Azotobacter Vinelandii for the Production Of

Home , Azotobacter, Azotobacter vinelandii

GENETIC MANIPULATION AND CULTURING OF

AZOTOBACTER VINELANDII FOR THE PRODUCTION OF

NITROGENASE FOR USE IN PROTEIN-ENGINEERED

ELECTROCHEMICAL SYSTEMS

ROYCE D. DUDA

Submitted in partial fulfillment of the requirements for the degree

of Master of Science

Chemical and Biomolecular Engineering

CASE WESTERN RESERVE UNIVERSITY

August, 2018

CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES

We hereby approve the thesis/dissertation of Royce D. Duda candidate for the degree of Master of Science *. Committee Chair Prof. Julie Renner Committee Member Prof. Harihara Baskaran Committee Member Prof. Heidi Martin Date of Defense June 20, 2018

*We also certify that written approval has been obtained for any proprietary material contained therein.

Table of Contents

List of Tables ...... 4

List of Figures ...... 5

Acknowledgements ...... 7

Abstract ...... 9

Chapter 1: Introduction ...... 10

1-1 Importance of Ammonia Production, The Haber-Bosch Process, and

Electrochemical Ammonia Production ...... 11

1-2 Review of the Nitrogenase Enzyme ...... 14

1-3 Utilization of the Nitrogenase Enzyme in Photo- and Electrochemistry ...... 17

1-4 Challenges in the Modification of the Nitrogenase Enzyme in A. vinelandii ...... 19

Chapter 2: Experimental Methodology ...... 24

2-1 Culturing and Derepression of A. vinelandii ...... 24

2-2 Preparation of Nitrogenase ...... 25

2-3 Nitrogenase Acetylene Reduction Activity Assay ...... 28

2-4 Competence and Transformation into A. vinelandii ...... 30

2-5 Modification of the pCRISPR vector in E. coli ...... 33

Chapter 3: Preparation of MoFe Nitrogenase ...... 34

3-1 Derepression of the nifHDK operon in A. vinelandii ...... 34

3-2 MoFe Nitrogenase Purification ...... 36

Chapter 4: Incorporation of the CRISPR-Cas9 System into A. vinelandii ...... 41

4-1 Technical Approach ...... 41

4-2 Cloning Designed DNA Spacer into the pCRISPR Plasmid ...... 46

4-3 Transformation and Replication of the pCRISPR and pCas9 Plasmids into A.

vinelandii ...... 49

4-4 Conclusions and Future Work ...... 54

Chapter 5: Summary and Conclusions ...... 55

Appendices ...... 57

Appendix A: Widening Opportunities for Women in Science Program ...... 57

A-1 Introduction: Women in Stem Fields ...... 57

A-2 Biomolecular Cloning in Escherichia coli Curriculum for the WOWS

Program ...... 58

A-3 WOWS Survey Results ...... 59

Appendix B: WOWS Program Documents ...... 64

Appendix C: Azotobacter vinelandii and Nitrogenase Laboratory Manual ...... 76

Appendix D: A. vinelandii Genomic DNA Repair Fragment Sequence ...... 100

Appendix E: Cloning of CRISPR Spacer into pCRISPR Plasmid Sequencing

Results ...... 102

Bibliography ...... 111

List of Tables

Table 1-1 Basic components and functions of the nitrogenase enzyme. (p. 15)

Table 3-1 Gas chromatography results from the derepressed A. vinelandii acetylene reduction activity assay. (p. 35)

Table A-1 Schedule for the E. coli cloning curriculum for the WOWS program. (p. 59)

List of Figures

Figure 1-1 Representation of the nitrogenase enzyme and the electron-transfer pathway contained within. (p. 17)

Figure 1-2 Flowsheet demonstrating the overall steps toward creating a protein-engineered nitrogenase and the testing of this enzyme on an electrode surface. (p. 23)

Figure 2-1 Schematic of the glassware setup utilized for acetylene production. (p. 29)

Figure 2-2 (A) Growth of Azotobacter vinelandii cells on modified Burk agar plates containing NH4OAc. (B) Growth of iron and molybdenum-starved competent A. vinelandii. (p. 31)

Figure 3-1 SDS-PAGE gel confirming the purity of MoFe nitrogenase. (p. 37)

Figure 3-2 Calibration curve of the concentration of bovine serum albumin standards along with the concentration of the MoFe proteins determined by the Biuret method. (p. 39)

Figure 4-1 Methods used to immobilize MoFe nitrogenase onto an electrode surface including (A) with an immobilization polymer and (B) through the potential use of protein- engineered nitrogenase. (p. 43)

Figure 4-2 Mechanism of genetic modification in A. vinelandii with the pCRISPR-pCas9 system. (p. 45)

Figure 4-3 (A) Sequences of the location of interest of the pCRISPR plasmid and the pCRISPR spacer insert. (B) Cloning scheme for the insertion of the pCRISPR spacer into the digested pCRISPR plasmid. (p. 48)

Figure 4-4 Results of agarose gel electrophoresis showing (A) the full digestion of the pCRISPR plasmid and (B) incomplete digestion of the pCRISPR plasmid. (p. 49)

Figure 4-5 Growth of A. vinelandii cultures in chloramphenicol and kanamycin after transformation of pCRISPR and pCas9 plasmids. (p. 51)

Figure 4-6 Growth of A. vinelandii cultures in media containing varied concentrations of chloramphenicol. (p. 52)

Figure A-1 Average responses to survey questions by students in the WOWS Program from before and after participation in the program. (p. 60)

Figure A-2 Average responses to survey questions about career opportunities for chemical engineering majors by students in the WOWS Program from before and after participation in the program. (p. 61)

Figure A-3 Average responses to survey questions about the WOWS program by student participants after participation in the program. (p. 62)

Acknowledgements

I would like to express sincere gratitude to my advisor, Dr. Julie Renner, for her consistent support throughout the process of creating this document. Her patience, knowledge, and availability were instrumental to my completion of this thesis. I thank her for providing me the opportunity and resources to conduct research that helps to address some of the world’s most pressing challenges. I would also like to thank Dr. Heidi Martin and Dr. Harihara Baskaran for being on my thesis committee and for their suggestions and advisement during my time at Case Western. I also thank Dr. Mohan Sankaran for his assistance on the day of my thesis defense.

I would like to thank a large group of fellow graduate students, including Chuck

Loney, Zhiqiang Zhong, Zihang Su, Chul-Oong Kim, and Nuttanit Pramounmat who would always bring a smile to my face on even the most frustrating days. Students in other groups were also immensely helpful as well, including Joseph Toth and Ryan Hawtof, who were important in aiding me in collecting important data for this document.

I would like to thank some members of the Case Western Reserve University staff.

I would not have been able to purchase the necessary equipment for this work without

Jennifer Pyles and Nichole Thomas, and I would not have been able to set up the equipment without the help of Laurie Dudik and especially Bill Marx. I would also like to thank Evan

Guarr, who was very helpful in collecting data for this document.

I would like to thank Dr. Shelley Minteer, Dr. Ross Milton, and Rong Cai for their generosity in inviting me to learn from them. Without their knowledge and willingness to share, I would not have been able to prepare a thesis in this interesting field of research.

In addition to those who have helped me while at Case Western Reserve University,

I would like to thank the mentors who helped guide me to this point. I would like to thank

Professor B. Wayne Bequette and Professor Yuri Gorby for helping to cultivate my interest in research. Diana Prout and Donnamarie Vlieg were also mentors to me who helped nurture my curiosity and love of science and engineering, and for them I will always be grateful.

I thank my friends from outside Case Western as well, including Bradley Johnson and Ryan Jenkins, who together have an incredible ability to make me laugh and uplift my spirit even in times of exhaustion or great frustration.

Lastly, I would like to thank my entire family. My Uncles John Harrington, Royce

Duda, Chris Duda, and Cousins Patricia Liddle, Martin Helmer, and Marie Liddle have always been supportive of and have taken interest in my studies. I would like to thank my sister, Amy Duda, whose energy and cheerfulness brings an unending amount of joy into my life. The emotional support she has given me throughout graduate school has allowed me to reach this milestone. Finally, I thank my parents William and Joan Duda for their unending love and support through both my childhood and my pursuit of a graduate degree.

This thesis would have been impossible to complete without their constant love, support, and belief in me.

Genetic Manipulation and Culturing of Azotobacter vinelandii for the

Production of Nitrogenase for Use in Protein-Engineered

Electrochemical Systems

Abstract

ROYCE D. DUDA

The industrial production of ammonia is a vital but energy intensive process.

Promising alternatives to the costly Haber-Bosch process include the utilization of the enzyme nitrogenase in protein-engineered electrochemical systems. Preparation of pure molybdenum-dependent nitrogenase from the bacteria Azotobacter vinelandii is reported in this thesis. An attempt to incorporate the CRISPR-Cas9 system in A. vinelandii to streamline the process of genetic modification in A. vinelandii is also reported. Specifically, a technical approach was created to test the suitability of the pCRISPR-pCas9 system in A. vinelandii, and initial results are reported that provide evidence that the plasmid pCRISPR is suitable for replication within A. vinelandii. A curriculum featuring molecular cloning in Escherichia coli was developed for the Widening Opportunities for Women in Science

Program, and survey results from this program were analyzed to reveal that it was successful in heightening female high school students’ awareness and interest in chemical engineering.

Chapter 1: Introduction

The objectives of this thesis are (i) to replicate the work of laboratories already studying nitrogen fixation by expressing and purifying active nitrogenase for use in the

Renner Laboratory for studying electrochemical nitrogen fixation, and (ii) to develop a novel approach for manipulating the genome of the bacteria A. vinelandii through the application of the CRISPR-Cas9 to the organism. The development of a curriculum for outreach in the Widening Opportunities for Women in Science (WOWS) Program is also documented in the Appendices.

The structure of the following thesis is:

Chapter 1: Introduction and motivation behind this work.

Chapter 2: Experimental methodologies used in this work.

Chapter 3: Results and Discussion of the preparation of active nitrogenase.

Chapter 4: Results and Discussion of the incorporation of the CRISPR-Cas9 system

into A. vinelandii.

Chapter 5: Summary and Conclusions.

Appendices: Additional supplemental information is provided, including

documentation of outreach through the WOWS program.

1-1 Importance of Ammonia Production, The Haber-Bosch Process, and

Electrochemical Ammonia Production:

Nitrogen, the fourth most abundant element in cellular biomass, is essential for sustaining life. Although dinitrogen composes 79% of the Earth’s atmosphere, most organisms are unable to use this atmospheric dinitrogen as a nitrogen source due to its inert nature. Diazotrophic organisms, which fix atmospheric nitrogen into molecules such as ammonia (NH3) that can be metabolized by other organisms, constitute a vital link in the nitrogen cycle. Nitrogen fixation is also an important industrial process, and due to the high demand for fixed nitrogen sources, natural nitrogen fixation from geochemical and biological processes has needed to be augmented with industrial nitrogen fixation.

Ammonia is a critical molecule containing fixed nitrogen that has numerous industrial uses. Ammonia is used to synthesize a variety of chemicals ranging from urea and nitric acid to more complex pharmaceutical compounds, plastics, and resins.1, 2 Additionally, ammonia is utilized for more traditional applications in explosives and refrigerants and simultaneously exists as a potentially important sustainable fuel.2, 3 Despite its variety of industrial uses, approximately 80% of all artificially produced ammonia is consumed in fertilizers.2 The agricultural demands required to sustain a burgeoning human population has necessitated greatly augmenting naturally occurring nitrogen fixation with the production and distribution of ammonia in fertilizers. Today, approximately half of Earth’s human population is dependent on ammonia produced by industrial nitrogen fixation.4

The Haber-Bosch process, the main chemical process used to industrially fix nitrogen today, produces approximately 100 million metric tons of fixed nitrogen for fertilizer use every year.4 The Haber-Bosch process involves the reaction of dinitrogen and dihydrogen

11 gas over a catalyst at high temperatures of approximately 500°C and high pressures between 150 and 300 bar.5, 6 The high temperatures and pressures associated with this process along with the large amounts of molecular hydrogen required make the Haber-

Bosch process very energy-intensive. Over 1% of global energy is consumed annually by the Haber-Bosch process resulting in approximately 3% of global carbon dioxide emissions.1, 7 The molecular hydrogen used to feed the Haber-Bosch process is primarily produced from fossil fuels including coal and natural gas, which leads directly to the large carbon dioxide emissions associated with the process.8 Additionally, the high temperatures and pressures associated with the reaction precludes the Haber-Bosch process from running efficiently at low scales,8 requiring ammonia produced at centralized plants to be transported to its point-of-use and further increasing the energy demands and carbon dioxide emissions associated with the process.1

A promising alternative to the Haber-Bosch process is the use of electrochemical cells for the artificial production of ammonia. This method of producing ammonia has some significant advantages over the Haber-Bosch process, including lower capital costs and lower production flows required to produce ammonia efficiently.1 These advantages allow such electrochemical cells to be built on a much smaller scale compared to large Haber-

Bosch chemical plants. The small scale and capability for intermittent production allows electrolytic cells to be integrated with renewable electrical energy supplies and allows plants to be placed closer to the point-of-use while decreasing the energy costs and carbon dioxide emissions associated with transportation.1 Additionally, the reduction of nitrogen in electrochemical systems requires hydrogen ions instead of molecular hydrogen gas.

Therefore, hydrogen can be introduced to electrochemical systems through the oxidation

12 of water, eliminating the need to produce molecular hydrogen from fossil fuels.8 Further, recent simulations indicate that the electrolytic reduction of nitrogen into ammonia could be energetically competitive to the Haber-Bosch process.8

Despite the potential advantages of ammonia-producing electrochemical systems over the Haber-Bosch process, numerous challenges still exist. Even in electrochemical systems, nitrogen reduction occurs most efficiently at elevated temperatures near or above

200°C.1 Further, most electrode catalysts that have the potential to reduce nitrogen preferentially evolve hydrogen, leading to low faradaic efficiencies.1 A potential solution to this issue is harnessing nitrogenase, the enzyme used to fix nitrogen by diazotrophic bacteria, as a catalyst in these electrochemical cells. The potential advantages of this approach are numerous. Using a biological catalyst would potentially eliminate the need for high temperatures to be used in electrochemical cells. Further, the reaction that occurs at the active site in nitrogenase (reaction 1) allows two moles of ammonia to be produced per mole of hydrogen evolved.

+ - N2 + 8 H + 8 e → 2 NH3 + H2 (1)

This reaction corresponds to a faradaic efficiency of 75%, approximately double the faradaic efficiency found in the most efficient nitrogen-reducing electrochemical cells to date.1 Challenges to the implementation of this enzyme in electrochemical systems are also numerous. Biological proteins are unstable and will often denature under electromotive force. Further, the nitrogenase enzyme itself is difficult to produce and purify and is extremely sensitive to oxygen. The oxygen sensitivity of nitrogenase poses additional challenges to electrolytic cell design as any cell using nitrogenase would require the cell to be completely sealed from the environment. Despite these challenges, the introduction of

13 nitrogenase as a catalyst in electrochemical cells presents a promising alternative to the

Haber-Bosch process for the production of ammonia.

1-2 Review of the Enzyme Nitrogenase

Portions from the Sections 1-2 and 1-3 are excerpted from a draft of Catalysts for

Nitrogen Reduction to Ammonia by Shelby L. Foster, Sergio I. Perez Bakovic, Royce D.

Duda, Sharad Maheshwari, Ross D. Milton, Shelley D. Minteer, Michael J. Janik, Julie N.

Renner and Lauren F. Greenlee, which has been accepted for publication by Nature

Catalysis. This excerpted draft was written by Royce D. Duda.

Biological nitrogen fixation occurs naturally in diazotrophic microorganisms through the enzyme nitrogenase.9,10 Notably, nitrogenase operates at mild conditions (<40°C, atmospheric pressure)11 compared to catalysts operating in the traditional Haber-Bosch process. Thus, the study of this enzyme is of great interest in meeting the grand challenge of sustainable and efficient ammonia synthesis.12

Three distinct nitrogenase enzymes sharing similar characteristics have been found; they are distinguished by the metals in their metal-centered catalytic cofactors (co): FeMo- co, FeFe-co, and VFe-co.13-15 Evidence for a fourth enzyme, distinct to the other three nitrogenase enzymes due to a superoxide dependency,16 has been found although the classification of this enzyme is still debated as little evidence for this distinct nitrogenase has been produced recently.17 The most widely studied and understood nitrogenase enzyme contains the FeMo cofactor.

The synthesis of ammonia from nitrogen through nitrogenase enzymes follows reaction (2) in natural conditions.18

+ - N2 + 8H + 16MgATP + 8e → 2NH3 + H2 + 16MgADP + 16Pi (2)

10 The reaction consumes ~500 kJ/mole of N2, and involves ATP hydrolysis to release stored chemical energy. As nitrogen is reduced to ammonia, protons are also reduced to form H2, resulting in 75% of the electrons in the reaction producing ammonia.

The turnover frequency (TOF) of the enzymes in ideal conditions is about 2 moles ammonia per mole active site per second.19

Molybdenum-dependent nitrogenase consists of two multi-subunit proteins, both of which are oxygen sensitive, with one protein serving as a catalytic domain and the other serving as a reducing domain (the nitrogenase enzyme depicted in Figure 1-1). The first protein, often referred to as the “MoFe protein” for its cofactor containing Mo and Fe, reduces nitrogen into ammonia. The second protein, or the “Fe protein,” hydrolyzes

MgATP molecules, ATP molecules bound to magnesium atoms, to provide electrons which are transferred to the MoFe protein to aid in the reduction of ammonia. Table 1-1 outlines the basic components of these proteins and their functions.

Table 1-1: Basic components and functions of the nitrogenase enzyme.

Enzyme Enzyme Part Function Facilitates hydrolysis of MgATP and Iron (Fe) Protein Fe4S4, F-cluster electron transfer to the P-cluster Homodimer Nucleotide binding (~66 kDa) Facilitates binding of MgATP sites

Catalyzes reduction of nitrogen to Molybdenum-Iron Molybdenum-Iron ammonia, buried to prevent access to H O Cofactor Clusters 2 (MoFe) Protein and prevent excess hydrogen evolution α2β2 Tetramer (~240 kDa) Transfers the electrons from the Fe- Fe S , P-clusters 8 7 protein to the FeMo-cofactor

The Fe protein is composed of two proteins which form a homodimer (~66 kDa).

Each subunit in the protein contains a nucleotide binding site for a MgATP molecule, and together the subunits share as single a Fe4S4 cluster, or F-cluster, which transfers an electron to the MoFe protein after MgATP hydrolysis. The MoFe protein is a larger tetramer (~240 kDa) consisting of two α subunit proteins and two β subunit proteins. The entire MoFe protein contains two Fe8S7 “P-clusters” (located between the α and β subunits) and two FeMo cofactors (Fe7MoS9C, located within the α subunit). The P-clusters of the

MoFe protein collect electrons from the F-cluster on Fe proteins. The electrons move from the P-cluster to the FeMo cofactor which is the active site for nitrogen reduction. The electron transfer to each component is depicted in Figure 1-1.

Figure 1-1: Depiction of the nitrogenase enzyme and the electron transfer

pathway between the Fe protein and MoFe protein from the Fe4S4 cluster

through the P-cluster to the FeMo-cofactor. Only half of the MoFe

nitrogenase is shown for clarity. Figure from Catalysts for Nitrogen

Reduction to Ammonia.

1-3 Utilization of the Nitrogenase Enzyme in Photo- and Electrochemistry

Due to the desirability of milder operating conditions as compared to Haber-Bosch catalysts, nitrogenase has garnered recent interest as a catalyst in photochemical and electrochemical applications. A recent study adsorbed MoFe nitrogenase onto light-

17 activated cadmium sulfur (CdS) nanocrystals.19 The nanocrystals were chosen to complement the geometry of the MoFe protein and were photoexcitable; under lit conditions, the CdS nanocrystals would produce electrons. When the MoFe protein was adsorbed onto the surface of these nanocrystals, was exposed to a nitrogen-rich environment, and was subjected to light, it was found that the MoFe protein could achieve light-driven nitrogen fixation to ammonia. This confirms that electrons can be directly transferred from inorganic substances to the P-cluster of the MoFe protein, meaning the function of the Fe protein can be replicated.

Recent work has also incorporated nitrogenase into electrochemical systems. Tests have been performed on the MoFe protein of nitrogenase while immobilized on a glassy carbon electrode surface.20 This system was designed to contain cobaltocene as an electron mediator, and it was found that under an applied voltage, the immobilized nitrogenase

- - would reduce azide (N3 ) and nitrite (NO2 ) to ammonia through proposed reactions (3), (4) and (5).20

- + - N3 + 3 H + 2 e → N2 + NH3 (3)

- + - N3 + 9 H + 8 e → 3 NH3 (4)

- + - NO2 + 7 H + 6 e → NH3 + 2 H2O (5)

The faradaic efficiencies of these tests were between 30% and 50% for azide reduction, and near 100% for nitrite reduction.20 While this system was unable to reduce dinitrogen into ammonia, it shows that mediated electron transport to MoFe nitrogenase immobilized on an electrode surface is possible, and is a promising step toward being able to produce ammonia from nitrogen in electrochemical systems.

Nitrogenase has also been tested in enzymatic fuel cells. Using a proton exchange membrane as a divider, an enzymatic fuel cell was created by adding nitrogenase in the cathode compartment of the cell.21 In this study, the nitrogenase was not immobilized at the electron surface and the Fe protein of nitrogenase was included. When using methylviologen as an electron mediator between the cathode and the Fe protein, it was found that if ATP was fed to the system, a current could be generated while small quantities of ammonia were produced. The faradaic efficiency of this system was found to be approximately 26%, making this a promising technology for future development.21 It may be possible to increase this efficiency by obtaining direct electron transfer from the electrode surface to the MoFe protein rather than through a system of intermediates. This may be possible by orienting the enzyme directly on the electrode surface through protein engineering. Further research has shown that the addition of the FeSII protein from

Azotobacter vinelandii can protect the activity of nitrogenase when exposed to low levels of oxygen which would otherwise oxidize the metal clusters in nitrogenase.22 These advances are compelling evidence that nitrogenase-based electrochemical cells are a promising alternative technology to the Haber-Bosch process.

1-4 Challenges in Genetically Manipulating A. vinelandii and Nitrogenase

A great deal of work has been compiled over the past few decades to determine the structure of the cofactor and the mechanism of electron transfer and nitrogen reduction in

MoFe nitrogenase.23-36 Genetic modification in Azotobacter vinelandii, a bacterium that expresses nitrogenase in nature, is crucial since studies to determine the mechanism of substrate reduction in nitrogenases often involve altering their amino acid sequences in

19 relevant locations.37-46 Additionally, approaches to optimize the performance of MoFe nitrogenase on electrode surfaces may rely on adjusting the amino acid structure of the enzyme to orient it properly to receive electrons directly rather than via a mediator as described previously.20

The bacteria Azotobacter vinelandii has been studied in great detail for over 100 years.47 A. vinelandii can survive in conditions with no fixed nitrogen source or with no carbon source.48 As an obligate aerobe, it is a member of the only category of diazotrophs that are free growing and require oxygen to grow, despite the sensitivity of the nitrogenase enzyme it produces.47 A. vinelandii is especially useful for studying nitrogen fixation as it is a genetically tractable bacterium. It is also a relatively easy diazotroph to culture given its ability to survive in oxygen and its relatively fast doubling time of two to four hours.49

A. vinelandii, however, isn’t only used for the study of nitrogenase. A. vinelandii is also used to study the biopolymer alginate, which has potential applications in industry and medicine and is secreted by the bacterium for protection.50 A. vinelandii also uses a complex protein system within the cells to protect nitrogenases from oxygen. This protein system has garnered interest for applications protecting nitrogenase in vitro.22 These protections that are provided by A. vinelandii allow nitrogenase to be produced in the organism, where other bacteria such as E. coli would not be able to produce active nitrogenase due to that organism’s lack of protections. The full genome of the A. vinelandii

DJ strain has been sequenced due its importance in multiple fields of microbiology, further cementing its stature as an important organism for study.

Unfortunately, current methods to genetically modify the genome of A. vinelandii and select for the proper transformants are labor intensive. Due to the unsuitability of many

20 modern cloning techniques in A. vinelandii, genomic DNA must be modified through the transformation of DNA into the bacteria and subsequently incorporated into the genome though homologous recombination. To select the modified bacteria, often two steps are required: first the genome of A. vinelandii must be modified to inactivate nitrogenase, allowing transformants to be screened for by checking their ability to survive in media without a fixed nitrogen source.21, 51 Secondly, colonies containing the inactivated form of nitrogenase must be transformed with the modified DNA allowing for the reactivation of nitrogenase. At this point, the modified A. vinelandii must again be checked by monitoring its growth in media devoid of fixed nitrogen. Often, thousands of colonies must be scratched and checked to identify successfully modified strains due to the low frequency of homologous recombination of donor DNA into the A. vinelandii genome. Due to the time and labor requirements associated with these processes, alternative methods to modify the genome of A. vinelandii would be advantageous for future work.

The clustered, regularly interspaced, short palindromic repeat (CRISPR) and

CRISPR associated protein 9 (Cas9) system has immerged as a powerful genome editing tool. The CRISPR-Cas9 system has been utilized to study a great variety of species ranging from bacteria and fungi to animals and plants.52 Additionally, the mechanism of the

CRISPR-Cas9 system allows for targeted cell death by creating double-stranded breaks of cell genome DNA at programmed sites.53, 54 This feature makes CRISPR-Cas9 a promising system for application in A. vinelandii since the targeted cell death of non-altered cells would eliminate the need to pick and scratch colonies to identify colonies with the modified genome.

CRISPR-Cas systems have been of great interest since it was proposed in the mid-

2000’s that they functioned as prokaryotic immune systems.53 The CRISPR-Cas9 system, as a Type II CRISPR-Cas system, requires only one Cas protein for both RNA-guided

DNA recognition and target cleavage making it a valuable system for applications in genome editing. Because of its utility as a gene-editing tool, the mechanism for this system has been studied in great detail. Just three loci must be encoded for the CRISPR-Cas9 system to be functional in bacteria: an operon encoding for the Cas9 protein, a gene encoding trans-activated CRISPR RNA (tracrRNA), and a separate CRISPR array.54 The

CRISPR array consists regularly repeated sections of DNA interspaced with singular genome-targeting DNA sequences.53, 54 The mechanism of the CRISPR-Cas9 system is first begun with the transcription of the CRISPR array to form precursor-CRISPR RNA

(pre-crRNA). The pre-crRNA is then processed through a series of steps involving tracrRNA, Cas9, and nuclease enzymes. Following the maturation process, the CRISPR

RNA (crRNA) is bound to the Cas9 protein along remaining tracrRNA. The crRNA is then able to guide the Cas9 protein to a specific matching target, or protospacer, in the genome.

If the Cas9 protein identifies a protospacer in the genome bordering a protospacer adjacent motif (PAM), the Cas9 protein initiates a double-stranded break of the DNA resulting in cell death. As the full genome of A. vinelandii DJ is known, the CRISPR-Cas9 system would be especially powerful for genetic modification of A. vinelandii.

Overall, there are two main objectives of this thesis. The first is the replicate the work of other research groups by culturing A. vinelandii and purifying active nitrogenase.

The second is to incorporate the pCRISPR-pCas9 system into A. vinelandii to streamline the genetic modification process of that organism. These objectives fit into a broader

22 overall objective of improving the efficiency of ammonia-generating electrochemical cells by using protein-engineered nitrogenase as a catalyst. A flowchart of these objectives are shown in Figure 1-2.

Figure 1-2: Flowsheet demonstrating the overall steps toward creating a

protein-engineered nitrogenase and the testing of this enzyme on an

electrode surface. This thesis addresses replicating the work of laboratories

already studying nitrogen fixation by culturing A. vinelandii and purifying

nitrogenase. Additionally, a technical approach was developed for testing

the suitability of the CRISPR-Cas9 system. Certain aspects of this system

were developed or tested including checking if the pCRISPR and pCas9

plasmids are suitable for replication in A. vinelandii and the development of

a pCRISPR DNA spacer and genomic DNA repair template.

Chapter 2: Experimental Methods

2-1 Culturing and Derepression of Azotobacter vinelandii

The experimental methods described in Chapters 2-1, 2-2, 2-3, and 2-4 have been compiled in greater detail in a laboratory manual designed for the Renner Laboratory at

Case Western Reserve University. This laboratory manual accompanies this thesis in

Appendix C.

Azotobacter vinelandii cultures were grown in a modified Burk media as previously reported in the literature.21 A. vinelandii strain DJ modified for nitrogenase with an 8x histadine tag at the N-terminus of the α subunit was generously gifted by the Minteer Lab at the University of Utah. Solutions in all experiments used deionized (DI) water from a mixed bed deionizer tank (Western Reserve Water Systems) as a solvent unless otherwise noted. The modified Burk media contained 3.51 mM K2HPO4 (EMD Millipore), 1.47 mM

KH2PO4 (VWR), 58.4 mM sucrose (Fisher Bioreagents), 0.81 mM MgSO4 (VWR), 0.61 mM CaCl2 (Fisher Chemical), 0.1 mM FeCl3 (Alfa Aesar), and 0.01 mM Na2MoO4

(Beantown Chemical). For the preparation of agar plates, a concentration of 16 g L-1 bacteriological agar (VWR) was used. When required, NH4OAc (Dot Scientific) was added as a nitrogen source at a concentration of 10.0 mM for liquid media and 25.0 mM for agar plates. Preparation of media required preparation of separate phosphate buffer, sucrose/Mg/Ca, FeCl3, Na2MoO4, NH4OAc, and agar solutions if required, which were sterilized separately from each other. The phosphate buffer, sucrose/Mg/Ca, NH4OAc, and agar solutions were autoclaved separately while the FeCl3 and Na2MoO4 solutions were filter sterilized before the necessary solutions were mixed. All solutions were sterilized separately to avoid the formation of precipitates in the media. A. vinelandii cultures were

24 first cultured on modified Burk media agar plates containing FeCl3, Na2MoO4, and

NH4OAc and were allowed to incubate at 30°C for 2 days or until sufficient growth was observed. When the A. vinelandii growth was deemed sufficient, a loop of cells was transferred by sterile spreading loop to 500 mL modified Burk buffer with NH4OAc in a

2 L baffled flask. This culture was then incubated overnight at 30°C and 250 rpm or until an OD600 of 1.5 was observed.

Derepression of A. vinelandii cultures refers to the derepression of the nifHDK operon, triggering production of nitrogenase. The presence of a fixed source of nitrogen such as ammonia or urea represses the nifHDK operon and the nif gene of A. vinelandii.

The nif gene composes three individual A. vinelandii genes: nifH encodes the Fe protein of nitrogenase while nifD and nifK encode for the α and β subunits of the MoFe protein of nitrogenase, respectively.55 Derepression of the nifHDK operon in an A. vinelandii culture was induced by transferring the culture to a modified Burk media with no NH4OAc. This was achieved by centrifuging the cell cultures at 4,000 g for 10 minutes followed by resuspension into 500 mL proper media. The A. vinelandii culture was then incubated in a

2 L baffled flask at 30°C and 250 rpm for approximately 3.5 hours. The derepressed cell media was then centrifuged at 4,000 g for 5 minutes; the supernatant was discarded and the remaining derepressed cells were stored at - 80°C.

2-2 Preparation of Nitrogenase

All steps outlined in Chapter 2-2 were performed in a vinyl anaerobic chamber

(Coy Laboratory Products) in an environment with an O2 concentration of < 0.5 ppm. Lysis

25 of A. vinelandii cells was performed through osmotic shock. Frozen derepressed A. vinelandii cells were slowly thawed and resuspended into a buffer containing 50 mM TRIS

Base (Dot Scientific), 100 mM NaCl (VWR), 37% glycerol (VWR), and 2 mM dithionite

(Fisher Chemical) in a 2:1 volume ratio of solution to cell pellet weight. Once cells were thawed and thoroughly resuspended, the mixture was transferred to a 50 mL Oak Ridge centrifuge tube and was centrifuged at 12,000 g and 4°C for 20 minutes. The supernatant was discarded and the cell pellet was rapidly resuspended in a TRIS solution containing 50 mM TRIS Base, 100 mM NaCl, and 2mM dithionite to lyse the cells. DNaseI (New

England Biolabs) is also added in trace amounts to the above solution to improve mixing and cell lysis. After full resuspension of A. vinelandii cells was achieved, the mixture was placed on ice for 10 minutes. The mixture was then centrifuged in Oak Ridge centrifuge tubes at 26,000 g and 4°C for one hour. After centrifugation, the supernatant was isolated for purification.

The supernatant containing both MoFe and Fe nitrogenase was purified through fast protein liquid chromatography, FPLC (GE Healthcare, AKTA Start). The crude nitrogenase was first purified by immobilized metal ion affinity chromatography (GE

Healthcare HisTrap FF, 5 mL). The FPLC system was cleaned with a 20% ethanol (VWR) solution, was attached to the HisTrap affinity column, and was prepared by flowing a TRIS solution (50 mM TRIS Base, 100 mM NaCl, and 2mM dithionite) through the column. The crude nitrogenase sample was then flowed through the FPLC to bind the His-tagged MoFe nitrogenase to the HisTrap column. The system was then washed with a TRIS buffer (20 mM TRIS Base, 500 mM NaCl, 2 mM dithionite) containing 20 mM imidazole (Alfa

Aesar) to remove lightly-bound proteins from the HisTrap column. The MoFe nitrogenase

26 was then eluted from the column using the same TRIS buffer with 250 mM imidazole. The presence of MoFe nitrogenase was confirmed through sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

MoFe nitrogenase was further purified through Q Sepharose anion exchange chromatography (GE Healthcare, HiTrap Q HP 5 mL). The FPLC system was first cleaned with 20% ethanol and washed with TRIS buffer (20 mM TRIS Base, 100 mM NaCl, 2 mM dithionite). The eluted MoFe from HisTrap purification was diluted to a final concentration of 100 mM NaCl and 20 mM TRIS base and was loaded into the FPLC. A linear gradient was then applied to the column, from 200 mM to 650 mM NaCl with at a constant 50 mM

TRIS Base, causing the elution of the MoFe nitrogenase. The purity of the MoFe protein was confirmed through SDS-PAGE. The MoFe nitrogenase was then desalted and concentrated via ultrafiltration using a 100 kDa molecular weight cutoff membrane at a pressure of 50 PSI in a stirred cell (Amicon).

The MoFe nitrogenase was flash frozen in liquid nitrogen and stored long-term in either liquid nitrogen or at -80°C. The concentration of the desalted MoFe protein was determined by the Biuret Method. Bovine serum albumin (BSA, Fisher) solutions were prepared in concentrations varying from 0.5 mg/mL to 9.0 mg/mL to be used as a standard of comparison against the MoFe samples. In addition to BSA and MoFe samples, water and a 50 mM TRIS base, 2 mM dithionite solution were added to correct for background.

All samples were added to a 96-well plate; for each 20 µL sample, 180 µL Biuret reagent was added. The Biuret reagent contains Cu2+ which forms complexes with peptide bonds in proteins and can be measured by spectroscopy at λ = 550 nm. The Biuret reagent was composed of 200 mM NaOH (Dot Scientific), 32 mM potassium sodium tartrate (Sigma-

Aldrich), 12 mM CuSO4 • 5H2O (Fisher), and 30 mM potassium iodide (Sigma-Aldrich).

Absorbances (λ = 550 nm) of the BSA standards were plotted against their concentrations and linear regression is performed in Origin data analysis and graphing software

(Originlab). The average absorbance (λ = 550 nm) of the MoFe samples were compared to this BSA standard calibration curve to determine their concentration.

2-3 Nitrogenase Acetylene Reduction Activity Assay

The activity of in vivo nitrogenase was tested by probing its ability to reduce

21 acetylene (C2H2) to ethylene (C2H4) as previously reported. Acetylene gas was produced by the reaction of distilled water on calcium carbide (CaC2, Acros Organic). High purity of acetylene is ensured due to collection of the gas under hydrostatic pressure to prevent mixing with the environment (Figure 2-1). Special glassware was designed to mimic the glassware used in other labs to capture pure gasses. This specialty glassware (Eagle

Laboratory Glass Company) is depicted on the left-hand side of Figure 2-1. The device is prepared by filling the lower chamber with water while the upper opening is sealed. Once the lower chamber has been completely filled with water, the lower chamber is sealed with a rubber stopper and the upper chamber is opened. The water in the specialized flask acts as a barrier which keeps the atmosphere from mixing with the gas that gets trapped in the lower chamber of the flask.

Figure 2-1: Schematic of the glassware setup for the collection of pure

acetylene from the reaction of water over calcium carbide. Water is poured

over calcium carbide in the filtering flask is collected under hydrostatic

pressure to ensure purity.

The reaction that produces acetylene is shown below for reaction (6).

CaC2 + 2 H2O → C2H2 + Ca(OH)2 (6)

After the reaction was initiated by pouring 30 mL of DI water over the calcium carbide, the reaction was allowed to proceed in a filtering flask for a few seconds before it was capped with a rubber stopper. Tubing with a Luer Lock needle adaptor was attached

29 to the side-arm of the flask and was allowed to sit for a few seconds to allow evacuation of atmospheric gases from the flask due to the positive pressure produced by the reaction. The needle from the filtering flask was then inserted into the sidearm of the specialized glassware shown in Figure 2-1 as the acetylene is collected. The acetylene gas displaced the water in the glassware, pushing the water into the upper chamber. The water barrier between the atmosphere and the acetylene prevents mixing of gas. Acetylene samples were collected using a Hamilton gas-tight syringe.

Activity assays were performed in septum-sealed vials in a balance of air.

Derepressed A. vinelandii samples are added to three vials, 1 mL in each before vials are sealed. A control was run where the 1 mL derepressed A. vinelandii cultures were replaced with 1 mL Burke media. After vials are sealed, pure acetylene is added into the vial to produce an environment with approximately 0.1 atm acetylene and 0.9 atm air. Under these conditions, the derepressed A. vinelandii samples were incubated at 30°C and 200 rpm for

15 minutes until the reaction was halted by the addition of 100 µL 4.0 M NaOH. The presence of ethylene in the resulting atmosphere is probed with gas chromatography with a gas ionized detector.

2-4 Azotobacter Vinelandii Competencey and Transformation

Azotobacter vinelandii was induced to competencey by spreading cells on modified

Burk media plates containing NH4OAc but excluding FeCl3 and Na2MoO4. Multiple passes on agar plates were performed to maximize competence by collecting cells from agar plates and vortexing cell clumps in modified Burk media absent FeCl3, Na2MoO4 and NH4OAc

30 before respreading. When required, A. vinelandii competent cells were transferred into a modified Burk media containing 5 mM NH4OAc. The competency of A. vinelandii cultures can be confirmed by checking the color of the cells since competent A. vinelandii cells secrete a fluorescent green siderophore. The color change associated with A. vinelandii competency is shown in Figure 2-2.

Figure 2-2 A: Growth of A. vinelandii on modified Burk media with

NH4OAc. B: Growth of A. vinelandii on modified Burk media with

NH4OAc with iron and molybdenum sources removed. The significant

color change that occurs with iron and molybdenum starvation confirms the

competency of the A. vinelandii cells.

Transformation of foreign DNA into A. vinelandii was attempted as reported in the literature.21 Competent A. vinelandii colonies from an agar plate were collected and deposited in 1 mL of modified Burk media absent FeCl3, Na2MoO4 and NH4OAc and was vortexed to remove cell clumps. One to ten mg of foreign DNA was then added to the

31 competent cell mixture which was incubated for one hour at 30°C. Cells from this mixture were then added to culture tubes containing 7 mL modified Burk media containing FeCl3,

Na2MoO4, NH4OAc and appropriate antibiotics. In some cases, cells were also transferred to agar plates containing Azotobacter Growth Media, a modified Burk media containing

FeCl3, Na2MoO4 and 0.125 g/L yeast extract (IBI Scientific). After significant growth was achieved in a positive control, the optical density of each of the liquid cultures was measured at 600 nm using a spectrophotometer (Molecular Devices Quickdrop), or for agar plates, a colony count was performed.

The DNA vectors pCRISPR and pCas9 were purchased from Addgene. Vectors were separately transformed into Subcloning Efficiency DH5α chemically competent

Escherichia coli cells (Invitrogen). Competent cells were chosen to maximize transformation efficiency and amplify DNA for purification. Transformation of vectors into E. coli was attempted by mixing competent cells with vector DNA followed by incubation on ice and heat-shock in a 42°C dry bath. The E. coli cells were then incubated in 2x YT media (16 g/L tryptone (Dot Scientific), 10 g/L yeast extract, 5 g/L NaCl, pH 7.0) at 37°C for one hour before their transfer onto 2x YT agar plates containing appropriate antibiotics (25 µg/mL chloramphenicol or 50 µL/mL kanamycin). Transformed cells were picked and cultured in 2x YT media. Vectors were purified with the QIAprep Spin

Miniprep Kit (Qiagen).

2-5 Cloning of Designed CRISPR Target into pCRISPR Vector in Escherichia Coli

The mechanism of the pCRISPR and pCas9 plasmids requires a target sequence from the host organism to be inserted into the pCRISPR plasmid. This insert in the pCRISPR plasmid allows the protein Cas9, which is encoded in pCas9, to locate the sequence in the host organism and initiate a double-stranded break causing the death of the host cell. A target sequence of DNA from the nif gene in A. vinelandii was chosen and is displayed in Figure 4-3 A. Oligonucleotides designed to create this sequence were purchased from Integrated DNA Technologies. The cloning of this insert into pCRISPR is performed in Escherichia coli.

The pCRISPR vector was digested using the restriction enzyme BsaI (New England

Biolabs). The complete digestion of the pCRISPR vector was confirmed through agarose gel electrophoresis and the appropriate band was extracted from the gel using the QiaQuick

Gel Extraction Kit (Qiagen). The digested pCRISPR vector was dephosphorylated with alkaline phosphatase, calf intestinal (New England Biolabs) to prevent intramolecular ligation. Oligonucleotides for the CRISPR target (Integrated DNA Technologies) were annealed and ligated with the dephosphorylated digested pCRISPR vector with T4 DNA

Ligase (New England Biolabs). The ligated vector was then transformed into competent E. coli cells, cultured in 2x YT media with 50 µg/mL kanamycin, and purified as reported above. Sequencing was purchased through GenScript USA.

Chapter 3: Preparation of MoFe Nitrogenase

3-1 Derepression of the nifHDK Operon in A. vinelandii

The study of the utilization of nitrogenase in electrochemical systems first requires the extraction of nitrogenase from diazotrophic bacteria such as A. vinelandii. The nif gene encoding for the nitrogenase enzyme in A. vinelandii is repressed under conditions with a fixed nitrogen source such as ammonia. Subjection of A. vinelandii cultures to fixed- nitrogen starvation causes the derepression of the nifHDK operon which activates the nifH, nifD, and nifK genes which encode for Fe nitrogenase and the α and β subunits of MoFe nitrogenase respectively. The presence of the Fe and MoFe proteins can be checked using methods such as western blot analysis and sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE, Figure 3-1), but these methods do not probe the activity of the nitrogenase enzyme. As nitrogenase enzyme is known to reduce a wide array of

- - - 10, 18, 20, 56, 57 substrates including N2, NO2 , N3 , N2H4, NC , C2H2, CO2, and CO, nitrogenase activity can be confirmed by probing the reduction of these substrates in the presence of nitrogenase. The ability of A. vinelandii cultures to reduce acetylene (C2H2) is a commonly used method to test the activity the nitrogenase produced in the cultures because pure acetylene is relatively easy to produce and because both acetylene and its reduced form ethylene are easy to probe for with gas chromatography.21, 58 To confirm nitrogenase activity in vivo, a single culture of A. vinelandii was first starved of a fixed-nitrogen source for 3.5 hours to maximize nitrogenase yield. Three 1mL samples from this single cultured were then subjected to an environment of approximately 0.1 atm acetylene and 0.9 atm air.

A negative control was created by subjecting the modified Burk media to the same environment. After incubation for 15 minutes, acetylene reduction in each sample was

34 halted and the resulting environment was probed with gas chromatography with flame ionized detector (GC-FID). The results are summarized in Table 3-1.

Table 3-1 GC-FID Results of in vivo Acetylene Reduction in Derepressed A. vinelandii

Cultures

Sample Peak 1 Peak 1 Peak 2 Peak 2 Percent Acetylene Retention Area Retention Area conversion to Time (min) (x 104) Time (min) (x 104) Ethylene (%) Control 20.471 0.0028 N/A N/A 0.00

1 19.142 121.8 23.300 55.2 31.19

2 19.022 38.3 23.236 10.1 20.95

3 19.018 519.1 23.22 6.3 1.19

The first peak with a retention time of approximately 19.02 corresponds to ethylene while the second peak with a retention time of approximately 23.2 corresponds to acetylene. As the calibration for acetylene and ethylene are nearly identical for the GC-

FID conditions used, the ratio between the peak areas gives the ratio between ethylene and acetylene. The percent conversion of acetylene to ethylene varies greatly between the samples. A possible explanation of the variance in these results is that the concentration of enzyme within the cells vary between the 1 mL samples. Additionally, possible mixing of air into the syringe used to transfer acetylene into the sample vials may have drastically effected the total volume of acetylene added into the samples. Variations in the total nitrogenase or acetylene present would affect the reaction kinetics for acetylene reduction and would create variance between samples. Additionally, baseline shifts that occurred during the measuring of the final atmosphere composition with the GC-FID made the

35 determination of exact peak areas difficult. Despite the variance in acetylene conversion between the samples, peaks showing ethylene were observed in samples containing the derepressed A. vinelandii culture that were not present in the control. The presence of ethylene in the sealed atmosphere confirms the activity of the nitrogenase in vivo.

3-2 MoFe Nitrogenase Purification

Preparation and purification of MoFe nitrogenase is required for further experimentation of its utilization in electrochemical systems. MoFe nitrogenase is extracted from derepressed A. vinelandii cultures through the lysis of cells by osmotic shock. MoFe nitrogenase is then purified through immobilized metal ion affinity chromatography and then anion exchange chromatography. The results of A. vinelandii derepression, lysis, and MoFe purification as determined through SDS-PAGE are shown in Figure 3-1.

Figure 3-1 SDS-PAGE results from the nitrogenase preparation and purification process. Lanes 1 and 2 show the results from when A. vinelandii cultures are originally fixed-nitrogen starved (T=0) and after 3.5 hours of fixed-nitrogen starvation at which point the cells were harvested (T=H), respectively. Lane 3 shows the presence of the proteins in the cell lysate, confirming cell lysis. Lane 4 shows the results of the first stage of MoFe purification, immobilized metal ion affinity chromatography. Lane 5 shows the results of the second stage of MoFe purification, anion exchange chromatography. The presence of MoFe nitrogenase is confirmed with a band near the expected position of 66 kDa. The results from Lane 5, the final stage in purification, confirm the purity of the MoFe protein.

The MoFe nitrogenase sample was desalted and concentrated after the purity was confirmed. The purified band of nitrogenase on the SDS-PAGE gel appears slightly lower than the expected value of 66 kDa. A possible explanation for this observation is that the

MoFe protein was not fully denatured before the SDS-PAGE run. The more globular protein may have moved through the gel somewhat faster than expected. The concentration of the desalted and concentrated MoFe sample is determined though the Biuret Method.

The Biuret Method is commonly used to determine nitrogenase concentration.21, 59, 60 The absorbance at λ = 550 nm of bovine serum albumin (BSA) standard solutions ranging from

0.5 mg/mL to 9 mg/mL are determined and plotted. From this data, linear regression is performed to obtain a calibration curve from which to determine MoFe concentration. This bovine serum albumin standard calibration is shown in Figure 3-2.

Figure 3-2 BSA calibration curve used to determine MoFe concentration

by the Biuret Method. Absorbance versus concentration of BSA standards

are plotted in black. The calibration curve derived from the BSA standards

is also shown in black along with the position of the MoFe protein sample

along this curve, shown in red. The concentration of the MoFe protein

sample was determined to be 4.82 mg/mL.

Linear regression of the BSA standards produced a calibration curve with a slope of 1.137 x 10-2 mL/mg and an intercept of 5.413 x 10-4. The R2 value for this fit is 0.9965.

From this calibration curve, the concentration of the desalted MoFe sample was determined to be 4.82 mg/mL, corresponding to the average absorbance of MoFe samples of

5.53 x 10-2. This final concentration of 4.82 mg/mL puts it within an order of magnitude of

39 the 20 mg/mL concentration previously reported.21 Further concentration of the MoFe protein could be performed using the method described in Chapter 2-2 to obtain a higher final concentration that is more similar to results obtained by previous studies.

In summary, nitrogenase was produced within A. vinelandii where its activity was confirmed by probing its ability to reduce acetylene into ethylene. MoFe nitrogenase was extracted from A. vinelandii and purified. Samples were confirmed to contain pure nitrogenase with SDS-PAGE before being desalted and concentrated. The final concentration of the desalted MoFe nitrogenase was determined to be 4.82 mg/mL. This work was successfully able to replicate the work performed by other labs working with

A. vinelandii and nitrogenase. A laboratory manual was compiled detailing the techniques used in this lab to ensure this capability in the Renner Laboratory for the future. The sample of nitrogenase developed for this thesis can be used in future studies on the utilization of

MoFe nitrogenase in electrochemical systems.

Chapter 4: Incorporating the CRISPR-Cas9 System into Azotobacter Vinelandii

4-1 Technical Approach

The incorporation of the CRISPR-Cas9 system to Azotobacter vinelandii would be advantageous to future studies on nitrogenase and its structure onto electrode surfaces. The plasmids chosen to incorporate the CRISPR-Cas9 system into A. vinelandii are pCas9 and pCRISPR, developed by the Marraffini Lab at The Rockefeller University, which have been shown to function in Escherichia coli. The plasmid pCas9 contains the sequence for tracrRNA and the Cas9 protein, as well as a chloramphenicol resistance cartridge. The pCRISPR vector contains the CRISPR array and a kanamycin resistance cartridge. The antibiotic cartridges contained in these plasmids make them attractive for use in A. vinelandii. The pCRISPR and pCas9 plasmids must be tested for their ability to replicate in A. vinelandii since many recombinant plasmids that are easily maintained in E. coli and other bacteria are unsuitable for replication in A. vinelandii.51 Due to the antibiotic cartridges contained in the pCRISPR and pCas9 vectors, testing the replication of these plasmids in A. vinelandii can be checked by testing the growth of transformed cultures in the appropriate antibiotic. If both the pCRISPR and pCas9 plasmids are suitable for replication, further tests can be performed to test the functionality of the CRISPR-Cas9 system in A. vinelandii.

While studies have been performed to test the function of the nitrogenase enzyme in electrochemical cells, these studies have either not immobilized the MoFe protein,21 or crudely immobilized the enzyme near the electrode surface with polymer.20 No studies to date have attempted to modify MoFe nitrogenase to bind with a metal electrode surface or otherwise orient the protein towards the electrode in a specific way. Testing the

41 functionality of the CRISPR-Cas9 system in A. vinelandii provides an opportunity to simultaneously test MoFe nitrogenase adsorption on a metal surface. By attempting to modify the A. vinelandii genome with the CRISPR-Cas9 system to produce an altered form of nitrogenase, the functionality of the CRISPR-Cas9 system can be confirmed by comparing the modified nitrogenase to the wild-type. Additionally, adding a gold-binding tag at the N-terminus of the a α subunit of MoFe nitrogenase would allow an opportunity to study nitrogenase adsorption with a Quartz Crystal Microbalance. Figure 4-1 highlights the comparison between current methods used to immobilize nitrogenase at electrode surfaces and a proposed novel use of protein-engineered nitrogenase in electrochemical systems.

Figure 4-1 Comparison of current polymer-immobilized MoFe nitrogenase on an electrode surface and the proposed protein-engineered MoFe nitrogenase immobilized on an electrode surface. The electrode is shown in black, immobilization polymer in light blue, and nitrogenase in orange with its set of metal clusters in red. (A) Current methods to immobilize nitrogenase involve an immobilization polymer which fails to organize the orientation of the enzyme at the electrode surface. The average distance between the electrode and the enzyme’s cofactors are not optimized.

(B) Proposed protein-engineered MoFe would allow for the orientation of the enzyme on the electrode surface to be optimized, shortening the average distance between the nitrogenase metal clusters. This novel approach may increase the odds that direct electron transfer from the electrode to the enzyme could be achieved.

Central to the technical approach to verifying the fitness of the CRISPR-Cas9 system in A. vinelandii is the determination of the location within the genome which to target. To select for A. vinelandii with the modified nitrogenase, the target was selected to be the DNA encoding near the N-terminus of the his-tagged MoFe nitrogenase.

Additionally, the requirement that the targeted DNA be next to a PAM further restricted the choice of DNA sequence to target. The oligonucleotides chosen for the DNA insert to be fit within the pCRISPR repeats are shown in Figure 4-3 A. Additionally, a segment for modification of the A. vinelandii genome was created to include the gold-binding tag and designed for homologous recombination into the correct location. The sequence of this

DNA fragment is also listed in Appendix D. The function of the CRISPR-Cas9 can be checked by transforming the plasmids pCas9 and pCRISPR containing the target DNA into

A. vinelandii while separately transforming these vectors and the DNA segment designed to homologously recombine into the genome. The death of the culture not containing the gene modification coupled with the survival of the culture with the modifying DNA would confirm the suitability of the CRISPR-Cas9 system in A. vinelandii. These methods are summarized in Figure 4-2.

Figure 4-2 Mechanism of pCRISPR-pCas9 genetic modification in A. vinelandii. (A) The pCas9 plasmid and a genomic DNA repair fragment are transformed. Transformation of pCas9 is screened by growth on chloramphenicol. (B) The pCRISPR plasmid containing a target spacer of

A. vinelandii genomic DNA is transformed. Transformation is screened by growth on chloramphenicol and kanamycin. (C) If the DNA repair template recombines in the genome, the pCRISPR spacer will not match the genomic

DNA preventing cell death by Cas9. All cells with the original genomic

DNA are killed by Cas9 as the pCRISPR target spacer matches a sequence in the genomic DNA.

Further testing to confirm the functionality of the CRISPR-Cas9 system in A. vinelandii involves the testing the modified version of nitrogenase. The MoFe nitrogenase, once purified and confirmed through sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), a Western Blot analysis can be performed and compared to the unaltered his-tagged MoFe nitrogenase purified in Chapter 3. An easy way to test if the enzyme was altered is to add an affinity tag to the new protein (such as the T7 motif) and probe for it using the appropriate antibodies. Further, the modified MoFe nitrogenase containing the gold-binding tag can be tested over a Quartz Crystal Microbalance to compare its adsorption to gold compared to the unaltered MoFe protein.

4-2 Cloning Designed DNA Spacer into the pCRISPR Plasmid

The DNA spacer designed to fit within the pCRISPR vector was designed to complement a section of nifD gene in A. vinelandii, the gene encoding for α subunit of the nitrogenase enzyme, directly after a protospacer adjacent motif (PAM). The design of the

DNA spacer insert and its intended insertion location into pCRISPR are shown in

Figure 4-3 A. Cloning of the insert into pCRISPR was performed following pre-established protocols.61 A simplified cloning scheme is shown in Figure 4-3 B. Briefly, the pCRISPR vector is digested with the enzyme BsaI and is separated by agarose gel electrophoresis

(Figure 4-4 A). Full digestion of the pCRISPR vector is confirmed through comparison the

DNA bands observed in the agarose gel with the bands produced by partially digested pCRISPR (Figure 4-4 B). The pCRISPR vector is phosphorylated before ligation with the pCRISPR spacer with the enzyme T4 DNA Ligase to prevent intramolecular ligation. To confirm the results, purified ligated DNA is sequenced after its transformation into E. coli

46 and growth in 50 µg/mL kanamycin. Primers were designed with assistance from Genscript

USA and are listed in Appendix E. Sequencing was performed on DNA extracted from four E. coli colonies containing the ligated DNA. The DNA primers successfully verified the sequence of the DNA sample, but the sequencing results showed that insertion of the pCRISPR spacer into the pCRISPR plasmid was unsuccessful. Sequencing Results are shown in Appendix E. Sequencing of the pCRISPR DNA from Samples 1 and 4 give evidence of undigested pCRISPR. It is likely that the enzyme BsaI did not digest 100% of the pCRISPR plasmid, allowing for a trace impurity of nondigested pCRISPR to be collected after agarose gel electrophoresis. The sequencing results of Samples 2 and 3 provide evidence of intramolecular homologous recombination of the plasmid. While both of these results were not expected, strong evidence is found that the phosphorylation of the plasmid was successful because no evidence of intermolecular or intramolecular ligation is seen in the sequencing results. The unsuccessful ligation of the pCRISPR spacer into the digested plasmid may have been caused by the use denatured T4 DNA Ligase, which had been stored for an extensive amount of time before its use. It is also possible that the ideal ratio of insert to vector was not achieved.

Figure 4-3 Sequences of the pCRISPR region of interest and the newly designed pCRISPR spacer sequence. The kanamycin resistance cartridge is represented in green, and the direct repeats of the pCRISPR primer are represented in grey. A: Representation of the pCRISPR plasmid with the sequence of the direct repeats and the spacer insert region as created by the

Marraffini Lab.61 The novel pCRISPR sequence designed to fit within the spacer site is listed as well. Top potion of image taken from the pCRISPR protocol from Addgene. B: The cloning scheme used to insert the pCRISPR

Spacer into the pCRISPR plasmid.

Figure 4-4: The results of agarose gel electrophoresis on the digested

pCRISPR Plasmid. A: Complete digestion of the pCRISPR plasmid; the

expected size of 2.4 kb is observed. B: Incomplete digestion of the

pCRISPR plasmid. A band at 2.4 kb shows the full digestion of the

pCRISPR plasmid while a band at 2.7 kb shows incomplete digestion.

4-3 Transformation and Replication of pCRISPR and pCas9 Plasmids in Azotobacter

vinelandii

The central question surrounding the incorporation of the pCRISPR-pCas9 system into A. vinelandii is whether the pCRISPR and pCas9 proteins are suitable for replication.

As the addition of the CRISPR-Cas9 system has not been attempted in A. vinelandii, the suitability of the pCRISPR and pCas9 plasmids for replication in that organism must be confirmed. The suitability of these plasmids for replication in A. vinelandii can be checked

49 by monitoring the growth of transformed cultures in antibiotics due to the antibiotic resistance cartridges contained in these plasmids. As pCRISPR contains a kanamycin resistance cartridge, testing the growth of transformed cultures in kanamycin indicates the compatibility of the pCRISPR plasmid in A. vinelandii, while the growth of the transformed cells in no antibiotic and in chloramphenicol acts as a positive and negative control respectively. Similarly, as the pCas9 plasmid contains chloramphenicol resistance, the growth pCas9-transformed A. vinelandii cultures in chloramphenicol indicates the suitability of pCas9 for replication, while growth in no antibiotic and in kanamycin act as a positive and negative control respectively.

Separate cultures of A. vinelandii were transformed with pCas9 and pCRISPR and were then cultured in separate culture tubes in modified Burk media containing either

50 µg/mL chloramphenicol, 50 µg/mL kanamycin, or no antibiotic. Kanamycin concentration was chosen to be above the lethal limit used previously.62 As little work has been performed to determine the lethal concentration of chloramphenicol to A. vinelandii, the same concentration as kanamycin was used, 50 µg/mL. The optical density,

λ = 600 nm, of the cultures observed after 7 days of growth are reported in Figure 4-5. The growth of the A. vinelandii transformed with pCas9 and pCRISPR was similar to the growth of the A. vinelandii without antibiotics. This result indicates that the 50 µg/mL chloramphenicol is too dilute to effectively kill A. vinelandii. The growth of the cell cultures in kanamycin is more promising; while growth was stifled in the A. vinelandii transformed with pCas9 and thus containing no kanamycin resistance, the growth of the culture transformed with pCRISPR was not inhibited to the same degree, indicating that the pCRISPR plasmid is suitable for replication within A. vinelandii.

Figure 4-5: Optical densities of A. vinelandii cultures transformed with the

pCas9 and pCRISPR vectors after growth in the presence of no antibiotic,

chloramphenicol (C), and kanamycin (K).

The determination of the lethal concentration of chloramphenicol to A. vinelandii is critical to testing for the suitability of the pCas9 plasmid for replication after transformation. The lethal concentration was determined by monitoring the growth of non- transformed A. vinelandii in culture tubes with increasing chloramphenicol concentrations.

The optical densities of the A. vinelandii cultures after 7 days of growth is reported in

Figure 4-6.

Figure 4-6: Optical densities of A. vinelandii cultured in varied

concentrations of chloramphenicol.

All future experiments used a chloramphenicol concentration of at least 400 µg/mL, although often the concentration was increased to 800 µg/mL or 1600 µg/mL to ensure suitable potency to inhibit cell growth. Unfortunately, additional experimentation could not replicate the data presented in Figure 4-5; over numerous attempts, no A. vinelandii transformed with either pCas9 of pCRISPR was able to grow in chloramphenicol or kanamycin. Given the inability of the transformed A. vinelandii cultures to grow in antibiotics, the results suggesting successful transformation and replication of the pCRISPR plasmid may have been caused by other factors. One potential reason could be that the antibiotics had expired after long storage, but this explanation is unlikely due to the effectiveness of the kanamycin against the A. vinelandii transformed with pCas9. A

52 more likely explanation involves the physiology of A. vinelandii cells. The morphology of

A. vinelandii cells are highly dependent on the agitation of their cultures. In unbaffled flasks, A. vinelandii produces three times as much alginate, a linear polysaccharide, as cultures grown in baffled flasks.63 Alginate has a gel-like quality that allows for aggregation of A. vinelandii into a viscous slime layer. Such biofilms are notorious for their increased antibiotic resistance. Studies have shown that under mild mixing and poor aeration, A. vinelandii was prone to growth as a viscous slime layer.64 The mixing and aeration conditions depicted in these studies are very similar to the culture tubes used to grow A. vinelandii for this thesis. It has been shown that cultures of A. vinelandii grown at an agitation rate of 300 rpm, the same speed used for growing the transformed A. vinelandii cultures for this study, produce high molecular weight alginate.65 Additionally, the unbaffled culture tubes used in this study along with their low surface area-to-volume ratio promote poor aeration and mixing, conditions which can cause the A. vinelandii to form a thick slime layer.64 These conditions may have caused the A. vinelandii culture transformed with pCRISPR to aggregate into a slime biofilm providing heightened resistance to both kanamycin and chloramphenicol, leading to the observed results. If this is the case, it would explain why the results have not been repeated despite numerous attempts. It is possible that the kanamycin resistance is not due to the inclusion of the pCRISPR plasmid with its kanamycin resistance cartridge, but rather due to the aggregation of A. vinelandii into a kanamycin resistant biofilm.

4-4 Conclusions and Future Work

A novel approach for implementing and testing the CRISPR-Cas9 system into

A. vinelandii has been reported in this thesis. Evidence has been found to suggest that the plasmid pCRISPR is suitable for replication in A. vinelandii. Little evidence has been found that the pCas9 plasmid is suitable for replication within A. vinelandii, however, and attempts to repeat the replication of pCRISPR within A. vinelandii has been unsuccessful.

The mixing and aeration of the A. vinelandii cultures could be better optimized by allowing cultures to incubate in baffled flasks rather than narrow culture tubes to reduce the likelihood of slime layer formation and unexpected results. The CRISPR-Cas9 system could also be introduced into A. vinelandii through methods other than the pCRISPR and pCas9 plasmids. The DNA for the CRISPR-Cas9 system could be added directly to the A. vinelandii genome through traditional methods. Additionally, plasmids known to be compatible in A. vinelandii could be modified to hold the CRISPR-Cas9 system and transformed directly into a competent culture.

Chapter 5: Summary and Conclusions

The large quantity of ammonia produced annually along with the energy-intensive methods required to make ammonia make research into alternative processes to the Haber-

Bosch process very important. The contents in this thesis focus on techniques used to genetically modify the nitrogenase-producing bacteria Azotobacter vinelandii as well as the preparation and purification of nitrogenase from A. vinelandii cultures.

The preparation of MoFe nitrogenase from A. vinelandii has been mainly successful. Cultures of A. vinelandii that were subjected to fixed-nitrogen starvation showed the ability to reduce acetylene to ethylene, confirming that active nitrogenase was produced. These derepressed A. vinelandii cultures were lysed to extract MoFe nitrogenase, which was successfully purified and prepared for further study of MoFe nitrogenase in electrochemical systems.

Attempts were also performed to incorporate the pCRISPR-pCas9 system into A. vinelandii to streamline the process of genetically modifying its genome. Initial results give evidence that the plasmid pCRISPR is suitable for replication in A. vinelandii, but further testing was inconclusive and no evidence of pCas9 replication in A. vinelandii was observed. While the cloning of a pCRISPR spacer designed to target the A. vinelandii genome into the pCRISPR plasmid was unsuccessful, other tests were successful such as the determination of the required chloramphenicol concentration to be effective versus A. vinelandii.

A manual for working with A. vinelandii and nitrogenase was created for future use in the Renner Laboratory. Additionally, a laboratory-specific curriculum featuring

55 molecular cloning in Escherichia coli for implementation in the Widening Opportunities for Women in Science (WOWS) Program was developed. These documents along with survey results and analysis from WOWS students are included in the Appendices.

Appendices

Appendix A: Outreach in the Widening Opportunities for Women in Science

Program

A-1 Introduction: Women in STEM Fields

Historically, women have been greatly underrepresented in science, technology, engineering, and mathematics (STEM) fields. While female participation in STEM fields has improved over the past few decades, the percent of undergraduate degrees in engineering conferred to women has stagnated near 20%.66 As these trends are evident at the high school level, extending experiences to young women in grades nine through twelve are important for improving the percentage of women who major in engineering at the undergraduate level.

The Case Western Reserve University Department of Chemical and Biomolecular

Engineering’s Widening Opportunities for Women in Science (WOWS) Program was created to provide outreach to female high school students by providing hands-on research experience during the summer, and general education about the chemical engineering profession. Each student spends seven weeks in a research setting with a graduate student mentor. Specifically, for the Renner Laboratory, a seven-week curriculum was developed educate high school and undergraduate students in the techniques for biomolecular cloning in Escherichia coli. Survey results were obtained from the participants to access the success of the program. This section describes the specific program developed in the Renner

Laboratory, and the survey results for the program in general.

A-2 Biomolecular Cloning in Escherichia coli Curriculum for the WOWS Program

The project chosen for the WOWS program is the insertion of DNA designed to create sequences of amino acids known to bind to specific elements into the plasmid pET-EL48. The plasmid pET-EL48 contains a sequence encoding for a peptide containing a series of elastin-like repeats, a mechanical domain that can stretch and contract. Elastin peptides are promising materials for use in stabilizing scaffolds, and thus their application on metal surfaces has potential applications in a designed scaffold for orienting and stabilizing enzymes such as nitrogenase on an electrode surface. Any studies on their performance on electrode surfaces first involves modifying the elastin peptide to contain a binding domain to allow the peptide to bind to a particular surface. For the WOWS program, five sets of oligonucleotides encoding the binding tags for five separate elements were used: platinum, gold, silver, iridium, and carbon. Having five sets of oligonucleotides allowed each participant to use a unique binding tag for their project.

Although the total length of the WOWS program is seven weeks, consisting of two, three-hour sessions each week, a combination of university-mandated safety modules and university holidays limit the total number of sessions for hands-on research experience to six sessions plus a session for presenting their research to the other WOWS students. The schedule used for these sessions is shown in Table A-1. For the introductory session, multiple documents were prepared to outline both the schedule of the program and to introduce the E. coli cloning procedure. Additionally, documents were created for each following session outlining the protocols of the steps to be performed on that day. These documents have been collected in Appendix B. Students were then guided though the cloning process.

Table A-1: Schedule for the E. coli cloning curriculum for the WOWS program.

Session Number Session Description and Date 1: July 6, 2017 Introduction to the cloning process and elastin peptides. Discussion of general lab techniques such as pipetting and autoclaving. Selection of binding tags and preparation of liquid media and agar plates. 2: July 11, 2017 Demonstration of streaking cell cultures on agar plates and initiating liquid cultures. Purification of the pET-EL48 plasmid from pre- grown liquid cultures of E. coli. 3: July 13, 2017 Digestion of purified pET-EL48 plasmid with enzymes XhoI and AgeI. Perform agarose gel electrophoresis to separate the digested plasmid. Image the agarose gel, excise the appropriate bands, and extract the digested DNA. 4: July 18, 2017 Ligation of binding tags into the pET-EL48. Transformation of ligated plasmids into E. coli. 5: July 20, 2017 Purification of DNA from pre-grown liquid cultures of E. coli containing the transformed the modified pET-EL48 plasmids. 6: July 25, 2017 Digestion the purified pET-EL48 plasmids containing the binding- tag inserts. Perform agarose gel electrophoresis to check for the inserts. Work with the students on their presentations. 7: July 27, 2017 Final meeting. Students present on their research experiences over lunch and share their experiences by touring the multiple labs where WOWS students have worked on their projects.

A-3 WOWS Survey Results

At the beginning of the WOWS program, the participants were surveyed with questions designed to gauge interest in and knowledge of the chemical engineering profession. The success of the program was determined by giving the same survey at the end of the program to monitor how the students’ interest in chemical engineering changed in response to their experience. Additional questions were also given to assess the participants’ enjoyment of the program and their understanding of their individual projects.

The results of these surveys are shown in Figure A-1, Figure A-2, and Figure A-3.

Figure A-1: Average responses to survey questions by students in the

WOWS Program from before and after participation in the program (Pre and Post, respectively). For each of the six questions represented here, a response of “5” corresponds to “Strongly Agree” while a response of “1” corresponds to “Strongly Disagree.” The six questions are as follows:

Question 1: I am interested in a profession where I get to help people.

Question 2: I am confident working in a laboratory.

Question 3: I understand what chemical engineers do.

Question 4: I think chemical engineering is a field where you can help

people.

Question 5: I am considering chemical engineering as a career option.

Question 6: I know what classes to take if I want to prepare for a chemical

engineering degree.

Figure A-2 Average responses to survey questions about career opportunities for chemical engineering majors by students in the WOWS

Program from before and after participation in the program (Pre and Post, respectively). For each position, labeled 1 through 7, students were asked if a chemical engineering degree could allow for entry into the field. The seven fields are as follows: 1. Chemical process designer; 2. Worker as part of a team; 3. Biotechnology 4. Energy; 5. Environment; 6. Medical Doctor;

7. Lawyer.

Figure A-3 Average responses to survey questions about the WOWS program by student participants after participation in the program.

Questions were designed to assess participant enjoyment of the program and understanding of the individual hands-on research project. For each of the nine questions represented here, a response of “5” corresponds to “Strongly

Agree” while a response of “1” corresponds to “Strongly Disagree.” The nine questions are as follows:

Question 1: Overall, I enjoyed participating in the WOWS program. Question 2: I enjoyed conducting research in a laboratory. Question 3: I understand the project I was working on this summer. Question 4: My graduate mentors were helpful in increasing my understanding of my project. Question 5: I enjoyed the presentations about chemical engineering and career options. Question 6: My faculty mentor was helpful in increasing my knowledge about chemical engineering and career options. Question 7: In the future, I am more likely to take classes related to chemical engineering because of this program. Question 8: In the future, I am more likely to participate in research because of this program. Question 9: I would recommend the WOWS program to a friend.

Figures A-1, A-2, and A-3 show the success of the WOWS program. Figure A-1 highlights the program’s success in educating the WOWS students on working in the laboratory environment and generally about chemical engineering profession and the skillset required for it. Figure A-2 further confirms that the WOWS program helped to educate the students on the career opportunities available for chemical engineers. Figure A-

3 specifically represents the success of the faculty and graduate mentors in creating an enjoyable environment for the WOWS students and in educating students specifically on their hands-on research projects as well as generally on career options in chemical engineering. Further, the WOWS program was successful in increasing interest in the chemical engineering profession as a career choice, as shown in Figures A-1 and A-3.

In summary, a cloning program was designed as part of the WOWS outreach program at Case Western Reserve University. Survey results of the program, in general, shows that it is a worthwhile endeavor for educating female high school students about chemical engineering.

Appendix B: WOWS Program Documents

Renner Lab-Specific Widening Opportunities for Women in Science Program Curriculum for Cloning in Escherichia coli

DNA is the genetic material in cells. The DNA (deoxyribonucleic acid) is made up of base-pairs; the bases include A, C, G, and T. Using the code in the DNA, the cells are able to make proteins, which do many of the cells’ functions. Proteins are basically a series of amino acids, you can think of proteins as buildings where amino acids are all the materials that go into the building (like bricks, pipes, windows, furniture). The processes by which cells convert the code of DNA into proteins is called transcription and translation. The main takeaway is that changing the DNA of a cell can change the amino-acid sequence used to make proteins, and thus change the function of the proteins all-together. This process is the basic concept behind "protein engineering," as we are trying to engineer proteins.

What we will be doing over the next few weeks is trying to manipulate the DNA inside of bacteria, Escherichia coli, or E. coli, so that it would produce a modified form of protein. We want E. coli to produce elastin (the stretchy protein in our skin) with a modification that allows it to bind to metals. The E. coli we already have contains DNA that codes for elastin (pET-EL48), so we want to change the DNA of the E. coli to produce a new version of elastin that can bind to certain metals. Basically, we will add DNA that encodes an amino acid sequence (in proteins) that is known to bind to certain elements (in our case, Gold, Silver, Platinum, Iridium, or Carbon) into the DNA of the cell at exactly the point where the DNA starts to encode the elastin. This way, we can get the cell to produce the elastin protein with an additional portion that will bind with metals. So basically, we will grow up some of the E. coli, take the DNA out of it, cut the DNA open, then combine it with the new metal-binding DNA, and finally insert it back in the cell. This process is described in the flowchart. Here is a description of each of the steps:

Grow Cells on Plates: In this step, we take the bacteria E. coli and grow it up on plates. This is done to get a sample of the E. coli. It already contains the DNA needed to produce elastin, and was given kanamycin (K) resistance so they will grow on the K-plates that we will make.

Pick Colonies/Initiate Liquid Cultures: This step is to take some of the colonies we will see on our plates and put them into our liquid 2xYT media. This media contains the "food" that the E. coli needs to grow, so this step is just to get the E. coli cells to grow and multiply so that we can get a lot of DNA from the cells.

DNA Purification: In this step, we will break down the cells which we will have grown up in the tubes and will purify the DNA so that we can use it in the future.

Digestion: Using enzymes, we will cut the DNA that already exists in E. coli. The two enzymes that we will use cut out a small section of the existing DNA.

DNA gel/imaging: After the Digestion, we will put the DNA samples into the gel. In a process called gel electrophoresis, we will put the gel in a device that places the gels in an electric field, and we will run it at 100 millivolts. Because DNA has a natural negative charge, it moves through the gel from the negative end to the positive end (opposites attract). Different sized strands of DNA move through the gel at different speeds, so it separates the DNA based on size. We will then take an image of the gel to show us that this indeed happened and that we have the right piece of DNA.

Cut and Purify DNA Band: We then use the transilluminator to look at and cut the bands of DNA that we want (the ones that encode elastin in this case). We put the cut gel pieces in the small tubes and extract the DNA from the gel. This gives us a concentrated cut piece of DNA.

Ligation: In this step, we combine the metal-binding DNA that we have with the original DNA from the cell. Because of the way we designed the metal-binding DNA, it will connect with the original E. coli DNA.

Transformation: In this last step we will put the DNA into competent cells (Cells designed to be extra willing to take up DNA). In this step, we add the new DNA to the cells and then "shock" them with the temperature cycling to get them to absorb the new DNA. When this step is done, will we plate out the new cells and we should get colonies of these new cells that have our new DNA. These cells should now produce the elastin that will bind to element you choose metal.

This process will allow us to make the protein elastin that will bind with the element you choose. Because elastin is stretchy, it can help stabilize other things that we want to hold to metals. For example, we could add these items into batteries which use one of these elements as an electrode.

Schedule: July 6th: Introduction to the cloning process and safety information. Go over handout and schedule and purpose of each day. Pick a metal-binding insert for insertion into E. coli. Make media and plates for future use. Review pipetting and sterilization.

July 11th: Streak a plate, pick colonies, and purify DNA. Purify the pET EL48.

July 13th: Digest DNA, run a gel and image (cutting the pET EL48 for insertion).

July 18th: Ligation and transformation.

July 20th: Purify DNA from the transformed colonies. Start work on presentations if time permits.

July 25th: Digest DNA from transformed colonies; check for inserts and work on presentations.

Available binding tags: Platinum, Gold, Silver, Carbon, Iridium.

Tasks for July 11

Streaking Plates of pet-EL48: 1) Obtain the necessary materials (torch, loop, plates, safety equipment) 2) Find the box in the -80C freezer on the top section located on the lowest left shelf labeled Mark’s Stocks. Remove a tube of pET-EL48. 3) Transfer a loop of cells from the stock solution onto the plate: a. Heat the loop until red hot – do this two times to sterilize the loop b. Heat the loop and insert it into one of the stock tube. Keep doing this until liquid is inside the loop c. Spread the liquid onto a section of the plate (K). Follow the pattern in the image below. 4) Label plate on the gel side and place plate in the incubator at 37°C with gel side up so that liquid won’t condense and fall onto the gel. 5) Place the stock back in the -80 freezer.

Picking Colonies / Initiating Liquid Cultures of pET-EL48 1) Bring the liquid culture tubes we made last week to the bench and the kanamycin stocks. 2) Obtain the plates I pre-made last week in the fridge. 3) Add 1µL antibiotic for every mL media in the tube – in our case add 7 µL antibiotic into each tube a. First turn on the torch and arrange the bench safely b. Use the pipette to take 7 µL of kanamycin from the tube. c. Take the metal top off of the culture tube and flame the top of the glass tube

d. Add the antibiotic without touching the sides of the glass tube with your pipette. e. Discard tip, flame top of glass tube again and cover with metal cap 4) Pick one colony a. Pick colony from plate with pipet tip. Try to just take one colony. b. Take the metal top off of the culture tube and flame the top of the glass tube c. Eject tip into tube with your pipet d. Discard tip, flame top of glass tube again and cover with metal cap 5) Place all tubes into the incubator at 37C and shake overnight. DNA Purification 1) Remove the pre-made liquid cultures from the incubator. 2) Add the bacteria culture into micro-centrifuge tubes in even amounts. 3) Centrifuge for 3 minutes at speed 6800g. 4) Pour off the supernatant and refill culture then repeat step c. Run this step multiple times so that about 2 liquid culture tubes are used in each micro-centrifuge tube. 5) Resuspend pellet bacteria in 250μl P1 buffer. 6) Add 250 μL buffer P2 and invert tubes 4-6 times to mix well. (They will turn blue) 7) Add 350 μL buffer N3 and invent tubes 4-6 times to mix well. 8) Centrifuge for 10 minutes at 16000g. 9) Apply 800μl supernatant to Spin Column and centrifuge for 1min and then discard the flow-through. 10) Add 0.75ml buffer PE and centrifuge for 1min. 11) Discard the flow-through and centrifuge for 1 min to remove residual wash buffer. 12) Place the Column in 1.5ml micro-centrifuge tubes and add 50μl buffer EB. 13) Let them stand for 1 min and then centrifuge for 1 min. 14) Measure the concentration, label them and save them in refrigerator.

Tasks for July 13

1. Digestion of purified pET-EL48 DNA a. Obtain the following materials: Purified pET-EL48 plasmid, Enzymes AgeI and XhoI, 10x NEB Buffer. b. Using the pET-EL48 concentration, determine the volume required to have 1 µg. c. Make up the Digestion recipe. Add sterilized water first and enzymes last: i. Restriction enzyme XhoI 1μL ii. Restriction enzyme AgeI 1μL iii. pET-EL48 DNA 1μg iv. 10X NE Buffer 5μL v. Total reaction volume 50μL d. Incubate at 37℃ for 15 minutes.

2. Running DNA gels a. While digestion is incubating, create an agarose gel (3%) using the following recipe: i. 2.25g agarose ii. 75ml TAE Buffer b. Microwave the agarose and mix it well until it’s clear (about 2 minutes). c. Add 7.5μl stain to color the gel solution and mix it well. d. Pour the agarose into a gel tray with the well comb in place. Make sure that the gel tray is level and there are no leaks. While gel is drying, obtain loading dye and the DNA ladder. e. Once solidified, transfer the agarose gel into the gel (gel electrophoresis unit) f. Fill gel box with 1xTAE until the gel is covered. g. Add 10 µL loading dye to samples h. Load the ladder into the first lane of the gel. Be careful to make sure that the pipette tip is in the well. Do not release the ladder or samples too quickly. i. Load the samples into additional wells of the gel j. Run the gel at 80-150 V until the dye line is approximately 75-80% of the way down the gel. k. Turn OFF power, disconnect the electrodes from the power source, and then carefully remove the gel from the gel box.

3. Imaging the gels and cutting band a. Turn on the power of c300 and open the software. b. Switch to “GEL” option and choose “EPI BLUE” and choose “AUTO EXPOSURE”

c. Slowly and carefully slide the gel onto the tray inside the c300. d. Close the door and press “capture.” Once the picture is taken, save the image. e. Transfer the gel to the transilluminator. Turn on the transilluminator and observe the gel through the orange shield. Locate the desired bands. f. Use the razor blade to cut out the desired bands. Take care not to cut yourself. Try to limit the size of the gel while still cutting out all of the sample. g. Save these gel samples in the freezer at -20℃. 4. Extract the DNA from the Gel a. Follow the Gel Extraction Kit protocol: b. Pre-warm the dry bath to 50°C. c. Weigh the gels and add 3 volumes buffer QG to 1 volume gel (100mg gel ~ 100μl). d. Incubate at 50℃ for 10 minutes. Vortex the tube every 2-3 min to help dissolve gel. e. Add 1 gel volume isopropanol and mix. f. Add sample to the QIAquick column and centrifuge for 1 min. (Remember to balance the centrifuge). g. Discard the flow-through. h. Refill the column and repeat step e and f until all the samples were done. i. Add 750μl buffer PE (ethanol added) to the column and centrifuge for 1 min then discard the flow-through. j. Place the column in a 1.5ml micro-centrifuge tube. k. Add 30μl buffer EB, stand for 1 min and centrifuge for 1 min. l. Measure the concentration of DNA using the QuickDrop and store at -20℃ for next time.

Tasks for July 18 1. Anneal Oligonucleotides for Binding Tags a. Follow the IDT Protocol for annealing oligonucleotides (oligos). Make sure to use IDT Nuclease-free duplex buffer and not distilled water. 2. Ligation a. Obtain the following materials: extracted, digested pET-EL48 DNA, annealed oligos, nuclease free duplex buffer, 10x NEB T4 Ligase Buffer, T4 DNA Ligase. b. Create the following mixtures of these materials. Multiple solutions are made to try to find the ideal vector-to-insert ratio. c. Add the T4 DNA Ligase last. 1:10 3:3 10:1 (-) control Vector .7 l 2.1 l 7 l 3 l Insert 7 l 2.1 l .7 l 0 l Water 4.8 l 8.3 l 4.8 l 9.5 l 10x buffer 1.5 l 1.5 l 1.5 l 1.5 l ligase 1 l 1 l 1 l 1 l Total 15 l 15 l 15 l 15 l d. Allow the mixtures to incubate at room temperature for 10 minutes. e. Stop the reaction after 10 minutes by heat shocking at 65 °C. 3. Transformation a. Thaw competent cells (DH5α), and four tubes on ice. b. Add 50 μL cells into each of the tubes, refreeze unused cells immediately. c. Add 5 µL from each of the above ligation mixtures to the tubes of competent cells. d. Incubate tubes on ice for 30 minutes. e. Heat-shock the cells for 20 seconds in a 42C water bath without shaking. f. Place the tubes on ice for 2 minutes. g. Add 950μL of pre-warmed 2x YT media to each tube. h. Incubate the tubes for 1 hour at 225 rpm(37°C) i. Add 100μl from each tube to a 2x YT agar plate with kanamycin. Spread the cells across the plate evenly using the spreader: i. Clean the spreader with ethanol. ii. Use the flame to boil the ethanol off of the spreader. iii. Use the spreader to evenly distribute the bacteria over the plate. j. Store the remaining transformation reaction at 4°C, so that more cells can be plated if needed. k. Incubate the plates overnight at 37°C.

Tasks for July 20

Today, we will purify the DNA from the transformed E. coli colonies. I picked the colonies and grew up liquid cultures yesterday so that we can purify DNA today. After purification, we will start working on the final presentation.

DNA Purification 1) Remove the pre-made liquid cultures from the incubator. 2) Add the bacteria culture into micro-centrifuge tubes in even amounts. 3) Centrifuge for 3 minutes at speed 6800g. 4) Pour off the supernatant and refill culture then repeat step c. Run this step multiple times so that about 2 liquid culture tubes are used in each micro-centrifuge tube. 5) Resuspend pellet bacteria in 250μl P1 buffer. 6) Add 250 μL buffer P2 and invert tubes 4-6 times to mix well. (They will turn blue) 7) Add 350 μL buffer N3 and invent tubes 4-6 times to mix well. 8) Centrifuge for 10 minutes at 16000g. 9) Apply 800μl supernatant to Spin Column and centrifuge for 1min and then discard the flow-through. 10) Add 0.75ml buffer PE and centrifuge for 1min. 11) Discard the flow-through and centrifuge for 1 min to remove residual wash buffer. 12) Place the Column in 1.5ml micro-centrifuge tubes and add 50μl buffer EB. 13) Let them stand for 1 min and then centrifuge for 1 min. 14) Measure the concentration, label them and save them in refrigerator.

Tasks for July 25

Today, we will digest the DNA samples we purified last time. We will then run a DNA gel, and we might be able to see the inserts (the binding tags we cloned into the pET- EL48 Vector). While the gel is running and after we finish all-together, we will finish up the presentation together. 1. Digestion of purified pET-EL48 DNA e. Obtain the following materials: Purified pET-EL48 plasmid, Enzymes AgeI and XhoI, 10x NEB Buffer. f. Using the pET-EL48 concentration, determine the volume required to have 1 µg. g. Make up the Digestion recipe. Add sterilized water first and enzymes last: Restriction enzyme XhoI 1μL Restriction enzyme AgeI 1μL pET-EL48 DNA 1μg 10X NE Buffer 5μL Total reaction volume 50μL h. Incubate at 37℃ for 15 minutes. 2. Running DNA gels a. While digestion is incubating, create an agarose gel (3%) using the following recipe: iii. 2.25g agarose iv. 75ml TAE Buffer b. Microwave the agarose and mix it well until it’s clear (about 2 minutes). c. Add 7.5μl stain to color the gel solution and mix it well. d. Pour the agarose into a gel tray with the well comb in place. Make sure that the gel tray is level and there are no leaks. While gel is drying, obtain loading dye and the DNA ladder. e. Once solidified, transfer the agarose gel into the gel (gel electrophoresis unit) f. Fill gel box with 1xTAE until the gel is covered. g. Add 10 µL loading dye to samples h. Load the ladder into the first lane of the gel. Be careful to make sure that the pipette tip is in the well. Do not release the ladder or samples too quickly. i. Load the samples into additional wells of the gel j. Run the gel at 80-150 V until the dye line is approximately 75-80% of the way down the gel. k. Turn OFF power, disconnect the electrodes from the power source, and then carefully remove the gel from the gel box.

3. Imaging the gels and cutting band a. Turn on the power of c300 and open the software. b. Switch to “GEL” option and choose “EPI BLUE” and choose “AUTO EXPOSURE” c. Slowly and carefully slide the gel onto the tray inside the c300. Close the door and press “capture.” Once the picture is taken, save the image.

Appendix C: Azotobacter Vinelandii and Nitrogenase Manual

Azotobacter Vinelandii and Nitrogenase Manual Royce D. Duda

Protocols developed are based on procedures used by the Minteer Lab at the University of Utah and the Dean Lab at Virginia Polytechnic Institute.

Media and Buffers for A. vinelandii growth 100x Phosphate Buffer K2HPO4 32.0 grams KH2PO4 8.0 grams Dissolve into 350 mL water. Then, bring up final volume to 400 mL and autoclave.

10x Salts Solution Sucrose 180. grams MgSO4 • 7H2O 1.8 grams CaCl2 • 2H2O 0.864 grams Dissolve sugar into 700 mL distilled water. Add remaining chemicals one at a time. Bring final volume to 900 mL with distilled water. Autoclave.

1000x Fe Solution FeCl3 810 milligrams

Dissolve FeCl3 in distilled water and bring final volume to 50 mL. Sterilize using filter.

1000x Mo Solution Na2MoO4 128 milligrams

Dissolve Na2MoO4 in distilled water and bring final volume to 50 mL. Sterilize using filter.

100x NH4 Solution NH4OAc 15.4 grams

Dissolve NH4OAc in distilled water and bring final volume to 200 mL. Autoclave.

Agar Plates and Liquid Culture Media Agar Plates Recipe for 500 mL or approximately 20 plates:  Add 8 grams of Agar into 440 mL distilled water. Autoclave.  When cooled, add: 5 mL 100x Phosphate Buffer, sterile. 50 mL 10x Salts Solution, sterile. 0.5 mL 1000x Fe Solution, sterile. * 0.5 mL 1000x Mo Solution, sterile. * 12.5 mL 100x NH4 Solution, sterile. * DO NOT use Fe Solution or Mo Solution when making Competent Plates.  If needed, the following antibiotics can be added at the listed final concentrations: Kanamycin 5.0 mg/mL Ampicillin 50 mg/mL Chloramphenicol 1600 mg/mL  Pour out Agar Medium into approximately 20 separate plates. Once cooled, refrigerate at 4°C. Before streaking cells, incubate plate at 30°C. Liquid Culture Media for Individual Tubes Recipe for approximately 72, 7 mL tubes. 500 mL total.

 Into a 1000 mL media bottle, add: 440 mL Distilled Water 50 mL 10x Salts Solution  Aliquot this mixture into 72 culture tubes, 6.9 mL per tube. Autoclave.  In one sterile 1.5 mL centrifuge tube, add: 0.60 mL 1000x Fe Solution, sterile. 0.60 mL 1000x Mo Solution, sterile.  Transfer 14 µL of this 1000x Fe, Mo solution into each 7 mL culture tube, using a flame to make sure contamination of media does not occur.  In one sterile 15 mL centrifuge tube, add: 6.0 mL 100x Phosphate Buffer Solution, sterile. 6.0 mL 100x NH4 Solution, sterile.  Transfer 0.14 mL of PO4-NH4 mixture from 15 mL centrifuge tube into each liquid culture tube, using a flame to make sure contamination does not occur. When complete, media should be transparent with a very slight yellow tint.

Liquid Culture Media Recipe for 500 mL, for use in one 2 L baffled flask.  In a 2 L baffled flask, add: 440 mL Distilled Water 5 mL 100x Phosphate Buffer.  Autoclave Flask. When cool, add: 50 mL 10x Salts Solution, sterile. 0.5 mL 1000x Fe Solution, sterile. 0.5 mL 1000x Mo Solution, sterile. 5 mL 100x NH4 Solution, sterile. * nd * DO NOT use NH4 Solution during the 2 portion of the A. vinelandii derepression protocol, when A. vinelandii is being derepressed. When complete, solution will have a transparent light-yellow color. Liquid Media for Starter Culture Recipe for 20 mL, for use in one 125 mL flask.  In a 125 mL flask, add: 18.0 mL Distilled Water 2.0 mL 10x Salts Solution  Autoclave Flask. When cool, add: 200 µL 100x Phosphate Buffer, sterile. 200 µL 100x NH4 Solution, sterile. 20.0 µL 1000x Fe Solution, sterile. 20.0 µL 1000x Mo Solution sterile.  All solutions should be added one at a time. When finished, solution should be light-yellow.  To begin starter culture growth, add 0.5 mL DMSO stock and grow overnight. DMSO Stock Buffer Recipe for 10 mL total stock, for use in 10, 1 mL tubes. Must use immediately.  In one 15 mL sterile centrifuge tube, add: 9.0 mL Sterile Water 98 µL 100x Phosphate Buffer 0.7 mL DMSO (Dimethyl Sulfoxide) * * NOTE: Do not autoclave or filter 100% DMSO. It will dissolve filter.  Mix well. Aliquot into 10 sterile 1.5 mL Eppendorf tubes (0.97 mL in each tube).  Add one loop of A. vinelandii cells grown on agar plates into each tube.  Vortex until cell loop is completely resuspended. Store in -80°C.

Solutions for A. Vinelandii Lysis and Nitrogenase Purification Note: Each of the following solutions should have sodium dithionite (sodium hydrosulfite, referred from here on as solely “dithionite”) added at a concentration of 2 mM directly before use. Dithionite is used to reduce residual oxygen but degrades quickly (approximately 2 days), so it must to be added to solution directly before use. Additionally, solutions need to be thoroughly degassed in the anaerobic chamber before the addition of dithionite, otherwise the dithionite will be oxidized and will be ineffective. The final pH of each solution should be 8.0 unless otherwise indicated. Letters next to the following solutions correspond to those used by the Minteer Lab.

Q Sepharose Solution A (Masses given for 500 mL) TRIS Base 50 mM 3.028 grams Dissolve into 500 mL distilled water. Add 174 mg dithionite before use. This is the Q Sepharose wash buffer. Q Sepharose Solution B (Masses given for 500 mL) TRIS Base 50 mM 3.028 grams NaCl 1.0 M 29.22 grams Dissolve into 500 mL distilled water. Add 174 mg dithionite before use. This is the Q Sepharose elution buffer. Derepression Resuspension Buffer C (Masses given for 100 mL final solution) TRIS Base 50 mM 606 milligrams NaCl 100 mM 580 milligrams Glycerol 37% 37 milliliters Dissolve TRIS Base, NaCl into 63 mL distilled water. Add 37 mL glycerol to bring final volume to 100 mL. Mix thoroughly. Add 34.8 mg dithionite after cells are resuspended and the solution has been degassed. Osmotic Shock Buffer (Masses given for 100 mL final solution) TRIS Base 50 mM 606 milligrams NaCl 100 mM 580 milligrams Dissolve into 100 mL distilled water. Alternatively, mix 90 mL Q Sepharose Solution A with 10 mL Q Sepharose Solution B. Add 34.8 mg dithionite after solution has been degassed and before use. S-200 Buffer D (Masses given for 500 mL final solution) TRIS Base 50 mM 1.42 grams NaCl 500 mM 11.6 grams Dissolve into 500 mL distilled water. Add 174 mg dithionite after solution is degassed.

HisTrap Binding Buffer E (Masses given for 250 mL final solution) TRIS Base 20 mM 606 milligrams NaCl 500 mM 7.3 grams Dissolve into 250 mL distilled water. Final pH should be 7.9. Add 87.0 mg dithionite after solution has been degassed. HisTrap Elution Buffer F (Masses given for 250 mL final solution) TRIS Base 20 mM 606 milligrams NaCl 500 mM 7.3 grams Imidazole 250 mM 4.25 grams Dissolve into 250 mL distilled water. Final pH should be 7.9. Add 87.0 mg dithionite after solution has been degassed. Nitrogenase Dilution Buffer G (Masses given for 250 mL final solution) TRIS Base 50 mM 1.51 grams EDTA 5.0 mM 420 milligrams Dissolve into 250 mL distilled water. Add 87.0 mg dithionite after solution has been degassed. Degassing Protocol: Note: This protocol is the same for each of the above solutions.

 Insert solution into anaerobic chamber. Media bottle caps should not be left on while adding the solutions to the chamber as the air inside the media bottles will contaminate the inside of the chamber with oxygen.  After solution has been added to the chamber, allow solution to sit without a cap for approximately one hour. This will allow oxygen dissolved in solution to equilibrate out into the chamber.  If solution is going to be used during the day, add the appropriate quantity of dithionite to the solution.  After the solution has been degassed, close media bottle with cap. Otherwise, the low humidity within the chamber will cause rapid evaporation of water causing the solutions to increase in concentration.

Solutions for Nitrogenase Concentration and Activity Assays Biuret Reagent (Concentration Assay) (Masses given for 100 mL) NaOH 200 mM 0.800 grams Potassium Sodium Tartrate 32 mM 0.903 grams CuSO4 • 5 H2O 12 mM 0.300 grams KI 30 mM 0.498 grams Create 0.2 M NaOH by dissolving solid NaOH into 100 mL of distilled water or alternatively diluting 20 mL 1.0 M NaOH into 80 mL distilled water. Pour the base into water and not the water into the base. Once the 0.2 M NaOH is created, serially dissolve the Potassium Sodium Tartrate, CuSO4 • 5 H2O, and KI into the 0.2 M NaOH in order (Potassium Sodium Tartrate first, KI last) making sure each ingredient is totally dissolved before proceeding to the next. If a dark precipitate forms, discard and restart. Miscellaneous Additional Concentration Assay Solutions: Note: When making these solutions, make sure to record the EXACT masses used for each solute in a notebook, the values will be important when determining concentration. Larger volumes of the following solutions may be made for accuracy.

BSA Standard, 10 mg/mL: Dissolve 10 mg BSA into 1 mL DI H2O. Dithionite and TRIS Standard (2 mM dithionite, 50 mM TRIS): Dissolve 6.06 mg TRIS Base and 0.348 mg sodium dithionite into 1 mL DI H2O. ATP-Regenerating Solution (Acetylene Assay Stock Solution) (Quantities given for 13 mL final volume, pH = 7.0) Distilled Water Solvent 13 mL MgCl2 6.7 mL 100 µL of 1.0 M MgCl2 MOPS 100 mM 313.5 mg Creatine Phosphate 30 mM 146.8 mg (for FW = 327.2) * ATP 5 mM 41 mg Creatine Phosphokinase 0.2 mg/mL 3.0 mg BSA 1.3 mg/mL 18.0 mg

Before beginning preparation of the ATP-Regenerating solution, prepare a 1.0 M MgCl2 solution for use in making the solution (Dissolve 2.03 grams MgCl2 • 6 H2O in 10 mL DI water). Once MgCl2 solution has been prepared, dissolve 100 µL into 13 mL DI H2O. Serially dissolve MOPS, Creatine Phosphate, and ATP. Adjust solution to pH = 7.0. Bring solution inside of anaerobic chamber and serially dissolve Creatine Phosphokinase and BSA (Bovine Serum Albumin) into the solution. * If using Creatine Phosphate with FW = 279, add 122.5 mg to the solution.

Agar Plates and Liquid Media for A. vinelandii Competence and Transformation Agar Plates Basic Recipe for 500 mL or approximately 20 plates: NOTE: Certain ingredients are not included for different plates. See below for details on for each type of plate.  Add 8 grams of Agar into 440 mL distilled water. Add 0.25 grams of Yeast Extract if making Azotobacter Growth Plates. Autoclave.  When cooled, add: 5 mL 100x Phosphate Buffer, sterile. 50 mL 10x Salts Solution, sterile. 0.5 mL 1000x Fe Solution, sterile. 0.5 mL 1000x Mo Solution, sterile. 12.5 mL 100x NH4 Solution, sterile. For the following plate types, do not add these ingredients: Modified Burk Competent Plates: Yeast Extract. 1000x Fe, Mo Solutions. Dean Method Competent Plates: Yeast Extract. 1000x Mo Solution. Azotobacter Growth Plates: 100x NH4 Dean Method Transformation Plates: Yeast Extract, 1000x Fe and Mo Solutions, 100x NH4 Solution.

 If needed, the following antibiotics can be added at the listed final concentrations: Kanamycin 5.0 mg/mL Ampicillin 50 mg/mL Chloramphenicol 1600 mg/mL  Pour out Agar Medium into approximately 20 separate plates. Once cooled, refrigerate at 4°C. Before streaking cells, incubate plate at 30°C. Competent Liquid Culture Media Recipe for 50 mL, for use in one 125 mL flask.  In a 125 mL flask, add: 44 mL Distilled Water 0.5 mL 100x Phosphate Buffer.  Autoclave Flask. When cool, add: 5 mL 10x Salts Solution, sterile. 0.5 mL 100x NH4 Solution, sterile.

Miscellaneous Solutions 1x Burk Buffer (1x Phosphate Buffer) In one, 15 mL sterile centrifuge tube, add: 10 mL Sterile Water 100 µL 100x Phosphate Buffer Mix well. 1x MOPS Transformation Buffer (Masses given for 10 mL final solution) MOPS 20 mM 41.8 milligrams MgSO4 • 7H2O 20 mM 7.3 grams Dissolve into 9 mL distilled water in a 50 mL sterile centrifuge tube. Adjust pH to 7.2 using NaOH. Bring final volume to 10 mL using distilled water. Filter sterilize and aliquot into 1 mL samples in 1.5 mL Eppendorf centrifuge tubes. Store at -80°C.

Preparation of Nitrogenase Growth of Azotobacter vinelandii on Agar Plates

 Incubate Agar Plate at 30°C for 15 minutes. When preparing nitrogenase, use a normal Modified Burk Media plate.  After agar plate has been incubating for 10 minutes, remove a DMSO stock solution of A. vinelandii from the -80°C freezer.  As soon as A. vinelandii stock begins to thaw, remove the plate from the incubator.  Open agar plate immediate beneath the flame from a propane torch. * Transfer 50 µL A. vinelandii DMSO stock as soon as the necessary quantity thaws. ** Use sterile spreading rod (dipped in ethanol, and burned off with the flame) to evenly spread the cells across the agar plate, while constantly keeping the agar plate directly underneath the flame. * When no antibiotics are used, contamination likely unless the agar plate is kept directly underneath the flame the entire time it is open. ** If possible, use a sterile pipette tip to scrape frozen DMSO stock onto the agar plate. This avoids thawing and refreezing in the stock.

 Once the cells are evenly distributed, close agar plate and insert into incubator.  Immediately place DMSO stock back into the -80°C freezer. Thawing and refreezing can kill the cells.  Keep plate in incubator at 30°C for 2-3 days required to see substantial growth.  When using normal modified Burk Media plates, cells will grow to be white to tan in color. When using Competent plates (modified Burk Media – Fe and Mo solutions, the cells should grow to be neon green. Starter Culture for A. Vinelandii Culture Growth (Recommended but Optional)  If using DMSO stock, directly add 0.5 mL DMSO A. vinelandii stock into 20 mL starter culture. Use flame to ensure media remains sterile when adding cells.  If using A. vinelandii directly from plate, first make 1x Phosphate Buffer. In a 1.5 mL Eppendorf tube, add: 970 µL Sterile Water 9.7 µL 100x Phosphate Buffer  Add one loop of cells into this 1x Phosphate Buffer using a sterile loop.  Vortex Eppendorf tube to fully break up the cell loop.  Add 500 µL from this tube into 20 mL starter culture media. Use flame to ensure media remains sterile when adding cells.  Incubate flask overnight at 30°C at 13A-175 RPM. Overnight, cells should grow to be white-ish in color. OD600 should reach approximately 1.0.

Growth of Azotobacter vinelandii in 500 mL Media for Derepression

 Prepare 500 mL modified Burk Media in Baffled 2 L baffled flask (Recipe on Page 3). 500 mL of media should produce approximately 3 grams of cells.  Add 10 mL starting culture to baffled flask. Use torch to keep media sterile.  Incubate culture at 30°C and at 250 rpm overnight. In the morning, monitor the culture. If it reaches an OD600 of 1.5 to 1.7, remove culture from the incubator. If the OD600 of the culture shoots above 1.7, it can still be used. Derepression

 Transfer 500 mL culture into 2, 250 mL centrifuge tubes. Balance the two tubes.  Centrifuge tubes at 4,000 g for 10 minutes.  Resuspend the cells in 500 mL Derepression Media. (Recipe on Page 3. NH4 Solution is NOT ADDED).  Once cells are resuspended, take 2, 1 mL samples. Mark this sample, “Repressed, T=0.” Centrifuge pellet and store in -20°C (Dean).  Incubate the rest of the media/cells at 30°C and 250 rpm for approximately 3.5 hours (Never less than 3 hours and never more than 4 hours. 3.5 hours is ideal).  After media is removed from the incubator, transfer to 2, 250 mL centrifuge tubes. Balance tubes. Centrifuge at 4,000 g for 5 minutes.  Remove cells (pellet). If Liquid Nitrogen is available, flash freeze in liquid nitrogen (Milton). If liquid nitrogen is not available, cells can be frozen in the -80°C freezer. They may also be stored in the -20°C freezer (Dean). Cell Lysing Preparation  Cool centrifuge to 4°C. Change rotor to allow for 50 mL Oak Ridge centrifuge tubes.  Insert desired cells, Derepression Resuspension Buffer C, dithionite, and Oak Ridge centrifuge tubes (if necessary) into anaerobic chamber.  Dissolve A. vinelandii cells in Buffer C in a 1:2 Ratio (e.g. 25 g cells dissolved in 50 mL Buffer C). Stir gently to dissolve and melt A. vinelandii. Solution should be light tan, like coffee with milk.  Once fully mixed, transfer the homogeneous solution into an appropriate number of Oak Ridge centrifuge tubes (containing O-ring) to keep atmosphere inside tube anaerobic  Balance centrifuge by filling up opposite centrifuge tubes with water. If any tube of cells is too heavy to balance, glycerol can be used.  Centrifuge tubes at 4°C and 12,000 g for 20 minutes.  While centrifuging, make Osmotic Shock Buffer if needed. For cell lysis, the same volume is needed as the volume of Buffer C used, plus a little more for cleaning the centrifuge tubes.

Cell Lysis (Most important step in Nitrogenase Purification)  After centrifuging cells is complete, add the centrifuge tubes, ice, marbles (if needed) and deoxyribosenuclease from bovine pancreas (“DNase”) into the anaerobic chamber.  Mark the solution level on the centrifuged tubes with a marker and remove the supernatant. Cell pellet should remain light tan.  Add some water into the DNase via pipette. Mix this solution with the pipette.  Split the DNase solution evenly between all tubes. Add 3 marbles into each tube. Mix.  Add Osmotic Shock Buffer into the centrifuge tubes up to the drawn line.  Close the tubes quickly and vigorously shake the tubes until there is no bacteria remaining on the walls of the centrifuge tubes.  Place tubes on ice and wait about 10 minutes for the tubes to get cold. Make sure the Oak Ridge centrifuge tubes are sealed with an O-ring.  Balance centrifuge tubes again as mass in tubes will change slightly.  Centrifuge at 4°C and 26,000 g for one hour. After centrifugation, the supernatant should be dark. After moving the centrifuge tubes back inside the anaerobic chamber, pour supernatant into a beaker for FPLC purification. Fast Protein Liquid Chromatography (FPLC) Purification Note: His-Tagged MoFe Nitrogenase is purified using the HisTrap column followed by the Q Sepharose column for complete purification. The Fe Protein will not bind to the HisTrap Column, so the flow-through must be collected. Fe Nitrogenase is purified first with the Q Sepharose column and then with the S-200 column. Wild-type MoFe cannot be purified with the HisTrap column and thus must be purified through Q Sepharose and S-200. HisTrap Purification (Distinguishes by Affinity)  Turn on the FPLC. Both the HisTrap column and FPLC itself should be filled with a 20% ethanol in water solution during down time.  Run the entire system with ethanol to flush the system. Flow Rate can be as high as 5.0 mL/minute.  Remove FPLC tubes A and B from ethanol mixture and add them to HisTrap Binding Buffer E and HisTrap Elution Buffer F respectively. Flush tube A with Buffer E and tube B with Buffer F. Use remaining Osmotic Shock Buffer from Cell Lysis to clean out the substrate tube. During these steps, the HisTrap Column SHOULD NOT be connected.  Pause the FPLC. Connect the HisTrap Column using the following procedure: This procedure should be followed directly to ensure air does not enter the HisTrap column.  Unscrew the FPLC tube where the HisTrap column should go.  Unscrew the top cover of the HisTrap column.  Put FPLC tube into the top of the HisTrap column. DO NOT screw column into place.

 Run some of the solution from the sample tube through the FPLC and into the top of the HisTrap Column to remove air. Pause Run.  Screw the FPLC tube into the HisTrap column.  Unscrew the bottom cover of the HisTrap Column. Run sample solution through the FPLC and the column. Turn the column upside down to ensure all air has been removed.  Connect the FPLC tube to the bottom of the HisTrap Column.  Run FPLC with the sample tube to flush out the HisTrap Column.  When the column has been sufficiently flushed out (this can be monitored by the UV and conductivity meters on the FPLC), pause the run. Switch the sample tube to the nitrogenase solution making sure not to allow air to enter the sample tube.  Run the nitrogenase sample through the HisTrap column. During this step, the nitrogenase should adsorb onto the HisTrap column. A dark ring should appear around the top of the HisTrap column. Make sure to switch the FPLC valve to solution A (HisTrap Binding Buffer E) before the nitrogenase sample is all used up and before air can enter the sample tube.  Once as much nitrogenase as possible is adsorbed onto the HisTrap column, run a mix of 92% Solution A (Buffer E) and Solution B (Buffer F) through the column. This produces a 20 mM Imidazole solution which should remove proteins that are lightly bound to the HisTrap column.  Once this 20 mM Imidazole solution passes through the column, the valve can be set to 100% B, sending a 250 mM solution of Imidazole through the HisTrap column. When this solution reaches the column, the dark ring of nitrogenase on the column should begin to migrate down the column and elute through the bottom. Elution should be run at 3 mL/minute. Exact speed can be calculated using a graduated cylinder.  When the nitrogenase is moved through the UV meter, the UV value in the Unicorn AKTA Start software should spike. When the UV reading begins to tick upwards, wait a few seconds and then transfer the FPLC elution tube into a separate vial. Continue to allow the nitrogenase solution to collect in the vial until the UV reading drops again. Wait a few more seconds and transfer the elution tube to a new vial.  At this point, 10 µL samples of the nitrogenase solution can be saved in Eppendorf tubes for further analysis (dot blot, protein gel, western blot, etc.).  If Q Sepharose purification is not going to be performed immediately, the nitrogenase vial should be closed with an airtight cover using the crimper. These vials can then be frozen in liquid nitrogen if available or in the -80°C freezer.  If the FPLC will not be immediately used for further purification, clean the FPLC tubes with 20% ethanol solution. After ending the run, remove the tubing from the peristaltic pump.  Remove the HisTrap column after it has been filled with 20% ethanol. Close the HisTrap column with the screw-on caps making sure not to allow air into the column.

Q Sepharose Purification (Distinguishes by Charge)  If not moving directly from HisTrap column, clean the FPLC tubes with ethanol (including sample tube and tubes A and B).  Transfer FPLC Tube A into Q Sepharose Solution A and FPLC Tube into Q Sepharose Solution B. Wash Tubes A and B. Wash FPLC sample tube with remaining Osmotic Shock Buffer (100 mM NaCl).  Dilute nitrogenase solution to 100 mM NaCl using Nitrogenase Dilution Buffer G. Since nitrogenase in HisTrap step is eluted at 500 mM NaCl, the nitrogenase sample should be diluted with 4 volumes of Buffer G. Dean et al. recommends diluting by at least 7 volumes.  Flush the entire system using a mix of 90% Solution A (0 mM NaCl) and 10% Solution B (1M NaCl). This produces a solution of 100 mM NaCl for flushing the FPLC. This removes any residual oxygen in the system due to the dithionite in Solutions A and B.  After FPLC tubes have been flushed, connect the Q Sepharose column using one of the following protocols: If the Q Sepharose column has a spring:  Make sure the spring-loader is filled with water. Connect the top of the column first so that no air gets into the top of the column.  Once the top is connected, remove the spring at the bottom of the column and connect the bottom to the FPLC. If the Q Sepharose column does not have a spring:  Follow the same protocol as the HisTrap column listed above (Pages 8 and 9) to ensure that no air enters the Q Sepharose column.  After the Q Sepharose column is connected to the FPLC, use the same 100 mM solution (90% Solution A, 10% Solution B) to wash the 20% ethanol solution form the column.  Load the DILUTED nitrogenase solution into the FPLC through the sample tube. With a NaCl concentration of 100 mM, nitrogenase should stick to the column.  When most of the nitrogenase solution has been added the FPLC, pause the flow and return to a flow of 100 mM NaCl using 90% Solution A and 10% Solution B.  Once all of the nitrogenase protein solution has moved through the column, pause the FPLC run again.  Increase the percentage of Solution B to 20% (This will create a 20 mM NaCl solution). Using the Unicorn Start FPLC computer program, set the percentage of Solution B to rise from 20% to 65% over a gradient. If running at 5 mL/min., use at least 10 column volumes. If running at 2 mL/min., running for 7 column volumes should be enough to effectively separate contaminants.  NOTE: The MoFe nitrogenase protein will elute at a NaCl concentration of between 280 mM and 300 mM. The Fe nitrogenase protein will at a NaCl concentration of between 380 mM and 400 mM.  Watch the dark band of nitrogenase adsorbed on the column. When the band on the column begins to move toward the bottom of the column, move the collection to a

separate vial to collect the eluting nitrogenase protein. This will correspond to a rise in UV absorbance.  After nitrogenase solution has been collected, it may be stored in a sealed vial and stored after frozen in liquid nitrogen or -80°C freezer. However, the NaCl solution must be removed from the nitrogenase. This is achieved while the nitrogenase solution is concentrated using a pressurized membrane filter process (See the LATER SECTION).  Transfer Tube A, Tube B, and the Sample tube into 20% ethanol. Clean each tube and the entire system and column with the 20% ethanol.  Remove the Q Sepharose column (bottom first). Make sure air does not enter the column by running the system with 20% ethanol during this process. Once the bottom has been capped, unscrew the top of the column and allow the ethanol to pool at the top. Screw in the cap to the column and then reattach the tubing to the FPLC in the same manner to ensure no air enters the system.  If finished for the day, remove the flexible tubing from the peristaltic pump. S-200 Purification (Distinguishes by Size) Note: For optimal results, samples must be concentrated before injection into the S-200 column. As the S-200 purification is a size-exclusion column, the protein does not bind to the column, but flows though the column at a rate related to its size. Therefore, it is important to have a concentrated sample so the entirety of the sample enters the column over the shortest possible time span. See the next section for the protocol for concentrating and desalting nitrogenase.  Clean the FPLC tubes with ethanol (including sample tube and tubes A and B).  Pause the FPLC. Connect the longer green tubing to the location where the column will be connected. Connect the tubing in the most downstream location possible first. Run the FPLC to force all the air out of the tubing. Once all air is removed, connect it back with the next piece of FPLC tubing.  Pour a small amount of Buffer D into a clean beaker. Add Tube A into the remaining Buffer D and add the sample tube into the small beaker containing Buffer D. (Tube B is not used in this portion of the purification. Make sure that the percentage of solution B used is 0%).  Run Buffer D through the system using the sample tube. Once the sample tube has been primed with Buffer D, switch the sample valve to draw from Tube A to prime the entire system in Buffer D. When stable UV and conductivity values are maintained, pause the system.  Connect the S-200 Column:  Make sure that the column is oriented properly on the ring stand. The spring-loaded pump is connected at the bottom of the column pushing solution upwards.  Remove the top cap of the column. The spring pump at the bottom of the column should force the storage solution out of the top of the column to ensure that no air enters the column.

 Run the FPLC at 0.5 mL/min. Unscrew the long tube and connect it to the top of the S-200 column, making sure that the solution is pooling at the top of the column and thus no air is entering the column.  Remove the spring pump from the bottom of the column and quickly connect it to the FPLC. Run Buffer D through the column until the UV and conductivity values level out.  Once the column is connected and equilibrated in Buffer D, the concentrated protein sample can be injected into the column through the sample tube.  When the sample has been almost completely injected, pause the FPLC system. Transfer the sample tube back to the beaker containing Buffer D taking great care not to allow air into the sample tube. Run the FPLC system to inject the sample remaining in the sample tube and pause the Run.  Resume the FPLC using the Buffer D from Tube A at 2 mL/min to elute proteins. Collect each peak as a fraction in vials. The samples should be run in an SDS-PAGE gel to confirm fractions containing the Fe protein or wild-type MoFe protein.  Once all proteins have been eluted from the column, pause the FPLC. Transfer the sample tube to 20% ethanol, making sure not to introduce air bubbles. Run the FPLC to clean the sample tube and pause the run.  Switch Tube A to 20% ethanol. Switch the sample valve to draw 20% ethanol out of Tube A. Run the FPLC at 5 mL/min to clean Tube A, the S-200 column, and the entire system. When the system is clean, reduce the flow rate to 0.5 mL/min.  Remove the S-200 column and reconnect the shorter tubing:  Disconnect the tubing from the bottom of the S-200 column. Allow 20% ethanol to drip from the column  Connect the spring pump to the bottom of the column, making sure that no air enters the bottom of the column. As soon as the pump is connected to the bottom of the column, immediately loosen the top connection of the column.  Completely unscrew the top of the column and slowly remove the tubing, allowing the 20% ethanol to pool at the opening. Close the top of the S-200 column.  Remove the long green tubing that had connected to the top of the column. Reconnect the short green tubing while the system is still running. Allow for all the air to be pumped out of the short tube.  Reconnect the short green tube to the FPLC, making sure to not allow air into the system by waiting for the ethanol solution to pool at the connection before screwing in the connection.  Allow the 20% ethanol to remain running through the system for a few more minutes to completely clean the FPLC System.  End and save the run using the UNICORN software. Remove the tubing from the peristaltic pump on the FPLC to finish.

Concentrating and Desalting Nitrogenase Samples (Amicon Stirred Cell)  Assemble the Amicon Stirred Cell. Make sure to choose the appropriate membrane: 100 kDa MWCO when concentrating the MoFe protein, 30 kDa MWCO when concentrating the Fe protein.  Pour the fractions containing the desired protein into the stirred cell. Securely fasten the top of the stirred cell making sure to include the O-ring so that gas does not escape.  Attach the inlet gas tube on the Amicon stirred cell to the ultra-pure argon inlet stream. Place the stirred cell on a magnetic stirrer and place the outlet tube into a collection vial or beaker.  Begin stirring the stir bar at a medium pace. Increase the ultra-pure argon pressure to approximately 50 PSI. DO NOT EXCEED 75 PSI.  Turn off the gas flow once the level inside the cell decreases to 1 or 2 mL.  Once filtration is complete, shut off the gas regulator. DO NOT REMOVE THE GAS INLET TUBING. Turn off the magnetic stirrer  Slowly raise the blue side-lock to slowly depressurize the system. Once the stirred cell has been completely depressurized, disconnect the inlet tubing at the point where it connects to the cell by pressing down the metal tab and pulling the inlet tube fitting away from the cover of the stirred cell.  Remove the cover and the stir bar. Recover the nitrogenase sample by pouring or pipetting the retentate into an airtight vial. Collect a small sample for use in an SDS- PAGE gel and a sample for the concentration assay.  Seal the airtight vial using the crimper. Freezing and Storing Nitrogenase Samples  Pour a small amount of liquid nitrogen out of the storage container and into the thermos-flask. Make sure to be wearing cryogenic cloves.  Using a syringe, remove about 0.1 mL of nitrogenase sample from the sealed vial. Place the needle of the syringe into the liquid nitrogen and quickly expel the nitrogenase sample into the liquid nitrogen. Pushing out the sample too slowly can cause the sample to freeze in the needle. If the needle freezes, lightly grab the needle with your gloved hand to warm it. The nitrogenase balls should freeze almost instantly.  Repeat the previous step, depositing nitrogenase balls until there is no more nitrogenase in the sealed vial.  Collect the nitrogenase sample balls and spoon them into an appropriate number of 1.5 mL Eppendorf tubes.  Store the 1.5 mL Eppendorf tubes in an appropriate location:  Liquid Nitrogen Storage Container: Eppendorf tubes stored in the liquid nitrogen storage container should be punctured at the top and the bottom (along with the box it is stored in) to allow liquid nitrogen to directly protect the samples.

 -80°C Freezer: Eppendorf tubes stored in the -80°C freezer should not be punctured. These tubes should be parafilmed to ensure freeze-drying does not occur. Alternatively, if desired, nitrogenase samples can be stored in specialized 1-2 mL tubes containing an O-ring.

Nitrogenase Concentration and Activity Assays Concentration Assay (Biuret Method)  Obtain a plate for use that can be read by a plate reader.  In the first column of the plate reader, make the following 60 µL mixtures using the BSA Standard Solution (abbreviated in the following table as “BSA”) and distilled water:

Row Volume BSA (µL) Volume H2O (µL) Total Volume (µL) [BSA] (mg/mL) 1 0 60 60 0 2 3 57 60 0.5 3 6 54 60 1 4 12 48 60 2 5 18 42 60 3 6 30 30 60 5 7 42 18 60 7 8 54 6 60 9 Note: Actual BSA concentration values should be calculated based from values actually used when creating the BSA standard solution.  Pipette 20 µL from each row into the first column in the plate to columns 2 and 3 to create 3 wells for each different concentration of BSA.  In 3 separate wells, pipette 20 µL 2 mM dithionite/TRIS standard solution (so there are 3 wells each containing 20 µL 2 mM sodium dithionite and 50 mM TRIS).  In 3 more separate wells, pipette 20 µL of the nitrogenase sample of unknown concentration (again, 20 µL in each well). Note: to conserve sample, wells containing nitrogenase can be diluted.  Add 180 µL Biuret Reagent into each well (for 200 µL total volume in each well). Wait 20 minutes.  After the 20 minutes, read the plate using a plate reader at λ = 550 nm. Export data to Excel.  In Excel, perform the following calculations:  Average each set of 3 wells together to get a single average for each set.  Subtract the average value for the distilled water (Row 1 in the table above) from each subsequent set of three wells.  Using the resulting average absorbance values for each of the following BSA solutions, plot absorbance as a function of concentration. Obtain a trend line. This calibration is used to find the nitrogenase concentration.  Subtract the average absorbance of the dithionite standard solution from the average absorbance of the nitrogenase solution.  Using the corrected absorbance value of the nitrogenase solution and the BSA calibration curve, determine the concentration of the nitrogenase.

Acetylene Assay Preparation of Acetylene (See Figure on Next Page)  In a chemical hood, gather the following supplies: acetylene gas flask, appropriate rubber stoppers, arm flask, 1-foot tubing, gas hose Luer-Lock connector, Luer Lock needle, water, and calcium carbide (CaC2).  Use a #2 rubber stopper to seal the top of the acetylene flask. Fill the lower chamber of the flask with water using the side arm. Keep your finger over the top opening.  Seal the lower chamber at the side arm with a #2 rubber stopper and parafilm. Remove your finger from the top. The water should remain in place, otherwise, the flask has not been properly sealed.  Prepare the side-arm flask for acetylene production. Connect the 1-foot gas hose to the side-arm flask. Connect the Luer Lock connector to the free end of the tubing. Connect a Luer Lock needle to the connector.  Inside the fume hood, add a spoonful of calcium carbide into the side-arm flask. Make sure you have the appropriate rubber stopper for the side-arm flask ready.  Add approximately 30 mL distilled water into the side-arm flask. The water reacts with calcium carbide to form acetylene gas. Allow the reaction to proceed for a few seconds to allow for the pressure to push atmospheric oxygen out of the flask. This will allow the collection of pure acetylene as well as reduce the risk of explosion. Close the top of the side-arm flask with a #6 rubber stopper.  Allow an additional few seconds to allow the pressure to push out remaining oxygen in the gas hose. Once the gas hose has been flushed out with the acetylene, attach the needle to the bottom chamber of the acetylene gas flask through the rubber stopper.  Once the lower reservoir in the acetylene flask is filled with acetylene and the water has been pushed into the upper reservoir, disconnect the syringe from the lower flask. Make sure the lower reservoir is sealed. Remove the rubber stopper from the side-arm flask containing the calcium carbide. Allow the reaction to run until completion. Add enough water so that the water is not the limiting reagent.  To add acetylene to reagent vials, extract the appropriate volume of acetylene from the lower chamber of the acetylene flask using the 1 mL Hamilton syringe. If using 10.0 mL vials for the acetylene assay, extract 1000 µL to add into each vial. Make sure the lower chamber is sealed after each time gas is extracted.  When all necessary acetylene has been extracted from the lower chamber, remove the rubber stopper to allow the acetylene gas to escape through the chemical hood. Make sure the hood is closed and as low as possible when freeing the gas from the lower chamber.  When the calcium carbide has been completely consumed in the side-arm flask, rinse in the sink and dispose of the remaining precipitate in the trash so that it does not clog the sink.

In vitro Acetylene Assay  In 3, 10 mL sealable vials, add: ATP Regenerating Solution 1 mL Sodium Dithionite * 2.61 mg MoFe Protein 0.1 mg of pure MoFe protein ** Fe Protein 1.66 mg of pure Fe protein ** Add 1 mL ATP Regenerating Solution to the 10 mL vials first. Then dissolve the sodium dithionite. Once dissolved, incubate these mixtures at room temperature inside the anaerobic chamber for 5 minutes. After 5 minutes, add the appropriate volumes of MoFe and Fe Protein solutions. Seal the vial using the crimper. * Sodium dithionite is used as an electron donor at a concentration of 15 mM. Other electron donors can be used at appropriate concentrations. ** The total mass of the MoFe and Fe protein in the assay solution should be 0.1 mg and 1.66 mg respectively. The total volume of each of these solutions that must be added must be calculated based on the concentration of each sample.  From the custom acetylene glassware, add 1000 µL acetylene gas to each vial using the 1 mL Hamilton syringe. Remove the positive pressure by piercing the septum cap with a Luer Lock syringe needle and rapidly removing the needle as not to allow transfer of air into the system. This will provide each assay solution with an atmosphere of 0.9 atm argon and 0.1 atm acetylene.  Incubate all vials for 15 minutes at 30°C and 200 rpm. While incubating, retrieve 4 N NaOH.  After 15 minutes, remove the vials from the incubator. Inject each vial with 100 µL 4 N NaOH to stop the reaction.  Measure the ratio of acetylene to ethylene in each vial using a gas chromatograph with flame ionization detector.

In vivo Acetylene Assay Note: All steps are carried out OUTSIDE of the anaerobic chamber. Assay is performed in an environment with 0.1 atm acetylene and 0.9 atm air.  Obtain a sample from a derepressed A. vinelandii culture. Measure the optical density of the culture (λ = 600 nm).  Add 1.0 mL of the culture to a 10 mL serum vial. Seal the vial with the crimper.  From the custom acetylene glassware, add 1000 µL acetylene gas to each vial using the 1 mL Hamilton syringe. Remove the positive pressure by piercing the septum cap with a Luer Lock syringe needle and rapidly removing the needle as not to allow transfer of air into the system. This will provide each derepressed A. vinelandii culture with an atmosphere of 0.9 atm air and 0.1 atm acetylene.  Incubate all vials for 15 minutes at 30°C and 200 rpm. While incubating, retrieve 4 N NaOH.  After 15 minutes, remove the vials from the incubator. Inject each vial with 100 µL 4 N NaOH to stop the reaction.  Measure the ratio of acetylene to ethylene in each vial using a gas chromatograph with flame ionization detector.

Azotobacter vinelandii Competence and Transformation Induction of Competency (Based on protocols used by the Minteer Lab)  On a modified Burk competent plate, spread 50 µL of A. vinelandii DMSO Stock using a sterile spreading rod. Volume of cells added can be modified.  Incubate plate at 30°C until sufficient growth is achieved, usually in 3 or 4 days. Cells should turn bright green.  Make 4 total passes on modified Burk competent plates to maximize competency:  After sufficient growth is observed, collect a loop of cells using a sterile loop.  Add loop of green cells into a 1.5 mL Eppendorf tube containing 1x Burk Buffer. Vortex Eppendorf tube until cells are fully resuspended.  Transfer 50 µL resuspended cells to another modified Burk competent plate. Spread with sterile spreading rod. Incubate plate at 30°C until sufficient growth is observed.  Repeat this process until 4 total passes on modified Burk competent plates are made. Induction of Competency (Based on protocols used by the Dean Lab)  On a Dean Method competency plate, spread 50 µL of A. vinelandii DMSO Stock using a sterile spreading rod. Volume of cells added can be modified.  Incubate plate at 30°C until sufficient growth is achieved, usually in 3 or 4 days. Cells may not turn light green.  Make a second pass on a Dean Method competency plate to maximize competency:  After sufficient growth is observed, collect a loop of cells using a sterile loop.  Add loop of green cells into a 1.5 mL Eppendorf tube containing 1x Burk Buffer. Vortex Eppendorf tube until cells are fully resuspended.  Transfer 50 µL resuspended cells to another Dean Method competency plate. Spread with sterile spreading rod. Incubate plate at 30°C until sufficient growth is observed.  Transfer a loop of cells from the second pass on Dean Method competency plates to a flask of Competent Liquid Culture Media using a sterile spreading rod. Let the flask sit on the lab bench for five minutes.  Vigorously shake the flask for 10-20 seconds to break up cell clumps.  Incubate flask at 30°C and 170 rpm until cell culture grows and turns bright green. This may take multiple days.

Transformation (Based on protocols used by the Minteer Lab)  From the fourth pass of A. vinelandii cells on a modified Burk competent plate, collect a loop of cells using a sterile spreading loop.  Place loop of cells into a 1 mL Eppendorf tube containing 1 mL 1x Burk Buffer. Vortex cell loop until all cell clumps are fully resuspended.  Into these resuspended cells, add 1-50 µg of DNA for transformation into A. vinelandii.  Incubate this tube for one hour at 30°C.  After on hour, transfer this cell mixture to Azotobacter Growth plates or liquid media tubes: Azotobacter Growth Plates:  Transfer 200 µL of transformed A. vinelandii cells to each Azotobacter Growth Plate, containing antibiotics if necessary. Incubate at 30°C with the agar down until the liquid is absorbed into the agar plate; then invert. Less than 200 µL of cells can be added so that cell liquid dries immediately.  Incubate at 30°C until colonies are observed, usually in about 2 days. Colonies can be picked again and spread on new Azotobacter Growth plates to further screen for transformants. Liquid Culture Tubes  Transfer at least 30 µL transformed A. vinelandii cells to 7 mL liquid culture tubes (Page 2) containing appropriate antibiotics if necessary. A larger volume of cells can be added to each tube as long as an even volume of cells can be added to each tube.  Incubate tubes at 30°C and 170 rpm until sufficient growth is observed. This often takes 2 to 3 days.  If checking for antibiotic resistance, measure the optical density of the cell cultures at λ = 600 nm using the QuickDrop. Transformation (Based on protocols used by the Dean Lab)  From the 50 mL liquid culture of competent A. vinelandii cells, transfer 200 µL cells to a sterile 1 mL Eppendorf Tube.  In this 1 mL Eppendorf Tube, add 200 µL 1x MOPS Transformation Buffer and 20-40 µL of plasmid DNA (5 µL can be used if not using antibiotic selection).  Let the tube sit at room temperature for 15 to 20 minutes.  Transfer this cell mixture to Dean Method transformation plates or a liquid media tube: Dean Method Transformation Plates:  Transfer 50 µL of transformed A. vinelandii cells each to 2 Dean Method Transformation Plates.  Incubate at 30°C until sufficient growth is observed.

Liquid Media Tube (For Antibiotic Selection):  Remove 4 mL modified Burk media from a 7 mL culture tube (Page 2), leaving 3 mL remaining.  Transfer all transformed cells into the 3 mL culture tube.  Incubate this tube at 30°C and 170 rpm overnight.  Transfer 50 µL of this cell culture each to 2 Dean Method transformation plates containing the appropriate antibiotics.  Incubate at 30°C until sufficient growth is observed.

Appendix D: A. vinelandii Genomic DNA Repair Fragment Sequence

AATTGGGCCCGACGTCGTTGGCTGCGCCGGCCGTGGTGTTATCACCGCCATCAACTTCC

TGGAAGAGGAAGGCGCCTACGAAGACGATCTGGACTTCGTATTCTACGACGTGCTGGGC

GACGTGGTGTGTGGCGGCTTCGCCATGCCGATCCGCGAGAACAAGGCCCAGGAAATCTA

CATCGTCTGCTCCGGTGAGATGATGGCCATGTACGCCGCCAACAACATCTCCAAGGGCA

TCGTGAAGTATGCCAACTCCGGCAGCGTGCGTCTGGGCGGCCTGATCTGCAACAGCCGT

AACACCGACCGCGAAGACGAGCTGATCATCGCTCTGGCCAACAAGCTGGGCACCCAGAT

GATCCACTTCGTGCCGCGTGACAACGTCGTGCAGCGCGCCGAAATCCGCCGCATGACCG

TGATCGAATACGATCCGAAAGCCAAGCAAGCCGACGAATACCGCGCTCTGGCCCGCAAG

GTCGTCGACAACAAACTGCTGGTCATCCCGAACCCGATCACCATGGACGAGCTCGAAGA

GCTGCTGATGGAATTCGGCATCATGGAAGTCGAAGACGAATCCATCGTCGGCAAAACCG

CCGAAGAAGTCTGATAGCCGCTCCGGTTTCAGAAGGACGGGACAGGGCAGATTGGCTCT

GTCGGGGTGGCGCCCCCCGCATGGGGCGGGCGCCCCACCCGTTACCCGCATATGAACGC

TAAGGCAAGAGGAGTCATACCCATGACCCACCACCATCATCACCACCATCACATGGCTA

GCATGACTGGTGGACAGCAAATGGGTGGTATGTCGCGCGAAGAGGTTGAATCCCTCATC

CAGGAAGTTCTGGAAGTTTATCCCGAGAAGGCTCGCAAGGATCGTAACAAGCACCTGGC

CGTCAACGACCCGGCGGTTACCCAGTCCAAGAAGTGCATCATCTCCAACAAGAAGTCCC

AGCCCGGTCTGATGACCATCCGCGGCTGCGCCTACGCCGGTTCCAAAGGCGTGGTCTGG

GGCCCCATCAAGGACATGATCCACATCTCCCACGGTCCGGTAGGCTGCGGCCAGTATTC

GCGCGCCGGCCGTCGTAACTACTACATCGGTACCACCGGTGTGAACGCCTTCGTCACCA

TGAACTTCACCTCGGACTTCCAGGAGAAGGACATCGTGTTCGGTGGCGACAAGAAGCTC

GCCAAACTGATCGACGAAGTGGAAACCCTGTTCCCGCTGAACAAGGGTATCTCCGTCCA

GTCCGAGTGCCCGATCGGCCTGATCGGCGACGACATCGAATCCGTGTCCAAGGTCAAGG

GCGCCGAGCTCAGCAAGACCATCGTACCGGTCCGTTGCGAAGGCTTCCGCGGCGTTTCC

100

CAGTCCCTGGGCCACCACATCGCCAACGACGCAGTCCGCGACTGGGTCCTGGGCAAGCG

TGACGAAGACACCACCTTCGCCAGCACTCCTTACGATGTGGCCATCATCGGCGACTACA

ACATCGGCGGCGACGCCTGGTCTTCCCGCATCCTGACTAGTGAATTCGCGGCCGCCT

101

Appendix E: Cloning of CRISPR Spacer into pCRISPR Plasmid Sequencing Results

Sequencing results, Sample 1 primer 1:

GGGGCAATTCTATACTAAAATATGGTATAATACTCTTAATAAATGCAGTAATAC

AGGGGCTTTTCAAGACTGAAGTCTAGCTGAGACAAATAGTGCGATTACGAAATT

TTTTAGACAAAAATAGTCTACGAGGTTTTAGAGCTATGCTGTTTTGAATGGTCC

CAAAACTGAGACCAGTCTCGGAAGCTCAAAGGTCTCGTTTTAGAGCTATGCTGT

TTTGAATGGTCCCAAAACTTCAGCACACTGAGACTTGTTGAGTTGAATTCGGTC

AGTGCGTCCTGCTGATGTGCTCAGTATCTCTATCACTGATAGGGATGTCAATCT

CTATCACTGATAGGGACTCGAGGTGAAGACGAAAGGGCCTCGTGATACGCCTAT

TTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCGGAATTGCCAG

CTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTT

TCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCTGATCAAGAGACAG

GATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGG

CCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCT

GCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTG

TCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGC

TATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCA

CTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCC

TGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGC

GGCGGCTGCATACGCTTGATCCGGCTACTCTGCCCATTCGACCATCAAGGCGGA

ACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGA

TGATCTGGGACGAGGAGCATCAAGGGCTCGCGCCAGACGAACTGTTCGCCAGGC

102

TCAGGCGGCGCATGCCCGACGTCGAGGATCTCGTCGTGGACCATTGGCGATGCC

TGCTTTGCCCGAATATCATG

103

Sequencing Results, Sample 1 primer 2:

CAACTTCGTTGGTGCTTGAGTTTTGGGGACCATTCAAAACAGCATAGCTCTAAA

ACGAGACCTTTGAGCTTCCGAGACTGGTCTCAGTTTTGGGACCATTCAAAACAG

CATAGCTCTAAAACCTCGTAGACTATTTTTGTCTAAAAAATTTCGTAATCGCAC

TATTTGTCTCAGCTAGACTTCAGTCTTGAAAAGCCCCTGTATTACTGCATTTAT

TAAGAGTATTATACCATATTTTTAGTTATTAAGAAATAGGATCCCATGGTACGC

GTGCTAGAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCG

TTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGCC

CTAGACCTAGGGCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGT

AATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAA

AGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCA

TAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTG

GCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCT

CGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCT

CCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTC

GGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCC

CGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACA

CGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATAGCAGAGCGAGGTAT

GTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGA

AGGACAGTATTTGGTATCTGCGCTCTGCTGAAGGCAGTTACCTTCGGAAAAAGA

GTTAGTAGCTCTGATCCGGCGAACAAACCAACGCTGGTAGCGGCTGGTTTTTTT

GTTTGGCAGCCGCAGATTACCGCGCAGATAAAATGATGTCAGTAGATCCTTTGA

TCTTTTCTACTGCGTCTGACGCTCAGTTGGCACGCAAAACCTCCGCGTTTAAGG

GGAATTTG

104

Sequencing Results: Sample 2 primer 1:

TGGGGCAAAAACTTATACTAAAAATATGGTATAATACTCTTAATAAATGCAGTA

ATACAGGGGCTTTTCAAGACTGAAGTCTAGCTGAGACAAATAGTGCGATTACGA

AATTTTTTAGACAAAAATAGTCTACGAGGTTTTAGAGCTATGCTGTTTTGAATG

GTCCCAAAACTTCAGCACACTGAGACTTGTTGAGTTGAATTCGGTCAGTGCGTC

CTGCTGATGTGCTCAGTATCTCTATCACTGATAGGGATGTCAATCTCTATCACT

GATAGGGACTCGAGGTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAG

GTTAATGTCATGATAATAATGGTTTCTTAGACGTCGGAATTGCCAGCTGGGGCG

CCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCG

CCAAGGATCTGATGGCGCAGGGGATCAAGATCTGATCAAGAGACAGGATGAGGA

TCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGG

GTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGAT

GCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACC

GACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGG

CTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCG

GGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCT

CACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTG

CATACGCTTGATCCGGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCAT

CGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGA

CGAAGAGCATCAAGGGCTCGCGCCAGCCGGAACTGTTCGCCAGGCTCAAGCGCG

CATGCCCGGACGTCGAAGGATCTCGTCGTGACTCATGGCCGATGCCTGCTTTGC

CGAATATTCATGTTGAAAATGGCCGCTTTTCTGAATTCATCGACTGGTGACGCT

GGGTGTGGCGGAACCGCTATTCAGGAATAACGTTGGCTACCCGTGAAATATGTG

CTGAAGAGCTTTGCTGAGCAATATG

105

Sequencing Results, Sample 2 primer 2:

TAAACTCAAGGGGTGCTTGGAAGTTTTGGGACCATTCAAAACAGCATAGCTCTA

AAACCTCGTAGACTATTTTTGTCTAAAAAATTTCGTAATCGCACTATTTGTCTC

AGCTAGACTTCAGTCTTGAAAAGCCCCTGTATTACTGCATTTATTAAGAGTATT

ATACCATATTTTTAGTTATTAAGAAATAGGATCCCATGGTACGCGTGCTAGAGG

CATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGT

TGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGCCCTAGACCTAG

GGCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTA

TCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAA

AAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGC

CCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCG

ACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCT

CCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGA

AGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTC

GTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGC

GCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCG

CCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGT

GCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTA

TTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGC

TCTTGATCCGGCAAACAAACCACCGCTGGGTAGCGGTGGTTTTTTTGTTTGCAG

CAGCAGATTACGCGCAGAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTA

CGGGTCTGACGCCTCAGTGAACGAAAACTCACGGTAAGGATTTTGTCATGACTA

ATGCTGATCTCACATAAAAACGCCCGGCGCACCGAGGCGGTTCTGGACAAATTC

TCGGA

106

Sequencing Results: Sample 3 primer 1:

GTGGCAACCTATACTAAAATATGGTATAATACTCTTAATAAATGCAGTAATACA

GGGGCTTTTCAAGACTGAAGTCTAGCTGAGACAAATAGTGCGATTACGAAATTT

TTTAGACAAAAATAGTCTACGAGGTTTTAGAGCTATGCTGTTTTGAATGGTCCC

AAAACTTCAGCACACTGAGACTTGTTGAGTTGAATTCGGTCAGTGCGTCCTGCT

GATGTGCTCAGTATCTCTATCACTGATAGGGATGTCAATCTCTATCACTGATAG

GGACTCGAGGTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAA

TGTCATGATAATAATGGTTTCTTAGACGTCGGAATTGCCAGCTGGGGCGCCCTC

TGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAG

GATCTGATGGCGCAGGGGATCAAGATCTGATCAAGAGACAGGATGAGGATCGTT

TCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGA

GAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGC

CGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCT

GTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGC

CACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAG

GGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCT

TGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATAC

GCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCG

AGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGA

GCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCC

CGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCAT

GGGTGGAAAATGGCCGCTTTTCTGGATTCAT

107

Sequencing Results, Sample 3 primer 2:

CAACCTTAGTGTGCTGAGTTTTGGGACCATTCAAAACAGCATAGCTCTAAAACC

TCGTAGACTATTTTTGTCTAAAAAATTTCGTAATCGCACTATTTGTCTCAGCTA

GACTTCAGTCTTGAAAAGCCCCTGTATTACTGCATTTATTAAGAGTATTATACC

ATATTTTTAGTTATTAAGAAATAGGATCCCATGGTACGCGTGCTAGAGGCATCA

AATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTT

GTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGCCCTAGACCTAGGGCGT

TCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCAC

AGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGC

CAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCC

TGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGG

ACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGT

TCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGT

GGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCG

CTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTT

ATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACT

GGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTAC

AGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAAGGACAGTATTTG

GTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTT

GATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAGCAGCA

GATTACGCGCAGAAAAAAAAGATCTCAGGAGATCCTTTGATCTTTTTCTACGGG

GTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGAATT

108

Sequencing Results, Sample 4 primer 1:

GTGGCCTTCTATACTAAAATATGGTATAATACTCTTAATAAATGCAGTAATACA

GGGGCTTTTCAAGACTGAAGTCTAGCTGAGACAAATAGTGCGATTACGAAATTT

TTTAGACAAAAATAGTCTACGAGGTTTTAGAGCTATGCTGTTTTGAATGGTCCC

AAAACTGAGACCAGTCTCGGAAGCTCAAAGGTCTCGTTTTAGAGCTATGCTGTT

TTGAATGGTCCCAAAACTTCAGCACACTGAGACTTGTTGAGTTGAATTCGGTCA

GTGCGTCCTGCTGATGTGCTCAGTATCTCTATCACTGATAGGGATGTCAATCTC

TATCACTGATAGGGACTCGAGGTGAAGACGAAAGGGCCTCGTGATACGCCTATT

TTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCGGAATTGCCAGC

TGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTT

CTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCTGATCAAGAGACAGG

ATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGC

CGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTG

CTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGT

CAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCT

ATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCAC

TGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCT

GTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCG

GCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACA

TCGCATCGAGCGAGCACGTACTCGGATGGGAAGCCGGGTCTTGTCGATCAGGAT

GATCTGGACGAGAGCATCAGGGGCTCGCGCAGCCGAACTGTCGCCAGGCTCAAG

CGCGCATGCCGACGGCGAAGATCTCGTCGTGACCCATGGCGAATGCCTGCTT

109

Sequencing Results, Sample 4 primer 2:

AAACCTTCAGTGTGCTGAGTTTTGGGACCATTCAAAACAGCATAGCTCTAAAAC

GAGACCTTTGAGCTTCCGAGACTGGTCTCAGTTTTGGGACCATTCAAAACAGCA

TAGCTCTAAAACCTCGTAGACTATTTTTGTCTAAAAAATTTCGTAATCGCACTA

TTTGTCTCAGCTAGACTTCAGTCTTGAAAAGCCCCTGTATTACTGCATTTATTA

AGAGTATTATACCATATTTTTAGTTATTAAGAAATAGGATCCCATGGTACGCGT

GCTAGAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTT

TTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGCCCT

AGACCTAGGGCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAA

TACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAG

GCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATA

GGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGC

GAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG

TGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCC

CTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGG

TGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCG

ACCGCTGCGCCTTATCCGGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACAC

GACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTAT

GTAGGCCGGTGCTACAGAGTTCTTGAAGTGGTTGCCCTAACTACGGCTACACTA

GAAGGACCGTATTTGGGTATCTGCGCTCTGCTGAAGCCAGTTCTCGTCGGAAGA

AGAGTGGGTG

110

Bibliography

1. Renner, J. N.; Greenlee, L. F.; Herring, A. M.; Ayers, K. E., Electrochemical

Synthesis of Ammonia: A Low Pressure, Low Temperature Approach. Electrochem. Soc.

Interface 2015, 24, (2), 51-57.

2. Ammonia, 1. Introduction. In Ullmann's Encyclopedia of Industrial Chemistry.

3. Grzesiak, D.; Kedzior, R.; Poplawski, D.; Halat, A.; Falewicz, P., AMMONIA AS

A SUSTAINABLE FUEL. Ecol. Chem. Eng. A 2015, 22, (3), 393-401.

4. Erisman, J. W.; Sutton, M. A.; Galloway, J.; Klimont, Z.; Winiwarter, W., How a century of ammonia synthesis changed the world. Nat. Geosci. 2008, 1, (10), 636-639.

5. Amar, I. A.; Lan, R.; Petit, C. T. G.; Tao, S. W., Solid-state electrochemical synthesis of ammonia: a review. Journal of Solid State Electrochemistry 2011, 15, (9),

1845-1860.

6. Fuhrmann, J.; Hulsebrock, M.; Krewer, U., Energy Storage Based on

Electrochemical Conversion of Ammonia. Transition to Renewable Energy Systems 2013,

691-706.

7. Smith, B. E., Nitrogenase reveals its inner secrets. Science 2002, 297, (5587), 1654-

1655.

8. Kugler, K.; Ohs, B.; Scholz, M.; Wessling, M., Towards a carbon independent and

CO2-free electrochemical membrane process for NH3 synthesis. Phys. Chem. Chem. Phys.

2014, 16, (13), 6129-6138.

9. Hoffman, B. M.; Lukoyanov, D.; Yang, Z. Y.; Dean, D. R.; Seefeldt, L. C.,

Mechanism of nitrogen fixation by nitrogenase: the next stage. Chem Rev 2014, 114, (8),

4041-62.

111

10. Burgess, B. K., & Lowe, D. J., Mechanism of Molybdenum Nitrogenase. Chemical

Reviews 1996, 96, (7), 2983-3012.

11. Trinick, M. J., Effects of ooxygen, temperature and other factors on the reduction of acetylene by root-nodules formed by rhizobium on parasponia-andersonii planch. New

Phytol. 1980, 86, (1), 27-38.

12. Sustainable Ammonia Sythesis. Roundtable discussion sponsored by DOE BES held on 2-18-16. http://science.energy.gov/~/media/bes/csgb/pdf/docs/2016/NH3_Report.

13. Eady, R. R., Structure-function relationships of alternative nitrogenases. Chemical

Reviews 1996, 96, (7), 3013-3030.

14. Christiansen, J., Dean, D. R., & Seefeldt, L. C., Mechanism features of the Mo- containign nitrogenase. Annual review of plant biology 2001, 52, (1), 269-295.

15. Hu, Y.; Ribbe, M. W., Nitrogenase and Homologs. Journal of biological inorganic chemistry : JBIC : a publication of the Society of Biological Inorganic Chemistry 2015,

20, (2), 435-445.

16. Hofmann-Findeklee, C.; Gadkari, D.; Meyer, O., Superoxide-Dependent Nitrogen

Fixation. In Nitrogen Fixation: From Molecules to Crop Productivity, Pedrosa, F. O.;

Hungria, M.; Yates, G.; Newton, W. E., Eds. Springer Netherlands: Dordrecht, 2000; pp

23-30.

17. MacKellar, D.; Lieber, L.; Norman, J. S.; Bolger, A.; Tobin, C.; Murray, J. W.;

Oksaksin, M.; Chang, R. L.; Ford, T. J.; Nguyen, P. Q.; Woodward, J.; Permingeat, H. R.;

Joshi, N. S.; Silver, P. A.; Usadel, B.; Rutherford, A. W.; Friesen, M. L.; Prell, J.,

Streptomyces thermoautotrophicus does not fix nitrogen. Scientific reports 2016, 6, 20086.

112

18. Seefeldt, L. C., Hoffman, B. M., & Dean, D. R. , Mechanism of Mo-dependent nitrogenase. Annu Rev Biochem 2009, 78, 701-722.

19. Brown, K. A.; Harris, D. F.; Wilker, M. B.; Rasmussen, A.; Khadka, N.; Hamby,

H.; Keable, S.; Dukovic, G.; Peters, J. W.; Seefeldt, L. C.; King, P. W., Light-driven dinitrogen reduction catalyzed by a CdS:nitrogenase MoFe protein biohybrid. Science

2016, 352, (6284), 448-450.

20. Milton, R. D.; Abdellaoui, S.; Khadka, N.; Dean, D. R.; Leech, D.; Seefeldt, L. C.;

Minteer, S. D., Nitrogenase bioelectrocatalysis: heterogeneous ammonia and hydrogen production by MoFe protein. Energy Environ. Sci. 2016, 9, (8), 2550-2554.

21. Milton, R. D.; Cai, R.; Abdellaoui, S.; Leech, D.; De Lacey, A. L.; Pita, M.;

Minteer, S. D., Bioelectrochemical Haber-Bosch Process: An Ammonia-Producing H-2/N-

2 Fuel Cell. Angewandte Chemie-International Edition 2017, 56, (10), 2680-2683.

22. Milton, R. D.; Cai, R.; Sahin, S.; Abdellaoui, S.; Alkotaini, B.; Leech, D.; Minteer,

S. D., The In Vivo Potential-Regulated Protective Protein of Nitrogenase in Azotobacter vinelandii Supports Aerobic Bioelectrochemical Dinitrogen Reduction In Vitro. Journal of the American Chemical Society 2017, 139, (26), 9044-9052.

23. Lancaster, K. M., Roemelt, M., Ettenhuber, P., Hu, Y., Ribbe, M. W., Neese, F., ...

& DeBeer, S, X-ray Emission Spectroscopy Evidences a Central Carbon in the Nitrogenase

Iron-Molybdenum Cofactor. Science 2011, 334, (6058), 974-977.

24. Spatzal, T., Aksoyoglu, M., Zhang, L., Andrade, S. L., Schleicher, E., Weber, S.,

... & Einsle, O. , Evidence for Interstitial Carbon in Nitrogenase FeMo Cofactor. Science

2011, 334, (6058), 940-940.

113

25. Spatzal, T.; Schlesier, J.; Burger, E. M.; Sippel, D.; Zhang, L.; Andrade, S. L.; Rees,

D. C.; Einsle, O., Nitrogenase FeMoco investigated by spatially resolved anomalous dispersion refinement. Nat Commun 2016, 7, 10902.

26. Doan, P. E.; Telser, J.; Barney, B. M.; Igarashi, R. Y.; Dean, D. R.; Seefeldt, L. C.;

Hoffman, B. M., 57Fe ENDOR spectroscopy and 'electron inventory' analysis of the nitrogenase E4 intermediate suggest the metal-ion core of FeMo-cofactor cycles through only one redox couple. J Am Chem Soc 2011, 133, (43), 17329-40.

27. Bjornsson, R.; Lima, F. A.; Spatzal, T.; Weyhermüller, T.; Glatzel, P.; Bill, E.;

Einsle, O.; Neese, F.; DeBeer, S., Identification of a spin-coupled Mo(iii) in the nitrogenase iron–molybdenum cofactor. Chem. Sci. 2014, 5, (8), 3096-3103.

28. Bjornsson, R.; Neese, F.; Schrock, R. R.; Einsle, O.; DeBeer, S., The discovery of

Mo(III) in FeMoco: reuniting enzyme and model chemistry. J Biol Inorg Chem 2015, 20,

(2), 447-60.

29. Lowe, D. J.; Thorneley, R. N. F., THE MECHANISM OF KLEBSIELLA-

PNEUMONIAE NITROGENASE ACTION - PRE-STEADY-STATE KINETICS OF H-

2 FORMATION. Biochem. J. 1984, 224, (3), 877-886.

30. Lowe, D. J.; Thorneley, R. N. F., THE MECHANISM OF KLEBSIELLA-

PNEUMONIAE NITROGENASE ACTION - THE DETERMINATION OF RATE

CONSTANTS REQUIRED FOR THE SIMULATION OF THE KINETICS OF N-2

REDUCTION AND H-2 EVOLUTION. Biochem. J. 1984, 224, (3), 895-901.

31. Thorneley, R. N. F.; Lowe, D. J., THE MECHANISM OF KLEBSIELLA-

PNEUMONIAE NITROGENASE ACTION - PRE-STEADY-STATE KINETICS OF AN

114

ENZYME-BOUND INTERMEDIATE IN N-2 REDUCTION AND OF NH3

FORMATION. Biochem. J. 1984, 224, (3), 887-894.

32. Christiansen, J., Goodwin, P. J., Lanzilotta, W. N., Seefeldt, L. C., & Dean, D. R.,

Catalytic and Biophysical Properties of Nitrogenase Apo-MoFe Protien Produced by an ifB-Deletion Mutant of Azotobacter v inelandii. Biochemistry 1998, 37, (36), 12611-

12623.

33. Danyal, K.; Dean, D. R.; Hoffman, B. M.; Seefeldt, L. C., Electron Transfer Within

Nitrogenase: Evidence for a Deficit-Spending Mechanism(). Biochemistry 2011, 50, (43),

9255-9263.

34. Chan, J. M.; Christiansen, J.; Dean, D. R.; Seefeldt, L. C., Spectroscopic evidence for changes in the redox state of the nitrogenase P-cluster during turnover. Biochemistry

1999, 38, (18), 5779-85.

35. Yang, Z. Y.; Ledbetter, R.; Shaw, S.; Pence, N.; Tokrnina-Lukaszewska, M.; Filers,

B.; Guo, Q. J.; Pokhrel, N.; Cash, V. L.; Dean, D. R.; Antony, E.; Bothner, B.; Peters, J.

W.; Seefeldt, L. C., Evidence That the P-i Release Event Is the Rate-Limiting Step in the

Nitrogenase Catalytic Cycle. Biochemistry 2016, 55, (26), 3625-3635.

36. Singh, A. R.; Rohr, B. A.; Schwalbe, J. A.; Cargnello, M.; Chan, K.; Jaramillo, T.

F.; Chorkendorff, I.; Norskov, J. K., Electrochemical Ammonia Synthesis-The Selectivity

Challenge. ACS Catal. 2017, 7, (1), 706-709.

37. Barney, B. M.; Igarashi, R. Y.; Dos Santos, P. C.; Dean, D. R.; Seefeldt, L. C.,

Substrate interaction at an iron-sulfur face of the FeMo-cofactor during nitrogenase catalysis. J Biol Chem 2004, 279, (51), 53621-4.

115

38. Igarashi, R. Y., Dos Santos, P. C., Niehaus, W. G., Dance, I. G., Dean, D. R., &

Seefeldt, L. C. , Localization of a catalytic intermediate bound to the FeMo-cofactor of nitrogenase. J Biol Chem 2004, 279, (33), 34770-5.

39. Lee, H. I., Igarashi, R. Y., Laryukhin, M., Doan, P. E., Dos Santos, P. C., Dean, D.

R., ... & Hoffman, B. M, An Organometallic Intermediate during Alkyne Reduction by

Nitrogenase. Journal of the American Chemical Society 2004, 126, (31), 9563-9569.

40. Dos Santos, P. C.; Mayer, S. M.; Barney, B. M.; Seefeldt, L. C.; Dean, D. R.,

Alkyne substrate interaction within the nitrogenase MoFe protein. J Inorg Biochem 2007,

101, (11-12), 1642-8.

41. Benton, P. M. C.; Mayer, S. M.; Shao, J. L.; Hoffman, B. M.; Dean, D. R.; Seefeldt,

L. C., Interaction of acetylene and cyanide with the resting state of nitrogenase alpha-96- substituted MoFe proteins. Biochemistry 2001, 40, (46), 13816-13825.

42. Scott, D. J., May, H. D., Newton, W. E., Brigle, K. E., & Dean, D. R. , Role for the nitrogenase MoFe protein α-subunit in FeMo-cofactor binding and catalysis. Nature 1990,

343, 188-190.

43. Kim, C. H., Newton, W. E., & Dean, D. R, Role of the MoFe Protein. alpha.-

Subunit Histidine-195 Residue in FeMo-cofactor Binding and Nitrogenase Catalysis.

Biochemistry 1995, 34, (9), 2798-2808.

44. Dilworth, M. J., Fisher, K., Kim, C. H., & Newton, W. E. , Effects on Substrate

Reduction of Substitution of Histidine-195 by Glutamine in the α-Subunit of the MoFe

Protein of Azotobacter v inelandii Nitrogenase. Biochemistry 1998, 37, (50), 17495-17505.

45. Fisher, K., Dilworth, M. J., Kim, C. H., & Newton, W. E, Azotobacter vinelandii nitrogenases with substitutions in the FeMo-cofactor environment of the MoFe protein:

116

Effects of acetylene or ethylene on interactions with H+, HCN, and CN. Biochemistry

2000, 39, (35), 10855-10865.

46. Fisher, K., Dilworth, M. J., & Newton, W. E. , Differential effects on N2 binding and reduction, HD formation, and azide reduction with α-195His-and α-191Gln-substituted

MoFe proteins of Azotobacter vinelandii nitrogenase. Biochemistry 2000, 39, (50), 15570-

15577.

47. Setubal, J. C.; dos Santos, P.; Goldman, B. S.; Ertesvag, H.; Espin, G.; Rubio, L.

M.; Valla, S.; Almeida, N. F.; Balasubramanian, D.; Cromes, L.; Curatti, L.; Du, Z. J.;

Godsy, E.; Goodner, B.; Hellner-Burris, K.; Hernandez, J. A.; Houmiel, K.; Imperial, J.;

Kennedy, C.; Larson, T. J.; Latreille, P.; Ligon, L. S.; Lu, J.; Maerk, M.; Miller, N. M.;

Norton, S.; O'Carroll, I. P.; Paulsen, I.; Raulfs, E. C.; Roemer, R.; Rosser, J.; Segura, D.;

Slater, S.; Stricklin, S. L.; Studholme, D. J.; Sun, J.; Viana, C. J.; Wallin, E.; Wang, B. M.;

Wheeler, C.; Zhu, H. J.; Dean, D. R.; Dixon, R.; Wood, D., Genome Sequence of

Azotobacter vinelandii, an Obligate Aerobe Specialized To Support Diverse Anaerobic

Metabolic Processes. Journal of Bacteriology 2009, 191, (14), 4534-4545.

48. Sadoff, H. L., ENCYSTMENT AND GERMINATION IN AZOTOBACTER-

VINELANDII. Bacteriological Reviews 1975, 39, (4), 516-539.

49. Wong, T. Y.; Maier, R. J., H-2-DEPENDENT MIXOTROPHIC GROWTH OF N-

2-FIXING AZOTOBACTER-VINELANDII. Journal of Bacteriology 1985, 163, (2), 528-

533.

50. Pacheco-Leyva, I.; Pezoa, F. G.; Diaz-Barrera, A., Alginate Biosynthesis in

Azotobacter vinelandii: Overview of Molecular Mechanisms in Connection with the

Oxygen Availability. Int. J. Polym. Sci. 2016, 12.

117

51. Dos Santos, P. C., Molecular Biology and Genetic Engineering in Nitrogen

Fixation. In Nitrogen Fixation: Methods and Protocols, Ribbe, M. W., Ed. Humana Press

Inc: Totowa, 2011; Vol. 766, pp 81-92.

52. Ceasar, S. A.; Rajan, V.; Prykhozhij, S. V.; Berman, J. N.; Ignacimuthu, S., Insert, remove or replace: A highly advanced genome editing system using CRISPR/Cas9.

Biochim. Biophys. Acta-Mol. Cell Res. 2016, 1863, (9), 2333-2344.

53. Doudna, J. A.; Charpentier, E., The new frontier of genome engineering with

CRISPR-Cas9. Science 2014, 346, (6213), 1077-+.

54. Jinek, M.; Chylinski, K.; Fonfara, I.; Hauer, M.; Doudna, J. A.; Charpentier, E., A

Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity.

Science 2012, 337, (6096), 816-821.

55. Marty R. Jacobson, K. E. B., Lisa T. Bennett, Robert A. Setterquist, Mark S.

Wilson, Valerie L. Cash, Jim Beynon, William E. Newton, Dennis R. Dean, Physical and

Genetic Map of the Major nif Gene Cluster from Azotobacter vinelandii. Journal of

Bacteriology 1989, 171, (2), 1017-1027.

56. Shaw, S.; Lukoyanov, D.; Danyal, K.; Dean, D. R.; Hoffman, B. M.; Seefeldt, L.

C., Nitrite and Hydroxylamine as Nitrogenase Substrates: Mechanistic Implications for the

Pathway of N-2 Reduction. Journal of the American Chemical Society 2014, 136, (36),

12776-12783.

57. Yang, Z. Y.; Danyal, K.; Seefeldt, L. C., Mechanism of Mo-Dependent

Nitrogenase. In Nitrogen Fixation: Methods and Protocols, Ribbe, M. W., Ed. Humana

Press Inc: Totowa, 2011; Vol. 766, pp 9-29.

118

58. Hardy, R. W. F.; Burns, R. C.; Holsten, R. D., Applications of the acetylene- ethylene assay for measurement of nitrogen fixation. Soil Biology and Biochemistry 1973,

5, (1), 47-81.

59. Hageman, R. V.; Burris, R. H., NITROGENASE AND NITROGENASE

REDUCTASE ASSOCIATE AND DISSOCIATE WITH EACH CATALYTIC CYCLE.

Proc. Natl. Acad. Sci. U. S. A. 1978, 75, (6), 2699-2702.

60. Song, S. D.; Hartmann, A.; Burris, R. H., PURIFICATION AND PROPERTIES

OF THE NITROGENASE OF AZOSPIRILLUM-AMAZONENSE. Journal of

Bacteriology 1985, 164, (3), 1271-1277.

61. Jiang, W. Y.; Bikard, D.; Cox, D.; Zhang, F.; Marraffini, L. A., RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat. Biotechnol. 2013, 31, (3), 233-239.

62. Pulakat, L.; Efuet, E. T.; Gavini, N., Segregation pattern of kanamycin resistance marker in Azotobacter vinelandii did not show the constraints expected in a polyploid bacterium. FEMS Microbiol. Lett. 1998, 160, (2), 247-252.

63. Pena, C.; Campos, N.; Galindo, E., Changes in alginate molecular mass distributions, broth viscosity and morphology of Azotobacter vinelandii cultured in shake flasks. Appl. Microbiol. Biotechnol. 1997, 48, (4), 510-515.

64. Pena, C.; Reyes, C.; Larralde-Corona, P.; Corkidi, G.; Galindo, E., Characterization of Azotobacter vinelandii aggregation in submerged culture by digital image analysis.

FEMS Microbiol. Lett. 2002, 207, (2), 173-177.

65. Pena, C.; Trujillo-Roldan, M. A.; Galindo, E., Influence of dissolved oxygen tension and agitation speed on alginate production and its molecular weight in cultures of

Azotobacter vinelandii. Enzyme Microb. Technol. 2000, 27, (6), 390-398.

119

66. Cheryan, S.; Ziegler, S. A.; Montoya, A. K.; Jiang, L., Why Are Some STEM Fields

More Gender Balanced Than Others? Psychol. Bull. 2017, 143, (1), 1-35.

120