scotti, E. rqfinesquei-E. barrenense, E. pyrrhogaster-E. zonistium, E. duryi-E. flavum and E. simoterum-E. atripinne) are not reciprocally monophyletic. If the Monophyletic Species Concept (Donoghue, 1985;
Mishler 1985) and /or the Genealogical Species Concept (Baum, 1992; Davis, 1997) are strictly applied to the subgenus Ulocentra, only eight of the twenty described species {E. tallapoosae, E. brevirostrum. E. ramseyi, E. lachneri, E. colorosum. E raneyi, E. etnieri, and E. baileyi) would be valid. Given the recent radiation of the group from four independently evolving clades, it is likely that many of the sister
species pairs have not yet undergone the process of complete stochastic lineage
sorting [as described in Avise (1994) pg. 126-133] to make them monophyletic. even though they no longer exchange genes. The process of mtDNA lineage sorting has been modeled by Avise et al. (1984), to show a strong demographic effect. While a small founding population of around 10 individuals may only take 10" generations to purge itself of two or more haplotypes, a larger one of 10,000 individuals may take up to 10^ generations to do so (Avise et al. 1984). Snubnose darters are usually among the most abundant species at a stream site and have a generation time of 1-2 years (Clayton, 1984; Carney and Burr, 1989; Page and Mayden, 1981; O'Neil,
1981). Even if the population size of ancestral stocks to snubnose sister species were around 50 individuals, it would take an estimated 5,000-10,000 years of mtDNA
69 evolution before the sister species would be expected to exhibit reciprocal monophyly. Since the phylogeographic evidence points to a time frame of this magnitude for the formation of major clades in Ulocentra, most snubnose species would be expected to exhibit polyphyletic relationships with their sister species today. A case study of genetic structure between two sister species reveals that £. barrenense population samples were distinct from E. rqfinesquei population samples even in the Gasper River, a downstream tributary to the Barren river inhabited by a relict population of E. rafinesquei (Table 1.4). Since identical haplotypes from any given species were never revealed in samples of their closest relatives, and many population samples show fixation o f one haplotype (Table 1.4), snubnose species appears to be evolving independently form each another and therefore constitute good species under the Phylogenetic Species Concept (Cracraft, 1983; Davis. 1997).
70 CHAPTER 2
Osteological Analysis of the Darter Subgenera Ulocentra^ Nanostoma, and
Etheostoma (Genus Etheostoma, Family Percidae).
INTRODUCTION
In Chapter I, three competing hypotheses on the interrelationships of the darter subgenera Ulocentra, Nanostoma, and Etheostoma were evaluated with a new- set of characters, mtDNA sequence data. The results support monophyly for the subgenus Ulocentra {sensu Bailey and Etnier. 1988), and suggest that the subgenus
Etheostoma is polyphyletic. The mtDNA study places two species groups of the subgenus Etheostoma genetically closer to the members of the subgenus Ulocentra than to other members of the subgenus Etheostoma, promoting a restriction of the subgenus Etheostoma to the E. talassinum group of Tsai (1966), plus an assemblage forming a novel E. blennioides species group (Chapter 1) including E. blennioides,
E. blennius, E. rupestre, and E. histrio. In addition, the mtDNA study suggests restricting the subgenus Nanostoma to two species (£. zonale and E. lynceum), and the resurrecting of the subgenus Poecilichthys to contain the saddle darters of the E. variatum species group (Richards, 1966) in an effort provide systematic nomenclature that reflects monophyletic groups. The legitimacy of these clades
71 based on the current set of published morphological characters is tentative, as there have been few synapomorphic characters proposed to date.
This chapter investigates the morphological support for proposed relationships among and between the subgenera Ulocentra, Nanostoma, and
Etheostoma through the phylogenetic analysis of osteological characters. Efforts are made to identify monophyletic subgenera based on morphological criteria. An interpretation of the functional significance of osteological characters is presented to interpret the evolutionary sequence of events that led to the various clades within the
Etheostoma group.
METHODS AND MATERIALS
Sample Collection
Taxa were selected to test current hypotheses regarding the monophyly of the subgenera Ulocentra. Nanostoma, and Etheostoma (Bailey and Etnier, 1988; Page.
1981 ; Wood and Mayden. 1997). A taxonomic summary of species important to this study is presented in Table 2.1. Efforts were made to collect snubnose species from their type localities in breeding season, or from localities known to only have one species of snubnose darter, to help diminish questions of species identification.
Samples were taken by kick seining into a downstream '‘common sense” seine (1.8 x
2.4 meter fine mesh nylon). Each collection locality was given a site number and each collection was assigned a unique field number. Specimens were sorted to
72 species lots and assigned a unique catalogue number for voucher in The Ohio State
University Museum of Zoology (OSUM) collections. Specimens utilized in this analysis are listed in the Material Examined section.
Clearing and Staining
Specimens for skeletal preparation were fixed in 10 % formalin for two to three days. Excess formalin was removed from the specimens by soaking in several changes of water for 24 hours before working them through a series o f increasing ethanol solutions up to 70% ethanol, where specimens could be stored for many years before skeletal preparation. The enzyme method (Taylor, 1967) was used for clearing and staining darter specimens to produce fully articulated skeletons.
Specimens were soaked in water to remove the storage ethanol. Pigments were bleached from the integument for several hours using 0.3 % hydrogen peroxide in
0.5% w/v KOH water solution. Muscle was digested at 37^ C with 1% w/v Trypsin enzyme in sodium borate buffer (30% saturated sodium borate in water). Bones were stained with alizarin red S in 0.5% KOH after 12-24 hours. Specimens were rinsed in water and cleared with progressive solutions of 0.5%KOH and glycerin to a final storage in full strength glycerin.
Cleared and stained specimens were prepared for photography following the
Ridewood method (Ridewood, 1904). Dissection was performed with iris scissors and forceps. Functional units were photographed in glycerin with a binocular sterioscope (Wild M5), under 25-50X magnification using T-Max 100 film.
73 Phylogenetic Analysis
Characters for osteological analysis were obtained from the examination of cleared and stained specimens and checked against reports in the literature.
Characters were coded into character states and polarized by outgroup comparison
(Watrous and Wheeler, 1981), using outgroups listed in the Material Examined section. Character state were recorded from 31 species of the Etheostoma group sensu Bailey and Etnier (1988). The character matrix was submitted to hennig86 and
NONA for maximum parsimony analysis.
Osteological Character Descriptions
The following transformation series summarize the description of osteological character states observed from cleared and stained material, x-ray photography, and ethanol stained specimens for the subgenera Etheostoma,
Nanostoma, and Ulocentra (Table 2.1). A brief description of the systematic utility follows the information on the coding of each transformation series. The taxonomic names used in the description of these characters follows Table 1.1. Characters that exhibited multiple states were not ordered to avoid a priori assumptions on the directionality of evolutionary events within the group. Transition series were polarized by the outgroup method (Watrous and Wheeler, 1981) through the analysis of various other subgenera of Etheostoma.
74 1 5 10 15 20 25 30 35 40 45 50 54 I I I i I I I I I I : ! tetrazonum 000000000000000000001000000000001000000000000110000010 2 variatum 000000000000000000011000000010000000000000000110000100 2 zonale 000001112201100101110101120101003000001000000100010000 1 3 lynceum 00000 1111201101101110100120101003000001000000100010010 swannanoa 000001112102001111111102001112000000000100010100010010 2 2 thalassinum 010000012102100011011000020112000000000100010100010000 3 inscriptum 000000012102100101111102320112000100000100010100010000 2 blennioides 111011120202211101001102201012000000001010101100000100 2 1 rupestre 110101110200101111001102021012020000000010021100000110 blennius 110001112200101111111102 701112000000001000010100000000 2 h istrio 000101112202001111101102000010023100000001020100001000 2 1 1 simoterum 111101120212212102111210101212012111112001110000121ÛG1 a cripinne 111111120212212101111210201212012111112001110000121011 barrenense 111101120212212102101210101212022111112001110000021001 rafinesquei 111101120212212102101210101112003111112001110000021001 2 baileyi 111011120212212101101211110012013110111001100001021CG1 2 1 duryi 110101120212112101101210 300000003110012001110000021001 1 1 flavum 11010012021211210110G212300G0Ü0Û3110111001110000021000 1 1 e tn ie ri 100110120212102102111210200100013110011001100000021000 1 coosae 100100001212002111100200200100013110010001110001021000 1 2 s c o tti 110100001212002111110200200100013110010001110001021000 1
continued.
Table 2.1. Osteological character matrix for phylogenetic analysis.
75 1 5 10 15 20 25 30 35 40 45 50 54 I I I I I I I I I I I ! pyrrhogaster 100101101212102101111210200000013110011001120000021001 2 zonistium 110100101212102101111210220100113110011001110001021001 chermocki 110101121212102112101212220000103110001001120000021000 1 b e lla tor 110101101212102111101211200100103110011001110000021000 colorosum 110100111212102102110210700100013110001001120001021001 2 11 tallapoosae 110100011212102111111210200100103110001001010001021000 1 1 brevirostrum 110100121212102102101210200000103110000001010001021000 1 1 lachneri 110100101212102102117210300010103111010001110001021000 ramseyi 110100121212102112117210 300000103110010001110001021001 2 1 raneyi 11010011121170010210 7211200010103110001001110000021000 2 11
Table 2.1 continued. Osteological character matrix for phylogenetic analysis.
76 Ratios were used to determine relative size of various structures. The previous use
of osteological characters in other studies is cited, along with any reinterpretations of
polarity and coding unique to this study.
Cranial Skeleton
Jaws
1. Premaxillary length (Wiley, 1992 Figure 2, pg. 253; Simons, 1992: Figure la,
b, pg. 271 ; Shaw, 1996). (0) Short, with height of ascending process of the
premaxilla relative to the length of the alveolar process producing ratios of
0.5 — G.8:l(Figure 2.1a); (1) Long, with ratios 0.81 - 1.19:1 (Figure 2.1b).
The derived state is found among most members of the subgenus Ulocentra.
E. blennius, E. blennioides, and E. rupestre.
2. Maxillary process of the premaxilla (Simons, 1992: Figure la, b, pg. 271. (0)
Rounded and separated from the ascending process (Figure 2.1a); (1) with
dorsal alar protrusion extending well past the articular surface (Figure 2.1b).
This character was reworked from two characters utilized by Simons (1992)
and Shaw (1996), to characterize the height, fusion, and shape of the
maxillary process. In Ulocentra darters the amount of fusion to the
ascending process is directly related to the shape of the maxillary process
77 b.
c.
Figue 2.1. Lateral view of left premaxillae and maxillae of (a) E. tetrazonum
(b ) E. baileyi, (c) E . c o o sa e , (d) £ 1 rafinesquei. Hyphenated numbers refer to transformation series and character state. Scale bar equals 1mm.
78 (presence o f alar protrusion). The derived state is found in most members of
the subgenus Ulocentra, and E.blennius, E. blennioides, E. rupestre, and E.
thalassinum.
3. Maxillary length. (0) Long and slender, with maxillary blade greater than
1.25 times the length of the articular surface (Figure2.1c); (1) short and wide,
with ventral blade approximately equal to the length of the articular surface,
width of blade about 0.5 times length (Figure 2. Id). The derived state is
found in the E. simoterum species group of Ulocentra.
4. Number and arrangement of foramina on mandibular canal (Wiley, 1992:
Figure 4h; Shaw, 1996: Figure 17a-d). (0) Four (Figure 2.2a, b. d); (1) three
(Figure 2.2c). The primitive condition equals state one of Shaw ( 1996), and
the derived state equals state three of Shaw (1996). E. baileyi shares the
primitive state with most members of the subgenus Etheostoma, with the
exception o f E. histrio and E. rupestre, which are derived in a similar manner
to the other members of Ulocentra.
5. Placement of the second mandibular pore. (0) Ventral placement with
enclosed canal above, but not below (Figure 2.2b); (1) lateral placement, with
canal enclosed above and below (Figure 2.2d). The derived state is shared by
E. baileyi, E. atripinne, E. etnieri, and E. blennioides.
79 b.
F%me 2 2 . Lateiai view of left dem ay and angoloaiticnlar of (a) E. tetrazonum, (b) E zonaJe,(c)E. coosae, aad(d)E. baileyi. Mandibular poms are numbered anfenor to posterior. Hyphenated numbers refer to transfoimation series and character states. Scale bar equals I mm.
80 6. Angle of the coronoid process of the dentary to the lower limb of the
dentary. (0) Coronoid process not significantly deflected dorsally making the
angle between the coronoid and body of the dentary less than 45 degrees
(Figure 2.2a, c); (1) coronoid process deflected dorsally making the angle
approximately 45 degrees to the body of the dentary (Figure 2.2b. d). This
character varies among the taxa from each subgenus.
7. Length of dentary. (0) Long, extending anterior past the lacrimal for half its
length or more (Figure 2.2a, c); (1) short, not extending appreciably anterior
past the lacrimal (Figure 2.2b, d). This character varies among the taxa from
each subgenus.
8. Surangular process of the anguloarticular (Wiley. 1992:Figure 4. pg. 255).
(0) Forms a small pointed prominence (Figure 2.2a, c); (I) forms a rounded
prominence about equal in size to the coronoid process of the dentar}' (Figure
2.2b); (2) posterior expansion of the surangular process making it noticeably
larger than the coronoid process of the dentary (Figure 2.2d). This transitions
series is polarized, but unordered. E. tetrazonum, E. variatum, and some
members of the E. coosae + Coastal Plains species groups have the primitive
state. Only mature specimens should be used for this character since it does
not consistently reach full development imtil after the first year.
81 Suspensorivm
9. Anterior tip of ectopterogoid (Shaw, 1996: Figure 18a-c). (0) Overlaps the
palatine by at least one-quarter of the length of the ectopterygoid (Figure
2.3a); (1) slightly overlaps the palatine (Figure 2.3c); (2) abuts the palatine
(Figure 2.2b). An unordered but polarized transition series following Shaw
(1996). This character varies among the taxa from each subgenus.
10. Palatine dentition (Richards, 1966). (0) Palatine with numerous teeth (Figure
2.3a); (1) palatine teeth reduced to 1-3; (2) palatine teeth absent (Figure 2.3b.
c). In situations where this character is known to vary within a species, it is
coded as polymorphic. The advanced state (2) is present in all members of
the subgenus Ulocentra and numerous members of the subgenus Etheostoma.
11. Body of the quadrate. The body of the quadrate is the portion that articulates
anteriorly with the ectopterygoid, dorsally with the endopterygoid, and
posteriorly with the metapterygoid. (0) Body rounded in perfect curve Figure
2.3a, b); (1) posterior portion forms an abrupt angle to articulate flat against
the metapterygoid (Figure 2.3c). Members of the subgenus Ulocentra have
the derived state.
82 Figure 2.3. Lateral view of left suspensorium of (a) Etheostoma tetrazonum, (b) E. zonale, (c) E. rafinesquei. Hyphenated numbers refer to transformation series and character state. Scale bar equals 2mm.
83 y
b.
à
Figure 2.3. Lateral view of suspensoria 84 12. Posterior notch of the quadrate (Simons. 1992: Ig, h. pg. 271). The notch
between the body o f the quadrate and the posterior process accepts the
symplectic. (0) notch is actually a grove in the medial surface, while the
lateral surface is connected by bone (Figure 2.3a); ( 1 ) Intermediate notch
present such that only one half of the symplectic is laterally exposed (Figure
2.3b); (2) deep notch such that most or all of the symplectic is laterally
exposed (Figure 2.3c). The primitive condition is found in the E. variatum
group E. rupestre, and E. blennius.
13. Shape of symplectic. (0) Long and slender (Figure 2.3a); ( 1 ) short with a
small dorsal lamina (Figure 2.3b); (2) short with a lamina that interdigitates
with the metapterygoid (Figure 2.3c). The primitive state is found in the £.
variatum group, E. swannanoa. E. histrio, and E. coosae. The most derived
state (2) is foimd in E. blennioides and all members of the £. simoterum
group.
14. Origin of the adductor mandibula. (0) On ridge of hyomandubular near its
articulation with the preopercle (Figure 2.4a, b) ; (1) on an anteriorly directed
spur of the hyomandibular (Figure 2.4c). The derived state is found in £.
blennioides, £. duryi, £. flavum, and all members of the £. simoterum group.
85 Opercular Series
15. Size of ascending process of the subopercle (Shaw, 1996: Figure 3 la-c, pg.
132). (0) Short, extending up the opercle only one third of the way (Figure
2.4a); (1) intermediate, extending up the opercle more than one third, but less
than one half (Figure 2.4b); (2) long, extending up the opercle half way or
more (Figure 2.4c). This transtiton series is reworked from Shaw (1996) to
reflect a progressive lengthening of the ascending process within the
Etheostoma group, and the sates are ordered. The members of the subgenus
Ulocentra share the most derived state with a long ascending process.
16. Anteriodorsal contour of the opercle. (0) Anteriodorsal edge of opercle is
nearly straight (Figure 2.4a); (1) concave along the inferior portion making a
notch that accepts the ascending process of the subopercle (Figure 2.4b, c).
The primitive state is found in E. thalassinum and member of the E. variatum
group.
17. Development of the opercular spine. (0) Strong spine with development of a
reinforcing strut across the entire opercle and an emarginate ventral boarder
of the opercle (Figure 2.4b, c); (1) weak spine resulting from minimal
development of a reinforcing strut and confluent ventral boarder (Figure
2.4a). The loss o f the opercular spine is variable among taxa.
86 Figure 2.4. Lateral view of left byomandubulai; opercle and subopeiclefiom (a)
Etheostoma thalassinum, (b) E . z o n a le , (c) E atripinne. Hyphenated manbeis refer to txansformatkm series and character states.
87 18. Angle o f the preopercle. (0) Inside angle between upper and lower arms of
preopercle around 130° (Figure 2.5a); (1) inside angle 100-110° (Figure
2.5b); (2) inside angle 90°. The primitive state is found in the E. variatum
group.
19. Anterior concave margin of the preopercle and relationship to interhyal
(Simons, 1992: Figure 2g, h, pg. 274; Shaw, 1996: Figure 25a-c, pg. 125).
(0) Preopercle contains a notch at the location of the articulation with the
interhyal (Figure 2.5a); (1) smoothly concave not covering the distal end of
the interhyal (Figure 2.5b). These characters were recoded from Simons
(1992) and Shaw (1996) because their most primitive state (smoothly
concave and covering the distal end of the interhyal) was not present among
members in this investigation.
20. Posterior boarder of the bony preoperculomandibular canal (Shaw, 1996:
Figure 28a-b, pg. 127). (0) Canal partially or mostly closed (Figure 2.5a, b);
( 1 ) canal completely open forming a shelf over the canal. This character is
variable among taxa.
88 J
Figioie 2.5. Lateral view o f left preopercle fiom (a) Etheostoma tetrazonum (b) E. histrio.
Hyphenated taunbers refer to transformation series and character states. Scale bar equals Irrrm.
89 Branchiohyoid Apparatus
21. Ossified pharyngobranchial-1. (0) Absent, or present as a cartilage (Figure
2.6a); (1) present as a small rod-like structure connecting the pharyngeal
apparatus to the prootic (Figure 2.6b).
22. Length of basihyal. (0) Long, equal in length to basibranchials 2 plus 3
(Figure 2.6a); (1) intermediate, equal in length to basibranchials 1 and 2; (2)
short, equal in length to basibranchial 3 (Figure 2.6b). The most derived state
is found in all members of the subgenus Ulocentra.
23. Number of branchiostegal rays (Bouchard, 1977; Wiley, 1992: Figure 5a-c.
pg. 256). (0) Six; (1) five. The derived state is present in all members of the
subgenus Ulocentra and some individuals of E. zonale, except that E. coosae
often has six. The derived condition results from a loss of branchiostegal
number three following the numbering system of Wiley (1992).
24. Shape of the dorsal portion of the anterior ceratohyal. (0) Incomplete bridge;
(1) nearly complete bridge; (2) complete bridge. This character varies
among taxa.
90 Figme2.6. Dofsal view of the lower biancliial apparatus and ventral vew of the upper branchial apparatus fiom (a) Etheostoma tetrazonum (b) E simoterum. Hyphenated mimbeis refer to transformation series and character states. Scale bar equals 1mm,
91 25. Shape of the anteriodorsal urohyal. (0) club shaped spine; (1) two pleats
expanded laterally; (2) one pleat expanded laterally; (3) no pleats. This
character varies among taxa.
Infraorbital Series
26. Number of infraorbital bones (Shaw, 1996: Figure 33a-g, pg. 135). (0) Six
(Figure 2.7a, c, e, h. I); (1) seven (Figure 2.7g); (2) five (Figure 2.7b, d, f, i, j,
k); (3) four. This character is variable among taxa and even within an
individual (right and left sides). Characters were coded as polymorphic.
27. Shape of lacrimal (Figure 2.7). (0) Shape approximated by a rhombus where
the greatest height exceeds the greatest width; (1) shape approximated by an
isometric rhombus where the greatest height is approximately equal to the
greatest width.
28. Dorsal margin of the lacrimal (Figure 2.7). (0) Straight, or nearly so; (1 )
concave; (2) convex.
29. Anterior margin of the lacrimal (Figure 2.7). (0) Straight, or nearly so; (1)
slightly convex; (2) strongly convex.
92 Figure 2.7. Lateral view of left infraorbital series from (a) Etheostoma tetrazonum. (b) E. lynceum, (c) E. swannanoa, (d) E. histrio, (e) E. blennioides, (f) E. blennius, (g) E. coosae, (h) E. flavum, (I) E. baileyi, (j) E. barrenense, (k) E. simoterum, (I) E. atripinne. The enlarged lacrimal is infraorbital number I. Hyphenated numbers refer to transformation series and character states. Scale bar equals 1 mm.
93 32-0 b.
28-0 28-1 30-2
29-1 29^1 c. 28-1 y30-2^ 28-0
29-1 29-1 e.
294) '3 3 -3
30- : ^ 28-2 ,2 8 -0
29-1 29-1 Figure 2.7. Infraorbital Series. 94 30. Anteriodorsal juncture of the lacrimal (Figure 2.7). (0) Angled (Figure 2.7a);
(I) pointed dorsally (Figure 2.7b); (2) rounded (Figure 2.7c).
31. Bony tube surrounding the infraorbital canal on the lacrimal (Shaw, 1996:
Figure 34a-c, pg. 136). (0) Bent strongly dorsally opposite the third foramen;
(1) straight or slightly curved from foramen one to four. The derived state is
found in several members of the subgenus Ulocentra.
32. Closure of the infraorbital canal on infraorbital two (Shaw, 1996: Figure 36a,
b, pg. 139). (0) Bony tube three-quarters closed (Figure 2.7a); (1) bony tube
half open (Figure 2.7i); (2) bony tube closed, for at least a portion (Figure
2.7J). This character was reworked from (Shaw, 1996).
33. Laminar shelf on infraorbital two (Shaw, 1996: Figure 35a-c, pg. 138). (0)
dorsal and ventral lamina (Figure 2.7f); (1) dorsal shelf only (Figure 2.7a);
(2) ventral shelf only (Figure2.7 j); (3) no lamina (Figure 2.7g). This
character was reworked from Shaw (1996).
95 34. Ends of each infraorbital bone (Figure 2.7). (0) Bent ventral ly to form the
base of the fleshy tube (Figure 2.7f); (1) ends straight with no ventral
widening (Figure 2.7h). The derived state is foimd in E. inscriptum, E.
histrio, and all members of the subgenus Ulocentra.
Cranium
35. Supraoccipital Crest (Shaw, 1996; Figure 16a-c, pg. 109). (0) elongate ridge
along the anterior- posterior axis; (1) reduced to small trigangular ridge. The
derived state is found in all members of the subgenus Ulocentra.
36. Vomerine teeth (Richards, 1966). (0) present; (1) absent. The derived state
is found in members of the E. duryi species group (Bouchard, 1977; Bailey
and Etnier, 1988). In addition, some specimens of E. baileyi also had the
derived state, contrary to the literature (Bouchard, 1977; Page and Burr,
1982; Bailey and Etnier, 1988).
37. Body of the mesethmoid. (0) Narrow and positioned anterior to the lateral
ethmoids when viewed in lateral view (Figure 2.8a); (1) wide and bending
posteriorly between the lateral ethmoids (Figure 2.8b, c). The derived state is
found in all members of the E. simoterum species group.
96 b.
c.
Figuie 2.8. Lateral view of cranium. 97 38. Olfactory foramen of the lateral ethmoid. (0) Foramen completely enclosed
in bone (Figure 2.9a); (1) foramen open along the medial surface (Figure
2.9b). The derived state is found in Ulocentra except E. chermocki and E.
tallapoosae, which occasionally have it enclosed by a thin bridge.
39. Shape of the parasphenoid (Figure 2.8a-c). (0) Ventral keel absent (Figure
2.8a); (1) small ventral keel along portion anterior to the lateral processes: (2)
prominent ventral keel along the portion anterior to the lateral process. The
most derived state is found in E. barrenense, E. rafinesquei, E. simoterum, E.
atripinne, and E. duryi.
40. Size of the exposed portion of the parietal bone. (0) Small; (1) large. The
derived state is foimd in E. swannanoa, E. thalassinum. and E. inscriptum.
41. Lateral process of the nasal bone (Simons, 1992 Figure 4 pg. 279). (0)
Prominent; (1) reduced. The derived state is found in E. rupestre and E.
blennioides.
98 Figme 2.9. Frontal view o f right lateral ethmoid of (a) Etheostoma zonale (b) E flaw m showing variation in the closure o f the olâctoiy foramen. Hyphenated numbers refer to transformation series and character state. Scale bar equals 1mm.
99 Appendicular Skeleton
Pectoral Girdle
42. Spine of the cleithrum (Figure 2. lOa-c). (0) Short, not extending extensively
superior to the humeral process in lateral view (Figure 2.10b); (1) long,
extending superior to the humeral process (Figure 2.10c). The derived state
is found in £. histrio and all members of the subgenus Ulocentra.
43. Humeral arm of the cleithrum (Figure 2.10a-c). (0) Bent 30 to 45 degrees
above horizontal (Figure 2.10a, b); (1) bent 20 degrees or nearly horizontal
(Figure 2.10c). This character is variable tunong taxa.
44. Scapular foramen (Tsai, 1966). (0) large, comprising one quarter the area of
the scapula (Figure 2.10a); (I) medium, comprising one ninth or one tenth of
the area of the scapula (Figure 2.10c); (2) small, comprising one fifteenth of
the scapular area (Figiure 2.10b).
45. Intercleithrocoracoid fenestra (Tsai, 1966: Figure 2b, pg. 348). (0) Present;
(1) nearly closed. The derived state is foimd in E. blennioides and E.
rupestre.
100 42-0
42-1
Figure 2.10. lateral view o f left pectoral girdle o f (a) Etheostoma tetrazonum, (b) £. swannanoa,
(c) E. simoterum. Hyphenated numbers refer to transformation series and character states. Scale bar equals 1mm. 101 46. Base of pectoral rays (Figure 2.10a-c). (0) Thom-like processes absent
(Figure 2.10c); (1) strong superior thom-like processes for attachment of the
abductor pectoralis muscle. The derived state is found in all members of the
subgenus Etheostoma.
47. Articular surface of the radiais (Figure 2.1 Oa-c). (0) terminal articulation
with the pectoral rays (Figure 2.10c); (1) Articular surface is directed
laterally (Figure 2.10a). The derived state is found in E. variatum species
group.
48. Length of postcleithrum 2. (0) Short, extending ventrally to the upper half of
the scapula when viewed in medial view; (I) long, extending ventrally to the
ventral margin of the scapula. This character is variable among taxa.
49. Shape of postcleithrum 3 (Shaw, 1996: Figure 41, pgl50). (0) With a
moderate expansion three to six times the posteroventral arm; ( I ) lacking any
significant expansion. The derived state is found in E. atripirme and E.
simoterum, but this character is influenced by sex, and therefore only males
should be compared.
102 Pelvic Girdle
50. Length of ischiopubic process (Figure 2.1 la-c). (0) Fused for greater than
half of the entire pelvic girdle (Figure 2.1 la); (1) fused for approximately
half of the entire pelvic girdle (Figure 2.1 lb); (2) fused for much less than
half of the entire pelvic girdle (Figure 2.1 Ic). The most derived state is
found exclusively in the members of the subgenus Ulocentra.
51. Pelvic spine (Figure 2.11 a-c). (0) Broad and stout spine, length is less than
the length o f the pelvic bone (Figure 2.1 la); (1) long and slender spine,
approximately equal to the length of the pelvic bone (Figure 2.1 lb, c). This
character is variable among taxa.
52. Medioposterior process o f the pelvic bone (Tsai, 1966: Figure 2c, pg. 348).
(0) Not enlarged; (1) enlarged laterally into two wings;. The derived state is
found in E. variatum., E. blennioides, and E. rupestre.
103 Figure 2.11. Ventral view of the pelvic girdle from (a) Etheostoma tetrazonum, (b) E. zonale, (c) E. etnieri. Hyphenated numbers refer to transformation series and character states. Scale bar equals 1mm.
104 51-0
51-1
c.
Figure 2.11. Ventral view of pelvic ginfle.
105 Axial Skeleton
53. First epineural rib (Figure 2.12). (0) Not laterally compressed; (1) Laterally
compressed on the distal surface to provide a wide articular surface with
postcleithrum 2 (Figure 2.12). The derived state is found in E. tetrazonum, E.
rupestre, E. swannanoa, E. lynceum and E. atripinne.
54. First anal spine pterygiophore (Tsai, 1966 Figure 12 pg. 341; Shaw, 1996
Figure 42 pg. 152). (0) Enlarged dorsal end reaches to the hemal arch; (1)
reduced, not reaching the hemal arch. This character is variable among taxa.
106 Figure 2.12. Lateral view o f the enlaigied and flattened distal portion o f epmeuiai I th^ articulates with postcleithrum 2 (removed) in Etheostoma tetrazanum. Hyphenated number refers to transformation series and character states. Scaiebarequals ImtrL
107 RESULTS
The maximum parsimony analysis of the 54 osteological characters produced
14 equally parsimonious trees with lengths of 195 evolutionary steps. A strict consensus cladogram of these 36 trees is presented in Figure 2.13. Rooting the tree with E. tetrazonum is justified by the large number of plesiomorphic characters retained by members of the E. variatum group (Hubbs and Black, 1940) and by the its basal position on phylogenetic trees produced from allozyme data (Page and
Whitt, 1973b; McKeown et al., 1984). The subgenus Ulocentra is demonstrably monophyletic, while members of the Subgenus Etheostoma appear to be polyphyletic.
Seven osteological synapomorphies unite members of the subgenus
Ulocentra. The typical percid quadrate has a rounded body that abuts a concave anterior surface of the metapterygoid. In the subgenus Ulocentra, the body of the quadrate does not form a smooth curve and bends abruptly near its apex to articulate flat against the convex anterior surface of the metapterygoid. Most darter taxa have a short ascending process o f the subopercle (Shaw, 1996). Members of the subgenus
Ulocentra have a long ascending process of the subopercle, contacting the opercle along its anterioventral length to a height greater than half the height of the opercle.
The basihyal in members of the subgenus Ulocentra is abbreviated and widened
108 jtetrazonum v a r ia tu m h a la s s in u m in sc rip tu m a n n a n o a o n a le ly n c e u m b le n n iu s blennioides ru p e stre istrio c h e r m o c k i b e lla to r ■aneyi fftn ie r i lyrrhogaster .zo n istiu m co lo ro su m tallapoosae .co o sa e s c o tti brevirostrum la c h n e r i ra m s e y i d u r y i 'ovum b a ile y i a fin e s q u e i b a rre n e n se im o teru m a trip in n e
Figure 2.13. Maximumm Parsimony strict consensus cladogram of 14 equally parsimoneous trees of 196 evolutionary steps for 54 osteological characters coded for members of the subgenera Etheostoma and Ulocentra.
109 unlike other members of the genus Etheostoma. The supraoccipital crest in
Ulocentra darters does not extend down the entire anterior- posterior ridge of the basioccipital. Instead, it forms a prominent triangular crest restricted to the superior portion of the basioccipital. Most percids have an enclosed olfactory foramen of the lateral ethmoid. In most Ulocentra individuals, the lateral ethmoid is open on its anterior surface. Specializations of the Ulocentra appendicular skeleton are seen in an elongated pelvic bone with a small fusion at the ishiopubic process, so that the fusion is much less than one half the length of the pelvic girdle. In the pectoral girdle of Ulocentra species, an enlarged cleithral spine extends well above the humeral arm.
The monophyly of the £ simoterum species group (Bouchard. 1977; Bailey and Etnier, 1988) is also supported by several osteological synapomorphies.
Members of the £. simoterum species group, including £. simoterum, E. atripinne, E. baileyi, E. barrenense, and £. rafinesquei. have a shortened maxillary blade to complement short upper and lower jaws and small gape size. Most species of
Etheostoma have a cylindrical symplectic bone that articulates only with the hyomandibula and interhyal posteriorly, and the quadrate anteriorly. In members of the £. simoterum species group of the subgenus Ulocentra (and perhaps secondarily in £. blennioides), the symplectic interdigitates with the metapterygoid forming a rigid articulation.
110 DISCUSSION
The subgenus Ulocentra is diagnosed as a monophyletic group by the presence of four osteological synapormorphies not found in other darter subgenera examined in this study. Members of the subgenus Ulocentra share a short basihyal that is approximately equal in length to the third basibranchial, a reduced supraoccipital crest forming a small triangular dorsal ridge, short fusion of the ischiopubic process, and an incomplete olfactory foramen that is open along the mesa] surface.
In addition, two other osteological characters define all members of the subgenus Ulocentra from members of the sister subgenus Etheostoma. All members of the subgenus Etheostoma have a rounded posterior body of the quadrate. In
Ulocentra species, the posterior body o f the quadrate is abruptly angled to articulate flat against the metapterygoid, but this character is also shared with members of the subgenus Oligocephalus. All members o f the subgenus Etheostoma have prominent thorn like processes on the anteriodorsal surface of the pectoral fin that presumably provide attachment for the abductor pectoralis muscle. These enhanced attachment surfaces, coupled with laterally directed articular surfaces o f the radiais, probably accounts for the laterally extended fin posture found in members of the E. variatum
111 group of Etheostoma. Ulocentra species lack thom-like articular processes on the pectoral rays, a plesiomorphic condition shared by all other outgroup taxa analyzed.
Several other osteological characters unite most members of the subgenus
Ulocentra, but appear to be reversed in a few taxa. A long ascending process of the preopercle is found on all Ulocentra species except £. raneyi, which shows a probable reversal to the abbreviated state. Ulocentra species usually have five branchiostegal rays on each side, however E. coosae and E. scotti often have six, and
E. zonale and E. lynceum occasionally have six.
Several osteological characters support the close relationship of E. histrio to the members of the subgenus Ulocentra. The spine of the cleithrum is long, extending past the humeral process in both E. histrio and Ulocentra species, but is short in all other members of the subgenus Etheostoma. Likewise, E. histrio shares an elongate and slender pelvic spine with all Ulocentra species. The ends of the infi-aorbital bones are unspecialized in these taxa, but are bent ventrally in most other members of the subgenus Etheostoma to provide a widened base to the fleshy infraorbital canals.
The genus Etheostoma was described by Constantine S. Rafinesque in 1819 to accompany the description of E. blennioides and E. Jlabellare. The generic name
Etheostoma means “variable mouth,” and indeed the genus is appropriately named given a comparison of the jaw structures between these two species. Although the basic prey items (insect larvae) are largely consistent among darter species, members of the genus Etheostoma possess a wide variety of mouth structures in response to
112 evolutionary pressures to divergent feeding strategies. Five or more darter species can often be found within a single riffle in eastern North American streams, each partitioning the larval insect resource by foraging in a particular microhabitat
(Schlosser and Toth, 1984; Page and SwofFord, 1984) and/ or on particular prey items (Wynes and Wissing, 1982). Variation in stream conditions among the various microhabitats has shaped the feeding apparati of darters in different ways. While the terminal mouth of £. caeruleum may be ideal for picking insect larva off the side of a rock, the oblique mouth of £.jlabellare is well suited for foraging on the undersides of rocks.
Members of the subgenus Ulocentra are highly specialized benthic foragers, and their jaw morphology reflects adaptations for bottom feeding in slow moving water. The most generalized mouth structure would involve a more horizontal feeding strike, a likely ancestral condition for the members of the Etheostoma group.
The "ancestral strike” would involve a rapid protrusion of the premaxilla and maxilla forward. The anterior articular surface of the mesethmoid would be directed forward to provide an articular tract for the premaxilla; and the metapterygoid would be more dorsally oriented to support an elevated suspension of the upper jaw.
Successful horizontal strikes would also require an elongated dentary, and anguloarticular, bones of the lower jaw to compensate for the outward protrusion of the upper jaw. Although a darter with this generalized morphology could perform a benthic strike, it would need to rapidly pitch its body downward, causing a tremendous expenditure of energy against a rapidly moving current.
113 In contrast, an “ideal benthic strike” would favor the morphology of a long ascending process of the premaxilla in conjunction with an articular surface of the mesethmoid directed ventrally to guide the upper jaw downward. The metapteryogoid would be oriented downward to support a more relaxed upper jaw.
In addition, foreshortening of the lower jaw would be necessary to compensate for overshooting a benthic prey item.
Members of the subgenus Ulocentra and various members of the sister subgenus Etheostoma have evolved in parallel with the subgenus Nanostoma, various morphological specializations for benthic feeding. Foreshortening of the snout to form a “snubnose darter” morphology was a necessary accommodation to the underlying structural changes in osteology. This study of osteology supports the hypothesis that these three clades converged on this similar morphology by independent evolutionary changes. Within the subgenus Etheostoma (sensu Bailey and Etnier, 1988), the E. variatum group (Richards, 1966) exhibits the most plesiomorphic morphology with a large body size and primitive cranial osteology.
The premaxillary bone has a short ascending process and a large denticular surface.
Both the palatine and the vomer are well equipped with teeth for prey capture in the rapid flowing riffles where they live. The lower jaw is long and contains the full complement of 10 preoperculomandibular pores enclosed in a bony canal. The opercular series is unspecialized with a straight anteriodorsal angle of the opercle and short ascending process of the subopercle. The branchiohyoid apparatus is robust with the primitive number of branchiostegal rays (six) and a urohyal with a
114 club-shaped anterior spine for ligamentous attachment to the hypohyal and basibranchial.
The three members of the E. thalassinum species group (sensu Tsai and
Raney, 1974) also retain numerous plesiomorphic characters, as they form the geographically partitioned counterpart to the E. variatum group. They retain the primitive premaxillary combination of a short ascending process, long alveolar process, and rounded maxillary process. Likewise, the lower jaw is long with the full complement of mandibular pores. A variable reduction in palatine and vomerine teeth in E. inscriptum and E. swannanoa probably reflects a decrease in body size and a preference for smaller prey items.
The E. blennioides species group (Chapter 2), comprised of E. blennioides, E. blennius, E. rupestre, and E. histrio, show numerous specializations from the ancestral condition. Three taxa, E. blennioides, E. blennius, E. rupestre, show specialization of the premaxillary in common with the subgenus Ulocentra, with a long ascending process, shortened alveolar process, and an alar protursion on the maxillary process. The lower Jaw is shortened and angled in E. rupestre and
E. blennioides, and the mandibular foramina are reduced to three in E. rupestre and
E. histrio, perhaps as a result of miniaturization. The pelvic bone is more elongate, and the fusion of the ischiopubic region is less extensive in E. blenius and E. rupestre.
The members of the subgenus Nanostoma, comprised of E. zonale and E. lynceum, are habitat specialists on filamentous algae where they spawn and forage
115 (Trautman, 1957). These two taxa are mtermediate in osteology from the plesiomorphic E. variatum / E. thalassinum groups and the E. blennioides group, thereby containing the greatest mixture of ancestral and derived traits. The two members of the subgenus Nanostoma have an intermediate condition in the posterior notch of the quadrate, which is partly fused along its ventrolateral surface. The ischiopubic fusion of the pelvic bone extends half way across the pelvic bone, an
intermediate condition shared by E. rupestre and E. blennius.
While many of the osteological synapomorphies of the subgenus Ulocentra are related to feeding specializations, others are consequences of the process of miniaturization. All Ulocentra darters have six preopercular pores, and all except E. coosae and E. scotti have lost branchiostegal number three to yield only five branchiostegal rays. Further specialization in the upper jaw of the E. simoterum
species group results in a diagnostic maxillary bone with a reduced ventral blade.
The E. simoterum species group also share a symplectic that interdigitates with the
metapterygoid, but it should be noted that this condition is also found in E. blennioides.
116 SUMMARY
The phylogenetic relationships of the 20 described species of snubnose darters, subgenus Ulocentra, and 11 members of the proposed sister subgenus
Etheostoma were investigated with 1033 base pairs of mitochondrial DNA sequence data and 54 osteological characters. Three hypotheses on the interrelationships and monophyly of these two subgenera were evaluated. Monophyly for the subgenus
Ulocentra was supported, but the subgenus Etheostoma appears to be polyphyletic.
Mitochondrial DNA sequence data from the entire control region, tRNA Phe gene, and partial 12S rRNA gene, were analyzed for 78 population samples of species within the subgenera Ulocentra and Etheostoma, producing species-level resolution of phylogenetic relationships. Population analysis of select darter species was performed using the heteroduplex method, which proved to be an efficient technique for obtaining both the number and frequency of haplotypes within a population. The phylogenetic relationships within the subgenus Ulocentra concur with the hypothesis of Bailey and Etnier (1988) with a basal division between members of the E. simoterum species group and E. dury species group. Within the
E. simoterum species group, E. baileyi, was basal to two sets of sister species; E. simoterum-E. atripinne, and E. rafinesquei-E. barrenense. Within the E. duryi species group, a basal clade was comprised of E. coosae and E. scotti, further
117 supporting the hypothesis of Bailey and Etnier (1988). A second clade within the E. duryi species group was formed from E. duryi-E. Jlavum. The remaining 11 snubnose species formed the Coastal Plains species group.
Phylogeography was utilized to interpret the genetic variation between populations and species of Ulocentra on maps of their geographic distributions.
Patterns of genetic diversity suggest that vicariance events from the Late Pleistocene through the Holocene were important in forming the four major clades of snubnose darters. The ancestral Ulocentra presumably occupied the Cumberland, Duck,
Tennessee, and Mobile systems in the mid-Pleistocene. The Cumberland, Duck, and
Tennessee populations freely exchanged genes, but the genetic exchange between these populations and the Coastal Plains was limited to the lower Duck and
Tennessee systems. This ancient population structure can account for the genetic similarity between the Coastal Plains species and the E. duryi species group.
Osteology indicates close morphological association between the E. simoterum and
E. duryi species groups, which would be expected between two populations sharing
free genetic exchange. The recent arise of the ancestral Ulocentra populations in the
Pleistocene would have denied their access to the Taeys-Mahomet system,
containing the geographic distribution of the group to regions East of the Mississippi
River.
Glacial outwash in the Late Pleistocene created a temporal series of
Mississippi embayments that isolated the ancestral E. simoterum populatins from the
E. duryi / Coastal Plains populations leading to the present phylogeographic pattern.
118 The syntopic distribution between members of the E. duryi species group and E. simoterum species group today probably resulted from secondary range expansion through Recent dispersal. The other species of Ulocentra are mostly allopatric.
Osteological analysis of 54 phylogenetic characters was performed on cleared and stained specimens of the subgenera Ulocentra and Etheostoma. The subgenus
Ulocentra was diagnosed as a monophyletic group by the presence of four osteological synapormorphies not found in other darter subgenera examined in this study. Prior to this study, there was no morphological support for the subgenus
Ulocentra.
Several osteological apomorphies united members of the subgenus Ulocentra and E. histrio. Additional apomorphic characters united members of the E. simoterum species group with E. duryi and E. Jlavum. but were shared with E. blennioides. Many of the osteological apomorphies for Ulocentra species resulted from specialization for benthic feeding in slow moving stream habitats.
Both the molecular and morphological data sets supported the monophyly of the subgenus Ulocentra. The banded darter, E. zonale, and its sister E. lynceum, were not the closest relatives to the snubnose darters and may be best classified apart from other members of the subgenus Etheostoma by resurrecting the subgenus
Nanostoma. The sister group to the subgenus Ulocentra contained a restricted assembly of species within the subgenus Etheostoma comprised of E. blennioides, E. rupestre, E. blennius, the thalassinum species group, and E. histrio.
119 APPENDICES
120 APPENDIX A:
Data Relevant to Chapter 1, Expanded Information on Collection Localities for Darter Taxa Used in mtDNA Analyses
Collection Localities for each site sampled for the mtDNA analyses are listed by collection site number. A unique site number was assigned to each new collection site sampled for genetic analysis and provides the primary key for information on darter collection localities. The site number is followed by an exact description of the collection locality (including county and state); the latitude, longitude, and elevation; stream gradient in (feet drop/1 mile calculated from accompanying 7.5 minute USGS topographical map reference); field number (unique to each new collection and consisting of the Collector initials, year, 3 letter month abbreviation, and day of collection); species used in mtDNA analysis, with OSUM catalogue number when available, and their deposition (including sample size of formalin-preserved/alcohol stored voucher specimens ‘*Alc:”, DNA archive samples stored in absolute ethanol “DNA:”, cleared and stained specimens stored in glycerin “C&S:”); and a species list of all fish species collected and archived.
Site #l Dog Creek at St. Rt. 728 bridge, 3.65 air miles SW of the town of Cub Run, Edmonson Co., KY. 37 16’47”N 86 16’05”W ele 650’ gradient 80.1’/mi. (Cub Rim, KY 1954) BAP 1992MAR24: Brady A. Porter and John W. Provance IV. No Ulocentra. Species list from Site #l : Lampetra aepyptera, Campostoma anomalum, Semotilus atromaculatus, Etheostoma caeruleum, £. stigmaeum, Percina maculata, Cottus carolinae.
121 Site #2 Little Trammel Creek at Co. Rd. 1147 bridge, 0.4 miles S of Petroleum, Allen Co., KY. 36 41’23”N 86 15’03”Wele 590’ gradient 13.2’/mi (Adolphus KY-TN 1954) BAP 1992MAR24B: Brady A. Porter and John W. Provance IV. No UlocentraP. BAP 1992APR18: Brady A. Porter and Christine M. Demko. E. barrenense BAP 1993APR23A: Brady A. Porter and Jay Studebaker. E. barrenense. BAP 1993NOV27C: Brady A. Porter and Charlotte A. Adams. E. barrenense. BAP 1994MAY0IE: Brady A. Porter and Charlotte A. Adams. E. barrenense. Species list from Site #2: Campostoma anomalum, Luxilus chrysocephalus, Lythrurus ardens fasciolaris, Notropis ardens. N. leuciodus, Hypentelium nigricans, Noturus elegans, Fundulus catenatus, Etheostoma barrenense, E. bellum, E. blenniodes, E. caeruleum, E. flabellare, E. spectabile. Cottus carolinae.
Site #3 Trammel Creek at Concord Church, Concord Church Road, 2.2 air miles SE of Petroleum, Allen Co., KY. 36 40’40’N 86 12’55'W ele 620’ gradient 20.O’/mi (Petroleum KY-TN 1982) BAP 1992MAR25; Brady A. Porter and John W. Provance IV. E. barrenense. Species list from Site #3: Campostoma anomalum, Phoxinus eryhtrogaster, Etheostoma barrenense, E. caeruleum, E. jlabellare, E. spectabile, Cottus carolinae.
Site #4 Wiggington Creek at 103 bridge and Thorton Road, 3.2 air miles S/SW Gasper. Logan Co., KY. 36 54’ 15”N 86 45’05”W ele 593’ gradient 13.9’/mi (Homer. KY 1951) BAP 1992MAR26: Brady A. Porter and John W. Provance IV. E. rafinesquei. BAP 1993NOV27A: Brady A. Porter and Charlotte A. Adams. £. rafinesquei. BAP 1998JUL17A: Brady A. Porter and Michelle I. Carter. E. rafinesquei. Species list from Site #4: Campostoma oligolepis, Cyprinella spiloptera, Lythrurus ardens, Pimephales notatus, Semotilus atromaculatus, Etheostoma caeruleum, E. flabellare, E. rafinesquei, E. squamiceps, Cottus carolinae. 122 Site #5 Pleasant Run at St. Rt. 664 bridge, 3 miles S of Corinth, Logan Co.. KY. 36 44’43”N 86 49’02”W ele 560’ gradient 7.8’/mi (Adairville KY 1951, Dennis KY 1952) BAP 1992MAR26B: Brady A. Porter and John W. Provance IV. Etheostoma flavum. Species list from Site #5: Not available.
Site #6 Red River at St. Rt. 77 bridge, Powell Co./ Menifee Co. line, KY. 37 49’58”N 83 39’37”W ele 707’ gradient 4.2’/mi (Slade KY 1966) BAP 1992APR17A: Brady A. Porter and Christine M. Demko. E. baileyi. BAP 1993DEC15A: Brady A. Porter and Charlotte A. Adams. E. baileyi. Species list from Site #6: Not available.
Site #7 Gladie Creek at 713 bridge, 0.5 miles from the confluence, Menifee Co.. KY. 37 50’13”N 83 36’34”WeIe 732’ gradient 15.6’/mi (Pomeroyton KY 1978) BAP 1992APR17B: Brady A. Porter and Christine M. Demko. E. baileyi and E. variatum. BAP 1993DEC15B: Brady A. Porter and Charlotte A. Adams. E. baileyi. Species list from Site #7: Lampetra aepyptera, Campostoma anomalum, Luxilus chrysocephalus, Nocomis micropogon, Notropis photogenis, N. rubellus, Hypentelium nigricans, Etheostoma baileyi, E. flabellare, E. virgatum.
Site #8 Pleasant Run Creek at 739 bridge (J. Soyers road), just S of Corinth, Logan Co.. KY. 36 45’46”N 86 48’20”W ele 560’ gradient 17.6’/mi (Dennis KY 1952) BAP 1992APR19: Brady A. Porter and Christine M. Demko. E. flavum. BAP 1993NOV27B: Brady A. Porter and Charlotte A. Adams. E. flavum. BAP 1998JUL17B: Brady A. Porter and Michelle I. Carter. E. flavum. Species list from Site #8: Lythrurus ardens fasciolaris, Semotilus atromaculatus, Etheostoma flavum, E. squamiceps, Cottus carolinae?.
123 Site #9 Caney Valley Creek at 25E Roadside Park, 5 air mi SE of Tazweil, Claiborne Co., TN. 36 24’25”N 83 29’42”W ele 1050’ gradient 75.5’/mi (Howard TN 1942) BAP 1992MAY16A; Brady A. Porter and Jay Studebaker. E. simoterum simoterum. Species list from Site #9: Campostoma anomalum, Luxilus chrysocephalus, Rhinichthys atratulus, Semotilus atromaculatus, Catostomus commersoni, Etheostoma caeruleum, E. simoterum simoterum Cottus bairdi ssp.
Site #10 Little Sycamore Creek at 25E Springdale Family Variety Store, 3.3 air mi SE of Tazweil, Claiborne Co., TN. 36 25’24”N 83 31’23”W ele 1060’ gradient 52.8’/mi (Tazewell TN 1943) BAP 1992MAY16B: Brady A. Porter and Jay Studebaker. E. simoterum simoterum. BAP 1993DEC16: Brady A. Porter and Charlotte A. Adams: E. simoterum simoterum. Species list from Site #10: Campostoma anomalum, Cyprinella spilopera, Hybopsis amblops, Luxilus chrysocephalus. Pimephales notatus. Rhinichthys atratulus obtusus, Semotilus atromaculatus, Hypentelium nigricans, Moxostoma duquesnei, Labidesthes sicculus, Etheostoma blennioides, E. caeruleum, E. jlabellare, E. simoterum, Percina caprodes, Cottus bairdi, C. carolinae.
Site #11 Mill Creek on Mill Creek Road, Putnam Co., TN. 36 05’26”N 85 20’52”W ele 1020’ gradient 105.8’/mi (Monterey Lake TN 1956) BAP 1992MAY16C: Brady A. Porter and Jay Studebaker. E. etnieri. BAP 1993APR24A: Brady A. Porter and Jay Studebaker. £. etnieri. BAP 1993NOV26: Brady A. Porter and Charlotte A. Adams. E. etnieri OSUM 85239, Ale 2, DNA 26, C&S 0. BAP 1998JUL18A: Brady A. Porter and Michelle I. Carter. E. etnieri. Species list from Site #11: Campostoma anomalum, Hybopsis amblops, Notropis telescopus, Pimephales notatus, Rhinichthys atratulus obtusus, Senotilus atromaculatus, Hypentelium nigricans, Etheostoma blennioides newmani, E. etnieri, E. virgatum, Cottus carolinae.
124 Site #12 Duck River at Henry Horton State Park at 3 1 A, 2 mi S of Chapel Hill, Marshall Co., TN. 35 35’32’TSl 86 4l'45"W ele 630’ gradient 0.8’/mi (Farmington TN 1981) BAP 1992MAY23A: Brady A. Porter and Christine M. Demko. E. simoterum atripinne. Species list from Site #12: Campostoma anomalum, Cyprinella galactura, Erimystax insignis, Hybopsis amblops, Lythrurus liras, Notropis boops, N. sp., Pimephales notatus, P. vigilax, Moxostoma sp., Etheostoma aquali, E. luteovinctum, E. simoterum, E. rufilineatum, E. zonale, Percina caprodes, Cottus carolinae.
Site #13 Defeated Camp Creek at 48 bridge, Fishcamp Restaurant, 1.2 mi N of Centerville, Hickman Co., TN. 35 47’ 16”N 87 27’02”W ele 480’ gradient 24.0’/mi (Centerville, TN 1952) BAP 1992MAY23B: Brady A. Porter and Christine M. Demko. E. Jlavum. BAP 1994MAR20A: Brady A. Porter and Charlotte A. Adams. E. Jlavum. Species list from Site #13: Campostoma anomalum, C. oligolepis, Clinostomus Junduloides, Luxilus chrysocephalus, Lythrurus ardens, Notropis amblops, N. ardens, N. leuciodus, Hypentelium nigricans, Moxostoma duquesnei, M. erythrurum, Phoxinus erythrogaster, Rhinichthys atratulus, Semotilus atromaculatus, Fundulus catenatus, Fundulus catenatus, Lepomis cyanellus X macrochirus, L. megalotis, Etheostoma caeruleum, E. Jlabellare, E. Jlavum. E. smithi, E. spectabile, Cottus carolinae..
Site #14 Sycamore Creek at old 69 bridge (St. Rt. 192), just E of Holladay, Benton Co., TN. 35 52’ 19”N 88 08’08”W ele 410’ gradient 34.1’/mi (Seventeen Creek TN 1950, Holladay TN 1950) BAP 1992MAY23c: Brady A. Porter and Christine M. Demko. E. zonistium. Species list from Site #14: Lampetra aepyptera, Campostoma oligolepis, Luxilus chrysocephalus, Lythrurus Jumeus, L. umbratilis, Opsopoeodus emiliae, Pimephales notatus, Semotilus atromaculatus, Hypentelium nigricans, Moxostoma erythrurum, Fundulus olivaceus, Lepomis auritis, L. cyanellus, Etheostoma dennicotti, E. kennicotti, E. neopterum, E. nigrum, E. zonistium, Percina caprodes, P. maculata.
125 Site #15 West Sandy Creek Drainage Canal at Co. Rd. 8024 (Reynoldsburg Rd.), 6 air mi S/SE of Paris, Henry Co., TN. 36 13’45”N 88 15’48”W ele 370’ gradient 4.77mi (Manleyville TN 1965, Mansfield TN 1950) BAP 1992MAY24A: Brady A. Porter and Christine M. Demko. E. zonistium. Species list from Site #15: Lampetra aeptptera?, Lythrurus fumeus, Opsopoeodus emiliae, Semotilus atromaculatus, Fundulus olivaceus, Etheostoma oophylax, E. zonistium.
Site #16 Clear Creek at Goldston Springs Road, S of Co. Rd. 8172, Henry Co.. TN. 36 25’27”N 88 22’53”W ele 450’ gradient 11.O’/mi (Cottage Grove TN 1950, Puryear TN 1950) BAP 1992MAY24B: Brady A. Porter and Christine M. Demko. E. pyrrhogaster. Species list from Site #16: Cyprinella whipplei, Lythrurus jumeus. Semotilus atromaculatus, Noturus hildebrandi, N. miurus, N. phaeus, Fudulus olivaceus, Gambmia affinis, Etheostoma nigrum, E. pyrrhogaster, Percina sciera.
Site #17 Terrapin Creek at St. Rt. 69 bridge, just S of ECY boarder, Henry Co., TN. 36 29’57”N 88 29’25”W ele 400’ gradient 5.9’/mi (Cottage Grove TN 1950, Lynn Grove TN 1971) BAP 1992MAY24C: Brady A. Porter and Christine M. Demko. E. pyrrhogaster and E. lynceum. Species list from Site #17: Not available
Site #18 Lovejoy Creek dst of Ga Hwy 156,2.75 mi W/SW of Curryvtlle, Floyd Co., GA. 34 25’51”N 85 07”29”W ele 600’ gradient 13.9’/mi (Armuchee GA 1968, Plainville GA 1985) BAP 1993MARI 8: Brady A. Porter and William J. Poly. No. Ulocentra. Species list from Site #18: Campostoma oligolepis 12, Cyprinella venusta, Fundulus olivaceus 1, Lepomis cyanellus 20, L. macrochirus, L. megalotis, L. microlophus, L. cyanellus x L. macrochirus, Cottus carolinae.
126 Site #19 Rocky Creek at GA Hwy 156 bridge, just W of Curryville, Gordon Co., GA. 34 26’42”N 85 05’OT’W ele 624’ gradient 24.0’/mi (Plainville GA 1985) BAP 1993MAR19: Brady A. Porter and William J. Poly. E. coosae. Species list from Site #19: Campostoma oligolepis, Cyprinella trichroistia, Notropis xaenocephalus, Hypentelium etowanum, Fundulus stellifer, Lepomis megalotis, Etheostoma coosae, Cottus carolinae.
Site #20 Sharp Mountain Creek, dst Old Canton road (GA Hwy 5), 6.75 mi NE of Canton, Cherokee Co., GA. 34 18’38”N 84 24’12”W ele 900’ gradient 6.70’/mi (Ball Ground West GA 1985) BAP 1993MAR20A: Brady A. Porter and William J. Poly. No. Ulocentra. Species list from Site #20: Hypentelium etowanum, Percina nigrofasciata, Cottus carolinae.
Site #21 Little River at Old Canton road (Ga Hwy 5), 1.75 air mi N/NE of Woodstock, Cherokee Co., GA. 34 07’21”N 84 30’16”W ele 860’ gradient 5.5’/mi (Mountain Park GA 1973) BAP 1993MAR20B: Brady A. Porter and William J. Poly. No. Ulocentra. Species list from Site #21 : Noturus leptacanthus, Lepomis cyanellus, Micropterus punctulatus?, Percina nigrofasciata.
Site #23 Butler Creek at Jim Owens road, 3 air mi W/SW of Kennesaw GA, 1.5 air mi S of Rt 41, Acworth Twp, Cobb Co., GA. 34 00’56”N 84 40’00”W ele 900’ gradient 44.0’/mi (Acworth GA 1972) BAP 1993MAR21A: Brady A. Porter and William J. Poly. E. scotti. Species list from Site #23: Campostoma oligolepis, Hypentelium etowanum, Moxostoma duquesnei, Lepomis auritus, L. cyanellus, Micropterus coosae, Etheostoma scotti.
127 Site #24 Butler Creek at Mack Dobbs road, 1.8 mi W/SW of Kennesaw, Big Shanty Twp, Cobb Co., GA. 34 0 r0 2 ’TSf 84 38’ 35”W ele 960’ gradient 40.77nii (Acworth GA 1972) BAP 1993MAR21B: BAP and William J. Poly. £. scotti. BAP 1993DEC31: Brady A. Porter and Charlotte A. Adams. E. scotti. Species list from Site #24: Campotsoma oligolepis, Cyprinella venusta, Semotilus atromaculatus, Hypentelium etowanum, Moxostoma duquesnei?, Lepomis auritus, L cyanellus, L. macrochirus, Micropterus coosae, Etheostoma scotti.
Site #25 Rock Creek just off St. Rt. 5/US 76, 7.7 air mi N/NE of Ellijay, Gilmer Co., GA. 3 4 46’45”N 84 23’32”W ele 1552’ gradient 68.1’mi (Cashes Valley GA 1946) BAP 1993MAR22A: Brady A. Porter and William J. Poly. No. Ulocentra. Species list from Site #25: Campostoma oligolepis, Cyprinella callistia, Notropis asperifrons, Semotilus atromaculata, Hpentelium etowanum, Percina paluaris, Cottus carolinae.
Site #26 Big Tumiptown Creek at GA Hwy 5/ US 76, 3.4 air mi NE of Ellijay, Gilmer Co., GA. 34 43’26”N 84 26’07”W ele 1353’ gradient 75.5’/mi (Ellijay GA 1971) BAP 1993MAR22B: Brady A. Porter and William J. Poly. E. brevirostrum OSUM 85504, Ale 4, DNA 0, C&S 0. Species list from Site #26: Ichthyomyzon sp. 1, Cyprinella callistia, C. trichroistia, Notropis xaenocephalus, Semotilus atromaculatus, Hpentelium etownum, Micropterus coosae, Etheostoma brevirostrum, Percina palmaris, Cottus carolinae.
Site #27 Lake Creek ust of Chubb road, off Jim Shack road by Chubb Church, E of Cave Springs, Floyd Co., GA. 34 05’18”N 85 17’05”W ele 700’ gradient 29.3’/mi (Cedartown West GA 1980) BAP 1993 MAR22: Brady A. Porter and William J. Poly. E. coosae. Species list from Site #27: Campostoma anomalum, Hypentelium etowanum, Lepomis auritus, L. cyanellus, L. punctatus, Micropterus coosae, Etheostoma coosae, Percina nigrofasciata, Cottus carolinae. 128 Site #28 Beach Creek at St. Rt. 120 bridge, 3.3 air mi S/SW of Buchanan, between Buchanan and Tallapoosa, Haralson Co., GA. 33 45’46”N 85 13'24"W ele 1000’ gradient lO.l’/mi (Buchanan GA 1973) BAP 1993MAR23A: Brady A. Porter and William J. Poly. E. tallapoosae. BAP 1993DEC30A: Brady A. Porter and Charlotte A. Adams. E. tallapoosae. Species list from Site #28: Ichthyomyzon gagei, Campostoma oligolepis, Cyprinella callistia, C. gibbsi, C. venusta, Luxilus chrysocephalus. Lythrurus bellus, Nocomis leptocephalus, Notropis lineapunctatus. Pimephales, Pimephales vigilex, Hypentelium etowanum, Lepomis auritus, L. macrochirus, L. megalotis, Etheostoma chuckwachatte, E. stigmaeum, E. tallapoosae, Percina palmaris, P. sp. “muscadine ", Cottus carolinae.
Site #29 Urmamed tributary to Beach Creek, ust of St. Rt. 120 bridge, 2 miles W of St. Rt. 120 crossing of Beach Creek, Haralson Co., GA. 33 46’03”N 85 15’07”W ele 1000’ gradient 81.3’/mi (Tallapoosa North GA 1966) BAP 1993MAR23B: Brady A. Porter and William J. Poly. E. tallapoosae. BAP 1993DEC29: Brady A. Porter and Charlotte A. Adams. E. tallapoosae. Species list from Site #29: Campostoma oligolepis, Cyprinella gibbsi, C. venusta, Hybopsis lineapunctatus, Luxilus chrysocephalus, Nocomis leptocephalus, Notropis lineapunctatus, Semotilus atromaculatus, Hypentelium etowanum, Moxostoma poecilunm, Lepomis auritus, Lepomis macrochirus, Micropterus coosae, Etheostoma tallapoosae, Percina nigrofasciata, P. sp. “muscadine ", Cottus carolinae.
129 Site #30 Shoal Creek at Forest Service road 500 bridge, in Pine Glen Recreation Area, Talladega National Forest, 13.5 air mi 8 center of Piedmont, Cleburne Co., AL. 33 43’32”N 85 36’ 18”W ele 950’ gradient 15.8’/mi (Heflin AL 1983) BAP 1993MAR23C: Brady A. Porter and William J. Poly. E. brevirostrum (Type locality). BAP 1994MAR25: Brady A. Porter and Charlotte A. Adams. E. brevirostrum. BAP 1994APR30A: Brady A. Porter and Charlotte A. Adams E. brevirostrum. Species list from Site #30: Campotoma anomalum, Cyprinella callistia, C. trichroistius, Notropis xaenocephalus, Hypentelium etowanum, Moxostoma duquesnei, Lepomis megalotis, Micropterus coosae, Etheostoma brevirostrum, E. jordani. Percina nigrofasciata, P. palmaris, Cottus carolinae.
Site #31 Turkey Creek at “The Narrows” adjacent to Turkey Creek road, 1.25 mi N of Pinson, Jefferson Co., AL. 33 42”08”N 86 41’27”W ele 580’ gradient 27.8’/mi (Pinson AL 1979) BAP 1993MAR24A: Brady A. Porter and William J. Poly. E. chermocki. BAP I994MAR26A: Brady A. Porter and Charlotte A. Adams. E. chermocki OSUM. BAP 1994APR30E: Brady A. Porter and Charlotte A. Adams. E. chermocki. Species list from Site #31: Campostoma anomalum, Cyprinella callistia, Luxilus chrysocephalus, Notropis stilbius, Semotilus atromaculatus, Hypentelium etowanum, Gambusia affinis, Lepomis cyanellus, L. macrochirus. Micropterus coosae, Etheostoma blennioides, E. chermocki, Percina nigrofasciata, Cottus carolinae.
Site #32 Turkey Creek at Tapawingo road, 1 mi NE of Pinson, Jefferson Co., AL 33 4 I”58”N 86 40’22”W ele 600’ gradient 20’/mi (Pinson AL 1978) BAP 1993MAR24B: Brady A. Porter and William J. Poly. £. chermocki (Type locality). Species list from Site #32: Campostoma anomalum, Luxilus chrysocephalus, Hypentelium etowanum, Lepomis cyanellus, L. mactochirus, Etheostoma chermocki, Cottus carolinae.
130 Site #33 Gurley Creek at Hwy 75 bridge, 0.4 mi N of Jefferson Co. line, Blount Co.. AL. 33 46’15”N 86 37’50”W ele 640’ gradient 40.7’/mi (Trafford AL 1970) BAP 1993MAR24C: Brady A. Porter and William J. Poly. £. bellator OSUM 85432, Ale 5, DNA 16, C&S 0. BAP 1994MAR26C: Brady A. Porter and Charlotte A. Adams. E. bellator. Species list from Site #33: Campostoma oligolepis, Notropis asperi/rons, Hypentelium etowanum, Minitrema melanops, Moxostoma duquesnei, M. poecilurum, Amiurus natalus, Gambusia affinis, Lepomis cyanellus, L. macrochius, L megalotis, L humilis, Micropterus salmoides, Pomoxis nigromaculatus, Etheostoma bellator. Percina nigrofasciata, Cottvs carolinae.
Site #34 Bledsoe Creek ust Rock Springs road bridge, E of old 3 1E, just S of Bethpage, Sumner Co., TN. 36 28’37”N 86 18’50”W ele 520’ gradient I2.57mi (Bethpage TN 1980) BAP 1993APR23B: Brady A. Porter and Jay Studebaker. E. simoterum atripinne OSUM 85566, Ale 42. DNA 25, C&S 4. BAP 1993NOV26B: Brady A. Porter and Charlotte A. Adams. £. simoterum atripinne. BAP 1994MAY01D: Brady A. Porter and Charlotte A. Adams. E. simoterum atripinne. BAP 1998JUL17C: Brady A. Porter and Michelle I. Carter. E. simoterum atripinne. Species list from Site #34: Campostoma anomalum, Hybopsis amblops, Luxilus chrysocephalus, Lythrarus ardens, Natropis rupestris? (range extension), Pimephalus notatus, Hypentelium nigricans, Fundulus catenatus, F. olivaceus, Gambusia affinis, Lepomis macrochiras, L. megalotis, Etheostoma blennioides newmani, E. caeruleum, E. crossopterum, E. flabellare, E. simoterum atripinne, E. smithi, Percina caprodes, Cottus carolinae.
Site #35 East Fork Stones River at US Rt. 231 bridge. Roadside Park, 6.5 mi N of Munfreesburo, Rutherford Co., TN. 35 56’30”N 86 22’40”W ele 500’ gradient 2.6’/mi (Walterhill TN 1975) BAP 1993APR23C: Brady A. Porter and Jay Studebaker. £. simoterum atripinne Species list from Site #35: Not available
131 Site #36 Charles Creek at 56 bridge N of McMinnville, Warren Co., TN 35 43’27”N 85 47’02”W ele 890’ gradient 16.5’/mi (Me Minnville TN 1984) BAP 1993APR24B: Brady A. Porter and Jay Studebaker. E. etnieri OSUM 85473, Ale 2, DNA 0, C&S 0. Species list from Site #36: Oncorhynchus mykiss, Clinostomus Junduloides, Notropis telescopus, Rhinichthys atratulus obtusus, Semotilus atromaculatus, Catostomus commersoni, Hypentelium nigricans, Lepomis cyanellus, Etheostoma etnieri, E. flabellare, E. spectabile?, E. virgatum, Cottus carolinae.
Site #37 McWilliams Creek at Boston road bridge, Sequatchie Co. TN. 35 24’22’N 85 19’47”W ele 720’ gradient 23.3’/mi (Mount Airy TN 1946) BAP 1993APR24C: Brady A. Porter and Jay Studebaker. E. duryi. BAP 1994APR29B: Brady A. Porter and Charlotte A. Adams. E. duryi OSUM 85126, Ale 19, DNA 15, C&S 0. Species list from Site #37: Campostoma anomalum, Luxilus chrysocephalus, L. coccogenis, Pimephales notatus, P. promelas, Rhinichthys atratulus obtusus, Semotilus atromaculatus, Catostomus commersoni, Hypentelium nigricans, Moxostoma duquesnei, M. erythrurum, Lepomis cyanellus, L. megalotis. Etheostoma caeruleum, E. duryi, Cottus bairdi, C. carolinae.
Site #38 Running Water Creek alongside 134 bridge, 0.5 mi S of 134 bridge, 1 mi N/NW of Whiteside, Marion Co., TN 34 59’35”N 85 30’32”W ele 740’ gradient 23.O’/mi (New Home TN 1970) BAP 1993DEC17A: B.A. Porter, Chris. Roberts, and Charlotte.A. Adams. E. duryi (Type locality). BAP 1994APR29: Brady A. Porter and Charlotte A. Adams. E. duryi. Species list from Site #38: Campostoma anomalum, Cyprinella spiloptera, Luxilus chrysocephalus, Rhinichthys atratulus obtusus, Semotilus atromaculatus, Hypentelium nigricans, Moxostoma erythrurum, Lepomis megalotis, Micropterus salmoides, Etheostoma duryi, Percina caprodes. Cottus bairdi, C. carolinae.
132 Site #39 Little Sequatchie River along side Sequatchie Cove road, across from Coppinger Cove Baptist Church, Marion Co., TN. 35 08’55”N 85 35’54”W ele 640’ gradient 19.6’/mi (Whitwell TN 1946) BAP 1993DEC17B: B.A. Porter, Chris Roberts, and C. A. Adams. E. simoterum simoterum. Species list from Site #39: Luxilus chrysocephalus. Notropis telescopus, Etheostoma caeruleum, E. duryi, E. simoterum simoterum.
Site #40 Jumpin In Creek, at Thomas road bridge, just E. of GA Hwy 100,3.5 air mi N of Bowdon, Smithfield Twp, Carroll Co., GA. 33 35’39”N 85 14’53”W ele 800’ gradient 12.6’/mi (Bowdon East GA 1982) BAP 1993 DEC30B: Brady A. Porter and Charlotte A. Adams. E. tallapoosae. Species list from Site #40: Cyprinella trichroistia, Luxilus chrysocephalus, Nocomis leptocephalus, Notropis asperifrons, Pimephales vigilax, Hypentelium etowanum, Moxostoma poecilurum, Lepomis macrochirus, Etheostoma tallapoosae, Percina nigrofasciata.
Site #41 Hurricane Creek at Rt. 7 bridge, 5.6 mi N of Oxford, Lafayette Co., MS. 34 26’45”N 89 30’41”W ele 320’ gradient 11.O’/mi (Oxford North MS 1980) BAP 1994MAR21 A: Brady A. Porter and Charlotte A. Adams. E. raneyi (Type locality). Species list from Site #41 : Erimyzon oblongus, Aphredoderus sayanus, Lepomis gulosus, L. marginatus, L. megalotis, L. punctatus, Etheostoma proeliare, E. raneyi.
Site #42 Graham Mill Creek at Co. road 108 bridge, just E of Abbeville, Lafayette Co., MS. 34 30’10”N 89 29’26”W ele 300’ gradient 23 .O’/mi (Bayley Lake MS 1980, Malone MS 1982) BAP 1994MAR21B: Brady A. Porter and Charlotte A. Adams. E. raneyi. Species list from Site #42: Lampetra aepyptera?, Esox americanus, Cyprinella whipplei, Luxilus chrysocephalus, Notemigonus chrysoleucas, Notropis wicklifft, Semotilus atromaculatus, Hypenteliam nigricans, Lepomis cyanellus, L. marginatus, Percina sciera, Etheostoma raneyi.
133 Site #43 Pumpkin Creek at MS Hwy 334 bridge, 5.8 mi SE of Oxford, Lafayette Co., MS. 34 17’07’TM 89 26H l”Wele 315’ gradient 16.5’/mi (Yocona MS 1980) BAP 1994MAR21C: Brady A. Porter and Charlotte A. Adams. E. lynceum. Species list from Site #43: Not available
Site #44 Wolf Creek at Alabama Hwy 17, just N of US Hwy 84. Bolinger, Choctaw Co., AL. 31 47’32”N 88 19’20”WeIe 140’ gradient 16.5’/mi (Silas AL 1986) BAP 1994MAR22A: Brady A. Porter and Charlotte A. Adams. E. lachneri (Type locality), E. rupestre. Species list from Site #44: Campostoma oligolepis, Ericymba buccata, Luxilus chrysocephalus, Lythrurus bellus, Nocomis leptocephalus. Notropis ammophilus, N. baileyi, Pimephales notatus, Semotilus atromaculatus. Hypentelium etowanum, Moxostoma erythrurum, M. poecilurum, Lepomis cyanellus, L. megalotis, Etheostoma lachneri. E. rupestre, E. stigmaeum, E. whipplei, Percina nigrofasciata.
Site #45 Little Creek at Rt. 25, just N of Vineland, Merengo Co., AL. 32 02’21”N 87 39’30”W ele 130’ gradient 8.3’/mi (Suringer AL 1978) BAP 1994MAR22B: Brady A. Porter and Charlotte A. Adams. E. ramseyi. Species list from Site #45: Not available
Site #46 Jordan Cr., at AL 31 bridge, 3.2 mi N of Castleberry. Conecuh Co.. AL. 31 21’00”N 87 01’38”Wele 170’ gradient 15.1 ’/mi (Castleberry AL 1971) BAP 1994MAR23A: Brady A. Porter and Charlotte A. Adams. E. colorosum. Species list from Site #46: Not available
134 Site #48 Enitachopco Creek at AL Hwy 9,2.5 air mi S/SW of Ashland, Clay Co., AL. 33 14’25”N 85 51’35”W ele ??? gradient 24.6 Vmi (Gibsonville AL 1968) BAP 1994MAR24: Brady A. Porter and Charlotte A. Adams. E. tallapoosae OSUM 85254, Ale 1, DNA 9, C&S 0. Species list from Site #48: Campostoma oligolepis, Cyprinella calUstia, C. gibbsi, Luxilus chrysocephalus, Nocomis leptocephalus, Hypentelium etowanum, Moxostoma duquesnei?, M. poecilurum, Lepomis aurius, L. mocrochirus, Micropterus salmoides, Etheostoma chuckwachatte. E. tallapoosae. Percina palmaris, P. sp.
Site #49 Verdin Creek at Rt. 46 bridge, just E of Verdins Chapel Church, 8.5 air mi SE of Heflin, Cleburne Co., AL. 33 34’49”N 85 27’55”W ele 920’ gradient 40.7Vmi (Hightower AL 1966) BAP 1994N'LAR25B: Brady A. Porter and Charlotte A. Adams. E. tallapoosae. Species list from Site #49: Campostoma oligolepis, Etheostoma tallapoosae.
Site #50 Murphy Creek at confluence with Mill Creek, adjacent to Blue Hole, along US Hwy 31, 3.6 air mi NW of Hayden, Blount Co., AL. 33 54’37”N 86 49’34”W ele 443’ gradient 24.0’/mi (Blount Springs AL 1978) BAP 1994MAR26B: Brady A. Porter and Charlotte A. Adams. £ bellator OSUM (Parotopotypes) Ale 0, DNA 1, C&S 0. Species list from Site #50: Campostoma oligolepis, Cyprinella callistia, C. venusta, S. atromaculata, Hypentelium etowanum, Lepomis cyanellus, Micropterus coosae, Etheostoma bellator, Percina nigrofasciata.
Site #51 Pine Barren Creek at Co. Hwy 4, 100 yards E of Sandy Hollow road. Escambia Co., FL. 30 57’55”N 87 28’04”W ele 200’ gradient 29.3’/mi (Bratt FL 1978) BAP 1994MAR27: Brady A. Porter and Charlotte A. Adams. E. colorosum OSUM 85559, Ale 2, DNA 24, C&S 0. Species list from Site #51: Ichthyomyzon gagei, Notropis texanus, Notomigonus crysoleucas, Pteronotropis hypselopterus, P. signipinnis, P. welaka, Noturus leptocanthus, Etheostoma colorosum.
135 Site #52 Little Sexton Creek at Ball Road bridge, 2 km E of the town of Sextons Creek, Clay Co., KY. 37 19’OT’N 83 45’38”W ele 780’ gradient 19.6’/mi (Maulden KY 1979) BAP 1994APR28: Brady A. Porter and Charlotte A. Adams. E. baileyi (Type locality). Species list from Site #52: Campostoma anomalum, Cyprinella whiplei, Luxilus chrysocephalus, Lythrurus ardens, Pimephales notatus, Semolitus atromaculatus, Hypentelium nigricans, Moxostoma erythrurum, Lepomis megalotis, Etheostoma baileyi, E. blennioides, E. caeruleum, E. flabellare, E. nigrum, Percina caprodes, P. moculatum, P. strokogaster.
Site #53 Little River at US Hwy 411 bridge, 5.3 air mi NE of Maryville. Blount Co., TN. 35 47’OT’N 83 53’02”W ele 860’ gradient 6.3’/mi (Maryville TN 1979) BAP 1994APR28B: Brady A. Porter and Charlotte A. Adams. E. simoterum simoterum. Species list from Site #53: Campostoma anomalum, Erimystax insignis, Luxilus chrysocephalus, L. coccogenis, Notropis photogenis, N. rubellus. N. telescopus, Hypentelium nigricans, Micropterus punctulatus, Etheostoma camurum, E. jessiae, E. rufilineatum, E. simoterum simoterum, Cottus carolinae.
Site #54 Uimamed tributary to Shoal Creek at Talladega National Forest. S of High Rock Lake, Cleburne Co., TN. 33 42’36”N 85 37’02”W ele 885’ gradient 28.5’/mi (Heflin TN 1983) BAP 1994APR30B: Brady A. Porter and Charlotte A. Adams. E. coosae. Species list from Site #54: Campostoma anomalum, Cyprinella callistia, C. trichroistia Notropis chrosomus, N. stilbius, Semotilus atromaculatus. Hypentelium etowanum, Fundalus stellifer, Lepomis gulosus, L. megalotis, Etheostoma coosae, E. jordani, Percina nigrofasciata.
Site #55 Knokes Creek at Co. road 10, just S of Rt. 46, 3.0 air mi W of Rathbume, Cleburne Co., AL. 33 31’23”N 85 24’30”W ele 998’ gradient 24.6’/mi (Hightower AL 1966) BAP 1994APR30C: Brady A. Porter and Charlotte A. Adams. £. tallapoosae. Species list from Site #55: Not available.
136 Site #56 Cahaba River at Hwy 11 Roadside Park, E Trussville, Jefferson Co.. AL. 33 37’22’’N 86 36’00”W ele 680’ gradient 92 Jmi (Leeds AL 1978, Argo AL 1970) BAP 1994APR30D; Brady A. Porter and Charlotte A. Adams. E. lachneri. Species list from Site #56: Campostoma oligolepis, Cyprinella callistia, C. trichroistia, C. venusta, Notropis chrosomus, N. stilbius, Semotilus atromaculatus, Hypentelium etowanum, Moxostoma erythrurum, M. poecilurum. Lepomis megalotis, Micropterus coosae, Etheostoma stigmaeum, Percina sp. mobile logperoh, Percina nigyofasciata.
Site #57 North Fork Blue Creek at the intersection of N. Fork Blue Creek road and S. Fork Blue Creek road, 11.2 air mi N/NE of Pulaski, Giles Co.. TN. 36 20’30”N 86 56'32”W ele 760’ gradient 52.8’/mi (Brick Church TN 1949) BAP 1994MAY01 A: Brady A. Porter and Charlotte A. Adams. E. simoterum simoterum. Species list from Site #57: Not available.
Site #58 Cane Creek at US 431 bridge, 2.7 air mi S of Petersburg, Lincoln Co.. TN. 35 16’52”N 86 37’45”W ele 700’ gradient 11.3’/mi (Petersburg TN 1951) BAP 1994MAY01B: Brady A. Porter and Charlotte A. Adams. E. duryi. Species list from Site #58: Not available.
Site #59 Rutherford Creek at Double Branch road. 8.2 km NNE of Columbia, Maury Co., TN. 35 40’23”N 86 58’41”W ele 600’ gradient 6.5’/mi (Carters Creek 1982) BAP 1994MAY01C: Brady A. Porter and Charlotte A. Adams. E. flavum. Species list from Site #59: Campostoma anomalum, Cyprinella galactura, C. spiloptera, Luxilus chrysocephalus, Lythrurus ardens, Hybopsis amblops, Pimephales notatus, Hypenbelium nigricans, Percina caprodes, E. flavum.
137 Site # 60 Caney Creek at US Rt. 27 bridge, 1.5 mi SW of the 1-40 intersection with Rt 27, Roane Co., TN. 35 53’55”N 84 36’2rW ele 760’ gradient l7.7’/mi (Harriman TN 1953) BAP 1994OCT01 : Brady A. Porter and Charlotte A. Adams. No Ulocentra. Species list from Site #60: Not available
Site #61 Cherry Creek at Rt 84, 0.25 mi N of Cherry Creek road. White Co.. TN. 35 59’38”N 85 25’09”W ele 880’ gradient 14.1’/mi (Sparta TN 1954) BAP 1994OCT03: Brady A. Porter and Charlotte A. Adams. E. etnieri (Type locality). Species list from Site #61 : Not available.
Site #62 Dismal Creek dst of St. Rt. 37 bridge, 1 mi NE of LaClede, LaClede Twp, Fayette Co., IL. 38 53’30”N 88 42’01”W ele 512’ gradient 60.2’/mi (Edgewood IL 1985) BAP 1995MAR17A: Brady A. Porter and Charlotte A. Adams. E. gracile. Species list from Site #62: Luxilus chrysocephalus. Lythrurus ardens, Pimephales notatus, Catostomus commersoni, Erimyzon oblongus, Fundulus notatus, Lepomis cyanellus, L. megalotis, Etheostoma gracile, E. nigrum. E. gracile, E. spectabile, Percina maculata.
Site #63 Pomme de Terre River ust Rt. 32 bridge along AA, 5.3 air miles E of Bolivar, Benton Twp., Polk Co.. MO. 37 36’18”N 93 18’35”W ele 920’ gradient 8.5’/mi (Cedar Vista MO 1961) BAP 1995MAR17B: Brady A. Porter and Charlotte A. Adams. E. blennioidespholidotum OSUM 85512, Ale 7, DNA 3, C&S 0. E. tetrazonum OSUM 85516, Ale 7, DNA 1, C&S 3. Species list from Site #63: Campostoma oligolepis, Cyprinella lutremsis, Luxilus zonatus, Pimephales notatus, Semotilus atromaculatus, Etheostoma blennioides, E. caeruleum, E. flabellare, E, spectabile, E. tetrazonum, E. zonale.
138 Site #64 Unnamed tributary to the North Dry Sac River at St. Hwy. 13 bridge (South bound), o.5 mi N of Green Co. line, Looney Twp., Polk Co., MO. 37 26’00”N 93 21’20”W ele 970’ gradient 44.0’/mi (Pleasant Hope MO 1975) BAP 1995MAR17C: Brady A. Porter and Charlotte A. Adams. Species list from Site #64: Not available.
Site #65 West Prong of Little Pigeon River alongside St. Hwy. 441 around the island at river mile 13.3, dst of King Branch Road, Sevier Co., TN. 35 45’4T’N 83 31’28”W ele 1080’ gradient 25.2’/mi (Pigeon Forge TN 1965) BAP 1995APR08A: Brady A. Porter and Charlotte A. Adams. E. simoterum simoterum and E. swannanoa. Species list from Site #65: Campostoma anomalum, Luxilus cocogenus, Nacomis micropogon, Notropis luciodus, N. telescopus, N. nibricroceus, Rhinichthys cataractae, Hypentelium nigricans, Etheostoma blennioides, E. chlorobranchium, E. rufilineatum, E. simoterum simoterum. E. swanuanoa, Cottus bairdi sp.
Site #66 South Saluda River at St. Rt. 11 near the intersection of US 276. 6 miles S of Caesar’s Head, Pickens/ Greenville Co., line, SC. 35 04’02”N 82 37’07”W ele 1030’ gradient 11.4’/mi (Cleveland SC 1961) BAP 1995APR08B: Brady A. Porter and Charlotte A. Adams. E. thalassinum. Species list from Site #66: Cyprinella pyrrhomelas, Hybopsis rubrifrons, Nocomis leptocephalus, Notropis lutipinnis, Hypentelium nigricans, Etheostoma thalassinum.
Site #67 Carrick Creek at Carrick Creek road and St. Rt. 288/ 11 bridge, 1.5 mi W of Pumpkintown. Pickens Co.. SC. 35 00’14”N 82 40’52”W ele 960’ gradient 57.0’/mi (Table Rock SC 1968) BAP 1995APR08C: Brady A. Porter and Charlotte A. Adams. E. thalassinum OSUM???? Ale 0, DNA ???, C&S 0. Species list from Site #67: Campostoma anomalum, Cyprinella nivea, C. pyrrhomelas, Hybopsis rubrifrons, H. zanema, Nocomis leptocephalus, Notropis lutipinnis, Hypentelium nigricans, Moxostoma rupiscartes, Amiurus platycephalus, Noturus leptacanthus, Etheostoma fusiforme, E. thalassinum.
139 Site #68 Little Eastatoe Creek at St. Hwy. 11 bridge, Pickens Co.. SC. 34 56’46”N 82 51’20”W ele 840’ gradient 44.0’/mi (Sunset SC 1980) BAP 1995APR08D: Brady A. Porter and Charlotte A. Adams. E. inscriptum. Species list from Site #68: Nocomis leptocephalus, Notropis lutipinnis, Moxostoma rupiscartes, Etheostoma inscriptum, Percina nigrofasciata.
Site #69 Barren Run, just ust from unnamed tributary, 0.8 air miles S of Airline road, across a farm field on Rt. 357, LaRue Co., BCY. 37 30’02”N 85 48’05”W ele 720’ gradient 40.7’/mi (Hammonville KY 1960. Tonieville KY 1960) BAP I996APR27: Brady A. Porter and Charlotte A. Porter. E. rajiesquei. OSUM 85609 (Parotopotypes) Ale 13, DNA 23, C&S 2. Species list from Site #69: Campostoma anomalum, Lythrurus ardens, Pimephales notatus, Semotilus atromaculatus, Hypentelium nigricans. Fundalus olivaceus, Ambloplites rupestris, Lepomis cyanellus. L megalotis, L. cyanellus x L. macrochirus, Etheostoma blennioides, E. flabellare, E. caeruleum, E. rafinesquei, E. squamiceps.
Site #70 Clear Creek at the mouth of Todd Branch, Co. road 1787 bridge, 5 mi N/NE of Wildie, Rockcastle Co., KY. 37 28’38”N 84 15’36”W ele 1020’ gradient 24.0’/mi (Wildie KY 1953) BAP 1996APR28: Brady A. Porter and Charlotte A. Adams. E. baileyi OSUM 85580, Ale 16, DNA 15, C&S 4. BAP 1998JUL17B: Brady A. Porter and Michelle 1 Carter. E. baileyi. Species list from Site #70: Campostoma anomalum, Cyprinella galactura, Luxilus chrysocephalus, Lythrurus ardens, Notropis voliicellus, Pimephales notatus, Rhinidithys atratidus, Semostilus atromaculatus, Ambloplites rupestris, Lepomis megalotis, Micropterus dolomieui, Etheostoma baileyi, E. blennioides, E. caeruleum, E. flabellare, E. spectabile, E. virgatum.
Site #71 Elliotts Creek at Hwy 69 at Moundville, Hale Co., AL. 32 59’42”N 87 37’28”W ele 160’ gradient 9.0’/mi (Moundville East AL 1980) BAP 1996JUN13: Brady A. Porter and Charlotte A. Porter. £. lachneri OSUM 85527, Ale 13, DNA 13, C&S 0. E. stigmaeum OSUM 85528, Ale 1, DNA 1, C&S 0. E. swaini OSUM 85529, Ale 3, DNA 2, C&S 0. Species list from Site #71: Lythrurus bellus, Noturus leptacanthus, Labidesthes sicculus, Lepomis megalotis, Etheostoma lachneri, E. stigmaeum, E. swaini, Percina nigrofasciata. 140 Site #74 Clifly Creek 1000’ ust of the Emory River, 2 air mi NW of Harriman, Morgan/ Roane Co. line, TN. 35 57’03”N 84 34’44”Wele 760’ gradient 44.0’/mi (Harriman TN 1953) BAP 1997MAY10: Brady A. Porter and Robin D. Clipson. E. simoterum simoterum OSUM ?????, Ale 0, DNA 2, C&S 0. Species list from Site #74: Campostoma anomalum, Cyprinella galactura, Etheostoma blennioides, E. fiifilineatum, E. simoterum simoterum, Percina caprodes.
Site #88 Rocky River at Metropolitan Park, just dst from Lorain bridge overpass, Fairview Park, Cuyahoga Co., OH. 41 27’06”N 81 49’27”Wele 640’ gradient 7.3’/mi (Lakewood OH 1963) BAP 1996JUNO 1 : Brady A. Porter and Charlotte A. Porter. E. blennioides pholidotum B7. OSUM ????, Ale 0, DNA 5, C&S 0. Species list from Site #88: Not available.
141 APPENDIX B:
Data Relevant to Chapter 1, Aligned mtDNA Sequences for 78 Taxa of Darters
Figure 1. Mitochondrial DNA sequence alignment for 78 taxa of darters representing the subgenera Ulocentra and Etheostoma. The site number and haplotype code follows each taxon name. The indicates that the sample was taken from the type locatity. The reference sequence from E. tetrazonum was included at the top of each page. The Indicates identity to the reference sequence and the indicates an inferred insertion / deletion event.
142 tetrazonumSVTZ'^ AMCTACACCTATCT«rTT*CACCATACATArATATTAACCAT*TAAGSCCCATTCMCCACArAT*TCTTTTA:CAACA SO vanatum 87A/1 . vanatum 7/V2 zonaÊaBSI^ ...... r...... ___ 7 .. - za n a la 3 l2 2 ...... r...... z a n a ia e iZ i ...... T...... V»0M>n43A.Y1 ...... T...... 7 ___ . jync«um1M.Y2 ...... T...... swwinanM 6SSW1 ...... T...... thtia n etu m 8G/TH1 ...... r...... iacniKUi? 88/11 ...A ...... 7...... 7 .. .___ r___ MwiHttBMa .a a « 4 ...... T...... SinniaUMA83/B5 ...... T...... bttmioiaaan. 11/B8 ...... T...... u m b ita A 8 M 7 ...... T...... fupM8a44/RU1 .T...... T...... OlMnteA 37/BUI ...... T...... Mmnu«A84AU2 ...... T...... /IMA79M1 ...... T...... c... .,,7______7 ...... C...... Atnotwum 1QIS4 . Ainalafuii 12/S5 ...... C...... T...... amohnmSflSB . smo#mm57/S7 _ ...... T...... Aina/aram9IS0 _ sinalBrun 74/S8B ...... T...... ànoWwn85/SB1 ...... T...... A*#M#34/A2 ...... r ...... T...... c...... 7____ aO
Figure 1. Mitochondrial DNA Sequence Alignment
143 l*#monomS3fTZl AAACTACACGTATCTATrTACACCATACATAT«TArTAACCATArMCCCCCATTCAAGGACATATArCTTTTAraUCA 30 t3CVC02 ...... A...... T...... r...... • 81/C03 ...... A...... r ...... ___ T...... taacos ____ T, >30C010 ...... A...... T...... ____ r...... )3Q(C011 ...... A...... T...... ___ r. I30C01S ...... A...... T...... ___ T...... • 27/C017 i78(C028 seo(ir‘2«SC2 seatf2«SC3 hwwprtunt •JOBRI Oravntttan 78M^«1 ûmwêoUfum 75IB R w 2 ...... T___ “-r -fTTtllTT '-*TWWn OnM*M*um *20nR27 6rev*oe»uni T W B R ^ oaiaroHm *51/01 ooiarenm 46/02 fmpoo»M4arri ...... T...... fii3poo f 4aff2 ...... T...... (MhpooM* 40/13 ...... T...... lKhnarf*4«L2 6CAW71/L3 - Figure 1. Mitochondrial DNA Sequence Alignment Continued 144 tetm orurn 63/TZl rArCT*CCATT*CO»CArTCAT*T*TCACC*TTACACTAi»CCCTTACAT*>UCCAr*r*Q»CCTTTATCTMOU-r* •58 vrafum 87/VI vanMbm 7/V2 «erMltaSn ...... r.. zonatt2/Z 2 ...... r. zonal» S IZ i V»0Mm43A.Y1 ...... T.. Vnowan 16/LY2 mrannanM 65/SW 1 ...... T.. ffiiHif fàiia» 66/TVH raenMum68/11 tHannoKlaa ÙL 9B/B* 8/Mmoa»#pi83/BS MMniaidteAllÆS MmiadMA8e/B7 apH »44/RU1 M m iisj: 37/BUI mWATBHI sinotwum 1Q/S4 ...... C. T siKOMrun 12/S5 .C. T amtanmSTISS ...... C. T simatanmSTISr ...... c. T àmetanm9lSè ...... c. T •A»..* Ainalarian 74/S80 ...... C- T .A...- j*nolaRan8SS81 ...... c. T atrtpinn»yUA2 ...... c. T .A.. .- afrp»ms12M3 ...... C- T .A... . ««>ma9(yA1S ...... c. T .A,. .- ùaranarsvZ/BAI «tMagua>’6Q/R3 .T...... c. T /«hHqiw* 8affM2 .T...... ù ^S 2 /B Y 2 T .A...... -r.. b^TOiem OuryiZTIQ\ dufyirsaiO* duyiSaiDi ,T...... --.r 8wum 8/F5 Asvum 13/FS 8avwnS/F7 •man'6l/E2 t11/E11 pyfrnogasMr 16/P2 zoraaum 14/Z12 zonsoum 1S/Z13 r Figure 1. Mitochondrial DNA Sequence Alignment Continued 145 IWeronum 63/TZl rATCTACGATTACCACATTCATATATCACCATTACACTAACCCr*ACATAAACCAUTAGAGCTTTATCTAACAA- :a: - Tsa r3CyC02 »81/C03 eooswaSfCOS «3CVCO10 »3Q Figure 1. Mitochondrial DNA Sequence Alignment Continued 146 tetrazonumSl/TZt ATrAAATCCTCCACA Figure 1. Mitochondrial DNA Sequence Alignment Continued 147 «eere*onum63/TZ1 ArTAAATCCTGCAC*CCCQWACTTAACACCCAACTA-T*TATTCATGACACAACTrAT*CCTrrACCCAAC*rCTCCTC 237 . • W cooCT»3OC02 m • CC . . A. . OOOCW81/C03 ...T ... AT .TT...... c o o M S a C O S ____ T ____ .TT...... coon»3(VCOlO ...T... . .ce __ .AT .TT...... ooasw3(VCOll ...T... . . c c . . . .TT...... C...... eaaswaOfCOlS r . . c c . . . A .TT ____ ...... C...... COOSM27/C017 ...... T.. ...T...... C.T ______G....ACA. . . c c . . . A.TT ____ nyw— 78/C028 ...... T...... T______G.. ..ACA. ___ c . . . A .TT ____ ...... c ...... « e a r 2 « S C 2 ...C.T ______G .. . ACA. . . c e . . . A .TT ____ ...... c ...... œ o tf 2 4 Æ C 3 .TT ____ ânMàDMun *30fiR1 ...... T.. .. .C .T ____ ...G. .ACA. . . c e . . . .TT ____ ...... c...... ûr«Mottum 7SBR«1 ..c c ... ârawDMunTSBRae __ ftfl>wtiwt77)IWW1 __ t»«âiM*un*3aaR27 __ 78(BWb37 ... .TT ____ ooâareeBHi "SI/CI .TT ____ cafaraMan48C2 .TT ____ ttepoosw ^em ----c ... .TT __ ...... c...... (al|poo8w48n2 ...... T.. ...C.T______G....ACA.__ c ... A .TT __ ...... c...... tieipooea»4 Figure 1. Mitochondrial DNA Sequence Alignment Continued 148 Mnxonam 63/TZ^ ATACCICACATT-rTAGCCCAATAACACACTACCATCAGTTGATAACTTGCCGC-TACSGTTATTCAAGGTGAGGGACAA yanafum 87A/l ...... A.A.C.. .ATGT G.. . . vanaftMi 7/V2 .C ...... acnjDirm12M3 .CC..C.. ACA...... «0iBim9a/A15 ...... TT. /Mn«nanM2/BAt .CC..C.. /«AMauar4/R2 /aAwagiMt *66513 /StaaqMr'Oa/RIZ /M*»tS2/BY2 .CC..C.. ùafc>t7(yBY3 .CC..C...... TT. ..AAT TTA...... dUyf 37/01 .CC..C...... TT. dwy*"3am* ...... TT. .TA...... dbryrSa/08 .CC..C...... TT. —. AmumS/FS .C ...... A .A .C . . .ATGT.C...... CA...... Aavum 13/F6 AavumS/F7 .C ...... A .A .C . . .ATGT.C...... CA...... aman *81/32 aonan 11/Ell .TA...... pjmfiogmtw 17/Pi gyffftoga«ari6/P2 zanstK jm 14/Z12 zonaaun 1S/Z13 .TA...... Figure 1. Mitochondrial DNA Sequence Alignment Continued 149 WBMonuw 63/TZt ArACCTCAGATT-TTAGCCCAATAACACAGTACCATCACTTGArMCTTCCCSC-TACCCTTATTaUGCrGAGCGAaU 3 '5 r30C02 .A.C. . .ATGT.C CC. .C ...... T T .. .AAT.ATC...... ,81/C03 caat. tt a ...... AAT..CA. ,300010 1 ...... cc...... TT..., AAT.TTA. ,300011 AAT.ATC. ,300015 .A.C. AAT.ATC. ,27/0017 AAT..CA. ,700028 1 ...... cc. .c ...... AAT..CA. scstf2«S02 i...... cc. .c ...... TT..., AAT.TCA. «W524/S03 AAT.TCA. ttnwiraiHjH, *30BR1 AAT. ATA. ÙWItfDtfM» 78/00 «1 Om tartum 7SIBRMS .A.C.. .ATGT.G..* ... CC. .C ...... 4T. . .AAT.ATA. ArMnxtim TTiaMZS .A.C.. .ATGT.G...... CC. .C ...... TT. . .AAT.ATA. .A.C.. .ATGT.G...... CC. .C ...... TT.. .AAT.ATA. awwtwujw78/00037 .A .C .. .ATGT.G...... CC. .C ...... T T .. .AAT.ATA. ooloranm *51/01 .A .C . . .ATGT.G...... CC. .C ...... TT.. .AAT. .TA. QOimnnT 46/02 .A .C .. .ATGT.G...... CC. .C ...... T T .. .AAT. .TA . ,480-1 .A .C .. .ATGT.G...... CC. .C ...... T T .. .AAT.ATC. ,4802 .A.C.. .ATGT.G...... CC. .C ...... TT. . .AAT .ATA. ,4003 .A.C.. .ATGT.G...... CC. .C ...... TT...AAT.ATA. *CAW44&2 .A .C . . .ATGT .G ...... C C . . C ...... TT . . .AAT . . TA. /K8nwi71A3 .A.C...ATGT.G...... C C ..C ...... T T ...AAT.ATA. /VM»#*41/Y1 A C . . .ATGT.G...... CC. .C ...... T T .. .AAT.ATA. mm#y/42/Y2 .A.C...ATGT.G ...... CC..C ...... TT...AAT .ATA. /wnaa)445/RM1 -A .C .. .ATGT.G...... CC. .C ...... TT.. .AAT.ATA. /«naay^56/RM2 .A .C .. .ATGT.G...... CC. .C ...... T T .. .AAT.ATA. M M br *SOOt2 .A.C...ATGT.G...... CC. .C ...... TT...AAT. .TA. /wMDr33fiL3 A .C .. .ATGT.G...... CC. .C ...... T T .. .AAT. .TA. c/Mwnec/tf31/0H2 A C . . .ATGT.C...... CC. .C ...... TT.. .AAT. .TA. c/Mnnodtf*32/OH3 A C .. .ATGT.C...... CC. .C ...... T T .. .AAT. .TA. Figure 1. \Iitochondrial DNA Sequence Alignment Continued 150 MttWonumfiSnri =’ *TTCTG6CCCTTrCACACAGTG*ATTArTCCTGGCArTTGCTT-CCr*crTCAGGTTCArT*ArTC*T*rr»TTCCTCA 595 vanatum 07l\n GC_____ : ...... vanatum7f\/Z GC_____ r ...... z o n a ta iS n zonaàa'2JZ2 . .c__ . . .C . zonal» S/Z3 .G . c iyncMni43A.Y1 .C... lynoMRi 16ILY2 . .G . swannanoa 6SISW1 tfialusram 88n>l1 r inonD(um68fl1 otonoaw flL aa<84 xpjeaiBS Umwmâanp^WBT moaUn btanntuax. 37/BU1 M vnus A. 84/BU2 WkW,79IH1 atnoMrum 1(VS4 amotiRm 13VSS sànotanm S7lStl amtmumsnSf ânoMnmSKSO aànatinanT4lSao ônoMrumaSSSI a»ÿâna34M2 o0«)m»12M3 autoinim 90IA15 »2IBA1 nrtwaquM’Oara '«>i8aqMt’a6VR-l2 Aa*»rSaBY2 6a*yr7aBY3 cftayi37/Dl ...... a c .. . .T... dbryi'38104 ...... G C .. .AT ...... c aayr 58108 ...... c e .. ..T... .et... Annan aiF5 - Annan 13IFB ...... cc.. AnnanS/F7 ...... c c .. ao«an‘S1/E2 aaaanll/Elt wmogaamriT/Pi pynf)ogasiBri6IP2 ...... c c .. fonwan 14^12 zenssun XS/ZIZ Figure 1. îvlitochondrial DNA Sequence Alignment Continued 151 M tnB onum S S/T Z I CTATTGTCGCC6TTTCAC*CACTCAATTATTCCTCGCATTTGGTTCCT*CTTCAGG7TCATTAATTCAT*TT*TTCCTCJk Î95 ► 30(CO 2 ...... c c . . . . r ...... (8 1 /C 0 3 ...... CC T ...... ,a a c o @ ...... CC...AT ...... raO fC O lO ...... c c T...... r3 0 C O 1 1 ...... G C . . . . r ...... ,3QAC01S ...... GC....T ...... ► 2 7 C 0 1 7 ...... GC....T ...... » 7 0 C O 2 8 ...... CC...AT ...... m a f 2 « S C 2 sesor24/SC3 tevim M uii *3(yBRl finwmtwn 78IBR^ Ann*iM*im 7BIBR037 ealQre«ait*S1/C1 ...... GC- - > 4 a r ri i4 a rT 2 t4 0 fT 3 lKAMrf’44A2 ...... GC.. tÊOnmfTVLZ rmwyt’W n tm w y t4 2 ffZ /emaei#4SRM1 mtatfiSSKkB r* S 0 « L 2 ...... GC.. r3 3 « L 3 cftarmoetf 31/CH2 ..T ...... cAaimocftf * 3 2 0 0 Figure 1. Mitochondrial DNA Sequence Alignment Continued 152 (B fraronum 63/T Z 1 CACTTTCATCGACCCTTCCATAACT - AATCCTCGACTACATACTCCTCCTTACCCACCAACCCCCCCCTTCTTTCCATCG 674 v r m u m 6 7 W vans(bm7A/2 . < o n « t» a s n zonal» 2/Z2 zo n al» a m Vno»un43fLY1 . l^ n o tu m 16ILY2 M amanoa 6SSW1 . tfialBTtrean flBHXI hsor«KUnt6M1 . Mwniaafc» flL aa Figure 1. Mitochondrial DNA Sequence Alignment Continued 153 iWBronum 63fTZ1 CACTTTCATCGACGCTTCCATAAGT-AATGCTCCACrACATACTCCTCGTTACCCACCAAGCCGGGCCTrCTTTCCArCG coosM3QfC02 GA. A. . r . c G . )S1/C03 .GA. A. •T.CG. •aacos .GA. A. ...CA. >30(C010 .GA. A. .T.CG. taocoii .GA. A. .T.CG. ,30*0015 .GA. A ...... T.CG. •27/0 0 1 7 .GA. A ...... C____ CA. • 7W0O28 .GA. .A ...... CA. sc a m Z V S C Z .GA. A ...... T.CG. scaar24/SC3 .GA. A...... T.CG. bravffoMun *3QfBR1 .GA. .A ...... T.CA. a>«M«i*uni 7 M R ^ .GA. A ...... T.CA. eravtnaw n TS/BRnS .GA. A ...... T.CA. .GA. .A ...... T.CA. .GA. A ...... T.CA. GravtM taR 7BIBRSS7 .GA. A ...... T.CA. oa/bRMum*S1iC1 .GA. A...... T.CA. OOfeRMIfR 4 6 /0 2 .GA. A ...... T.CA. » 4 0 n ’1 .GA. .A ...... T.CA. I 4 & T 2 .GA. A ...... T.CA. .GA. A ...... T.CA. «KAmrf*4«L2 .GA. A ...... T.CA. lKAnarf71/t3 .GA. A ...... T.CA. a«m»«*41/Y1 .GA. .A ...... T.CA. mrn^4am .GA. A ...... T.CA. «RHin yf Figure 1. Mitochondrial DNA Sequence Alignment Continued 154 (BffBZOnom63/TZT aCCAACCGCTTTTTTTTTTCTATTT-CCTTTC/UCTGCCATTTCACACTGCACACGGOAA-TAACAGACAACCCTCTAC* SS2 vanwum87/V/i G...... T...... - ...... - ...... r...... vanMum 7/V2 G...... T...... - ...... - ...... t ...... 20nato8S/1 ...TG... ..T.T.. . zonale 2/Z2 ..T.T.. » zonanG/Z3 ...TG... ..T.T.. . ^»«wom43 Figure 1. Mitochondrial DNA Sequence Alignment Continued 155 M rm zo n jm 63/T Z l CCCAACCCGTTTTTTTTTTCTATTT •CCTTTCAACTGCCATTTCACAGTGCACACGGCAA AACAGACAACCCTGTACA coosa»3(VC02 r .-TC. .T.T...T... ____ CT...... C...... r o o o m » 8 1 /C 0 3 r . .TC. .T.T... ____ CT...... C...... T eootmtOlCOS r . .TG. .T.T... ____ CT...... T ooan»3(VCOlO c . . eeon»3acO-li c . ...- eoasw3(VC01S r . .TG...... A.. .T.T... ____ CT...... C...... T o o o s m 2 7 /C 0 1 7 c . .. ooosw 7BfC088 c . .T.T...... - 9catf24/SC2 r ..TG. .T.T... ____ CT...... C...... r seatf24/SC3 c . . O f nrêrtw n "30AR1 c . c. •. Oi»»iiM>i«n TSIBWua c. ..TA. ....C.C.... .TCT... -. O f iiiiMlfiw>77/BRig3 c. ... O fiiiotiw t *300W27 ' c. ... . O f iiiMDMH 78(BWp3y • r ..TA. .T.T... ___ T. adarow n *S1/Ct c ..TA. .T.T... ____ T. odara>um4MC2 r ..TA. .T.T... «IOpOOM»40n’1 c, ..TA. .T.T... . «■eynnew4am r dfOpOOM»4Qn3 c, ..TA. .T.T... lKftnarf*44A2 c ..TA. .T.T... r ..TA. .T.T... . r r n r n v i^ a m c...... ftnw)44SRM1 r ..TA. ___ c.c___ .T.T...T...... GC...... C...... M. A ____ r. T fm w y fS & R M Z ■ r ..TA. ....C.C.... .T.T.. . . G...... C...... A T 0cMor*SQ«L2 c...... eifa*Br33fflt3 c. cM tmoctf 31/CH2 ■ c. T cftfWoelB*32>CH3 • c. Figure I. Mitochondrial DNA Sequence Alignment Continued 156 tetrnztjntim 63/TZl TTTTTCTT-GCTCCGCCGAAT*CTCTCAATCCTSAAAACATTTT*T«CAAASAACCACAT*rrAGCATATCATCTCCArA 631 varmttxn 37/Vl ytm m tum 7N2 zonal» 8S/1 . zonal» 2/Z2 . zonal»@Z3 /yne»oni43/l.Y1 . /yncaum 16A.Y2 . awannanoa 6S/SW1 CfMMssram 6VTH1 . raerialumSani "...C.. rr ManmoidBaâ. 8SB4 a Figure l. Mitochondrial DNA Sequence Alignment Continued 157 eeOfBzonum 63/TZ* TTTTTC 'T-GCTCCCCCCAATAC rCTCAArGGTGAAAACATrT7A rACAAACAACCACArATTAGCArATCATGTGCArA rXVCOZ ..._C..A...T ____ A C ______M »8liC03 rsacos »30IC010 . . r __ . »3Q XT. .A. ..C. ...M. XT. A. ..G. ...M. XT. A. .TG. ...A. .CT. A. .TG. .G.A. .CT. .A. ..G. .. .N. .CT. A. ..G. ...«. .CT. A. ..G. .G.H. .CT. A. .TG. .N.N. .CT. A. .TG. ...M. .CT. A. .TG. ...M. Figure 1. Mitochondrial DNA Sequence Alignment Continued 158 temanttrn 63/TZt *GTGCTCCAAArTACTCCTA*CTTCCCTAAC*CACCCCCCT - -CTCSSArTTCTTACCCTTTCTTTCCCTAAAACCCCCC W vanatum 87/Vi ..C-. • vanMum 7/V2 . .C -- zonal» 85^1 A.. .CTT...... r ... .. zanam 2/Z 2 .CT.....r...... T__ zonal» 6IZ3 jynooian 43/LY1 .CT.. ..c.. .. lyneaum 1M .Y 2 .CT.. ..c.. SMiannanoa 6S/SW1 .CT.. ...CTC ...... tfiai»H»ium asm -n m o r« A » n 6 M 1 2 . ...CT ...... C...... aHHnort»aa.ag Figure 1. Mitochondrial DNA Sequence Alignment Continued 159 leerezonuOT 63/TZl ACTGCTCGAAATTACTCCTAACTTCCCT/UWyiCACCCCCCT -CTCGGATTTCTTACGGTTTCTTTCCCTAAAACCCCCC 709 I3CVC02 . . . r . . . A T ------r ...... r ...... )81fC03 ...T. ..AT ------T...... T ...... rsacos . . . A r T...... ,300010 ..CT...AT ------T...... T ...... ,3(VC011 ...T...AT ------T...... T ...... ,300015 ...T...AT ------T ...... r ...... ,27/0017 ...T...AT _____ I ...... T ...... ,700028 ...A...AT ------T...... 3oaOF2«SC2 ...A...AC------T.C ...... «caar2«S03 ...A...ATG...T.C ...... diewoserun *30BR1 ...A ...... A ...... AfSwoMun 70BR*«1 ...A ...... C...... Omtaitun TSBRmS 6i«»ÉOi>iwt 77IOn8Z3 -.r.. *30BR27 ..r.. tirewloelrisn TOBRgflOT ■ .. eoferanm *51/01 .. coiSRMunt4002 .. »4on .. ,4802 ..T. ,4003 .. lWhmrf*44A2 .. lKhMrf71iL3 .. AM*f'41/Y1 .AT. ...T ...... T ...... rm rnvi ^ a m . /■mM)44SRM1 .. rrntmyiSBmtB. ...T.C ____ .. MMar*S08L2 ..T. .. .. /» M x 3 3 fiU ...A. ...T ...... cflannoetf 31/OH2 . . .A . ...T. ...T ...... cAamne/B *32IOH3 ...A* Figure 1. Mitochondrial DNA Sequence Alignment Continued 160 (Bft«ronian63rrZl C-*CCCCC-rTAACTCCTCACATACCTATCAATCCrCAAiUCCCCC:SSAAACACCA*AGCCTCT*CAACTA-rTTTTTS 736 varmtumVT!^ ,7/V2 zone»8Sfl r , ...... AT_____ ...T. - zonatoZSZ -Tr ...... AT_____ ...T. zanait6Q3 - rr ...... C.A...... A...... - -T. Veawn43A.Yl ...A...... AT____ ...T. lynemum 1GILY2 - rr ...T _____ ...... AT_____ ...T. - zwennwK*6aSW1 -Tr tfWbssnum66rrH1 -rr...... C.A...... T...... AT____ mo«XUm6aff1 T...... C.A...... AT____ MMnodwAi 88IB4 T...... C.A...... AT... . ùWmmaüMpiaWS T...... C.A...... T...... AT____ . ùâmnfaUwn. 11/86 T...... C.A...... T...... AT... tmnmaUm pLtemtr T... . . n p H t» 4 4 m n T...... C.A...... AT... . fi/ton te X. STWUI T... . tUHnteA. 840UZ T... . ta...... A T . . . /âM 9 79/HI . sinoMtun 1Q/S4 T. . . • x«naivunl2/S5 T... aàmeÊÊnmSnSB T...... C.A.., ...T. - G ,C.G. arnamntaSflSr T ...T. - G T...... C.A.., ...T. ...G. ânomum 74/366 T. .. • xinoMfun 68S91 T... . x«nNm34M2 T...... C.A». .T ...... T. . 4«r«jim»12M3 T... . T...... C.A.. ...T. . »2«A1 T-.. .r ...... T-., ,T ...... T, . .. .5. T-.- . . T-.. ...C.A.. .T ...... S. . baiÊViS3iem T. . ùWv7(VBY3 •T... . dbryt 37/01 T. . . • T . . durytsane • T .. , ...... AT... /lwtana/F5 .f . /iBvum 13/FB .T /lMunS/F7 -T /•S1/E2 -T r 11/611 -T •17/PI • t pyfTftogasser 16/P2 • t il«Z12 • t MSZ13 - r ... - Figure I. Mitochondrial DNA Sequence Alignment Continued 161 C*ACCCCC‘ rTAACTCCTGACArAGCTArCAATCCTCAAAACCCCCCCGAAACACCAAAGCCTCTAGAAGTA*rT7rTTG -T...... C.A ...... -T ...... C.A ...... -T ...... C.A ...... 30C011 -T ...... C.A ...... -T ...... C.A ...... -T ...... C.A ...... -T ...... C.A ...... -T ...... C.A ...... T ...... C.A ...... T ...... AT... -T ...... C.A ...... -T ...... C.A ...... -T ...... C.A ...... -T ...... C.A ...... -T ...... C.A ...... -T ...... C.A ...... ootte*»n*SVC1 -T ...... C.A ...... oolonmm4ÊÊCZ -T ...... C.A ...... »4arri -T ...... C.A ...... 14802 -T ...... C.A ...... f40O3 -T ...... C.A ...... teflrarf*4«l2 .T ...... C.A ...... MrarfTIAS -T ...... C.A ...... -T ...... C.A ...... -T ...... C.A ...... irnnrn^ASmm -T ...... C.A...C ...... T.C ...... AT... nmoaytsema -T ...... C.A...N ...... r*SQOt2 -T ...... C.A ...... rZaiBd -T ...... C.A ...... etmmoekf3VCH2 -T ...... C.A ...... cftnnoc*/*3aCH3 -T ...... C.A ...... Figure 1. Mitochondrial DNA Sequence Alignment Continued 162 IW rw o n o m S S rrZ l 3CC-ATCCAATTTCCATCTATTTACArrATT/UUArAATCTGCATGCTACCGr*CCTTAATTAAACCArAACACTGAACA 86S vmrmtum 87/V I 'fmnatumllsn J in o lK u n 1Q(S4 J t n o l v u n 12fSS vmettnmSnSi sànotmmSTIST stnatÊnmUSO sina«raa74Æ8B S fnotH U R 66(881 AfttMM»34M2 .....A ...... G,...... c ... afr«]drm12M3 AWin#9a(M6 ___ _A...... G-...... c___ ftawwH—aBAI ...... G... /a*m9uar4(R2 mAiMqW88(R3 b^SS/BFfZ , _ . T ...... btÊa^TWn , . . T ...... dkayÿ 37/01 ,..T ...... dbi>i*3604 ,_.T ...... atryrSaoa . . . r ...... bUfumB/FS ...T ...... Hmtum 13/PS ...T ...... nm m m SIPT ...T ...... att)«rf*8T/E2 (11Æ11 '17/Pi ...T-A P>nftogMMrl6/P2 ...r-A M«MU«»14Æ12 ...r-A «onsauntSZn ...r-A Figure I. Mitochondrial DNA Sequence Alignment Continued 163 mtmtmmearrzi 3CC-«TCaUTTTeCATCTArTT«CATr«rTA>UUTUrSTCCArcCT*CCCTACCTTAArTAiUCatr«ACACTaUCA 365 »3(yC02 ...... G.. ..CAT. r81iC03 r a a c o s rSOCOlO r a o c o i i ,30fCO15 ► 2WC017 )7«C 02S A...... G ...ATT ATT...... C. K om 24ISC 2 ...... -.A ...... G..G....ATT...ATT ...... C. tea U Z V S C a ... firaviortun *3QflR1 —... * ...... *’6 ...... c. Arwwaa>un7aiBR«1...... * ...... T...... c ...... A ...... T...... C...... A...... TO...... C...... A...... TO...... C. trai^aitun7M R037' ...T-A...... to...... c . oafcronm*S1IC1 ...*.A ...... T...... oelommmi4&CZ ...-.A ...... T...... lA arri * ...... ►4802 * ...... ►4003 . . . - . A ...... m im rf*44A 2 ...... * ...... : ...... * ...... tetawrniu *...... : ...... •4im ...-.A ...... rrnrn^^Sm . . . A...... /■mM)44SRM1 .....A ...... T...... fwmmylSBmn *S0fBL2 ...... -.A ...... T ...... 33/BL3 ...-.A ...... T ...... 6 ...... T. cTMmioctf31/CH2 * ...... ^ ...... G...... T. cA«inoeAi*aaCH3 •••'* ...... ^ ...... ®...... Figure I. Mitochondrial DNA Sequence Alignment Continued 164 le^rm^0nume3^^Z^ rCTTAAGATCACCCCTAGAAACCTCCCCGCCCAaUU«CCCTTGGTCCTGACTTT«CTArCAACTCT*ACTAMCTTâCAC 965 vanMun S7/V1 vanatum 7/V2 AonatoSSn ...... A...... r ... . .A...... G___ zarW» 2/Z2 la n a lm S IZ i ...... A...... T.,. . .A...... -C... iync0uni43/LY1 ...... T... VnoacanlttLYZ ...... A...... T.., .A...... G... •6SSW1 ...... A...... T...... G.., T G... RsoiMumQani ...... A...... T...... G... T -G... MwiinÂW&a&B# 1016305 btÊnmaHÊg Pi 9BIBr npaap»44inn ...... A...... T...... G... .G... Ofennte*. 37/BU1 ...... g a ...... T...... G... -G-., Mmw6.640U2 ...... A...... T.., ...... G.., GG... AMtoTOHI ...... A...... T...... C.T, T ,.G...... r ...... >1004 ...... T.. ...A ...... G..,.G...... nass ...... A...... T.. ..T...... G....G...... aimoHnmSflSB ...... A ...... T.. ..G....G...... ainalÊnMnSnSJ ...... A...... T.. ..G..,.G...... Afno(vun909 ...... A...... T.. ..G...,c...... ainotanan74/S8B ...... A...... T.. ...A ...... ,_G...,G...... AânoMrun6S/S81 ...... A ...... T.. ..G...,G...... tùipim3Wa ...... T.. ..G....G...... anUmMIAa ...... A ...... T.. ,.G...,G...... pPHimSOIAlS ...... T.. ..G...,G...... 6arrananM20A1 ...... A ...... T...... G.. ..G..,,G...... /aAwaqMf4/R2 ...... T...... G.. ..G..,,G...... /aAwaqMi *60012 b^ayiS2Kfn. 6Wyf70OY3 dfaryf'37/DI aUyf*3»D4 ,G.. auyfSB06 ...AA...... /lavumttFS ..G..-.G.T...... /iBvum 13/F6 ..G.. .G.T...... OmnjmSIFT ..G.. .G.r...... i*81/E2 ...... G...... T.. ...A ...... G.. . . . r ...... flI/Ell ...... G...... T.. .. .T...... pyirftogaM rlSP2 so r a H u m 14/Z12 z o n a o u m 1S/Z13 Figure 1. Mitochondrial DNA Sequence Alignment Continued 165 fMrvonun 63^1 TGTTAACArGACCCCTAC«AASCTCCSCCCCCACAAACCCTTGCTCCTCACTTrACTArCAACrCTMCTAAACrT«CAC 945 I30C02 .s.. .G .T . »81Æ03 • C . . .G . r . raacos .c.. . . . T . »3*CO10 • C . . AA. .G...G.T. »3QIC011 • S . . .G...G.T. »30C01S .6.. AA. .C...G.T. »27JC017 G.. .G...C.T. >7»C028 .S.. • G...... T. X o U 2 4 IS C 2 -G.. .G ...... T. te a a 2 4 tS C 3 •G.. .G ...... T. ùrsMRMtfiaa *3QIBR1 .GA. .A. G...G.T. flwwtoi>M»7M n«1 .GA. A. .G ...... T. .GA. A. .G ...... r . .GA. A. .G ...... T. .GA. A. G...G.T. .GA. A. G...... T. .GA. .G ...... T. .GA. .G ...... T. i^arri G.. .G...C.T. 14802 G.. .G...G.T. ,4003 .G.. .G...G.T. lHAMrf*4«U .GA. .G ...... T. lÊChnÊriTVLi G.. .G ...... T. mtayfWn G.. .G ...... T. mmj/Hartl G.. .G ...... T. /■m—y*4S(BM1 GA. .G ...... T. nmaayiS&nC .GA. G...... T. '*SQ«L2 ..A. G...... T. r330U .GA. AA. • G...... T. etmntoeUSVCHZ .GA. • G...... T. ehannocW*320a GA. Figure 1. Mitochondrial DNA Sequence Alignment Continued 166 f« ffazo n u m 6 a/T Z 1 *rGCAACTATCCCCATCCCCCTG«GAATCCCCTAa>CTTCCCTCCCCCCCAACAAGGAGCCGCT*rCACCakC *018 vanM un 87/V1...... wanafun 7/V2...... z o n o to S S n ...... r ...... z a n t m 2 / Z 2 ...... r ...... z o n a * 8 0 3 ...... T ...... Vncaum43A.Y1 ...... r ...... jyncacM) 16A.Y2 ...... t ...... jw fw n oa aS>SW1 ...... C ...... t t ...... T ...... tnm im ssàium O BrfW ...... r ...... r ...... m eriptunSSM ...... T ...... T ...... r 8 i 8 6 0 4 ...... c ...... r ...... IP L 8 3 0 5 ..... T ...... r a I li B B ...... T ...... tA .8 8 IB 7 ...... - ...... T ...... njpuxbm M inn ...... c ...... T ...... MMnto&37/BU1 ...... - ...... T...... r ...... tm nrn*b.W /aLa ...... - ...... T...... T ...... imWbTBHl - ...... T...... r ...... « r n o t v u n 1(VS4 T...... r ------s . i i m o t m i m 1 2/S S T ...... s . iimotm v nSfISK ...... T ...... a . aim atanm STIST ...... r ...... s . a à n d Ê n m V S O ...... T ...... G. a*mo*mm74(SBB ...... T ...... G. stnotÊom BBISO i ...... T ...... G. m H p i m t V U a T ...... G. alrfpinn»^7»a T ...... G. «8«âm9Q0M5 T...... G. tm tm tm nm ilBAX ...... c ...... r ...... G. rwOnm aqim iAim ...... c ...... r ...... g. nOnoamml’W O ...... c ...... r ...... g . r«taaqM i*aaiR12 ...... C...... T...... G. b ^ t y i S 2 K m T ...... Mto>«7Q«Y3 ...... : dbryt37i01 ...... Figure 1. Mitochondrial DNA Sequence Alignment Continued 167 (Ofr»rOf«jm63/TZ1 aTCOUGTATCCGCATCCCCCTCASMTGCCCTACAGTTCCCTCCCCCGCAACJUCCACCCCCTATCACCCAC 1018 » 3 0 C 0 2 r ...... r ...... r8i#C 03...... r ...... r a a c o s ...... T...... r ...... > a o c o io ...... T...... T...... »3(HC011 T...... T...... 1 3 0C 01S T...... T...... • 27/C017 T ...... T...... > 7 » C 0 2 8 T...... T...... seoaF24iSC2 T...... T...... aootf2«SC3 r ...... t ...... b w iiré rtw » *30 Figure 1. Mitochondrial DNA Sequence Alignment Continued 168 APPENDIX C: Animal Use Protocol m T W T . n « v m a r t s e a r . P ro to c o l N O . _ Ooeo taeolvod «wnrar. eU S UD 0 » OOHBXSnB _ZZ&I> nbaenratlona nn n .rr,r B^nrBdurtinn .a^havinr ______ pmeiFM . J—O— ram ». Ted Cavender (KBse Bo ooBbor o f o a a P aea ler) TypoA namo slq sacoro NOXXi OSS poca^uol Imolvod ia ehto protocol ouot cooploto eba Animal Cara and as Tralnlog Program BRSB antaala cam ba procorad. :a soBmitting ebla protocol, t , a pclaelpal Imvastlgatoc. aeeapt eha raapomalBlllty for eoaplta nca witB emis rsqutraaan t. Arartaalr Tielat Praf*e«ar 'aork So. C92 -7Ô73 Baargamcy ?hoaa So. 294-0173 Oapastaaoss 7 n r , I o»v______CoUagai Unlnji.-il.-acXaBraa------ 1315 Klpnear Road. M u s e u m of Btotogieal l^y»r ■avia» ataiosi «eoottnoattoo •continoation lal.tlaJ. Ratlaw -nr 50 cbaaga sita Cbaoga _ •PrOTlooa Protocol Nuasar PSklOP OP psasoe'a- Oataa Protocol w ill bal a a f f a c t f r o a i 12 / IJ /9 3 r o (not to aacaad 3 yoars) " irn m tT HBTUrrr*™'** aauyaaaMa»>. I haaa rarlawad tkia aaiaal uaa protocol and aodoraa Its a n f laaloa. cob Perer U P«pp.« _ _ Typad naaa Slgaaenra 1 am amiaamrsm s MPisst r Data eawlawad tbia protocol with cagacd to propoaad cars I am# o t initial T mad atlXimmtlon of mpproprlAt# fmeilitimm. 7h# PrlxieipmX Iav##clgmcor (or \ hmm b##a i a foamd Aboar my eeoceras/commentts chae arm g. OtLrr- io lA^piOj^ / t u - n - b * ^ ______ ntapf MrfJrirm //• lù = S h - Typad naaa Slgnatnra Data SOOXCXS) POX PSBDZSa POX PKUPOSID PROJXCr (Cback I f kaowB.1 1 , usuxPt spoaaer HP Propoaai/Projact No. . Oaaalopaaot Pdadt Ooaor ______Aceouat . CBl l asa/Dapair aanr ______Paadiag , nacDc x-oi Protocol (6/92) 169 LITERATURE CITED Agassiz, L. 1854. Notice of a collection of fishes from the southern bend of the Tennessee River, Alabama. Amer. J. Sci. and Arts. 17(2):297-308, 353-369. Autin, W. J., S. F. Bums, B. J. Miller, R. T. Saucier, J. I. Snead. 1991. Quaternary geology of the Lower Mississippi Valley, in Morrison, R. B., ed.. Quaternary nonglacial geology; Conterminous U.S. Boulder, Colorado, Geological Society o f America, The Geology of North America. V. K-2. Avise, J. C., J. Arnold, R. M. Ball, E. Bermingham, T. Lamb, J. E. Neigel, C. A. Reeb, And N. C. Saunders. 1987. Intraspecific phylogeography: the mitochondrial DNA bridge between population genetics and systematics. Annu. Rev. Ecol. Syst. 18:489-522. Avise, J. C., J. E. Neigel, and J. Arnold. 1984. Demographic influences on mitochondrial DNA lineage survivorship in animal populations. J. Mol. Evol. 20:99-105. Bailey, R. M. and Etnier, D. A. 1988. Comments on the subgenera of darters (Percidae) with descriptions of two new species of Etheostoma {Ulocentra) from southeastern United States. Miscellaneous Publications Museum of Zoology, University of Michigan 175:1-48. Bauer, B. H., D. A. Etnier, and N. M. Burkhead. 1995. Etheostoma (^Ulocentra) scotti (Osteichthyes: Percidae), a new darter from the Etowah River system in Georgia. Bull. Alabama Mus. Nat. Hist. 17:1-16. Baum, D.A. 1992. Phylogenetic species concepts. Trends in Ecology and Evolution 7:1-2 Bouchard, R. W. 1977. Etheostoma etnieri, a new percid fish from the Caney fork (Cumberland) river system, Tennessee, with a redescription of the subgenus Ulocentra. Tulane Studies in Zoology and Botany 19:105-130. 170 Boschung, H. T., Mayden, R.L., and Tomelleri, J. R. 1992. Etheostoma chermocki, a new species of darter (Teleostei: Percidae) from the Black Warrior River drainage of Alabama. Bulletin Alabama Museum of Natural History 13:11- 20. Bremmen K. 1988. The limits of amino acid sequence data in angiosperm phylogenetic reconstruction. Evolution 42:795-803. Burr. B. M., and M. L. Warren. 1986. A Distributional Atlas of Kentuckv Fishes. Kentucky Nature Preserves Commission, Frankfort, KY. 398 p. Cabot, E. L. and A. T. Beckenbach. 1989. Simultaneous editing of multiple nucleic acid and protein sequences with ESEE. Comput. Appl. Biosci. 5:233:234. Carney, D. A. and Burr, B. M. 1989. Life histories of the bandfin darter, Etheostoma zonistium, and the firebelly darter. Etheostoma pyrrhogaster. in Western Kentucky. Illinois Natural History Survey Biological Notes 134:1- 16. Chang, Y-S.. F-1. Huang, and T-B. Lo. 1994. The complete nucleotide sequence and gene organization of carp {Cyprinus carpio) mitochondrial genome, J. Mol. Evol. 38:138-155. Clayton. J. M. 1984. Population differences and life history of the emerald darter. Etheostoma baileyi (Pisces: Percidae). Masters Thesis University of Kenmcky. 1-95. Collette, B. B. 1962. The swamp darters of the subgenus Hololepis (Pisces, Percidae). Tulane Stue. Zool. 9:115-211. Collette, B. B. 1962. Systematic significance of breeding tubercles in fishes of the family Percidae. Proc. U. S. Nat. Mus. 17:567-614. Cracraft, J. 1983. Species concepts and spéciation analysis. Current Ornithology I : 159-187. Davis, J. I. 1997. Evolution, evidence and the role of species concepts in phylogenetics. Systematic Botany 22(2):373-403. Donoghue, M. J. 1985. A critique of the biological species concept and recommendations for a phylogenetic alternative. Bryologist 88: 172-181. 171 Etnier. D. A. and w. c. Stames. 1993. The Fishes of Tennessee. Univ. of TN. Press., Knoxville, TN. Faber J. E. and C. A. Stepien, 1997. The utility of mitochondrial DNA control region sequences for analyzing phylogenetic relationships among populations, species, and genera of the percidae in Kocher, T. D. and C. A. Stepien ed.. Academic Press. New York, New York, Molecular Svstematics of Fishes. 129-143. Hubbs. C. L. and J. D. Black. 1940. '‘Percid fishes related to Poecilichthys variants. with descriptions of three new forms.”. Occas. Pap. Mus. Zool. Univ. Mich.. #416. 30 p. International Code of Zoological Nomenclature. 1985. Third Ed. Jordan, D. S. 1877. Contributions to North American ichthyology based primarily on the collections of the United States National Museum. 2. A-Notes on Cottidae, Etheostomatidae. Percidae. Centrarchidae, Aphredoderidae. Dorysomatidae, and Cyprinidae. with revisions of the genera and descriptions of new or little known species. U.S. Nat. Mus. Bull. 10:5-68. Jordan. D. S. 1878. Manual of Vertebrates of the northern United States, including the district east of the Mississippi River and north of North Carolina and Tennessee, exclusive of marine species. 2nd ed.. p. 223. Keevin, T. M., L. M. Page, and C. E. Johnston. 1989. The spawning behavior of the saffron darter {Etheostoma flavum). Trans. Ky. Acad. Sci. 50:55-58. Kluge. A. G. 1989. A concern for evidence and phylogenetic hypothesis of relationships among Epicrates (Boidae. Serpentes). Sys. Zool., 38(l):7-25. Lee, W., Conroy, J., Howell, W. H., and Kocher, T. D. 1995. Structure and evolution of teleost mitochondrial control regions. J. Mol. Evol. 41:54-66. McKeown, P. E.; Hocutt, C. H.; Morgan, R. P. II; and Howard, J. H. 1984. An Electrophoretic Analysis of the Etheostoma variatum Complex (Percidae: Etheostomatini), with associated zoogeographic considerations. In the Environmental Bioloev of Darters ed. by Lindquist, D. G. and Page, L. M.. Dr. W. Jimk Publishers. O'Neil, P. E. 1981. Life history Etheostoma coosae (Pisces: Percidae) in Barbaree creek, Alabama. Tulane Studies in Zoology and Botany, 23:75-83. 172 Page, L. M. 1981. The genera and subgenera of darters (Percidae, Etheostomatini). Occas. Pap. Muse. Nat. Hist. Univ. Kansas. 90: 1-69. Page, L. M. 1985. Evolution o f Reproductive Behaviors in Percid Fishes. Illinois Natural History Survey Bulletin 33(3):275-295. Page, L. M. and Burr B. M. 1982. Three new spicies of darters (Percidae, Etheostoma) of the subgenus Nanostoma from Kentucky and Tennessee. Occ. Papers of the Mus. of Nat. Hist., Univ. KA. 101:1-20. Page, L. M. and R. L. Mayden. 1981. The life history of the Tennessee snubnose darter, Ehteostoma aimoterum in Brush Creek. Tennessee. Illinois Natural History Survey Biological Notes. 117: 1-11. Page, L. M. and D. L. Swofford. 1984. Morphological correlates of ecological specializations in darters. Environmental Biology of Fishes 11(2): 139-159. Page, L. M. and G.S. Whitt. 1973a. Lactate dehydrogenase isozymes of darters and the inclusiveness of the genus Percina. Illinois Natural History Survey Biological Notes, 82:1-7 Page, L. M. and G. S. Whitt. 1973b. Lachtate dehydrogenase isozymes, malate dehydrogenase isozymes and tétrazolium oxidase mobilities of darters (Etheostomatini). Comp. Biochem. Physiol. 44B: 611-623. Page. L. M., M. E. Retzer, and R. A. Stiles. 1982. Spawning behavior in seven species of darters (Pisces: Percidae). Brimleyana 8:135-142. Porterfield, J. C. 1997a. Separation of spawning habitat in the sympatric snubnose darters Etheostoma fla^rum and E. simoterum (Teleostei, Percidae). Trans. KY. Acad. Sci. 58(1): 4-8. Porterfield, J. C. 1997b. A molecular perspective on basal relationships of snubnose darters (Percidae: Etheostoma). Abstract from the 77* Annual Meeting of ASIH, Seattle, WA. Richards, W. J. 1966. Systematics of the percid fishes of the Er/zeojfoma thalassinum species group with comments on the subgenus Etheostoma. Copeia, 1966(4):823-838. 173 Ridewood, W. C. 1904. On the cranial osteology of the fishes of the families Elopidae and Albulidae with remarks on the morphology of the skull in lower teleostean fishes generally. Proc. Zeol. Soc. London, 2:35-81. Rodbell, D. T. 1996. Subdivision, subsurface stratigraphy, and estimated age of fluvial-terrace deposties in northwestern Tennessee. US Geological Survey Bulletin. 2128:1-24. Saccone, C., G. Fesole, E. Sbisa. 1991. The main regulatory region of mammalian mitochondrial DNA: Structure-ftmction model and evolutionary pattern. J. Mol. Evol. 33:83-91. Schlosser, I. J. and L. A. Toth. 1984. Niche relationships and population ecology of rainbow {Etheostoma caeruleum) and fantail (£. flabellare) darters in a temporally variable environment. Oikos 42:229-238. Schug, M. D. 1995. Invasion of a freshwater archipelago: Inferences from population genetics of mosquitofish {Gambusia hubbsi) in blueholes on Andros Island, commonwealth of the Bahamas. Dissertation. The Ohio State University. Shaw, K.A. 1996. Phylogenetic analysis and taxonomy of the Oligocephalus group of darters (Teleostei: Percidae). Ph.D. dissertation. University of Kansas. 257 p. Simons, A. M. 1992. Phylogenetic relationships of the Boleosoma species group (Percidae: Etheostoma). In Systematics, Historical Ecology, and North American Freshwater Fishes. Ed. R. L. Mayden. Stanford University Press, Stanford, CA. Pp268-292. Simons, A. M. and R. L. Mayden. 1997. Phylogenetic relationships of the creek chubs and the spine-fins: an enigmatic group of North American cyprinid fishes (Actinopterygii: Cyprinidae). Cladistics 13:187-205. Song, C-B. 1994. Molecular evolution of the cytochrome b gene among percid fishes. Ph. D. dissertation. Univ. IL. Urbana-Champaign. Southern, S. O., Southern, P. J., and Dizon, A. E. 1988. Molecular and phylogenetic studies with a cloned dolphin mitochondrial genome. J. Mol. Evol. 28: 32- 42. 174 SprinzI, M., C. Horn, M. Brown, A. Loudovitch, and S. Steinberg. 1998. Compilation of tRNA sequences and sequences of tRNA genes. Nue. Acid. Res. 26(1): 148-153. Stiles, R. A. 1974. The Reproductive Behavior of the Green and Barren River Ulocentra (Osteichthyes: Percidae: Etheostoma). Abstract from the ASB Bulletin, 21(l):86-87. Suttkus, R. D. and Bailey, R. M. 1993. Etheostoma colorosum and E. bellator, two new darters, subgenus Ulocentra, from southeastern United States. Tulane Studies in Zoology and Botany 29(1): 1-28. Suttkus, R. D.; Bailey, R. M.; and Bart, H. L. Jr. 1994. Three new species of Etheostoma, subgenus Ulocentra, from the Gulf Coastal Plain of Southeastern United States. Tulane Studies in Zoology and Botany 29:97- 126. Suttkus, R. D. and Etnier, D. A. 1991, Etheostoma tallapoosae and E. brevirostrum, two new darters, subgenus Ulocentra, from the Alabama river drainage. Tulane Studies in Zoology and Botany 28(1): 1-24. Taylor, W. R. 1967. An enzyme method of clearing and staining small vertebrates. Proc. U.S. Nat. Mus. 122(3596):1-17. Trautman, M. B. 1957. The Fishes of Ohio. The Ohio State University Press. 782pp. Tsai, C. 1966. A study of the systematics of E/Aeosroma zona/e (Cope) and its relatives, and the phylogeny of subgenus Etheostoma Rafinesque (Percidae. Teleostei). PhD. Thesis, Cornell University. 1-356. Tsai, C. and Raney, E. C. 1974. Systematics of the banded darter, Etheostoma zona/e (Pisces: Percidae). Copeia 1974(1): 1-24. Tzeng, C-S., C-F. Hui, S-C. Shen, and P. C. Huang. 1992. The complete nucleotide sequence of the Crossostoma lacustre mitochondrial genome: conservation and variation among vertebrates. Nucleic. Acids. Res. 20(18):4853-4858. Watrous, L. E. and Q. D. Wheeler. 1981. The out-group comparison method of character analysis. Syst. Zool. 30:1-11. 175 Weddle, G. K. 1990. Spawning orientation preference of the kentucky snubnose darter: An in-stream study of Etheostoma rafinesquei. Trans. Ky. Acad. Sci., 51(3-4): 159-165. Wiley, E. O., 1992. Phylogenetic relationships of the Percidae (Teleostei: Perciformes): a preliminary hypothesis in Svstematics. Historical Ecology, and North American Freshwater Fishes. Mayden, R. L. ed. Stanford University Press, Stanford, CA. 247-267. Winn H. E., 1958a. Observations on the reproductive habits of darters (Pisces- Percidae). Amer. Midi. Nat. 59:190-212. Winn, H. E., 1958b. Comparative reproductive behavior and ecology of fourteen species of darters (Pisces-Percidae). Ecological Monographs. 28:155-191 Wood, R. M., and R. L. Mayden. 1997. Phylogenetic relationships among selected darter subgenera (Teleostei: Percidae) as inferred from analysis of allozymes. Copeia. 1997(2):265-274. Wynes, D. L. and T. E. Wissing. 1982. Resource sharing among darters in an Ohio stream. Amer. Mid. Nat. 107(2): 294-304. Zardoya, R., J. M. Bautista, and A. Garrido-Pertierra. 1994. The complete nucleotide sequence of the mitochondrial DNA of the rainbow trout, Onchorhynchus mykiss. Unpublished. Genbank accession number L29771. Zhang, Q., and T. R. Tiersch. 1994. Rapid isolation of DNA for genetic screening of catfrshes by polymerase chain reaction. Trans. Amer. Fish. Soc. 123:997- 1001. 176 IMAGE EVALUATION TEST TARGET (QA-3) y % /. % 1.0 I l f IS 12.0 1.1 1.8 1.25 1.4 1.6 150mm V V / 1P P U E D A IIVMGE . Inc 1653 East Main Street Rochester, NY 14609 USA % /J — Phone: 716/482-OGOO - = = '- = Fax: 716/288-5989 / > O '993. Applied Image. Inc.. AU Rights R esened o/