Histone H3 Methyltransferase Suv39h1 Prevents Myogenic Terminal Differentiation by Repressing MEF2 Activity in Muscle Cells

International Journal of Molecular Sciences

Article Histone H3 Methyltransferase Suv39h1 Prevents Myogenic Terminal Differentiation by Repressing MEF2 Activity in Muscle Cells

Wei Jin 1, Yangyang Shang 1, Jian Peng 2,† and Siwen Jiang 1,3,*,† 1 Key Laboratory of Pig Genetics and Breeding of Ministry of Agriculture & Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, Huazhong Agricultural University, Wuhan 430070, China; [email protected] (W.J.); [email protected] (Y.S.) 2 Department of Animal Nutrition and Feed Science, College of Animal Science and Technology, Huazhong Agricultural University, Wuhan 430070, China; [email protected] 3 Key Projects in the Cooperative Innovation Center for Sustainable Pig Production of Wuhan, Wuhan 430070, China * Correspondence: [email protected]; Tel.: +86-27-8728-0302; Fax: +86-27-8728-1378 † These authors contributed equally to this work.

Academic Editor: David Sheehan Received: 22 July 2016; Accepted: 8 November 2016; Published: 28 November 2016

Abstract: The myogenic regulatory factors (MRFs) and myocyte enhancer factor 2 (MEF2) transcription factors have been extensively studied as key transcription factors that regulate myogenic gene expression. However, few reports on the molecular mechanism that modulates chromatin remodeling during skeletal muscle differentiation are available. We reported here that the expression of the H3-K9 methyltransferase Suv39h1 was decreased during myoblast differentiation. Ectopic expression of Suv39h1 could inhibit myoblast differentiation, increasing H3-K9 methylation levels, whereas knockdown of Suv39h1 stimulated myoblast differentiation. Furthermore, Suv39h1 interacted with MEF2C directly and inhibited MEF2 transcription activity in a dose-dependent manner. Together, our studies revealed a molecular mechanism wherein Suv39h1 modulated myogenic gene expression and activation during skeletal muscle differentiation.

Keywords: epigenetic modiﬁcation; histone methylation; Suv39h1; protein interaction; MEF2; myoblasts differentiation

1. Introduction Skeletal muscle differentiation is a rigorous development program. Genetic regulation in skeletal muscle differentiation primarily occurs at the transcription level [1]. Two key transcription factor families: myogenic regulatory factors (MRFs) and myocyte enhancer factor 2 (MEF2), are involved in this program and are required to activate downstream myogenic gene expression during muscle differentiation [2]. The MRF family includes Myf5, Mrf4, MyoD and myogenin. As master regulators of skeletal muscle differentiation, the MRF family functions through myoblast determination (Myf5 and MyoD) and differentiation (myogenin and Mrf4) [3–5]. In vertebrates, the MEF2 family has four members: MEF2A, MEF2B, MEF2C, and MEF2D [6]. As a transcription cofactor without myogenic activity, MEF2 acts with MRFs, to activate and sustain the myogenic differentiation program [7]. Moreover, MEF2 could perpetuate the differentiation program by regulating myogenic basic helix-loop-helix (bHLH) gene expression [8]. Histone covalent modiﬁcation is an important epigenetic regulation mechanism that has essential function in chromatin structure regulation and gene expression. Histone methylation is one of these covalent modiﬁcations [9,10]. Histone deacetylases interact with MEF2 and repress myoblast differentiation [11,12]. Similar to

Int. J. Mol. Sci. 2016, 17, 1908; doi:10.3390/ijms17121908 www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2016, 17, 1908 2 of 16 Int. J. Mol. Sci. 2016, 17, 1908 2 of 16 modifications [9,10]. Histone deacetylases interact with MEF2 and repress myoblast differentiation [11,12]. Similar to histone deacetylation regulation, histone methylation also plays an important role histonein gene deacetylationexpression silencing. regulation, Histone histone H3 methylation lysine 9 (H3-K9) also plays methylation an important is the role most in genehighly expression studied, silencing.and it is Histone generally H3 lysineassociated 9 (H3-K9) with methylation gene repression, is the most X-chromosome highly studied, andinactivation, it is generally and associatedheterochromatin with gene remodeling repression, [13] X-chromosome. As mammalian inactivation, H3-K9-specific and heterochromatin methyltransferase, remodeling Suv39h1 [13]. Ascatalyzes mammalian di- and H3-K9-specific tri-methylation methyltransferase, of H3-K9 and interacts Suv39h1 catalyzeswith heterochromatin di- and tri-methylation protein 1 of(HP1) H3-K9 to andensure interacts transcription with heterochromatin silencing [14–16]. protein 1Suv39h (HP1)1 to ensureis associated transcription with silencingMyoD [and14–16 suppresses]. Suv39h1 isMyoD-dependent associated with MyoD myogenic and suppressesgene activity MyoD-dependent to inhibit myoblast myogenic differentiation gene activity [1]. to inhibit myoblast differentiationThe Mef2c [1 ].gene is specifically expressed in muscle tissues [17]. MEF2C could regulate expressionThe Mef2c of itselfgene and is specifically myogenin during expressed myogenesis in muscle [8]. tissues Myogenin [17]. MEF2C associates could with regulate MEF2D expression to recruit ofhistone itself andacetylases,myogenin whichduring alters myogenesis the chromatin [8]. Myogenin structure associates of late withmyogenic MEF2D genes to recruit to promote histone acetylases,myogenic differentiation which alters [18], the chromatinand myogenin structure drives of high late expression myogenic of genes myogenic to promote genes in myogenic this loose differentiationchromatin structure [18], and [19]. myogenin In undifferentiated drives high myob expressionlasts, H3-K9 of myogenic surrounding genes inthe this MEF2 loose binding chromatin site structureat the myogenin [19]. In gene undifferentiated regulatory region myoblasts, is highly H3-K9 meth surroundingylated [12]. theSuv39h1 MEF2 is binding known siteto repress at the myogenintranscriptiongene and regulatory play a regionrole in is regulating highly methylated myoblasts [12 ].differentiation Suv39h1 is known [1,20]. to repressIt is suggested transcription that andanother play histone a role inmodification regulating medi myoblastsates the differentiation MEF2-myogenin [1,20 interaction.]. It is suggested Therefore, that we another hypothesized histone modificationthat Suv39h1 mediates and the theassociated MEF2-myogenin methylation interaction. of H3-K9 Therefore, suppressed we hypothesizedMEF2-mediated that myogenic Suv39h1 anddifferentiation the associated by inhibiting methylation MEF2-dep of H3-K9endent suppressed target gene MEF2-mediated transcription. myogenic differentiation by inhibiting MEF2-dependent target gene transcription. 2. Results 2. Results

2.1.2.1. Suv39h1 Was DifferentiallyDifferentially ExpressedExpressed duringduring MyoblastsMyoblasts DifferentiationDifferentiation WeWe examinedexamined the potential potential change change in in Suv39h1 Suv39h1 expression expression during during C2C12 C2C12 cell cell differentiation. differentiation. As Asshown shown in inFigure Figure 1,1 the, the expression expression of of Suv39h1 Suv39h1 prot proteinein decreased decreased during C2C12 cellcell differentiation,differentiation, andand occurredoccurred inin parallelparallel withwith decreaseddecreased histonehistone methylationmethylation levelslevels andand increasedincreased histonehistone acetylationacetylation levels.levels. TheThe resultsresults revealedrevealed thethe differentialdifferential expressionexpression ofof Suv39h1Suv39h1 duringduring myoblastsmyoblasts differentiation,differentiation, suggestingsuggesting thatthat itit mightmight playplay aa rolerole inin skeletalskeletal musclemuscle differentiation.differentiation.

FigureFigure 1.1. Expression of Suv39h1Suv39h1 duringduring myoblastmyoblast differentiation.differentiation. C2C12 cells were culturedcultured inin differentiationdifferentiation mediummedium for for 0, 0, 6, 6, 12, 12, 24, 24, 36, 36, 48 48 and and 72 72 h. Westernh. Western blot blot analyses analyses were were performed performed with with cell extractscell extracts using using antibodies antibodies that recognized that recognized the indicated the indicated proteins. proteins.β-actin andβ-actin histone and H3 histone were usedH3 were as a loadingused as control.a loading control.

Int. J. Mol. Sci. 2016, 17, 1908 3 of 16 Int. J. Mol. Sci. 2016, 17, 1908 3 of 16

2.2.2.2. Suv39h1 InhibitedInhibited MyoblastMyoblast DifferentiationDifferentiation ToTo testtest thethe effecteffect ofof Suv39h1Suv39h1 onon musclemuscle differentiation,differentiation, wewe ectopicallyectopically expressedexpressed Suv39h1Suv39h1 inin C2C12C2C12 cells.cells. Cells were cultured in growthgrowth medium.medium. After transfection 48 h later, the cellscells werewere culturedcultured inin differentiationdifferentiation medium.medium. AsAs shownshown inin FigureFigure2 2A,A, ectopic ectopic expression expression of of Suv39h1 Suv39h1 appeared appeared toto blockblock C2C12C2C12 cellcell differentiation,differentiation, andand morphologicalmorphological differencesdifferences betweenbetween Suv39h1Suv39h1 andand thethe controlcontrol vectorvector transfectedtransfected cellscells werewere observed.observed. ComparedCompared withwith control,control, Suv39h1-transfectedSuv39h1-transfected C2C12C2C12 cellscells exhibitedexhibited reducedreduced myotubemyotube formation.formation. Myogenic cell proliferation and differentiationdifferentiation isis mutuallymutually exclusive.exclusive. When When cell cell differenti differentiationation begins, myogenic genes are expressed, and myoblastsmyoblasts areare withdrawalwithdrawal fromfrom thethe proliferationproliferation [[21].21]. Hence, we firstfirst tested the effecteffect ofof Suv39h1Suv39h1 onon myoblastmyoblast proliferation.proliferation. The The results results showed showed that that Suv39h1 Suv39h1 increased increased amount amount of ofC2C12 C2C12 cells cells in inG0/G G01/G-phase1-phase and andthe proliferation the proliferation index index of C2C12 of C2C12 cells was cells significantly was significantly reduced reduced compared compared with control with controlcells (Figure cells (Figure2B). EdU2B). (5-ethynyl-2 EdU (5-ethynyl-2′-deoxyuridine)0-deoxyuridine) staining staining assays assaysshowed showed that Suv39h1 that Suv39h1 might mightreduce reduce new DNA new DNAsynthesis synthesis in C2C12 in C2C12 cells cells(Figure (Figure 2C).2 C).Next, Next, we we anal analyzedyzed the the expression expression of of early early and latelate myogenicmyogenic markersmarkers inin Suv39h1-transfectedSuv39h1-transfected cells.cells. We alsoalso analyzedanalyzed thethe expressionexpression ofof myogenicmyogenic cofactorcofactor MEF2CMEF2C inin Suv39h1-transfectedSuv39h1-transfected cells.cells. As shownshown inin FigureFigure3 3,, epigenetic epigenetic changes changes were were noted noted in in differentiated differentiated C2C12C2C12 cells. Specifically, Specifically, the the acetylation acetylation level level decreased, decreased, whereas whereas the the methylation methylation level level increased increased in inSuv39h1-transfected Suv39h1-transfected cells. cells. The The expression expression of of my myogenicogenic differentiation differentiation markers markers was was repressed inin differentiateddifferentiated Suv39h1-transfectedSuv39h1-transfected cells. Unexpect Unexpectedly,edly, the expression of earlyearly andand latelate myogenicmyogenic markersmarkers inin proliferatingproliferating Suv39h1-transfected Suv39h1-transfected cells cells exhibited exhibited no no detectable detectable changes. changes. In addition, In addition, we didwe notdid detectnot anydetect changes any inchanges the expression in the ofexpression the early myogenic of the markerearly myogenicMyf5 in Suv39h1-transfected marker Myf5 in proliferatingSuv39h1-transfected and differentiated proliferating cells and (Figure differentiated S1). cells (Figure S1).

Figure 2. Cont.

Int. J. Mol. Sci. 2016, 17, 1908 4 of 16 Int. J. Mol. Sci. 2016, 17, 1908 4 of 16

Figure 2. Suv39h1 affects myoblast proliferation and differentiation. (A) Immunofluorescence (IF) analysisFigure 2. of Suv39h1 Suv39h1 affects in C2C12 myoblast cell differentiation. proliferation C2C12and differentiation. cells were transfected (A) Immunofluorescence with pIRES-Suv39h1 (IF) withanalysis a GFP of(green Suv39h1 fluorescent in C2C12 protein) cell differentiation. expression construct C2C12 orcells empty were vector transfected as a control with andpIRES-Suv39h1 maintained inwith differentiation a GFP (green medium fluorescent (2% HS (horseprotein) serum)) expressi afteron transfection construct foror 48empty h. Then, vector the cellsas a werecontrol stained and withmaintained anti-Cy3 in antibody differentiation which recognizedmedium (2% the HS primary (horse anti-MHC serum)) after (myosin transfection heavy chain) for 48 antibody h. Then, (Red) the aftercells differentiationwere stained with for eightanti-Cy3 days. antibody The red whic Cy3-stainedh recognized cells representedthe primary theanti-MHC level of (myosin MHC protein. heavy Westernchain) antibody blot analyses (Red) wereafter performeddifferentiation using for an eight anti-Suv39h1 days. The antibodyred Cy3-stai to testned Suv39h1cells represented expression. the βlevel-action of MHC was used protein. as a Western loading blot control; analyses (B) The were influence performed of Suv39h1using an overexpressionanti-Suv39h1 antibody on cell to cycle test phaseSuv39h1 of C2C12expression. cells. Afterβ-action transfection was used 48 h,as C2C12a loading cells werecontrol; detected (B) The by flowinfluence cytometry of Suv39h1 (FCM) andoverexpression the cell cycle on phase cell cycle was phase analyzed. of C2C12 Then, cells. the After differences transfection in cell 48 populations h, C2C12 cells and were proliferation detected indicesby flow between cytometry two (FCM) groups and were the displayed cell cycle by phas graph.e was The analyzed. proliferation Then, index the wasdifferences calculated in cell by populations and proliferation indices between two groups were displayed by graph. The (S + G2/M)/G0/1;(C) The influence of Suv39h1 on myoblast proliferation. C2C12 cells were transfected withproliferation pIRES-Suv39h1 index was or pEGFP-N1 calculated as by a control (S + G with2/M)/G a GFP0/1; (C expression) The influence and stained of Suv39h1 with EdU on reagents.myoblast Theproliferation. GFP-positive C2C12 cells cells (green) were presented transfected the cells with transfected pIRES-Suv39h1 with pIRES-Suv39h1 or pEGFP-N1 or as pEGFP-N1 a control vector.with a RedGFP EdU-stained expression and nuclei stained indicated with proliferating, EdU reagents. duplicating The GFP-positive nuclei. Bars cells represented (green) presented the mean the± cellsSD oftransfected three experiments. with pIRES-Suv39h1 The statistical significanceor pEGFP-N1 of the vector. differences Red values EdU-stained was analyzed nuclei by Student’sindicated tproliferating,-test; * p < 0.05; duplicating ** p < 0.01. nuclei. Bars represented the mean ± SD of three experiments. The statistical significance of the differences values was analyzed by Student’s t-test, * p < 0.05, ** p < 0.01.

Int. J. Mol. Sci. 2016, 17, 1908 5 of 16 Int. J. Mol. Sci. 2016, 17, 1908 5 of 16

Figure 3.3. Suv39h1Suv39h1 inhibited skeletal muscle differentiation. C2C12 C2C12 cells cells were transfected with pIRES-Suv39h1 or or empty empty vector vector as as a acontrol. control. Cells Cells were were transferred transferred to differe to differentiationntiation medium medium for the for indicatedthe indicated time, time, and andlevels levels of histone of histone modifications modifications (A); (Aand); andmyogenic myogenic differentiation differentiation proteins proteins (B) (wereB) were analyzed analyzed by Western by Western blot blotanalysis. analysis. β-actinβ-actin and andhistone histone H3 were H3 were used used as a loading as a loading control. control. The Thequantification quantification on Western on Western blot blotof in ofdicated indicated proteins proteins were were normalized normalized to β to-actin.β-actin. Bars Bars represented represented the meanthe mean ± SD± ofSD three of three experiments. experiments. The Thestatistical statistical sign significanceificance of the of differences the differences values values was was analyzed analyzed by Student’sby Student’s t-test,t-test, * p *< p0.05.< 0.05.

Int. J. Mol. Sci. 2016, 17, 1908 6 of 16

Int. J. Mol. Sci. 2016, 17, 1908 6 of 16 In addition, to confirm the aforementioned results, we knocked down endogenous Suv39h1 in C2C12In cells addition, using to confirm siRNAs. the Weaforementioned transfected resu siRNAlts, we against knocked Suv39h1 down endogenous (si-Suv39h1) Suv39h1 or control in siRNAC2C12 (NC) cells into using C2C12 siRNAs. cells. We After transfected eight dayssiRNA of against differentiation, Suv39h1 (si-Suv39h1) myotube numbers or control increased siRNA in Suv39h1(NC) into knock-down C2C12 cells. cells After (Figure eight4 daysA).Suv39h1 of differentiation, knock-down myotube did numbers not affect increased cellular in proliferation Suv39h1 (Figureknock-down4B). When cells C2C12 (Figure cells 4A). were Suv39h1 transfected knock-down with di thed not si-Suv39h1 affect cellular or NC proliferation as a control, (Figure epigenetic 4B). changesWhen were C2C12 noted cells were in differentiated transfected with C2C12 the si-Suv39 cells.h1 Specifically, or NC as a control, the acetylation epigenetic changes level increased, were whereasnoted the in methylation differentiated level C2C12 decreased cells. inSpecifically, Suv39h1 knock-down the acetylation C2C12 level cells increased, (Figure4 C).whereas Western the blot methylation level decreased in Suv39h1 knock-down C2C12 cells (Figure 4C). Western blot analyses analyses demonstrated a significant increase in MyoD, myogenin and MEF2C protein expression demonstrated a significant increase in MyoD, myogenin and MEF2C protein expression in in differentiated Suv39h1 knock-down cells, while the expression of MyoD, myogenin, and MEF2C differentiated Suv39h1 knock-down cells, while the expression of MyoD, myogenin, and MEF2C hadhad no detectableno detectable changes changes in proliferatingin proliferating Suv39h1 Suv39h1 abrogation abrogation cells cells (Figure (Figure4D). 4D). Together, Together, these these data implieddata thatimplied Suv39h1 that Suv39h1 had a role had ina role inhibiting in inhibiting the terminal the terminal differentiation differentiation of myoblasts.of myoblasts.

2.3.2.3. Suv39h1 Suv39h1 Directly Directly Interacted Interacted with with MEF2C MEF2C inin UndifferentiatedUndifferentiated Muscle Muscle Cells Cells PreviousPrevious studies studies demonstrate demonstrate that that MEF2 MEF2 potentially potentially recruits recruits a histonea histone methyltransferase methyltransferase to to bind targetbind gene target transcriptional gene transcriptional regions regions through thro theugh HP1-HDAC the HP1-HDAC complex complex [12]. We[12]. examined We examined whether Suv39h1whether interacted Suv39h1 with interacted MEF2 physicallywith MEF2 and physic affectedally and MEF2-mediated affected MEF2-mediated myogenic differentiation.myogenic Firstly,differentiation. we raised antibodies Firstly, we against raised Suv39h1,antibodies MEF2C,against Suv39h1, and HP1 αMEF2C,, and examined and HP1α endogenous, and examined protein locationendogenous during myoblastprotein differentiation.location during In bothmyoblast proliferating differentiation and differentiated. In both proliferating C2C12 cells, Suv39h1,and MEF2C,differentiated and HP1 C2C12α were cells, all localized Suv39h1, toMEF2C, the nucleus and HP1 atα indicated were all localized times (Figure to the 5nucleusA). Next, at indicated we applied mammaliantimes (Figure two 5A). hybrid Next, assays we applied to determine mammalian the interactiontwo hybrid betweenassays to Suv39h1determine andthe MEF2interactionin vivo . between Suv39h1 and MEF2 in vivo. As shown in Figure 5B, the experiments clearly showed that As shown in Figure5B, the experiments clearly showed that Suv39h1 interacted with MEF2C in Suv39h1 interacted with MEF2C in undifferentiated C2C12 cells. We further confirmed the undifferentiated C2C12 cells. We further conﬁrmed the interaction between Suv39h1 and MEF2C by interaction between Suv39h1 and MEF2C by co-immunoprecipitation (IP; co-IP) experiments. Then, co-immunoprecipitationBHK-21 and C2C12 cells (IP; co-IP)were co-transfected experiments. Then,with Suv39h1 BHK-21 and and MEF2C C2C12 cellsexpression were co-transfectedplasmids, withseparately. Suv39h1 The and interaction MEF2C expression between Suv39h1 plasmids, and separately.MEF2C was Theobserved interaction in both betweenBHK-21 and Suv39h1 C2C12 and MEF2Ccells was(Figure observed 5C). Together, in both BHK-21 these data and suggested C2C12 cells that (Figure Suv39h15C). and Together, MEF2these physically data suggestedinteracted, that Suv39h1which and further MEF2 suggested physically that interacted, their interaction which furthercontributed suggested to the thatregulation their interaction of myogenic contributed gene to theexpression, regulation histone of myogenic methylation gene modification, expression, and histone myoblast methylation differentiation. modiﬁcation, Suv39h1 might and play myoblast a differentiation.regulatory role Suv39h1 through might modulation play a of regulatory MEF2. role through modulation of MEF2.

Figure 4. Cont.

Int. J. Mol. Sci. 2016, 17, 1908 7 of 16 Int. J. Mol. Sci. 2016, 17, 1908 7 of 16

FigureFigure 4. Knock-down 4. Knock-down of of Suv39h1 Suv39h1 stimulated stimulated skeletalskeletal muscle differentiation. differentiation. (A ()A C2C12) C2C12 cells cells were were transfected with siRNA against Suv39h1 (si-Suv39h1) with a fluorescent label (FAM) or control transfected with siRNA against Suv39h1 (si-Suv39h1) with a fluorescent label (FAM) or control siRNA siRNA (NC) as a control and maintained in differentiation medium (2% HS) after transfection for 30 (NC) as a control and maintained in differentiation medium (2% HS) after transfection for 30 h. The cells h. The cells were stained with anti-Cy3 antibody which was against the primary anti-MHC antibody were stained with anti-Cy3 antibody which was against the primary anti-MHC antibody (Red) after (Red) after differentiation for eight days. The red Cy3-stained cells presented the level of MHC differentiation for eight days. The red Cy3-stained cells presented the level of MHC protein. Western protein. Western blot analyses were performed using antibody that recognized the indicated blotproteins; analyses ( wereB) The performed influence usingof Suv39h1 antibody knock-down that recognized on the thecell indicatedcycle phase proteins; of C2C12 (B )cells. The influenceAfter of Suv39h1transfection knock-down 48 h, C2C12 on cells the were cell cycle detected phase by ofFCM, C2C12 and cells.the cell After cycle transfection phase was analyzed. 48 h, C2C12 Then, cells werethe detected differences by FCM, in cell and populations the cell cycle and phaseproliferatio wasn analyzed. indices between Then, thetwo differences groups were in displayed cell populations by andgraph proliferation. C2C12indices cells were between transfected two groupswith siRNA were agai displayednst Suv39h1 by graph. or NC. C2C12 Cells were cells weretransferred transfected to withdifferentiation siRNA against medium Suv39h1 for or the NC. indicated Cells were time, transferred and the levels to differentiation of histone modifications medium for the (C); indicated and time,myogenic and the differentiation levels of histone proteins modifications (D) were analyzed (C); and by myogenic Western blot. differentiation β-actin and histone proteins H3 ( Dwere) were analyzedused as by a Westernloading control. blot. β -actinThe quan andtification histone on H3 Western were used blot asof indicated a loading proteins control. were The normalized quantification on Westernto β-actin. blot Bars of indicatedrepresent the proteins mean were± SD normalizedof three experi to ments.β-actin. The Bars statistical represent significance the mean of± theSD of threedifferences experiments. values The was statistical analyzed significance by Student’s of t-test, the differences * p < 0.05, ** values p < 0.01. was analyzed by Student’s t-test, * p < 0.05; ** p < 0.01.

Int. J. Mol. Sci. 2016, 17, 1908 8 of 16 Int. J. Mol. Sci. 2016, 17, 1908 8 of 16

Figure 5. Suv39h1 and MEF2C interacted in vitro and in vivo. (A) Locating of Suv39h1, HP1α, and Figure 5. Suv39h1 and MEF2C interacted in vitro and in vivo.(A) Locating of Suv39h1, HP1α, MEF2C in C2C12 cells during differentiation. The red TRITC (rhodamine) and green FITC and MEF2C(fluorescein in C2C12isothiocyanate) cells during antibodies differentiation. were against The anti-Suv39h1, red TRITC anti-HP1, (rhodamine) and andanti-MEF2C green FITC (fluoresceinantibodies isothiocyanate) as indicated, respectively. antibodies Red were TRIT againstC- or anti-Suv39h1,green FITC-stained anti-HP1, cells represented and anti-MEF2C the antibodiesindicated as indicated, proteins respectively.at indicated Redtime; TRITC- (B) Plasmids, or green including FITC-stained reporter cells representedplasmid pG the5luc indicatedwere proteinsco-transfected at indicated into time; C2C12 (B )cells. Plasmids, Then, cells including were separately reporter maintained plasmid pG in5luc growthwere medium co-transfected (GM) or into C2C12differentiation cells. Then, medium cells were (DM). separately The luciferase maintained activity was in growthmeasured medium 48 h after (GM) transfection. or differentiation Firefly mediumluciferase (DM). levels The were luciferase normalized activity against was Renilla measured luciferase 48 levels. h after Bars transfection. represent the Fireflymean ± luciferaseSD of levelsthree were experiments. normalized The against statistical Renilla significance luciferase of the levels. differences Bars values represent was theanalyzed mean by± Student’sSD of three experiments.t-test, * p The< 0.05, statistical ** p < 0.01; significance (C) BHK-21 of theand differences C2C12 cells values were co-transfected was analyzed with by Student’sMyc-taggedt-test, Suv39h1 and/or HA-tagged MEF2C as indicated; Top: Suv39h1 proteins were immunoprecipitated * p < 0.05; ** p < 0.01;(C) BHK-21 and C2C12 cells were co-transfected with Myc-tagged Suv39h1 with anti-Myc antibodies, and anti-HA antibodies were used to detect the presence of MEF2C and/or HA-tagged MEF2C as indicated; Top: Suv39h1 proteins were immunoprecipitated with proteins in the immunoprecipitates by Western blot analysis. Anti-Myc antibodies was used as anti-Myc antibodies, and anti-HA antibodies were used to detect the presence of MEF2C proteins in control to detect the presence of Suv39h1 proteins; Bottom: Ten percent of cell extracts were the immunoprecipitatesimmunoblotted to detect by Westernthe presence blot of analysis. Suv39h1 Anti-Mycand MEF2C antibodies proteins. was used as control to detect the presence of Suv39h1 proteins; Bottom: Ten percent of cell extracts were immunoblotted to detect the presence of Suv39h1 and MEF2C proteins.

Int.Int. J. J. Mol. Mol. Sci. Sci.2016 2016,,17 17,, 1908 1908 99 of of 16 16

2.4. Suv39h1 Suppressed MEF2-Dependent Transcription 2.4. Suv39h1 Suppressed MEF2-Dependent Transcription Next, we tested whether Suv39h1 could affect MEF2-dependent transactivation. As reported, as a histoneNext, methyltransferase, we tested whether Suv39h1Suv39h1 couldcatalyzes affect H3-K9me MEF2-dependent2 and H3-K9me transactivation.3, which associate As reported, with asHP1 a histoneto influence methyltransferase, gene expression Suv39h1 [22,23]. catalyzes Then, we H3-K9me co-transfected2 and H3-K9me C2C12 3cells, which with associate a luciferase with reporter HP1 to inﬂuenceunder three gene repeats expression of a consensus [22,23]. Then, MEF2 we binding co-transfected site and C2C12 a MEF2C cells expression with a luciferase vector reporter along with under (or threewithout) repeats different of a consensus amounts MEF2 of Suv39h1 binding and site andHP1 aα MEF2C expression expression vectors. vector Co-transfection along with (or of without)Suv39h1 differenthad an amountsobvious ofeffect Suv39h1 on andthe HP1expressionα expression of a vectors.MEF2C-activated Co-transfection luciferase of Suv39h1 reporter had angene obvious in a effectdose-dependent on the expression manner. of aThe MEF2C-activated Suv39h1 inhibition luciferase effect reporterwas increased gene in by a dose-dependenta small amount manner.of HP1α The(Figure Suv39h1 6A). These inhibition data effectindicate was that increased Suv39h1 by potentially a small amount has the ofability HP1 αto (Figureinhibit 6MEF2-dependentA). These data indicatetarget thatgene Suv39h1 transactivation. potentially hasWestern the ability blot to inhibitexperiments MEF2-dependent were performed target gene to transactivation. confirm the Westernaforementioned blot experiments observations. were performedAs shown toin conﬁrmFigure the6A aforementionedright, the large observations.amount of Suv39h1 As shown could in Figurereduce6 Athe right, expression the large of amount MEF2C. of Whereas, Suv39h1 couldthe addition reduce of the HP1 expression with a ofsmall MEF2C. amount Whereas, (0.1 μg) the of additionSuv39h1 ofdid HP1 not with reduce a small the amount expression (0.1 µ ofg) ofMEF2 Suv39h1C, suggesting did not reduce that HP the1 expression could be ofcapable MEF2C, of suggestingrepressing the that MEF2C HP1 could target be gene. capable The results of repressing showed the that MEF2C Suv39h1 target inhibits gene. MEF2-dependent The results showed target thatgene Suv39h1 transactivation inhibits MEF2-dependentvia suppressing the target expression gene transactivation of MEF2C and via HP1 suppressingα enhances the expressionthe inhibitory of MEF2Caction of and Suv39h1 HP1α toenhances MEF2-dependent the inhibitory target action gene ofin Suv39h1an independent to MEF2-dependent regulation manner target (Figure gene in 6A). an independentPrevious studies regulation showed manner that (Figurethe di-6 A).and Previous tri-met studieshylation showed of H3-K9 that themarks di- andare tri-methylationenriched at the oftranscriptional H3-K9 marks region are enriched of silenced at the genes transcriptional [24]. The expression region of of silenced myogenin genes is induced [24]. The during expression myoblast of myogenindifferentiation,is induced and the during transcription myoblast region differentiation, of the myogenin and the gene transcription is regulated region by MEF2 of the [25].myogenin Next, genewe performed is regulated additional by MEF2 independent [25]. Next, we experiments performed to additional assess whether independent di-/tri-methylation experiments toof assessH3-K9 whetherenriched di-/tri-methylation at the transcription of of H3-K9 the myogenin enriched gene at the was transcription catalyzed ofbythe Suv39h1.myogenin Wegene transfected was catalyzed C2C12 bycells Suv39h1. with an We expression transfected plasmid C2C12 encoding cells with Suv39h an expression1. The results plasmid from encoding chromatin Suv39h1. IP (ChIP) The results assays fromshowed chromatin that Suv39h1 IP (ChIP) induced assays showedH3-K9 methylation that Suv39h1 at induced the regulatory H3-K9 methylation region of myogenin at the regulatory gene in regionundifferentiated of myogenin andgene differentiated in undifferentiated C2C12 cells and (Fig differentiatedure 6B). Furthermore, C2C12 cells qRT-PCR (Figure6B). analysis Furthermore, showed qRT-PCRthat the analysisexpression showed of thatmyogenin the expression was repressed of myogenin in Suv39h1-transfectedwas repressed in Suv39h1-transfected proliferative and proliferativedifferentiated and cells differentiated (Figure 6C). cells Taken (Figure together6C). Taken, we together, postulated we postulated that MEF2 that binds MEF2 to binds muscle to muscledifferentiation differentiation genes genesat their at theirregulatory regulatory regions regions (such (such as asmyogeninmyogenin) to) to activate activate gene gene expression,expression, whereaswhereas this this muscle muscle differentiation differentiation process process was was inhibited inhibited by by Suv39h1. Suv39h1.

Figure 6. Cont.

Int. J. Mol. Sci. 2016, 17, 1908 10 of 16 Int. J. Mol. Sci. 2016, 17, 1908 10 of 16

FigureFigure 6. 6.Suv39h1 Suv39h1 inhibited inhibited MEF2 MEF2 target targ geneet gene transactivation. transactivation. (A ()A C2C12) C2C12 cells cells were were transiently transiently transfectedtransfected with with expression expression vectors vectors for for Suv39h1 Suv39h1 (0.1 (0.1 to to 0.6 0.6µ g),μg), MEF2C MEF2C (0.2 (0.2µ μg),g), HP1HP1αα (0.1(0.1 µμg),g), a × µ a MEF2-dependentMEF2-dependent reporterreporter plasmid plasmid (3 (3×MEF2-luciferase MEF2-luciferase reporter reporter plasmid; plasmid; 0.1 0.1 g),μg), and and a pRL-TKa pRL-TK µ reporterreporter (0.04 (0.04g) μ tog) controlto control for for the the differences differences in transfectionin transfection efficiency. efficiency. Firefly Firefly luciferase luciferase levels levels were were normalized against Renilla luciferase levels. Bars represented the mean ± SD of three experiments. normalized against Renilla luciferase levels. Bars represented the mean ± SD of three experiments. The statistical significance of the differences values was analyzed by Student’s t-test, ** p < 0.01. Western The statistical significance of the differences values was analyzed by Student’s t-test, ** p < 0.01. blot analyses were performed using antibody that recognized the indicated proteins. β-actin was used Western blot analyses were performed using antibody that recognized the indicated proteins. β-actin as a loading control; (B) C2C12 cells were transfected with pIRES-Suv39h1 or empty vector as a was used as a loading control; (B) C2C12 cells were transfected with pIRES-Suv39h1 or empty vector control. Cells were transferred to differentiation medium for the indicated time. ChIP assays were as a control. Cells were transferred to differentiation medium for the indicated time. ChIP assays performed at differentiation 0 and 72 h on the myogenin promoter. Increased H3-K9me2/3 was apparent were performed at differentiation 0 and 72 h on the myogenin promoter. Increased H3-K9me2/3 was in Suv39h1 cells at both stages. DNA isolated from immunoprecipitated material was amplified by apparent in Suv39h1 cells at both stages. DNA isolated from immunoprecipitated material was qRT-PCR. Total chromatin was used as the input. The results were normalized against input and amplified by qRT-PCR. Total chromatin was used as the input. The results were normalized against GAPDH. Bars represented the mean ± SD of three experiments. The statistical significance of the input and GAPDH. Bars represented the mean ± SD of three experiments. The statistical significance differences values was analyzed by the Student’s t-test, * p < 0.05; (C) C2C12 cells were transfected with of the differences values was analyzed by the Student’s t-test, * p < 0.05; (C) C2C12 cells were pIRES-Suv39h1 or empty vector as a control. Cells were transferred to differentiation medium for the transfected with pIRES-Suv39h1 or empty vector as a control. Cells were transferred to indicated time, and expression of myogenin was analyzed by qRT–PCR. The results were normalized differentiation medium for the indicated time, and expression of myogenin was analyzed by qRT– against β-actin. Bars represented the mean ± SD of three experiments. The statistical significance of the PCR. The results were normalized against β-actin. Bars represented the mean ± SD of three differences values was analyzed by Student’s t-test, ** p < 0.01. experiments. The statistical significance of the differences values was analyzed by Student’s t-test, ** p < 0.01. 2.5. HP1α Suppressed MEF2C Transcription 2.5.Our HP1 resultsα Suppressed established MEF2C that Transcription Suv39h1 inhibits of MEF2-dependent reporter gene via suppressing MEF2COur expression results established (Figure6A). that In Suv39h1 addition, inhibits Suv39h1 of MEF2-dependent and MEF2C physically reporter interact gene via (Figure suppressing5). WeMEF2C therefore expression investigated (Figure whether 6A). In Suv39h1addition, wasSuv39h1 required and MEF2C to regulate physically MEF2C interact at the (Figure regulatory 5). We 0 regions.therefore We investigated isolated a 2330whether bp regionSuv39h1 containing was required 5 -flanking to regulate region MEF2C of the at pigthe regulatoryMef2c gene regions. and detectedWe isolated a HP1 a binding2330 bp siteregion in Mef2c containingpromoter 5′-flanking usingTESS region software of the pig (available Mef2c gene online: and http://www. detected a HP1 cbil.upenn.edu/tess/binding site in Mef2c). promoter Unexpectedly, using TESS we did software not detect (available a Suv39h1-binding online: http://www.cbil.upenn.edu/tess/). site in Mef2c promoter. However,Unexpectedly, transcriptional we did activity not detect of the Mef2ca Suv39h1-bindingpromoter was repressedsite in byMef2c Suv39h1 promoter. in C2C12 However, cells, α andtranscriptional overexpression activity of HP1 ofappeared the Mef2c to markedlypromoter repress was repressedMef2c activity by Suv39h1 (Figure7A). in ConsistentC2C12 cells, with and Mef2coverexpressiontranscription of activity, HP1α appeared the Mef2c toexpression markedly levelrepress was Mef2c decreased activity in (Figure Suv39h1-transfected 7A). Consistent cells with α α andMef2c HP1 transcription-transfected cellsactivity, (Figure the7 Mef2cB). Mutant expression and ChIP level assays was showeddecreased that in HP1 Suv39h1-transfectedwas bound to the cells Mef2candpromoter HP1α-transfected (Figure7 C–E).cells (Figure Our results 7B). Mutant suggested and that ChIP Suv39h1 assays affectedshowed Mef2cthat HP1geneα was expression bound to α indirectly,the Mef2c whereas promoter HP1 (Figureaffected 7C–E).Mef2c geneOur expressionresults suggested directly. that Suv39h1 affected Mef2c gene expression indirectly, whereas HP1α affected Mef2c gene expression directly.

Int. J. Mol. Sci. 2016, 17, 1908 11 of 16 Int. J. Mol. Sci. 2016, 17, 1908 11 of 16

α Figure 7. Inhibition of MEF2 transcriptional activity by Suv39h1 and HP1 .(A) C2C12 cells were transiently co-transfected with expression vectors for Suv39h1 or HP1α and Mef2c promoter vector. FireflyFigure luciferase 7. Inhibition levels of were MEF2 normalized transcription againstal activity Renilla luciferaseby Suv39h1 levels. and Bars HP1 representα. (A) C2C12 the mean cells± wereSD oftransiently three experiments. co-transfected The statisticalwith expression significance vectors of thefor differencesSuv39h1 or valuesHP1α and was Mef2c analyzed promoter by Student’s vector. t-test,Firefly * pluciferase< 0.05; ** levelsp < 0.01; were (B )normalized C2C12 cells against were transfected Renilla luciferase with expression levels. Bars vectors represent for Suv39h1 the mean or ± HP1SD αof, andthree the experiments. expression of TheMef2c statisticalwas analyzed signific byance qRT–PCR. of the Thedifferences results werevalues normalized was analyzed against by βStudent’s-actin. Bars t-test, represent * p < the0.05, mean ** p± < SD0.01; of three(B) C2C12 experiments. cells were The transfected statistical significance with expression of the differencesvectors for valuesSuv39h1 was or analyzed HP1α, and by Student’s the expressiont-test, *ofp

Int. J. Mol. Sci. 2016, 17, 1908 12 of 16

C2C12 cells showed a low differentiation level with reduced expression of myogenin and MHC. Ait-Si-Ali and co-workers believe that Suv39h is capable of silencing S-phase genes (cyclin D1 and A2) under low serum condition. Suv39h-depleted C2C12 cells were unable to silence S-phase genes, leading to a poor differentiation capacity. However, their data showed that “differentiating cells treated with Suv39 siRNA expressed little cyclin D1 and A2 under low serum condition”. There was a possibility that Suv39h1 up-regulated expression of cyclin D1 and A2 under low serum condition. In general, cyclins A and D1 were down-regulated upon myogenesis. A number of studies showed that overexpression of the cyclin D1, A or E could inhibit myogenic transcription [26], and this repression could be reversed by the cyclin-dependent kinase inhibitor p21 during myogenic differentiation [26]. Low serum triggers terminal differentiation in myoblasts [20]. In our studies, the myoblasts were culture in low serum to promote cell differentiation. Therefore, our data was inconsistent with Ait-Si-Ali et al [20]. In addition, the results of down-regulated of MHC by suv39h1 was supported by Mal [1]. Mal reported that Suv39h1 repressed myogenic gene expression and Suv39h-depleted C2C12 cells were able to express myogenin and MHC. Moreover, results of flow cytometry (FCM) showed that Suv39h1 arrested C2C12 cells in the G0/G1 phase of the cell cycle. Whereas, the opposite effect was not observed upon Suv39h1 knock down. Suv39h1 siRNA arrested C2C12 cells in the G2/M phase of the cell cycle, and neither of these affected the S phase of the cell cycle, which was involved in either DNA synthesis or cell cycle control [20]. In addition, we did not detect an opposite result from siRNA interference experiments as we expected that the proliferation index was not significantly increased in si-Suv39h1 transfected cells compared to the control cells. Moreover, the relationship between cycle control and cycle arrest was still unclear in this paper; this was also the shortcoming of this paper. Additionally, we only detected the effect of the cell population of G0/G1 phase caused by Suv39h1, and whether Suv39h affect proliferation was needed in order to detect the expression of cell cycle regulating genes. It was more complicated to find out whether the events of cell cycle exit and cell differentiation were separable [27]. Meanwhile, how to determinate the Suv39h1 as a cycle regulator to regulate cycle genes, played a role in regulating cell differentiation. These questions needed further study. Taken together, these results revealed distinct mechanisms for Suv39h regulating myoblast differentiation. Mouse embryogenesis studies indicated that MEF2C positively regulates its own expression [28], which is consistent with the auto-regulatory activity of Drosophila MEF2 [29]. As a MEF2C target gene, HDAC9 may associate with MEF2C, forming a negative-feedback loop that inhibits MEF2 and HDAC9 transcription and leads to the regulation of myogenic differentiation [30]. However, it is less clear how histone methyltransferases and MEF2C work together to influence myogenic gene expression. Suv39h1 associates with HP1 through tri-methylation H3-K9 [14]. A myogenesis study reported that Suv39h1 catalyzed H3-K9 methylation around the transcription region of myogenic differentiation genes [1]. Our observation indicated that Suv39h1 physically interacted with MEF2C and suppressed MEF2 target gene transactivation in a dose-dependent manner, and HP1 coordinated Suv39h1 to inhibit MEF2 target gene transactivation, whereas Western blot showed that HP1 did not coordinate Suv39h1 to down-regulate the expression of MEF2C. The studies of Zhang and colleagues showed that HP1 associated with MEF2-interacting transcription repressor (MITR) to silence MEF2 target gene, and the inhibitory action of HP1 also took place in a dose-dependent manner [12]. Hence, these data suggested that HP1 enhances the inhibitory action of Suv39h1 to MEF2-dependent target gene in an independent regulation manner. Moreover, HP1 represses Mef2c transcription activity and down-regulates Mef2c gene expression. We hypothesize that the interactions among MEF2C, HP1 and Suv39h1 might stabilize the chromatin repressive state; however, this notion must be confirmed with additional experiments. In summary, our findings provided insights for regarding Suv39h1 repression of myogenic gene expression and myoblast differentiation, in which Suv39h1 interacts with MEF2C to regulate skeletal muscle differentiation through sustaining H3-K9 methylation at the regulatory regions of myogenic differentiation genes. Int. J. Mol. Sci. 2016, 17, 1908 13 of 16

4. Materials and Methods

4.1. Plasmids Construction Expression plasmid pcDNA3.1-Mef2c and 3× MEF2-luciferase reporter construct, which contain three upstream tandem repeats of a MEF2 binding site sequence from the desmin gene, were kindly provided by Eric N. Olson. The Suv39h1 gene was ampliﬁed using SF1-SF3 primers (Table1). Then, the recombinant plasmids were separately digested with Xho I and EcoR I or Sal I and Not I, and ligated into the pIRES2-EGFP (BD Biosciences Clontech, Franklin Lakes, NJ, USA), pCMV-Myc (BD Biosciences Clontech), and pBIND vectors (Promega, Madison, WI, USA), separately.

Table 1. Primers used in in the construction of expression vectors of porcine Suv39h1.

Primer Name Primer Sequences (50–30) Size (bp) AT (◦C) SF1 CCGCTCGAGATGGCGGAAAATTTAAAAGGA SR1 GGAATTCCTAGAAGAGGTATTTGCGGCA G SF2 GAATTCATGGCGGAAAATTTAAAAGGAT 1239 68 SR2 CCCTGCGAGCTAGAAGAGGTATTTGCGGCA SF3 GCGTCGACgccgccaccATGGCGGAAAATTTAAAAGGAT SR3 TTGCGGCCGCCTAGAAGAGGTATTTGCGGCA MF1 GCGTCGACgccgccaccATGGGGAGAAAAAAGATT MR1 TTGCGGCCGCTCATGTTGCCCATCCTTCAG 1313 64 HF1 CTAGCTAGCATGGGAAAGAAAACCAA HR1 CCGCTCGAGTTAGCTCTTTGCTGTTTCTT G HF2 GAATTCATGGGAAAGAAAACCAA 576 68 HR2 CCGCTCGAGTTAGCTCTTTGCTGTTTCTT HF3 GCGTCGACgccgccaccATGGGAAAGAAAACCAA HR3 TTGCGGCCGCTTAGCTCTTTGCTGTTTCTT The Xho I site in SF1 and EcoR I site in SR1, the EcoR I site in SF2 and Xho I site in SR2, the Sal I site in SF3 and Not I site in SR3, the Sal I site in MF1 and Not I site in MR1, the Nhe I site in HF1 and Xho I site in HR1, the EcoR I site in HF2 and Xho I site in HR2, and the Sal I site in HF3 and Not I site in HR3 are underlined, respectively. The protective base pairs are presented in bold. The Kozak sequence is noted in italic.

The Mef2c gene was ampliﬁed using MF1 primers (Table1) designed according to the Sus scrofa Mef2c gene (accession number: NM001044540). Then, the recombinant plasmids were digested with Sal I and Not I, and ligated into the pCMV-HA (BD Biosciences Clontech), and pACT vectors (Promega), separately. The HP1α gene was ampliﬁed using HF1-HF3 primers (Table1). Then, the recombinant plasmids were digested with Nhe I and Xho I, and EcoR I and Xho I, or Sal I and Not I, and ligated into the pIRES2-EGFP, pCMV-HA, and pBIND vectors, respectively.

4.2. Cell Culture and Transfection Cells were passed into 24-well or six-well plates and were transfected with Lipofectamine 2000 reagent (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions 18 to 24 h after seeding. C2C12 myoblasts were cultured in growth medium (DMEM (Dulbecco’s modified Eagle’s medium) containing 10% foetal bovine serum) (Thermo Fisher Scientific). Cells were cultured in differentiation medium (DMEM containing 2% horse serum) (Thermo Fisher Scientific) after removing the growth medium for C2C12 myoblast differentiation. Cells were incubated at 37 ◦C in an atmosphere of 5% CO2/95% air.

4.3. Immunofluorescence (IF) and Co-Immunoprecipitation (Co-IP) Assays Coverslips were prepared in advance and placed in six-well plates. C2C12 myoblasts were seeded into the plates and fixed in 4% paraformaldehyde. The cell membranes were permeabilized in 0.1% (wt/vol) Triton X-100, and the cells were blocked in PBS (phosphate buffered saline) containing 3% BSA (bovine serum albumin) and stained with antibodies in PBS containing 3% BSA. Primary antibodies Int. J. Mol. Sci. 2016, 17, 1908 14 of 16 against Suv39h1 (Abcam, Cambridge, Cambridgeshire, UK), MEF2C (Abcam), HP1α (Abcam), and MHC (Abcam) were diluted at 1:500. Secondary fluorochrome-conjugated antibodies (Boster, Wuhan, China) were diluted at 1:64. DAPI (diamidino-phenyl-indole) was used as the nuclear counterstain. Cells were washed three times in PBS, scraped from 10 mm2 culture dishes and suspended in NP40 cell lysis buffer. Cell lysates were incubated on ice by repeated pipetting for 30 min and centrifugation in a microfuge for 10 min at 13,000× g, at 4 ◦C. For co-immunoprecipitations, antibodies (2 µg anti-Myc, MilliporeSigma, Billerica, MA, USA) were incubated with 500 µL of cell extract supernatant overnight at 4 ◦C. Then, this immune complex was immobilized on 20 µL protein A/G agarose (Thermo Fisher Scientific) and incubated for 2 h at 4 ◦C. The immunoprecipitates were washed thrice in wash buffer, eluted in 20 µL elution buffer and analyzed by Western blot.

4.4. Chromatin Immunoprecipitation (ChIP) Assays ChIP assays was performed as previously described [31] using 1 µg IgG (normal rabbit or mouse, Beyotime, Shanghai, China) or antibodies against HP1α (Abcam) and di/tri-methylated H3-K9 (Cell Signaling Technology, Danvers, MA, USA). The primers used in ChIP PCR included HP1 forward, 50-CACCCAAGCCGGGAGAAACAGCC-30, and reverse, 50-GTGAATCAGACAGC CTCC-30; myogenin forward [11], 50-GAATCACATGTAATCCACTGGA-30, and reverse, 50-ACG CCAACTGCTGGGTGCCA-30; GAPDH forward, 50-GCTCTCTGCTCCTCCCTGTT-30, and reverse, 50-CAATCTCCACTTTGCCACTGC-30.

4.5. RNA Interference Double-stranded small interfering RNAs (siRNAs) targeting Suv39h1 were obtained from genepharma (Shanghai, China). C2C12 cells were transfected with negative control (NC) or Suv39h1 siRNAs according to the manufacturer’s instruction. Cells were cultured in growth medium for 30 h after transfection and then switched to differentiation medium.

4.6. Western Blot and Quantitative Real-Time PCR (qRT-PCR) Protein samples were analyzed by 5%–12% acrylamide gradient SDS-PAGE (SDS, sodium dodecyl sulfate; PAGE, polyacrylamide gel electrophoresis) gel and transferred to a PVDF (polyvinylidene fluoride) membrane in transfer buffer. The membrane was blocked in 5% skim milk and incubated overnight at 4 ◦C with the primary antibodies. Primary antibodies against HA (Cell Signaling Technology), Myc (MilliporeSigma), Myogenin (Abcam), MyoD (Santa Cruz Biotechnology, Santa Cruz, CA, USA), MEF2C (Abcam), Suv39h1 (Abcam), H3-K9me2/3 (Cell Signaling Technology), and Acetyl-Lys (Ac-K) (Cell Signaling Technology) were diluted at 1:1000. The appropriate secondary antibodies (Boster) recognized the primary antibodies and the membrane was visualized by using an ECL (enhanced chemiluminescence) kit (Thermo Fisher Scientific). Total RNA was extracted from measured samples by TRIzol reagent (Thermo Fisher Scientific). After purification, 1 µg RNA was used for reverse transcription with oligo (dt) primers. qRT-PCR was run by the LightCycler®480 II (Roche, Basel, Switzerland) using SYBR®Green Real-Time PCR Master Mix (Toyobo, Osaka, Japan). All PCRs were repeated in three experiments, and gene expression was corrected by the expression of β-actin using 2−44Ct value. Student’s t-test was used for statistical comparisons. A p-value < 0.05 indicated statistical significance. Primers used in the qRT-PCR are presented in Table2.

Table 2. The primers for real-time PCR.

Gene Primer Sequences (50–30) Size (bp) AT (◦C) Suv39h1 ACCTGTGCCGACTAGCCAAGCCACGCCACTTAACCAGGTA 136 60 Mef2c TGTGCGACTGTGAGATTGTCTCGTGCGGCTCGTTGT 123 59 β-actin GGCACCACACCTTCTACAATGGGGGTGTTGAAGGTCTCAAAC 133 60 Int. J. Mol. Sci. 2016, 17, 1908 15 of 16

5. Conclusions Our study helped to understand how histone methyltransferases control myogenenic gene expression during myoblast differentiation. Unexpectedly, we did not detect an opposite result from siRNA interference experiments, and our results were inconsistent with Ait-Si-Ali and co-workers. It was the shortcoming of this paper, and these questions needed further study. Next, we should investigate the molecular mechanism for the association of Suv39h1 with Rb/EF2 during myoblast differentiation under our laboratorial situation, which would happen at the G1/S phase transition. The present study has shown that Suv39h1 as a tumor suppressor of reducing rhabdomyosarcoma formation in zebraﬁsh [32], which could be used for cancer therapy. Since Suv39h1 also is involved in chromatin remodeling, cell lineage commitment, proliferation and differentiation [33], and inﬂuences cell cycle genes [20]. Thus, we suggest that Suv39h1 functions as key switch by modulating chromatin conformation, and controlling cell cycle progression, cell proliferation and differentiation. Moreover, studying Suv39h1 may have therapeutic value in further.

Supplementary Materials: Supplementary materials can be found at www.mdpi.com/1422-0067/17/10/1908/s1. Acknowledgments: We are thankful to members of our laboratories for giving helpful suggestions about the manuscript writing and constructive discussion. This work was supported by National Science R&T Program (2013BAD20B00, 2011BAD28B01) and the Hubei province Technology Support Program (2014ABA025). Author Contributions: Wei Jin, Jian Peng and Siwen Jiang conceived and designed the experiments; Wei Jin performed the experiments; Wei Jin and Yangyang Shang analyzed the data; Siwen Jiang contributed reagents/materials/analysis tools; Wei Jin wrote the paper. Conﬂicts of Interest: The authors declare no conﬂict of interest.

References

1. Mal, A.K. Histone methyltransferase Suv39h1 represses MyoD-stimulated myogenic differentiation. EMBO J. 2006, 25, 3323–3334. [CrossRef][PubMed] 2. Dodou, E.; Xu, S.M.; Black, B.L. MEF2C is activated directly by myogenic basic helix-loop-helix proteins during skeletal muscle development in vivo. Mech. Dev. 2003, 120, 1021–1032. [CrossRef] 3. Olson, E.N.; Klein, W.H. bHLH factors in muscle development: Dead lines and commitments, what to leave in and what to leave out. Genes Dev. 1994, 8, 1–8. [CrossRef][PubMed] 4. Sabourin, L.A.; Rudnicki, M.A. The molecular regulation of myogenesis. Clin. Genet. 2000, 57, 16–25. [CrossRef][PubMed] 5. Tapscott, S.J. The circuitry of a master switch: Myod and the regulation of skeletal muscle gene transcription. Development 2005, 132, 2685–2695. [CrossRef][PubMed] 6. Black, B.L.; Olson, E.N. Transcriptional control of muscle development by myocyte enhancer factor-2 (MEF2) proteins. Annu. Rev. Cell Dev. Biol. 1998, 14, 167–196. [CrossRef][PubMed] 7. Molkentin, J.D.; Black, B.L.; Martin, J.F.; Olson, E.N. Cooperative activation of muscle gene expression by MEF2 and myogenic bHLH proteins. Cell 1995, 83, 1125–1136. [CrossRef] 8. Potthoff, M.J.; Olson, E.N. MEF2: A central regulator of diverse developmental programs. Development 2007, 134, 4131–4140. [CrossRef][PubMed] 9. Kouzarides, T. Chromatin modiﬁcations and their function. Cell 2007, 128, 693–705. [CrossRef][PubMed] 10. Krishnan, S.; Horowitz, S.; Trievel, R.C. Structure and function of histone H3 lysine 9 methyltransferases and demethylases. Chembiochem. 2011, 12, 254–263. [CrossRef][PubMed] 11. Lu, J.; McKinsey, T.A.; Zhang, C.L.; Olson, E.N. Regulation of skeletal myogenesis by association of the MEF2 transcription factor with class II histone deacetylases. Mol. Cell 2000, 6, 233–244. [CrossRef] 12. Zhang, C.L.; McKinsey, T.A.; Olson, E.N. Association of class II histone deacetylases with heterochromatin protein 1: Potential role for histone methylation in control of muscle differentiation. Mol. Cell. Biol. 2002, 22, 7302–7312. [CrossRef][PubMed] 13. Martin, C.; Zhang, Y. The diverse functions of histone lysine methylation. Nat. Rev. Mol. Cell Biol. 2005, 6, 838–849. [CrossRef][PubMed] 14. Lachner, M.; O’Carroll, D.; Rea, S.; Mechtler, K.; Jenuwein, T. Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins. Nature 2001, 410, 116–120. [CrossRef][PubMed] Int. J. Mol. Sci. 2016, 17, 1908 16 of 16

15. Lachner, M.; Jenuwein, T. The many faces of histone lysine methylation. Curr. Opin. Cell Biol. 2002, 14, 286–298. [CrossRef] 16. Esteve, P.O.; Patnaik, D.; Chin, H.G.; Benner, J.; Teitell, M.A.; Pradhan, S. Functional analysis of the N- and C-terminus of mammalian G9a histone H3 methyltransferase. Nucleic Acids Res. 2005, 33, 3211–3223. [CrossRef][PubMed] 17. Yokoyama, S.; Asahara, H. The myogenic transcriptional network. Cell Mol. Life Sci. 2011, 68, 1843–1849. [CrossRef][PubMed] 18. Ohkawa, Y.; Marfella, C.G.; Imbalzano, A.N. Skeletal muscle speciﬁcation by myogenin and Mef2D via the SWI/SNF ATPase Brg1. EMBO J. 2006, 25, 490–501. [CrossRef][PubMed] 19. Singh, K.; Dilworth, F.J. Differential modulation of cell cycle progression distinguishes members of the myogenic regulatory factor family of transcription factors. FEBS J. 2013, 280, 3991–4003. [CrossRef][PubMed] 20. Ait-Si-Ali, S.; Guasconi, V.; Fritsch, L.; Yahi, H.; Sekhri, R.; Naguibneva, I.; Robin, P.; Cabon, F.; Polesskaya, A.; Harel-Bellan, A. A Suv39h-dependent mechanism for silencing S-phase genes in differentiating but not in cycling cells. EMBO J. 2004, 23, 605–615. [CrossRef][PubMed] 21. Battisti, V.; Pontis, J.; Boyarchuk, E.; Fritsch, L.; Robin, P.; Ait-Si-Ali, S.; Joliot, V. Unexpected distinct roles of the related histone H3 lysine 9 methyltransferases G9a and G9a-like protein in Myoblasts. J. Mol. Biol. 2016, 428, 2329–2343. [CrossRef][PubMed] 22. Schotta, G.; Ebert, A.; Reuter, G. SU(VAR)3-9 is a conserved key function in heterochromatic gene silencing. Genetica 2003, 117, 149–158. [CrossRef][PubMed] 23. Stewart, M.D.; Li, J.; Wong, J. Relationship between histone H3 lysine 9 methylation, transcription repression, and heterochromatin protein 1 recruitment. Mol. Cell. Biol. 2005, 25, 2525–2538. [CrossRef][PubMed] 24. Binda, O. On your histone mark, SET, methylate! Epigenetics 2013, 8, 457–463. [CrossRef][PubMed] 25. Cheng, T.C.; Wallace, M.C.; Merlie, J.P.; Olson, E.N. Separable regulatory elements governing myogenin transcription in mouse embryogenesis. Science 1993, 261, 215–218. [CrossRef][PubMed] 26. Walsh, K.; Perlman, H. Cell cycle exit upon myogenic differentiation. Curr. Opin. Genet. Dev. 1997, 7, 597–602. [CrossRef] 27. Buttitta, L.A.; Edgar, B.A. Mechanisms controlling cell cycle exit upon terminal differentiation. Curr. Opin. Cell Biol. 2007, 19, 697–704. [CrossRef][PubMed] 28. Wang, D.Z.; Valdez, M.R.; McAnally, J.; Richardson, J.; Olson, E.N. The Mef2c gene is a direct transcriptional target of myogenic bHLH and MEF2 proteins during skeletal muscle development. Development 2001, 128, 4623–4633. [PubMed] 29. Cripps, R.M.; Lovato, T.L.; Olson, E.N. Positive autoregulation of the Myocyte enhancer factor-2 myogenic control gene during somatic muscle development in Drosophila. Dev. Biol. 2004, 267, 536–547. [CrossRef] [PubMed] 30. Haberland, M.; Arnold, M.A.; McAnally, J.; Phan, D.; Kim, Y.; Olson, E.N. Regulation of HDAC9 gene expression by MEF2 establishes a negative-feedback loop in the transcriptional circuitry of muscle differentiation. Mol. Cell. Biol. 2007, 27, 518–525. [CrossRef][PubMed] 31. Tao, H.; Mei, S.; Zhang, X.; Peng, X.; Yang, J.; Zhu, L.; Zhou, J.; Wu, H.; Wang, L.; Hua, L.; et al. Transcription factor C/EBPβ and 17β-estradiol promote transcription of the porcine p53 gene. Int. J. Biochem. Cell Biol. 2014, 47, 76–82. [CrossRef][PubMed] 32. Albacker, C.E.; Storer, N.Y.; Langdon, E.M.; Dibiase, A.; Zhou, Y.; Langenau, D.M.; Zon, L.I. The histone methyltransferase SUV39H1 suppresses embryonal rhabdomyosarcoma formation in zebraﬁsh. PLoS ONE 2013, 8, e64969. [CrossRef][PubMed] 33. Zhang, Z.C.; Liu, Y.; Li, S.F.; Guo, L.; Zhao, Y.; Qian, S.W.; Wen, B.; Tang, Q.Q.; Li, X. Suv39h1 mediates AP-2α-dependent inhibition of C/EBPα expression during adipogenesis. Mol. Cell. Biol. 2014, 34, 2330–2338. [CrossRef][PubMed]

© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).