DOCSLIB.ORG

The Debate on the Golden Rice and Its Background

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Debate on the Golden Rice and Its Background The Debate on the Golden Rice and its Background A Literature Review Klaus Ammann, [email protected] Dedicated to the inventor and relentless promoter of Golden Rice, Ingo Potrykus Judge GM crops on their properties, not the technique used to make them – and we can start saving lives Editorial help: Vivian Moses, Patrick and Michael Moore 20140614 final (with additions from June 17) references with names and full text links for private use only Millions of children die worldwide every year, an untenable situation that is still worsening which needs immediate correction. According to the World Health Organization (WHO, 2013), an estimated 250 million preschool children are vitamin A deficient (= VAD) and it is likely that in VAD areas a substantial proportion of pregnant women are also affected in 2013. Earlier reports (UN SCN, et al., 2004) make evident that the problems are still growing: (in 2004: 140 million preschool children and more than 7 million pregnant women were suffering from VAD) 2 Preface It is not the intention of the author for this literature compilation on Golden Rice to replace the two websites www.goldenrice.org and www.allowgoldenricenow.org, they contain major information pieces, are well organized and specific information is easy to access. Rather it is the aim here to pull together a set of publications related to the background of the Golden Rice debate. We often are confronted with all kinds of determined opinions about the Golden Rice, Bio-Fortification, Transgenic Plants, Traditional and Organic Agriculture etc. and it is the purpose of this summary to shed light to the background of opinions pro and contra the Golden Rice – on how and why those opinions grow and how they are unfortunately melting down into simplistic slogans. The author hopes, that – reflecting the scientific and cultural background of this ardent debate - it will be possible to enhance mutual understanding. It is highly necessary to foster dialogue to overcome the deep divides, but fundamentalist views have no place here and will be dismantled. Mutual understanding cannot be achieved by deviating in a superficial way from the scientific foundations of knowledge and heritage in all kinds of natural and social sciences. Contents 1. Introduction ................................................................................................................................ 3 2. Innovation in Agriculture: a lot of ignorance, many misunderstandings, an analysis of dynamics and origins of the fake debate driven by fear. ................................................................... 5 3. Golden Rice and Genetic Engineering ......................................................................................... 9 3.1. Bio-Fortification ....................................................................................................................... 9 3.2. Golden Rice, the first and second generation ..................................................................... 9 4. Genomic Misconception: Conventional and GM crops are based on the same molecular processes........................................................................................................................................... 11 5. Eco-Activists and their political influence. ................................................................................ 13 6. Campaign AllowGoldenRiceNow as a successful counter reaction: ......................................... 16 7. Limits of high cost vitamin A supplementation, food fortification and breast feeding ............ 17 8. Success of better diet in the fight against VAD fails in connection with extreme poverty ..... 19 9. Sustainability, an often abused term – let’s go back to the original report ............................. 21 10. Arguments of opponents of the Golden Rice and its contradiction ..................................... 22 10. 1 Introduction ........................................................................................................................ 22 10.2. List of contradictions to false statements of activists against the Golden Rice............ 23 11. The wider field of the Golden Rice debate, a summary ....................................................... 27 12. Selection of slides for presentations on the topic of Golden Rice ........................................ 30 12.1. The slides following this text ............................................................................................... 30 12.2. Additional slides from other Golden Rice presentations: ............................................. 30 13. References ................................................................................................................................ 31 3 1. Introduction Vitamin A deficiency (VAD) and malnutrition: the connection has been known for centuries. A cure for night blindness with the sap of roast or cooked pressed ox liver applied directly to the eyes has been known since the Ebers medical papyrus 1550bc (Aykroyd, WR, 1944, Dianabuja & Creative Commons, 20100621, Maumenee, A, 1993, Wolf, G, 1978). About the Papyrus Ebers see also (Bryan C. & Ebers Georg, AGt, 1930, 1974, Dieleman, J, 2010, Ebers G. & Stern L.C., 1875, Ebers Georg, 1880, Fischer-Elfert Hans-Werner, 2005, Joachim Heinrich, 1890, Steuer, RO, 1961, von Klein Carl H., 1905, Westendorf, W, 1999). Figure 1: A page from the Ebers Papyrus from Leipzig. A cure of night blindness with the sap of pressed ox liver applied directly to the eyes has been known since the Ebers medicine papyrus 1550bc (Maumenee, A, 1993) 4 A clear connection between eye diseases and malnutrition was established by Parsons as early as 1908 (Parsons, JH, 1908), who also mentions the Ebers-Papyrus. More on the early developments on Vitamin perspectives in food in a latest review (Sommer, A, 2014). As early as 1933 and 1938 experiments linked night blindness to VAD (Hess, AF & Kirby, DB, 1933, Wald, G, et al., 1938). Today we know that in developing countries between 250,000 and 500,000 children become blind annually, and half of them die within 12 months of losing their sight Today we know that in developing countries between 250,000 and 500,000 children become blind annually, and half of them die within 12 months of losing their sight (Pettifor JM & Zlotkin S., 2004, WHO, 2009, WHO, 2013). Even more shocking is the fact that VAD leads to nutritionally acquired immune deficiency (Reifen, R, 2002, Semba R.D., 2004, Semba R.D., 2012). Much more studies have been done by A. Sommer and his lab, an extensive, recently an extensive sommary has been published: (Sommer, A, 2014)Consequently, providing vitamin A to all children in undernourished settings could prevent an estimated 1.9–2.7 million child deaths annually from otherwise survivable infectious diseases. (Dubock Adrian, 2013, Stein, AJ, et al., 2008, Tang, G, et al., 2012). Generally, it is hard to understand why the GM opponents are indulging into a veritable eco-imperialism, giving orders to people e.g. in Africa on how to organize their food production by excluding GM crops (Karembu Margaret, 20140603). It is worth noting that, with full medical care, a much greater number of children, ca. 6 million, could be rescued annually (Bryce, J, et al., 2005). But, unfortunately, for many years this has been and will be an illusionary scenario. Based on statistics from 2000, this would entail an annual cost from US$ 3.1 - 8 billion. These figures call for an introduction of Golden Rice without further delay (Wesseler, J & Zilberman, D, 2014, Wesseler, J, S. , et al., 2014) – the annual costs of delay in India alone have been estimated as US$ 199 million, based on about 1.4 million life years lost over the past decade - in India as an indicator. See also (Economic Times of India, 20140613, Miglani Sanjeev, 20140612, Sharma Aman & Bhavna Vi Aurora, 20140614). 5 2. Innovation in Agriculture: a lot of ignorance, many misunderstandings, an analysis of dynamics and origins of the fake debate driven by fear. In the present era of the western prosperity we have lost contact with global reality (Paarlberg, R, 2010, Paarlberg, RL, 2002). It is sad to see that as consumers and citizens from the wealthy countries we do not adapt our thinking to the economies of poor countries (FAO, 2009). The world is still confronted with persistent hunger epidemics, slavery and the abuse of the poor of all kinds, particularly children (UNICEF, 2012, UNICEF, et al., 2014), gigantic food waste (FAO, et al., 2013, Gustavsson, J, et al., 2011), endemic violence supported by shameless arms trafficking fostered by the well-equipped and virtually unregulated weapons industries of wealthy countries (Perlo- Freeman Sam & Solmirano Carina, 2014), the existence of eco-imperialist attitudes of rich countries in the developing world (Anderson, K, 2010, Morris, EJ, 2011) - an awkward list which could easily be expanded. Indeed, this inertia to take account of the realities of global politics and specific needs of developing countries should be reduced by the growing global knowledge with its steadily improving internet exchange. But instead of seeing chances for change, we are compensating the growing contrasts with a cultural pessimism by developing technophobia and basic resistance towards progress in the Western world (Ammann Klaus, 20121228). Strange pseudo-cultural tendencies develop alongside a romantic concept of nature from which humans should be excluded, a concept which leads to more conflicts and fewer
Load more

Recommended publications
  • Controlling Pregnancy: Fred Lyman Adair and the Influence of Eugenics on the Development of Prenatal Care
    Yale University EliScholar – A Digital Platform for Scholarly Publishing at Yale Yale Medicine Thesis Digital Library School of Medicine January 2019 Controlling Pregnancy: Fred Lyman Adair And The nflueI nce Of Eugenics On The evelopmeD nt Of Prenatal Care Florence Hsiao Follow this and additional works at: https://elischolar.library.yale.edu/ymtdl Recommended Citation Hsiao, Florence, "Controlling Pregnancy: Fred Lyman Adair And The nflueI nce Of Eugenics On The eD velopment Of Prenatal Care" (2019). Yale Medicine Thesis Digital Library. 3504. https://elischolar.library.yale.edu/ymtdl/3504 This Open Access Thesis is brought to you for free and open access by the School of Medicine at EliScholar – A Digital Platform for Scholarly Publishing at Yale. It has been accepted for inclusion in Yale Medicine Thesis Digital Library by an authorized administrator of EliScholar – A Digital Platform for Scholarly Publishing at Yale. For more information, please contact [email protected]. Controlling Pregnancy: Fred Lyman Adair and the Influence of Eugenics on the Development of Prenatal Care A Thesis Submitted to the Yale University School of Medicine In Partial Fulfillment of the Requirements for the Degree of Doctor of Medicine By Florence Hsiao Class of 2019 Abstract This thesis examines the development of prenatal care in the United States in the early 1900s by focusing on the life and career of Fred Lyman Adair who, as an obstetrician and eugenicist, played a significant role in shaping prenatal care into what it is today. Although prenatal care was a product of infant welfare activists and public health officials, obstetricians like Adair who struggled to establish obstetrics as a legitimate specialty, saw an opportunity in prenatal care to pathologize pregnancy and elevate their specialty.
    [Show full text]
  • An Overview: Innovation in Plant Breeding
    An Overview: Innovation in Plant Breeding Modern plant breeding blends traditional ways of developing crops with the latest in science and technology to achieve improved crops – enabling more choices for both farmers and consumers, and producing crops that can better cope with evolving pests, diseases and a changing climate. The Basics What: The simplest definition of plant breeding is crossing two plants Most of the fruits, vegetables, and to produce offspring that share the best characteristics of the two grains that we eat today are the parent plants. Breeders make crosses then select which offspring to advance in the pipeline based on their desired characteristics. result of generations of plant breeding. About 5,000 years ago, Why: Even the earliest farmers understood that, in order to survive, watermelons were only they needed plant varieties specifically adapted to their environmental conditions and cultivated to produce the best foods to nourish their 2 inches in diameter livestock and communities. and had a bitter taste, vastly How: Through generations of research and discovery, plant breeding has advanced beyond selecting a parent plant simply based on its different from appearance. It now includes an in-depth understanding of plants’ the large, genetic makeup, enabling breeders to better predict which plants will sweet-tasting have the highest probability of success in the field and the grocery fruit we enjoy store before making a cross. today. The Background The earliest farmers were plant breeders who understood the value of identifying crops that showed beneficial characteristics to plant in future seasons. Later, they learned they could cross two plants to develop an even better plant.
    [Show full text]
  • The Debate on the Golden Rice and Its Background
    The Debate on the Golden Rice and its Background A Literature Review Klaus Ammann, [email protected] Dedicated to the inventor and relentless promoter of Golden Rice, Ingo Potrykus Judge GM crops on their properties, not the technique used to make them – and we can start saving lives Editorial help: Vivian Moses, Patrick and Michael Moore 20140615 references numbered with full text links Millions of children die worldwide every year, an untenable situation that is still worsening which needs immediate correction. According to the World Health Organization (1), an estimated 250 million preschool children are vitamin A deficient (= VAD) and it is likely that in VAD areas a substantial proportion of pregnant women are also affected in 2013. Earlier reports (2) make evident that the problems are still growing: (in 2004: 140 million preschool children and more than 7 million pregnant women were suffering from VAD) 2 Preface It is not the intention of the author for this literature compilation on Golden Rice to replace the two websites www.goldenrice.org and www.allowgoldenricenow.org, they contain major information pieces, are well organized and specific information is easy to access. Rather it is the aim here to pull together a set of publications related to the background of the Golden Rice debate. We often are confronted with all kinds of determined opinions about the Golden Rice, Bio-Fortification, Transgenic Plants, Traditional and Organic Agriculture etc. and it is the purpose of this summary to shed light to the background of opinions pro and contra the Golden Rice – on how and why those opinions grow and how they are unfortunately melting down into simplistic slogans.
    [Show full text]
  • View Presentation
    Merck & Co Eli Lilly Bristol-Myers Squibb Novo Nordisk Pfizer GlaxoSmithKline Takeda Sanofi Novartis AstraZeneca Roche Otsuka Johnson & Johnson Otsuka Abbott Teva1 Amgen Daiichi Sankyo Bayer Boehringer Ingelheim Merck & Co Eli Lilly Bristol-Myers Squibb Novo Nordisk Pfizer GlaxoSmithKline Takeda Sanofi Novartis AstraZeneca Roche Otsuka Johnson & Johnson Otsuka Abbott Teva Amgen Daiichi Sankyo Bayer Boehringer Ingelheim Merck & Co Eli Lilly Bristol-Myers Squibb Novo Nordisk Pfizer GlaxoSmithKline Takeda Sanofi Novartis AstraZeneca Roche Otsuka Johnson & Johnson Otsuka Abbott Teva Amgen Daiichi Sankyo Bayer Boehringer Ingelheim Merck & Co Eli Lilly Bristol-Myers Squibb Novo Nordisk Pfizer GlaxoSmithKline Takeda Sanofi Novartis AstraZeneca Roche Otsuka Johnson & Johnson Otsuka Abbott Teva Amgen Daiichi Sankyo Bayer Boehringer Ingelheim Merck & Co Eli Lilly Bristol-Myers Squibb Novo Nordisk Pfizer GlaxoSmithKline Takeda Sanofi Novartis AstraZeneca Roche Otsuka Johnson & Johnson Otsuka Abbott Teva Amgen Daiichi Sankyo Bayer Boehringer Ingelheim Merck & Co Eli Lilly Bristol-Myers Squibb Novo Nordisk Pfizer GlaxoSmithKline Takeda Sanofi Novartis AstraZeneca Roche Otsuka Johnson & Johnson Otsuka Abbott Teva Amgen Daiichi Sankyo Bayer Boehringer Ingelheim Merck & Co Eli Lilly Bristol-Myers Squibb Novo Nordisk Pfizer GlaxoSmithKline Takeda Sanofi Novartis AstraZeneca Roche Otsuka Johnson & Johnson Otsuka Abbott Teva Amgen Daiichi Sankyo Bayer Boehringer Ingelheim Merck & Co Eli Lilly Bristol-Myers Squibb Novo Nordisk Pfizer GlaxoSmithKline Takeda
    [Show full text]
  • Bayer Cropscience Contaminates Our Rice
    Bayer e CropScience contaminates our rice greenpeace.org Campaigning for Sustainable Agricultur Greenpeace is an independent global campaigning organisation that acts to change attitudes and behaviour, to protect and conserve the environment and to promote peace. Contents A Contamination Nightmare 3 US Export markets impacted by GE contamination 4 Key dates in the LL rice scandals 5 The situation now 6 LL601 and other Bayer GE rice varieties 7 Should consumers be worried about eating LL rice? 7 Contamination threats 8 Bayer CropScience 9 Rice facts 9 Securing a Healthy Industry - Conclusion and Demands 10 End Notes 11 For more information contact: [email protected] JN 085 Published in October 2007 by Greenpeace International Ottho Heldringstraat 5 1066 AZ Amsterdam The Netherlands Tel: +31 20 7182000 Fax: +31 20 5148151 greenpeace.org Cover image: ©Greenpeace/Novis Bayer CropScience contaminates our rice The following is a summary of events Japan and Korea imposed equally strict testing requirements, surrounding one of the worst cases of genetic followed some months later by the Philippines when engineering contamination of food in history Greenpeace revealed contamination there. Russia and Bulgaria imposed bans on US rice and Mexico, Iraq and and one of the most damaging events in the Canada imposed test and certification requirements on history of the US rice industry. imports. The United Arab Emirates required a GE free guarantee. (5) The devastation has been caused by the multinational company Bayer CropScience - which maintains that the contamination As of July 2007, Greenpeace has identified 30 countries wasn't their fault - it was an 'act of God'.
    [Show full text]
  • (Genetically Modified Organisms (Plants) Genetically Engineered Plants)) Why Create Transgenic Plants?
    Transgenic Plants (Genetically modified organisms (plants) Genetically engineered plants)) Why create transgenic plants? When there is no naturally occurring genetic variation for the target trait. Examples: 1. Glyphosate herbicide resistance in soybean, corn 2.Vitamin A in rice 3.Blue roses What genes to transfer? 1. One gene to a few genes - the CP4 ESPS example 2. Multiple genes - Golden Rice and Applause rose 3. In principle, any gene (or genes) ORIGIN 1 cctttcctac tcactctgga caggaacagc tgtctgcagc cacgccgcgc ctgagtgagg 61 agaggcgtag gcaccagccg aggccaccca gcaaacatct atgctgactc tgaatgggcc 121 cagtcctccg gaacagctcc ggtagaagca gccaaagcct gtctgtccat ggcgggatgc 181 cgggagctgg agttgaccaa cggctccaat ggcggcttgg agttcaaccc tatgaaggag 241 tacatgatct tgagtgatgc gcagcagatc gctgtggcgg tgctgtgtac cctgatgggg 301 ctgctgagtg ccctggagaa cgtggctgtg ctctatctca tcctgtcctc gcagcggctc CP4 EPSPS: The gene conferring resistance to the herbicide Roundup The gene was found in Agrobacterium tumefaciens and transferred to various plants Coincidentally, this organism is also used for creating transgenic plants TGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAG ATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGA CGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGACAAG CTGACTCTAGCAGATCTTTCAAGAATGGCACAAATTAACAACATGGCACAAGGGATACAAACCCTTAATCCCAATTCCAATTTCCATAAACC CCAAGTTCCTAAATCTTCAAGTTTTCTTGTTTTTGGATCTAAAAAACTGAAAAATTCAGCAAATTCTATGTTGGTTTTGAAAAAAGATTCAATT
    [Show full text]
  • Agribusiness and Antitrust: the Bayer-Monsanto Merger, Its Legality, and Its Effect on the United States and European Union
    The Global Business Law Review Volume 7 Issue 1 Article 9 7-1-2018 Agribusiness and Antitrust: The Bayer-Monsanto Merger, Its Legality, and Its Effect on the United States and European Union Aleah Douglas Cleveland-Marshall College of Law Follow this and additional works at: https://engagedscholarship.csuohio.edu/gblr Part of the Antitrust and Trade Regulation Commons, and the Business Organizations Law Commons How does access to this work benefit ou?y Let us know! Recommended Citation Aleah Douglas, Agribusiness and Antitrust: The Bayer-Monsanto Merger, Its Legality, and Its Effect on the United States and European Union, 7 Global Bus. L. Rev. 156 (2018) available at https://engagedscholarship.csuohio.edu/gblr/vol7/iss1/9 This Note is brought to you for free and open access by the Journals at EngagedScholarship@CSU. It has been accepted for inclusion in The Global Business Law Review by an authorized editor of EngagedScholarship@CSU. For more information, please contact [email protected]. AGRIBUSINESS AND ANTITRUST: THE BAYER-MONSANTO MERGER, ITS LEGALITY, AND ITS EFFECT ON THE UNITED STATES AND EUROPEAN UNION ALEAH DOUGLAS I. INTRODUCTION……………………………………………………………………... 157 II. BACKGROUND…………………………………………………………………….....158 A. A Review of the Bayer-Monsanto Merger………………………….…………... 158 B. United States Antitrust Laws…………………………………………………… 161 1. The Applicable Laws……………………………………………………. 161 2. Problems and Antitrust Violations……………………………………… 166 3. American Agribusiness…………………………………………………. 167 C. European Union Antitrust Laws……………………………………………….. 172 1. The European Union……………………………………………………. 172 2. The Applicable Laws………………………………….………………… 172 3. Problems and Antitrust Violations……………………….………....…... 174 4. European Union Agribusiness…………….…………………………….. 176 D. Illegality and Detriment …………………………………….…………………. 178 III. CONCLUSION……………………………………………………………………....... 180 ABSTRACT This note examines the current and historical antitrust laws of the United States and the European Union as they relate to the currently pending merger between Bayer and Monsanto.
    [Show full text]
  • Which of the 'Following Is True for Golden Rice' ? (A) It Has Yellow Grains, Because of a Gene Introduced from a Primitive Varie
    NEET REVISION SERIES BIOTECHNOLOGY AND ITS APPLICATIONS Revise Most Important Questions to Crack NEET 2020 Download Doubtnut Now Q-1 - 10761395 Which of the 'following is true for Golden rice' ? (A) It has yellow grains, because of a gene introduced from a primitive variety of rice (B) It is Vitamin A enriched, with a gene from daffodil (C) It is pest resistant, with a gene from Bacillus thuringiensis (D) It is drought tolerant, developed using Agrobacterium vector CORRECT ANSWER: B SOLUTION: Gene for β carotene is taken from daffodil plant and inserted in normal rice plant to make golden rice Watch Video Solution On Doubtnut App Q-2 - 26089157 The first clinical gene therapy was done for the treatment of (A) AIDS (B) Cancer (C) Cystic fibrosis (D) SCID (Severe Combined lmmuno Deficiency) resulting from the deficiency of ADA. SOLUTION: The first clinical gene therapy was done for the treatment of SCID (Severe Combined) immuno Deficiency resulting from the deficiency of ADA. The SCID patient has a defectiv e gene for the enzyme Adenosine Deaminase (ADA). Due to which he/she lacks functional T-lymphocytes and therefore fails to fight the infecting pathogen. Watch Video Solution On Doubtnut App Q-3 - 10761356 What triggers activation of protoxin to active toxin of Bacillus thuringiensis in boll worm (A) Acidic pH of stomach (B) Body temperature (C) Moist surface of midgut (D) Alkaline pH of gut CORRECT ANSWER: D Watch Video Solution On Doubtnut App Q-4 - 18928062 Which of the flowing has the ability to transform normal cell into cancerous cell in animal (A) Arbovirus (B) Rotavirus (C) Enterovirus (D) Retrovirus CORRECT ANSWER: C Watch Video Solution On Doubtnut App Q-5 - 40481518 In nematode resistance by RNA interference, some specific genes were introduced which form dsRNA.
    [Show full text]
  • Case M.8851 – BASF / BAYER DIVESTMENT BUSINESS
    EUROPEAN COMMISSION DG Competition Case M.8851 – BASF / BAYER DIVESTMENT BUSINESS Only the English text is available and authentic. REGULATION (EC) No 139/2004 MERGER PROCEDURE Decision on the implementation of the commitments - Purchaser approval Date: 07/11/2018 EUROPEAN COMMISSION Brussels, 07.11.2018 C(2018) 7488 final PUBLIC VERSION In the published version of this decision, some information has been omitted pursuant to Article 17(2) of Council Regulation (EC) No 139/2004 concerning non-disclosure of business secrets and other confidential information. The omissions are shown thus […]. Where possible the information omitted has been replaced by ranges of figures or a general description. To the notifying party Dear Sir/Madam, Subject: Case M.8851 – BASF / Bayer Divestment Business Approval of Syngenta Crop Protection AG as purchaser of the [NSH line of research 1 remedy package], following your letter of 13 September 2018 and the Trustee’s opinion of 18 October 2018 FACTS AND PROCEDURE 1. By decision of 30 April 2018 (the "Decision") pursuant to Article 6(1)(b) in conjunction with Article 6(2) of Council Regulation (EC) No 139/2004 of 20 January 2004 on the control of concentrations between undertakings1 (the "Merger Regulation"), the Commission declared the acquisition of assets of Bayer Aktiengesellschaft (the "Bayer Divestment Business") by BASF SE ("BASF") compatible with the internal market subject to full compliance with the commitments submitted by BASF, which were annexed to the Decision (the "Commitments"). 2. In particular, pursuant to the Decision, the Commitments provide that in order to address the serious doubts raised by the combination of BASF's and the Bayer Divestment Business' activities in certain nematicide markets as well as in weed management innovation, BASF would divest (i) its Trunemco nematicide (the "Trunemco Assets") as well as, separately, (ii) a package of data and intellectual 1 OJ L 24, 29.01.2004, p.
    [Show full text]
  • The Bio Revolution: Innovations Transforming and Our Societies, Economies, Lives
    The Bio Revolution: Innovations transforming economies, societies, and our lives economies, societies, our and transforming Innovations Revolution: Bio The The Bio Revolution Innovations transforming economies, societies, and our lives May 2020 McKinsey Global Institute Since its founding in 1990, the McKinsey Global Institute (MGI) has sought to develop a deeper understanding of the evolving global economy. As the business and economics research arm of McKinsey & Company, MGI aims to help leaders in the commercial, public, and social sectors understand trends and forces shaping the global economy. MGI research combines the disciplines of economics and management, employing the analytical tools of economics with the insights of business leaders. Our “micro-to-macro” methodology examines microeconomic industry trends to better understand the broad macroeconomic forces affecting business strategy and public policy. MGI’s in-depth reports have covered more than 20 countries and 30 industries. Current research focuses on six themes: productivity and growth, natural resources, labor markets, the evolution of global financial markets, the economic impact of technology and innovation, and urbanization. Recent reports have assessed the digital economy, the impact of AI and automation on employment, physical climate risk, income inequal ity, the productivity puzzle, the economic benefits of tackling gender inequality, a new era of global competition, Chinese innovation, and digital and financial globalization. MGI is led by three McKinsey & Company senior partners: co-chairs James Manyika and Sven Smit, and director Jonathan Woetzel. Michael Chui, Susan Lund, Anu Madgavkar, Jan Mischke, Sree Ramaswamy, Jaana Remes, Jeongmin Seong, and Tilman Tacke are MGI partners, and Mekala Krishnan is an MGI senior fellow.
    [Show full text]
  • From Disagreements to Dialogue: Unpacking the Golden Rice Debate
    Sustainability Science https://doi.org/10.1007/s11625-018-0577-y REVIEW ARTICLE From disagreements to dialogue: unpacking the Golden Rice debate Annika J. Kettenburg1,2 · Jan Hanspach1 · David J. Abson1 · Joern Fischer1 Received: 20 May 2017 / Accepted: 4 May 2018 © The Author(s) 2018 Abstract Transgenic Golden Rice has been hailed as a practical solution to vitamin A deficiency, but has also been heavily criticized. To facilitate a balanced view on this polarized debate, we investigated existing arguments for and against Golden Rice from a sustainability science perspective. In a structured literature review of peer-reviewed publications on Golden Rice, we assessed to what extent 64 articles addressed 70 questions covering different aspects of sustainability. Using cluster analysis, we grouped the literature into two major branches, containing two clusters each. These clusters differed in the range and nature of the sustainability aspects addressed, disciplinary affiliation and overall evaluation of Golden Rice. The ‘biotechnological’ branch (clusters: ‘technical effectiveness’ and ‘advocacy’) was dominated by the natural sciences, focused on biophysi- cal plant-consumer interactions, and evaluated Golden Rice positively. In contrast, the ‘socio-systemic’ branch (clusters: ‘economic efficiency’ and ‘equity and holism’) was primarily comprised of social sciences, addressed a wider variety of sustainability aspects including participation, equity, ethics and biodiversity, and more often pointed to the shortcomings of Golden Rice. There were little to no integration efforts between the two branches, and highly polarized positions arose in the clusters on ‘advocacy’ and ‘equity and holism’. To explore this divide, we investigated the influences of disciplinary affiliations and personal values on the respective problem framings.
    [Show full text]
  • Askbio Announces IND for LION-101, a Novel Investigational AAV Gene
    AskBio Announces IND for LION-101, a Novel Investigational AAV Gene Therapy for the Treatment of Limb-Girdle Muscular Dystrophy Type 2I/R9 (LGMD2I/R9), Cleared to Proceed by U.S. FDA -- LGMD2I/R9 is a Rare Form of Muscular Dystrophy with No Approved Therapies – -- First-in-Human Phase 1/2 Clinical Study Expected to Begin Dosing in 1H 2022 – Research Triangle Park, N.C. – May 25, 2021 – Asklepios BioPharmaceutical, Inc. (AskBio), a wholly owned and independently operated subsidiary of Bayer AG, announced that the U.S. Food & Drug Administration (FDA) has cleared its Investigational New Drug (IND) application for LION-101 to proceed in a Phase 1/2 clinical study. LION-101 is a novel recombinant adeno-associated virus (rAAV) based vector being developed as a one-time intravenous infusion for the treatment of patients with Limb-Girdle Muscular Dystrophy Type 2I/R9 (LGMD2I/R9). LION-101 will be evaluated in a first-in-human Phase 1/2 multicenter study to evaluate a single intravenous (IV) infusion in adult and adolescent subjects with genotypically confirmed LGMD2I/R9. AskBio plans to initiate dosing for the LION-101 Phase 1/2 clinical study in the first half of 2022. “In preclinical mouse models, LION-101 therapy demonstrated both dose-dependent efficacy and tolerability, providing a clear approach to study this novel AAV vector in first-in-human trials,” said Katherine High, MD, President, Therapeutics, AskBio. “Currently there are no approved therapies for LGMD2I/R9, and with limited treatment options that only address symptoms of the disease, the patient burden is profound.
    [Show full text]