© 2015 Nature America, Inc. All rights reserved. senior authorship. Correspondence should be addressed to S.L. ( Behavioral Neuroscience, Gunma University Graduate School of Medicine, Maebashi, Japan. Medical University of Vienna, Vienna, Austria. 1 quality. variable of data RNA-seq yielded which recordings, clamp taken from three neurons through a patch pipette without prior patch- properties. Qiu only Nevertheless, biophysical and cytoarchitecture neuronal of minants deter type–specific cell reveal to expression gene in variations wide transcriptome- resolve can it as classification neuronal for advance titative RNA-seq in single neurons would present a potentially critical hoc post and electrophysiology patch-clamp Combining neuron. same the of profiles and transcriptome morphology electrophysiology, the tigate on single neurons rays interneurons of classes of CA1 subfield 16 into the including hippocampus sub 47 subtypes, and cortex somatosensory the in of neurons classification molecular the allowed RNA-seq Particularly, types. cell novel of identification system nervous central the in (RNA-seq) sequencing (qPCR) PCR tative mixture of patch-clamp electrophysiology and single-cell semiquanti classification systems primarily rely on candidate marker analysis by a accepted, particularly for interneurons in the cerebral cortex well is traits neurophysiological and morphological developmental, lenge in neuroscience. Neuronal taxonomy based on a combination of the identification of distinct subclasses of neurons remains system a key chal nervous the in perform can circuit neuronal each computations distinct the neurotransmitter underlie neurons individual of and utilization connectivity excitability, morphology, The precisely map neuronal subtypes and predict their network in contributions the brain. established and, to our knowledge, hitherto undescribed neuronal subtypes. Our findings demonstrate the ability of Patch-seq to of receptors neurotransmitter and channels. Moreover, it neuronal distinguishes that subpopulations correspond to both well- seq reveals a close link responses characteristics, to between electrophysiological acute chemical challenges and RNA expression addition of unique molecular identifiers, cDNA Illumina amplification, library preparation and sequencing. We show that Patch- followed by the aspiration of the entire somatic compartment into the recording pipette, reverse of transcription RNA including whole-cell patch-clamp recordings in mouse brain slices. In our approach, termed Patch-seq, a patch-clamp stimulus protocol is Here, we present a method for obtaining full data transcriptome from single neocortical pyramidal cells and interneurons after However, the direct relationship between these parameters and the molecular phenotypes has remained largely unexplored. Traditionally, have neuroscientists defined the identity of neurons by the cells’ location, morphology, connectivity and excitability. Sten Linnarsson János Fuzik single-cell I nature biotechnology nature Received 23 June; accepted 2 December; published online 21 December 2015; Department of Medical Biochemistry and Biophysics, Karolinska Institutet, Stockholm, Sweden. ntegration ntegration of recordings with electrophysiological 14– 1 6 morphological reconstructions with the resolution of quan resolution the with reconstructions morphological , , multiplexed qPCR 1 , 2 , 1 5 9 , , Amit Zeisel 4 , , no robust method exists to simultaneously inves , 1 7– , 6 1 & Tibor Harkany 0 1 et al. et . More recently, advances in single-cell RNA single-cell in . More recently, advances 1 . Despite pioneering work using microar using work pioneering Despite .

R 17 1 advance online publication online advance 9 , 1 have attempted RNA-seq on material material on RNA-seq attempted have 8 NA-seq NA-seq data identifies neuronal subtypes and even proof-of-concept RNA-seq 1 , 5 , , Zoltán Máté 3 Institute of Experimental Medicine, Hungarian Academy of Sciences, Budapest, Hungary. 1 , 2 , 6 11– [email protected] 3 , , Daniela Calvigioni 1 3 led to the the to led 1– 4– 3

6 . Thus, Thus, . . . These ------doi:10.1038/nbt.344

and and CCK dual-labeled CCK of schizophrenia and orders neuronal of circuits gatekeepers dynamic and plastic the are interneurons areas cortical in interneurons dendrite-targeting to ing axon-target from quasi-continuum a form to thought are features ( interneurons (CCK)-containing( cholecystokinin on focused We characterization and collection Data RESULTS neuronal excitability. and morphology neuronal of determinants observed experimentally and responses RNA- predictions between causality seq–based established we interneurons, cortical of probing pharmacological acute Through proteins. synaptic and tors recep channels, ion known all that for mRNAs set resolves data simultaneously quantitative a produces and tissues, cleared optically the with compatible considered is Patch-seq that show previously Wealso subtypes. types distinct into homogenous interneuron cortical resolve to particu larly classification, high-quality achieve to sets data single-cell larger with them aligning by transcriptomes Patch-seq neurons. Wevalidate patch-clamp-recorded single of soma the from aspirated ) or T.H. ( Here, Patch-seq, we a describe relying method on RNAsequencing upeetr Fg 1a Fig. Supplementary 5 These authors contributed equally to this article. 2 + t 0 1 i interneurons is particularly challenging, we established a established we challenging, particularly is interneurons b . Their inactivation likely contributes to anxiety, mood dis to anxiety, mood contributes likely inactivation . Their , 2 2 o Department of Molecular Neurosciences, Center for Brain Research, ex vivo ex , , Yuchio Yanagawa r . h a r 3 Fig. Fig. k a n . Thus, Patch-seq is suited to discover molecular molecular discover to suited is Patch-seq Thus, . y BAC/dsRed @ 1 k ) because their morphological and molecular molecular and morphological their because ) post hoc post i . s e or 21 ::GAD67 t i b , 2 o morphological analysis of neurons in in neurons of analysis morphological 2 r , n smld ul DsRed dual sampled and ), . As reliable histochemical detection detection histochemical reliable As . . h a r k 4 a , , Gábor Szabó n gfp/+ y @ m mouse reporter mouse e d 4 u Department of Genetic and n i w i e 6 n These authors share . a ticles e l c i rt A c . a 3 t + , ). ) GABAergic GABAergic )

23 3 , 5 , 2 , 1 4 1 ( + . CCK . Fig. Fig. 1 /GFP  a + + - - - -

© 2015 Nature America, Inc. All rights reserved. intestinal polypeptide ( ( superficial layer-specific marker, calbindin D28k receptor subtype 3a ( protein–signaling regulator ( ( ( subunit ( C substrate kinase ( protein a GTPase-activating K gated ( in red, dendrites in gray. subclass is shown. Scale bars, 100 representative biocytin-filled interneuron for each a of reconstruction morphological panel, each To of ms. 25 right bars, the scale horizontal pA, 200 bars, scale Vertical characteristics. ADP and AHP to emphasize mV omitted +30 was AP, rheobasic the the For color. blue cool to warm from shift APs subsequent and red is AP first the plots, plane phase- In subtype. neuronal every for depicted are right) (bottom APs rheobasic and right) (top injection current rheobase 2× from rising APs the of plots Phase-plane shown. are (bottom) pulses current square to (top) responses AP 3 ( GAD67 CCK dual-tagged of recordings clamp bar, 50 Scale GAD67 a CCK of cortex somatosensory the of L1 layer in (arrows) neurons labeled dual- DsRed/GFP of photomicrograph ( interneurons. CCK of marks molecular representative and distribution 1 Figure whole-brain in microscopy two-photon or lightsheet with compatible also is method cleared tissues optically in morphology (axonal) of reconstruction the for clearing tissue and enic (3,3 chromog filling, biocytin electrophysiology, patch-clamp combined ( electrophysiology patch-clamp for routines whole-cell of custom-written a membrane series through properties active and passive its analyzed and layer) (cortical tion loca its cluster recorded we neuron, each For shown). not I-type data cells; any (three resemble not did parameters electrophysiology their if or Methods) (Online baseline from deviation >20% showed “Exc-types”; types, 1b Fig. (excitatory cells pyramidal types, “I-types” (inhibitory interneurons were Forty-five analysis. RNA-seq and electrophysiology combined for suitable proved cells 83 which recording; before microscopy epifluorescence by con firmed (as examination morphological and electrophysiology clamp ( analysis parative for com layer specificity cortical that resolve features and molecular (DsRed cells pyramidal cortical in expression CCK moderate of advantage We took cortex. somatosensory the of (L)1/2 layers in interneurons s e l c i rt A  Y ( Calb1 Scn3a g

) Cell type–specific expression of a voltage a of voltage expression type–specific ) Cell Npy We first selected ~120 DsRed ~120 Weselected first d ), 4 ( ), ) in subclassified I-type CCK ), a Ca ), Purkinje cell protein 4 ( gfp gfp/+ 25 +

+ – -channel interacting protein ( protein interacting -channel Cacna2d3 e ′ , Neurophysiological diversity, diversity, Neurophysiological only) to build a reference database of electrophysiological electrophysiological of database reference a build to only) interneurons (I-type 1 ( (I-type interneurons ; d -diaminobenzidine (DAB)) -diaminobenzidine labeling 2 ), 5 ( ),

6 Fig. 1b Fig. mouse ( mouse ). We discarded neurons only if their input resistance resistance input their if only neurons discarded We ). ( 2+ µ i. 1b Fig. -binding protein, vasoactive f m. ( m. )). At the left of each panel, panel, each of left the At )). y axis between −20 mV to mV −20 between axis – ), a ), Na b Nrgn Fig. 1 Fig. Supplementary Fig. 1a Fig. Supplementary Htr3a f – ) and DsRed and ) f Vip ) Representative current- ) Representative – V f ), a ), Ca m ) and neuropeptide ). Our visualization visualization Our ). + ), reelin ( a , membrane potential. Rgs12 channel subunit subunit channel ). Chn1 a ) Confocal ) Confocal BAC/dsRed 2+ Pcp4 channel channel ), serotonin b + µ ), a protein a ), protein interneurons. Reln ), 2 ( ), + + m. Axons are cortical neurons in total for patch- for total in neurons cortical Supplementary Table 1 Table Supplementary /GFP ), a G DsRed Kcnip1 ), a :: c ), ), / + ). ). with an additional 38 being being 38 additional an with

), ), 2 7

f e d GA a Vm (mV) Vm (mV) Vm (mV) D67 Supplementary Supplementary –1 –1 –1 –60 –60 –6 20 60 60 20 60 20 -GFP 0 0 0 0 0 0 0 Fig. 1 Fig. / ). We also also We ). CCK L2 a Ti Ti Ti ), of ), me (s) me (s) me (s) 0 0.5 0.5 .5 1 1 - - - - L1

These cells displayed the highest AP amplitude, the steepest AP AP steepest the amplitude, AP upstroke slope highest and the highest the firing frequency of displayed all recorded neurons. cells These firing. burst producing without trains AP accommodating had cells ( potential membrane resting hyperpolarized smallest the most- and (AHP) demonstrated after-hyperpolarization largest the burst, amplitude, AP a producing without stimulus 1 rheobasic a of onset the at spike to I-type began They ratio. adaptation low properties. a with electrophysiological accommodation (AP) potential action exhibited interneurons their on based purely 1–5, (I-types subclasses five DsRed to classify physiology cells drite-targeting or den perisomatic axo-axonic, subclasses: distinct morphologically three of one into fall interneurons innervation, of target pattern postsynaptic their on Based features. morphological and biophysical interneurons for nomenclature common most The interneurons CCK of analysis morphological and Functional increasing the three-dimensional integrity of neuronal morphology. slices (300- to 350- 1. b c 1. 1. 0 0 0 Vm (mV) Vm (mV) –60 –60 –1 –1 –60 –6 –6 60 V (mV) V (mV) V (mV) 20 60 20 –1 –1 m –1 m m 0 0 0 0 –50 –40 240 240 advance online publication online advance –50 –40 –50 –40 240 40 60 20 20 40 40 60 60 20 0 0 (mV/ms) (mV/ms) (mV/ms) V dV/dt dV/dt V dV/dt V m m m (mV) (mV) (mV) 60 60 60 Ti Ti me (s) me (s) 0. 0.5 µ 1 5 L2 L2 L3 L1 L2 L1 L1 m thick), thus greatly reducing processing time and 3 , 5– 7 , L3 L4 2 8 . Here, we first used patch-clamp electro patch-clamp used first we Here, . I-t I-t 1. I-t .0 ype 0 ype ype + Fig. 1b Fig. –60 –60 /GFP

5 V (mV) 4 V (mV) –1 –1 ; 3 m m 240 240 –50 –40 –50 –40 ; n ; 20 20 40 60 40 60 n = n =8(C =7(C 14 + (mV/ms) (mV/ms) V – V dV/dt interneurons in cortical L1 into L1 cortical in interneurons (C dV/dt m m (mV) f (mV) and and ell 35) ell 50) ell 60 60

12 nature biotechnology nature ) Supplementary Table 1 Supplementary L2 L1 L2 L1 Cacna2d3 g V rest Kcnip1 Rgs1 Scn3a Calb Htr3a Pcp4 Chn1 Nr Re Np Vi I-t ; ; gn

I-t I-t ln Fig. 1 Fig. p 1 2 ype ype y ype 6

I-t 1 key combines ype 2 ; 1 n I-t ; =

2 n ype b =6(C 10 ). I-type 2 I-type ). I-t 3

ype (C

I-t ell 20)

4 ell 21) ype 5 - - )

© 2015 Nature America, Inc. All rights reserved. buffer, which allowed for in-tube reverse transcription by PCR. ( PCR. by transcription reverse in-tube for allowed which buffer, ( pressure. negative maintaining mV, +20 to while potential) (holding mV −5 from pulses voltage square ( interneurons. tagged ( orange. and yellow in highlighted cortex somatosensory the with anatomy slice brain ( cortex. somatosensory the access to brain a mouse of plane 2 Figure by characterized we that neurons same the on sequencing RNA cell We next developed a method, called Patch-seq, for performing single- aspirates somatic of sequencing RNA RNA-seq. by single-cell interrogated be can which identity, cell for determinants molecular of diversity critical a suggest features distinct Their subtypes. interneuron fide bona as and morphological differences identify I-type 1-5 CCK electrophysiology correlated above the Cumulatively, cells. 1 I-type neighboring pyramidal cells, with less dense network labeling than for and interneurons 5 I-type between coupling dye saw we Rarely, L2. apically. 5 I-type interneurons in branched horizontally L1 and upper L2 with some collaterals reaching as far as L4. Their dendrites targeted in concentrated nests axonal elaborate of their majority the had cells 4 I-type L2. in coursing processes of majority the with branched less was arbor axonal Their 1 cells. of I-type thickness process of the half yet were all diameters, with less homogenous than had also processes cells, 1 I-type to similar interneurons, 3 I-type L2. in located sively exclu almost were axons their L2, and L1 both into intruded drites of that twice 1 and den at Whereas their cells, I-type resided the transition. L1-L2 least at diameters somatic had interneurons 2 I-type below). (see yellow Lucifer using experiments by shown dye-loading with junctions as gap cells, pyramidal to L2/3 even and cells maintained nonpyramidal neighboring cells 1 I-type L2. and L1 in trated concen processes These microscopy. light by dendrites or axons as assignment unequivocal their thus precluding throughout, processes sized equally had interneurons 1 I-type as: such morphology, cell in ( subtypes of arbors the five putative interneuron and nests the axonal dendritic ( current threshold the 2× at stimulated when AP consecutive second a and ADP pronounced and resistance input higher exhibited cells regular spiking ( and accommodating nonbursting, as categorized were only) (DsRed 1b Fig. L5; and L4 L2/3, (Exc L5 and L4 L2/3, in recorded assessed. types interneuron the among rheobase highest the had and rise, AHP the of trajectory falling the on ADP small-amplitude ( burst a producing without APs fired and spiking, irregular exhibited interneurons 5 I-type examined. classes sub interneuron among all input resistance highest had the neurons slow AHP; yet this was to insufficient produce a burst ( a before ADP small a displayed that cells interneu accommodating were rons 4 I-type depolarization. sag largest the as well as (ADP), after-depolarization large a had neurons These current. threshold 2-times on AP first the after spikes 3–4 of consisted burst AP Each lowest AP upstroke slope and considerable accommodation ( rents; cur cationic nonselective hyperpolarization-activated of activation the indicating (a phenomenon not did show They depolarization sag nature biotechnology nature instrument. Hiseq2000 Illumina an on performed sequencing RNA cell Supplementary Fig. 1d Fig. Supplementary Next, we used used we Next, For comparison and validation, we examined the 38 pyramidal cells Fig. 1 Fig. –

d Workflow diagram of Patch-seq procedures. ( procedures. Patch-seq of diagram Workflow and Fig. 1b Fig. c c ) Whole-cell patch-clamp recording of DsRed of recording patch-clamp ) Whole-cell ). I-type 3 interneurons produced AP bursts, the shal the bursts, AP produced interneurons 3 I-type ). Supplementary Table 1 Supplementary Supplementary Fig. 1b Supplementary post hoc post – f ). Our analysis revealed substantial differences differences substantial revealed analysis Our ). d ) Aspiration of neuronal somata was followed by followed was somata neuronal of ) Aspiration ). morphological reconstructions to identify identify to reconstructions morphological advance online publication online advance e ) The sample was expelled into lysis lysis into expelled was sample ) The ). L2/3 and L4 pyramidal cells cells and L4 pyramidal ). L2/3 , c ). ). In contrast, L5 pyramidal Fig. 1 Fig. f ). These cells had a had cells These ). a ) Coronal cutting cutting ) Coronal Supplementary Supplementary Fig. Fig. 1 + + interneurons /GFP b ) ) Ex vivo Ex f ) ) Single- e + Fig. Fig. 1

). ). These dual-

d ). ). ------RNA molecules/neuron, mapped to ~5,000 distinct genes distinct ~5,000 to ~19,000 mapped recover molecules/neuron, can RNA neocortex mouse the from neurons single of with previously published single-cell data by of as cell, per 7% comparison inferred ciency mRNA per molecule ( neurons, respectively inhibitory and excitatory in molecules mRNA 6,760 and ones). On 5,977 average, mainly protein-coding models, we observed gene conservative Browser Genome UCSC using average, (on genes distinct 2,068 to uniquely mapped 40% which of cell, per reads raw reaction. tube a in samples reverse (STRT-C1) single-cell–tagged transcription of version modified a using performed charged samples (0.8–0.9 the negatively Subsequently, solution. holding pipette the in efficiently molecules most RNA by RNA of loss the reduced intervals) 5-ms at mV, length, −5 in ms 5 each potential ing hold from mV +20 potential membrane (to pulses voltage positive ( cells ~140 on approach iterative an We using pipette. found, recording the into aspirated was compartment somatic entire their min, protocols 20–25 within voltage-clamp and current-clamp of series a in neurons ( electrophysiology patch-clamp ( Subsets of these interneurons also expressed mRNAs for neuropeptides vesicular glutamate transporter 1 ( ( transporter acid amino inhibitory ular Moreover, all subtypes of interneurons contained mRNAs for the vesic (the gene encoding GAD65; 39 of 45 cells), as well as expressed neurons I-type As neurons. expected, and excitatory from inhibitory respectively. cells, the of 87% and 79% in detected were markers Pan-neuronal surfaces. or plastic glass to ences, leakage during cell aspiration and/or binding of aspirated RNA differ procedural to Welosses ~20%. attribute of efficiency capture Vip reporter neuron Patch-clamp c (somatosensory cortex) Brain slice b Mouse brain a Next, Next, we each subjected sample to RNA-seq, generating 1.6 million To validate the quality of our RNA-seq data, we compared the results , Npy and µ Gad1 l) were ejected into lysis buffer (0.6 (0.6 buffer lysis into ejected were l) dual Supplementary Fig. 2 Fig. Supplementary Fig. 3 Fig. Crh (the gene encoding GAD67; 41 of GAD67; and 45 cells) gene (the encoding ) and Ca d ). This corresponds to an absolute capture effi capture absolute an to corresponds This ). + – 2+ 29 -binding proteins ( , 3 0 designed to handle low RNA input input RNA low handle to designed f e d Single-cell RNA-seq transcription, ampli cation RNA ejectionandin-tubereverse in pipettesolutionwithelectricpulsetrain Aspiration ofneuronalsoma,keepingRNA Figs. 2 2 Figs. Slc17a7 ), that applying a continuum of of continuum a applying that ), and Slc32a1 1 ) ) or 2 ( 1 . . By comparison, RNA-seq 3a– Calb1 Slc17a6 ) c 3 ). After testing the the testing After ). 1 µ 1 Cck ticles e l c i rt A 1 but lacked either either lacked but l). RNA-seq was was RNA-seq l). ;

Thy1 Figs. 1g (44 of 45 cells). ) ) (refs. –5 mV +20 mV and and 1 1 and , with a with , 32 Stmn2 Gad2 , 3 3 3 e ). ). ),  - - - -

© 2015 Nature America, Inc. All rights reserved. whereas a single interneuron (1/45) was found reminiscent of L5 L5 of reminiscent ( cells pyramidal found was (1/45) interneuron single a whereas interneurons, as classified were (0/38) cells excitatory the of None and cell, removing groups measured with ( lower correlation tures (e.g., genes), ranking the candidate groups by correlation with any lier Patch-seq to ear one of distinguished neuronal subtypes the possible populations. sample small-sized in accuracy classification overall of availability reference data sets for major brain regions enhance will the increasing approach is not for classification, mandatory neuronal this though Even subclasses. neuronal better-defined molecularly to properties electrophysiological assign to able be would we set, data larger much this to aligned be could data Patch-seq if that reasoned recently generated took advantage of data set the cortex we on single-cell somatosensory cal power. To increase the reliability of our molecular classification, we of ous low groups because the resulting of statisti is cells challenging the molecular classification of neurons from small and/or heterogene is inherently limited in throughput. Electrophysiology Consequently, sets data RNA-seq single-cell on identities neuronal Mapping identities. cell defined physiologically electro and transcriptionally between correspondence one-to-one ( markers among interneurons revealed a distinct pattern of common molecular cer the in of of the RNAeach the 5 phenotypes I-types Examining cortex. ebral neurons excitatory and inhibitory between distinction functional major the reflect accurately data of lower copy numbers along considerably with extent butSlc17a6, not Slc32a1 (0 of 38 cells), lesser a to and Slc17a7, expressed only cells ( pyramidal Exc-type contrast, By transcripts. parvalbumin contained in CCK with interneurons co-exist to known markers layers cortical deep and superficial in cells pyramidal for markers and marker, interneuron markers, pan-neuronal are (magenta). interneurons and (green) cells pyramidal by positioning (L) layer and expression gene Differential positions. anatomical specified at genes select for cell per counts molecule mRNA showing plots ( set. data the in cell each for (bottom) genes detected of number corresponding the and (top) molecules mRNA of number ( interneurons. (inhibitory) and cells pyramidal (excitatory) distinguish others, many among that, examples as shown are (bottom) duration AP and ( reproducibility. high reveal neurons inhibitory and excitatory of pairs between plots Scatter classification. neuronal for parameters of sets large using interneurons and cells pyramidal ( 3 Figure s e l c i rt A  corroborated certainty high with cells pyramidal of phenotype ular c a

) Resting membrane potential ( potential membrane ) Resting , b The anatomical position, electrophysiology classification and molec from neuron each assign to classifier We correlation-based a built Cck 1 ) Analysis of patch-clamp recordings from from recordings patch-clamp of ) Analysis 1 . The classifier . used an The classifier iterative process of relevant fea selecting mRNA ( mRNA

Overview of Patch-seq methodology. methodology. Patch-seq of Overview Figs. 1g 1g Figs. 5 d , ) Bar plots showing the total total the showing plots ) Bar 6 Fig. Fig. . None of the cells (0/45) (0/45) cells the of None . Fig. 4 Fig. 1 1 and 1 1 , , respectively. , containing >3,000 single-cell transcriptomes. We 3 e 3 b Calb1 ). Thus, our RNA-seq RNA-seq our Thus, ). ). e Gad1 ). Thus, at this level of analysis, there was a was there analysis, of level this at Thus, ). Thy1 and and Pvalb is a pan- is V and and rest Pcp4 , top) , top) ) mRNA mRNA ) e Stmn2 ) Bar ) Bar are are

a b Cell 55 Cell 81 100 100 10 10 1 1 1 1 1 1 Pyramidal cell Interrneuron (excitatory) (inhibitory) Cell 50 Cell 80 Fig. Fig. 4 0 0 a 100 100 ). ). ------

e d c Gabra1 10,000 at high frequencies upon prolonged depolarization of fast-spiking fast-spiking of depolarization prolonged upon frequencies high at K fluctuations. potential membrane subthreshold determining in V quantitative expression of channels subtype in (for our data set subtype Fig. 5 titative expression of genes encoding ATPase subunits ( a key electrogenic determinant of membrane potential changes with ( detected subunit any of differences expression compare could I-type the ( interneurons in receptors and pumps ion channels, of expression the The depth of our analysis molecular allowed us to quantitatively assay excitability interneuron determine to candidates Molecular predictions. statistical and criteria morphological) (and biophysical power of through the increased combination classification of real-life from an of combination and benefits patch-clamp RNA-seq methods with the that shows This subsets. of to these each heterogeneity assigned of cells the half exceptional showed 4 I-type types. cell related of closely subset another forming to Int5-Int8, 2 and 3 assigned were related interneurons (Int11-Int14 in ref. molecularly. 1 Instead, I-types and 5 were to aligned one set of closely group single a into classified was subdivisions interneuron “I-type” interneurons were assigned to CCK ( identities L2/3-L5 layer-specific their GAD67 Cxcl14 Stmn2 Scn3a 5,000 3,000 Calb1 Clcn3 (mV) Gria2 Gad1 L4 L2 Htr3a Pcp4 rest + Rorb Thy1 Reln CCK –60 –50 Npy Cck For AP frequency modulation, Kv3.1 ( Kv3.1 modulation, frequency AP For Cl Voltage-gated Crh -channel, is broadly assumed to confer the capacity to discharge discharge to capacity the confer to assumed broadly is -channel, (ms) Vip L5 L3 L1 0 0 2 4 ( Supplementary Fig. 3b Supplementary a Genes mRNA molecules Action potentialduration Resting membranepotential ) closely and positively correlated with the advance online publication online advance 3 6 , are thought to modify , are to thought modify Fig. 5a Fig. − channels, a family of poorly understood ion ion understood poorly of family a channels, – c ). Having our cells patch-clamp recorded, we recorded, patch-clamp Havingcells our ). Clcn3 ( V Atp1a3 rest ), potentially ), implicating potentially channels these Fig. 5 ) was shown to positively correlate with V V rest , see , see d + rest subclasses ( ). For example, Na in excitable cells by Here, ion gating the fluxes. Supplementary Fig. 3a Fig. Supplementary Fig. 4 Fig. 1

1 nature biotechnology nature Kcnc1 ; ; Fig. Fig. 4 c ). All of the measured measured the of All ). V ), a delayed rectifier rectifier delayed a ), Fig. Fig. 4 d rest ). ). Likewise, I-types of each neuronal Atp1a1 34 d + /K ). ). None of the , 3 5 . The quan + ATPase is - Atp1b3 ). - ;

© 2015 Nature America, Inc. All rights reserved. provide candidates for the future molecular dissection of neuronal neuronal of dissection molecular future the for candidates provide exact functional importance of these associations remains elusive, the they Although parameters. AP with associated and together grouped ( 4 ( one but not of For subset another interneurons. example, synuclein- able by hypotheses on focusing the preferential expression of genes in Fig. 4d lation with at ( parameter least one electrophysiology Slc32a1 Cadps2 ( CCK any for distinguishing it if allows studies for future valuable be could cients exceeding −0.4 and/or +0.4 (ref. that any robust for correlation sufficiently (filtered correlation coeffi We hypothesized trains. AP or APs single of parameters biophysical specific with association meaningful returns predictors as criteria) numbers of ion channels and synapse-related proteins (167 passed our mRNA and copy if asked rendering of tage data sets, our quantitative lation with one or more electrophysiology parameters. We took advan expression of many genes (748 out of 5,600) showed significant corre trophysiological parameters. The quantitative elec and expression gene between relations cor of analysis the permitted also Patch-seq classification, priori a many of Independent neurons of markers use-dependent for matrix Correlation excitability. neuronal neurophysiology of parameters specific future interrogating studies for predictions Table1 of consequence biophysical a depolarization, sag hyperpolarization-activated of lack the confirmed electrophysiology where cells, 1 channel ion nucleotide-regulated cyclic detecting by demonstrated RNA was and data physiology electro the of coherence Similarly, ulation). Kcnc1 cells expressed pyramidal ~3× higher RNA of count/cell for excess in firing interneurons interneurons (below). types cell respective denote plots Bar (top). subtypes neuronal between distances ( interneurons ( cells pyramidal of clustering molecular with classification electrophysiology-based ( alignment. best the fitting after set data our in cell each for results ( subtypes. interneuron and described pyramidal cell ( in neurons identified align to used process classification based ( set. data cortical a large using neurons Patch-seq–sampled of 4 Figure nature biotechnology nature states. or pathological physiological under networks Sncg Clic4 Vamp4 Hcn1 + ), synaptotagmin 7 ), ( synaptotagmin ( , , interneuron subtype. The quantitative expression of 24 genes genes 24 of expression quantitative The subtype. interneuron – P , , ). Thus, our RNA-seq data will allow allow will data RNA-seq our Thus, ). , , Clip3

Hcn1 i ciiy ( activity Slc6a17 Molecular classification and validation validation and classification Molecular < 0.05 for cell pop the whole I-type ). The main advantage of this approach is that it provides test Exoc8 ) and the GABA synaptic reuptake transporter transporter reuptake synaptic GABA the and ) 3 d , , . We saw no expression in I-type 7 ). Dendrograms depict cluster cluster depict Dendrograms ). . Our data support this because Cacna1g , , Cck , , a Gria1 Sort1 ) Schema of the correlation- the of ) Schema i. 1 Fig. mRNA copy numbers in numbers copy mRNA c Figure 1 Figure , d ) Compliance of the the of ) Compliance , , , , Supplementary Fig. Supplementary 1b , , Stx4a Grin2b Kcnma1 b b Syt7 ) Classification ) Classification ; ;

b Supplementary Supplementary to previously previously to advance online publication online advance , , ), vesicle-associated membrane protein ), vesicle-associated Syt6 , , Htr7 , , , , Kcnj11 Syt7 c , , ) and ) and 1 1 Kcnma1 , , ); ); Tac2 , , Supplementary Fig. Supplementary 4a Kcnc1 - - - - )

) had significant corre ) had significant , , d b a Npy , , Electrophysiology Apba2 S1PyrL23 S1PyrL5a S1PyrL6b S1PyrL4 S1PyrL5 S1PyrL6 Supplementary Supplementary classi cation G , , Patch-seq I-t I-t I-t I-t I-t L4 L2 AD67 Int1 Int1 Int1 Pak1 CCK Int1 ype ype ype ype ype RNA data Int5 Int6 Int7 Int8 Cc Slc6a1 L5 L3 L1 , , 1 3 2 4 5 4 3 2 1 k Cacna1g , ,

Pcdh8 0 0 0 0 0

were were Int1 , b 0 0 0 0 0 γ - - - - - ) , , Int2

Cortex database able able brain the in rons CCK in highest be to reported was which sample, our in ( receptor cannabinoid 1 type the of expression the examined predictions by and histochemistry channel neurophysiology. Next, we 3.61; of difference in 38 pyramidal cells (8.57 rons (4.46 subunit by interneurons is in explained usually low their of levels GluR2 ( desensitization and inactivation receptor AMPA of kinetics fast are expressed differentially in various neuronal subtypes. As such, the by expressed neurons. all Its GluR1 ( subunits, receptors (AMPA) acid 3-hydroxy-5-methyl-4-isoxazolepropionic inputs. afferent of heterogeneity and cificity ( neuron sampled each on load network net the determine which receptors, other and protein–coupled) (G metabotropic channels, ionotropic ligand-gated all) not (if most on information contains it that is set by tuned of An inputs. its data cally afferent advantage our Patch-seq is dynami of a neuron excitability intrinsic Atthe time, any in point interneurons CCK in repertoire receptor Subtype-specific Int4 0 0 0 0 0 For example, fast glutamatergic transmission relies on on relies transmission glutamatergic fast example, For Cnr1 Int3 0 0 0 0 0 3 8 Fig. 5a Fig. . Here, we sampled 210 mRNA expression (12 (12 expression mRNA 0 2 0 1 0 ± Int5 5.3 and mRNA 283 molecules/cell) mRNAs cumulatively 1 2 2 0 0

– Int6 39 Alignment c ). This allows for inferences be made on the spe the on made be inferences for allows This ). Fig. 5 Fig. , 4 0 0 4 4 0 0 Int7 . Here, we find that I-type 1 cells lack appreci lack cells 1 I-type that find we Here, . c Electrophysiology C b 0 0 0 4 0 orr to

classi cation Lea ±

), thus quantitatively recapitulating earlier earlier recapitulating quantitatively thus ), Int8 cor elation withP 8.08 mRNA molecules/cell; Ex Gene selection neur ve Ex Ex tical gr c L2/3 mostcorr 0 0 0 0 0 cell t c L5 c L4

Int9 Cc onal t Gria1 k ypes oups 0 0 0 0 0 Cnr1

Int10 ypes atch-seq 0 0 1 8 elat

mRNAs in total in 45 interneu S1PyrL23 0 0 0 1 1 ed mRNA molecules in total), total), in molecules mRNA

Int13 Alignment

S1PyeL4 3 0 0 Int15 0 0 0 0 0 Gria1 12 1

to S1PyrL5 4 0 0 0 3 cor

Int11 s e l c i rt A )-GluR4 ( )-GluR4 tical gr 3 5 0 0 Best aligned gr

9 4 1 0 0 S1PyrL6 P Int12 < 0.05, mean + oups interneu 1 2 α 0 0 0 0 2 S1PyrL5a

-amino- Int14 Gria4 Gria2 Cnr1 2 0 0 0 0 0 0 0 Int16 S1PyrL6b oup ), ),  - - - - - ) )

© 2015 Nature America, Inc. All rights reserved. functional outcomes functional by providing platform a ofmarks identifying for helpfutureinvestigations systemsneurobiology rationalizediverseto Patch-seqourapproachthat suggest will we receptors.Overall, 5-HT tor behavior in its L1 microcircuit even if the interneuron itself lacked CCK a identify to us primed depolarization at suprathreshold 5-HT load. Thus, our Patch-seq data gap junctions through potentials membrane their synchronize to interneurons for cortical nonpyramidal neurons, and even pyramidal cells. This allowed 5-HT.ofinterneurons neighboring tiondye-coupled 1 wereto I-type is explanatory of the depolarization of I-type 1 cells upon bath applica morphological reconstruction of the sampled interneurons ( lack of any metabortopic or ionotropic 5-HT receptors. Moreover, the the to interneuronsowing 1 I-type in insensitivity 5-HT predicts seq pharmacological results thus establish causality, considering that RNA- I-type 4 interneurons became readily depolarized ( interneurons did not cause depolarization ( ( centtracer fluores a coapplying by load 5-HT We equal somata. controlledron was embedded, 10 by imposed neuronaleffects the network into recorded the which cell dissect the origin of the depolarizing 5-HT effect and rule out indirect 25 5 with depolarization ( 5-HT 5 pA, 0 to cells clamping the While ( interneurons the excitatory effect of 5-HT on I-type 1 ( of the 5-HT receptors. We validated our Patch-seq results by measuring Htr1d ( tags genetic by interneurons CCK of undersampling the to leading likely thought, initially than restricted more be might interneurons that suggests This interneurons. ( ( in expression ( 5-HT3a cells no 1 I-type observed we set, data Patch-seq our In receptor 3a ( CCK cortical among complexity of molecular Fig. 5 which contrasts with I-type 2–5 subclasses (678 voltage. membrane in changes fast determining channels ion voltage-gated the of those with accord codes Color (green/orange). hyperpolarization and (green/yellow) repolarization ( rest phases: specific ( respectively. green, and magenta in mean bars, Error counts. molecule mRNA to correspond Numbers receptors. metabotropic (2-AG)-activated 2-arachidonoylglycerol and (DA) dopamine ( receptors. (Gly) glycinergic and (5-HT) serotonergic (nACh), acetylcholinergic nicotinic (GABA), GABAergic (Glu), glutamatergic of subunits channel K activated Na of expression CCK in genes receptor 5 Figure s e l c i rt A  specific modalities among neurons. Vip Fig. 6 Fig. Calb

Subsequently, ourall analysisto expanded we (5-HT) serotonin the utilize studies biology developmental Many µ + M 5-HT / + ± c mRNAs. Notably, I-type 1 cells contained no mRNA copy for any Npy c / ). ). These differences suggest level another hitherto undescribed s.d. Interneuron and pyramidal cell subtypes are color coded coded color are subtypes cell pyramidal and Interneuron s.d. Fig. 6d Fig. Npy

). None of the CCK the Noneof ). Cell type–specific quantitative expression of ion channel and and channel ion of expression quantitative type–specific Cell − + c ) and I-type 4 ( (K ) Subunits of Glu, GABA, muscarinic acetylcholine (mACh), (mACh), acetylcholine muscarinic GABA, Glu, of ) Subunits + 4 Htr3a Fig. 6d Fig. 42– /Vip 1 4 . Ca 5 , i. 6a Fig. , assigning I-type 1 cells as passive followers of network 4 e Fig. 6a Fig. + ) ion channel subunits. ( subunits. channel ) ion 4 /K upper trace) were bath-applied. Both subthreshold subthreshold Both bath-applied. were trace) upper was observed in both I-type 1 and 4 interneurons. To − ) subtype to detect and classify CCK interneurons µ + ) cells and high mRNA copy numbers in I-type 3 I-type in numbers copy mRNA high and cells ) -ATPase, voltage-gated Cl -ATPase, voltage-gated , M 5-HT was microejected (‘puffed’) onto interneu e V + , middle). Direct 5-HT application 5-HT 1 Direct onto middle). I-type , rest interneurons and pyramidal cells. ( cells. pyramidal and interneurons , , b c µ )/subthreshold (magenta), depolarization (cyan), (cyan), depolarization (magenta), )/subthreshold ) in whole-cell current-clamp experiments. experiments. current-clamp whole-cell in ) ), low low ), M and suprathreshold depolarization with with depolarization suprathreshold and M Vip + + interneuronscontained + / interneuron with a 5-HT-driveneffec a interneuron with Npy Htr3a + d , ) Schema of an AP indicating its its indicating AP an of ) Schema Htr3a µ Fig. 6b mRNA expression in I-type 2 I-type in expression mRNA M (data not shown) and 25 25 andshown) not (data M b ) Ligand-gated ionotropic ionotropic ) Ligand-gated n Fig. 6 xrsin mn CCK among expression = 4) versus I-type 4 ( , − c , , Na ) and I-type 5 ( + d interneurons. Cnr1 + , bottom). By contrast, Htr1a-Htr7 Fig. 6 , , K + , , Ca mRNAs in total; Htr1a e a , bottom). Our ) Differential ) Differential Htr3a 2+ and Ca and Vip , , Fig. 6a subtypes Htr1b − -driven -driven / n Npy = 4) 2+ µ 4 or , , - 4 M b + 1 + - - - - ) ) .

come existing limitations of classical function-structure analyses. analyses. function-structure classical of limitations existing come interneurons of cohort distinct a target successfully to brain. the in components of cellular fingerprinting detailed limited require tools biology molecular single-cell and neurophysiology that conditions histo and PCR single-cell for chemistry) (~20 time given any at probed unbiased be of could that inception markers of number the limited the Moreover, delayed classification. and dominate, to continued analyses and RNA based histochemistry now is advanced and neurophysiology, of array wide classification a on for of arbors, topography dendritic and and size the axonal as such features, morphological used exclusively who Golgi), and Cajal (e.g., neuroanatomy of pioneers molecular and phenotypes parameters biophysical connectivity, morphology, geneity hetero cellular of level highest the exhibits undoubtedly brain The DISCUSSION a

We combined mouse genetics and patch-clamp electrophysiology electrophysiology patch-clamp and genetics mouse We combined 2+ + + – KCa Ca K Na ATPase, CI Kcnh4 Kcnh3 Kcnh2 Kcnh1 Kcng4 Kcng2 Kcnf1 Kcnd3 Kcnd2 Kcnc4 Kcnc3 Kcnc2 Kcnc1 Kcnb2 Kcnb1 Kcnab3 Kcnab2 Kcnab1 Kcna6 Kcna4 Kcna3 Kcna2 Kcna1 Scnm1 Scn9a Clcn7 Clcn6 Clcn5 Clcn4-2 Clcn3 Clcn2 Atp1b3 Atp1b2 Atp1b1 Atp1a3 Atp1a2 Atp1a1 Kcnu1 Kcnt2 Kcnt1 Kcnn3 Kcnn2 Kcnn1 Kcnmb4 Kcnmb2 Kcnma1 Cacna2d3 Cacna2d2 Cacna2d1 Cacna1i Cacna1h Cacna1g Cacna1e Cacna1d Cacna1c Cacna1b Cacna1a Kcnv1 Kcns3 Kcns2 Kcns1 Kcnq5 Kcnq4 Kcnq3 Kcnq2 Kcnh7 Kcnh5 Scn8a Scn5a Scn4b Scn3b Scn3a Scn2b Scn2a1 Scn1b Scn1a 1 advance online publication online advance 0 , and contains a large variety of neurons that differ in their their in differ that of neurons variety a large contains , and 7 5 together with the often mutually exclusive experimental experimental exclusive mutually often the with together 128 9 96 23 45 152 20 6 2 349 106 5 60 9 30 56 40 51 15 24 40 10 22 11 28 5 4 39 33 40 25 17 23 67 6 8 2 66 63 41 3 80 8 2 29 97 56 160 116 125 183 44 78 149 1,246 1,170 164 4 5 19 3 26 3 8 4 62 27 6 15 4 46 2 10 22 28 6 , 6 , 6 4 . Nevertheless, reliance on known candidate marks marks candidate known on reliance Nevertheless, . 6 . The taxonomy for neurons dates back to the first first the to back dates neurons for taxonomy The . I-type 1 I-type 2 I-type 3 I-type 4 I-type 5 Exc L23 Exc L4 Exc L5 d b c GABA GABA mACh nACh 2-AG 5-HT 5-HT Gl Gl Gl DA u u V (mV) y

m –30 50 Grm5 Grm3 Grm2 Grm1 Glra Htr3a Chrnb2 Chrna7 Chrna4 Gabrr1 Gabrg3 Gabrg2 Gabrg1 Gabrd Gabrb3 Gabrb2 Gabrb1 Gabra Gabra Gabra Gabra Gabra Grin Grin3a Grin2d Grin2c Grin2b Grin2a Grin Grik5 Grik3 Grik2 Grik1 Grid2 Grid1 Gria Gria Gria Gria Cnr1 Drd5 Drd4 Htr1f Htr1a Chrm4 Chrm3 Chrm1 Gabbr2 Gabbr1 Grm7 nature biotechnology nature 0 6 4 2 0 2 a 1 4 3 2 1 5 4 3 2 1 V rest 96 11 21 14 7 155 15 8 48 2 2 125 7 40 64 104 23 35 103 17 35 243 263 13 8 4 227 9 236 130 2 51 56 2 12 39 71 493 106 708 2 2 5 4 4 38 28 23 105 11 Depolarization

Time (ms)

Repolarizatio I-type 1 I-type 1 n

Hyperpolarizatio I-type 2 I-type 2

5 I-type 3 I-type 3 , 4

7 I-type 4 I-type 4 to over to I-type 5 Threshol I-type 5 Exc L23 Exc L23 Exc L4 Exc L4 8 n Exc L5

d Exc L5 - - -

© 2015 Nature America, Inc. All rights reserved. the progressive decoding of regional heterogeneity in the nervous nervous the with in heterogeneity together regional of methods, decoding progressive These the identification. cell positive tating facili thus products), transgene (e.g., standards reference (spike-in) external of exploitation future the allow might technologies mouse Moreover,associations. the combination of Patch-seq with transgenic meaningful return molecules of 1–5 range at the even numbers copy its extremely low rate of false-positive identification of because expression low of genes even sample efficiently to ficient suf However, still is it tissues. dissociated on RNA-seq single-cell in events. network cortical to fundamental contribution their been systematically missed in prior genetic reporter analyses, have obscuring might subclass abundant this that possibility the raises neurons available. The lack not of are reagents suitable if or limited is tools tochemical his available of resolution the when cases in contingents) neuronal of undersampling to (due results false-negative prevent to help will and subtype, neuronal any essentially to applied be can approaches about neurotransmitter-receptor relationships. We expect that similar example, for hypotheses, form to help We can Patch-seq that interest. show also of type cell priori the of a or knowledge systems classification other of discover sets of cellular markers independent (refs. receptors ( on data of they sets reported previously reconcile because important is examples these CCK divide determinants that can be used to sub further seq can a identify number select of molecular We subtypes. fied showed that Patch- further subfields not layers cortical (but deep from L1/L2 from sample interneuron CCK molecules our classified mRNA first We present. of were numbers copy low when even accuracy, present its to Patch-seq optimize and improve to us allowed diversity, which neuronal considerable expected CCK the In plane. recording Rec, shown. are group per 1,2) (cell Two examples application. 5-HT focal to responses potential membrane Bottom: (puff). (10 5-HT identical suggesting cells, recorded the of (60×) images microscopy epifluorescence and contrast (25 5-HT 4 ( I-type 1 ( I-type by firing AP representative ( interneurons. in subunits receptor 5-HT metabotropic and ionotropic for expression mRNA of assessment quantitative specific 100 bars, Scale (bottom). reconstruction its and (top) above as processed 100 bars, Scale bottom). (arrows, neighbors dye-coupled including processes, its of reconstruction and (top) 1 interneuron I-type DAB-stained of stack ( interneurons. cortical of phenotype neurophysiological the with 6 Figure nature biotechnology nature RNA-seq databases large-scale through system The efficiency of mRNA capture in Patch-seq is lower than that that than lower is Patch-seq in capture mRNA of efficiency The 3 , 6

, e Compliance of RNA-seq predictions predictions RNA-seq of Compliance 7 5 µ µ ) interneurons upon bath-applied bath-applied upon ) interneurons , , 4 M) load upon focal microejection microejection focal upon load M) interference differential Middle: M). 5Ht3a 3 7 Rgs12 + 9 ) into the five commonly identi commonly five the into ) interneuron subclasses. Each of Each subclasses. interneuron – + cell population studied, we we studied, population cell 4 µ 1 m. ( m. ). We note that Patch-seq can , , , , Cnr1 Htr3a b a ) I-type 4 interneuron 4 interneuron ) I-type ) Orthogonal image image ) Orthogonal ) ) and channels ( and µ m. ( m. 1 1

or hippocampal hippocampal or Cnr1 advance online publication online advance c ) ) Subclass- d mRNA transcripts in I-type 1 inter d , e ) and ) and ) ) Top: Hcn1

+ - - )

11– d 1 a 11 3 V (mV) V (mV) V (mV)

, can increase the , can increase m m m , 1 –61 –59 –57 –55 –68 –66 –64 –62 –40 2 40 Rec . Thus, mRNA 0 L1 0 0 2 0

5-HT puff(10 5-HT (25 5-HT puff(10 5-HT 4 0 2 2 Rec - - - ­ µ

M) wash-in µ µ Time (s Time (s Time (s l-type drites contain >2,500 mRNAs >2,500 contain drites den and mRNAs, 1,000–4,500 about contain to thought are axons mRNA soma: the total than much less contain axon and the dendrite CamKII as such neurites, into transported actively be to thought mRNAs for even true is This known case of an mRNA that is localized exclusively outside the soma. is and not there a single in more than in neurites, soma the abundant are species mRNA all) not (if most contrary, the On soma. the from neurites axons or dendrites. Although some mRNA is actively transported into of domains distant to targeted preferentially are that mRNAs many misses one may that Patch-seq Therefore, argue ume is considerable. vol intracellular their and spaces large occupy axons and dendrites genes/cell) 10–20 to for qPCR (e.g., compared methods previous contingents, cell probed selectively in cell) per genes (~2,000 expression gene about information accurate and complete are However, limited. can and alone stand Patch-seq give much more experiments when cell numbers from patch-clamp electrophysiology once atlases, available, will reference allow for precise hierarchical Such landscapes to be built even classification. neuronal of stringency M) M) Patch-seq samples somatic material upon aspiration. In neurons, neurons, In aspiration. upon material somatic samples Patch-seq 6 0 5-HT 1 4 4 ) ) ) 4 8 , this does not mean that those mRNA species are absent absent are species mRNA those that mean not does this , 8 0 b L1 6 6 I-type Cell Cell Puff 2 1 1 0 e Vm (mV) Vm (mV) Vm (mV) α –54 –56 –52 –50 –48 –52 –50 –48 –54 –40 Rec 40 and spinophilin and 0 0 2 0 0 4 9 . These numbers are at least an order an order are at least numbers . These 5-HT puff(10 5-HT puff(10 5-HT (25 5-HT l-type 4 0 2 2 Rec µ 4 M) wash-in µ µ 4 Time (s) Time (s) Time (s) M) M) 9 . It is also known that that known also is It . 6 0 5-HT c Htr5b Htr3b Htr2b Htr1d Htr1b Htr5a Htr3a Htr2c Htr2a Htr1a Htr1f 4 4 Htr7 Htr6 Htr4 ticles e l c i rt A 6 , 7 155 . 19 10 17 SUM 0 4 2 0 0 2 2 0 0 0 8 0 I-type 1 I-type 6 6 I-type 2 Cell Cell I-type 3 Puff I-type 4 2 1 4

0 I-type 5  - - © 2015 Nature America, Inc. All rights reserved. 6. 5. 4. 3. 2. 1. reprints/index.htm R The authors declare no competing interests.financial for submission. funding and oversaw the research. All authors read and approved the manuscript neurons. Y.Y., Z.M. and G.S. provided unique reagents. S.L. and T.H. acquired figures. D.C. performed RNA-seqsingle-cell and the transcriptome-based cell classification, and drafted cell classification, electrophysiology-based and drafted figures. A.Z. performed J.F., A.Z., S.L. and T.H. wrote the paper. J.F. performed electrophysiology and the NovoNordisk Foundation (to T.H.). 7th Framework Program (PAINCAGE, to T.H.), Hjärnfonden (to T.H.) and the and T.H.); Human Frontier ProgramScience (to A.Z.), the European Commission Council (BRAINCELL 261063, to S.L.), the Swedish Research Council (to S.L. Neurolucida reconstructions. This work was supported by the European Research reconstructions, T. Klausberger and E. Borók for discussions and assistance with Karolinska Institutet for making the Imaris software package available for neuronal We thank A. Juréus for DNA sequencing, and the CLICK Imaging Facility at online version of the pape Note: Any Supplementary Information and Source Data files are available in the codes. Accession the in versio available are references associated any and Methods M processes. pathological and physiological of fundamental understanding to a better contributing thus settings, experimental many in changes transcriptome-wide of acterization RNA transcriptome. the on impact minimal have to expected a be can on h 1 than occur shorter that timescale recordings patch-clamp of impact the Thus, tion. identifica cell-type affect not did genes immediate-early removing Egr2 (e.g., genes immediate-early of tion induc the is setting any in known response transcriptional quickest h 1 than shorter be to known none with h), 9 (median: hours many of order the on are molecules mRNA most of lifetimes the as might alter the transcriptome. Here, we used 20- to 25-min protocols, stimuli electrical because recordings electrophysiology of length the neurites. the into transported efficiently less or more are mRNAs which on information without of by view mRNA a although give a expressed neuron, representative mRNAs). As a result, the sequencing soma content can be to expected >100,000 contains (which soma the of that than lower magnitude of s e l c i rt A  C AUTH A

eprints and permissions information is available online at at online available is information permissions and eprints c O

ethods In conclusion, Patch-seq can be expected to facilitate the char the facilitate to expected be can Patch-seq conclusion, In is controlled tightly be to needs that element technical Another know MP soi G.A. Ascoli, hippocampus. the of Interneurons G. Buzsáki, & T.F. Freund, Tricoire,L. unity the dynamics: temporal and P.diversity Somogyi, Klausberger,T.Neuronal & biology. developmental from perspective a neocortex: the of Evolution P. Rakic, mind. their change and up grow neurons Pyramidal C. Hanashima, & G. Fishell, oecaue f etrs f AAri itrern o te eerl cortex. cerebral Neurosci. the Rev. of interneurons GABAergic of features of nomenclature (1996). 347–470 diversity. interneuron operations. circuit hippocampal of Neurosci. Rev. Nat. Neuron ), ), which can be detectable after 30 min, but peaks at 3 h. However, O n of the pape the of n E TI R R C

N l 57 e ON G G FI , 333–338 (2008). 333–338 , dgm et al. et t al. et TRIBUTI

N l 9 . A , 557–568 (2008). 557–568 , A blueprint for the spatiotemporal origins of mouse hippocampal mouse of origins spatiotemporal the for blueprint A en GEO: GEO: N eil Itrern oecaue ru. eil terminology: Petilla Group. Nomenclature Interneuron Petilla

r CIAL CIAL I 10 ts . post hoc r J. Neurosci. J. . , 724–735 (2009). 724–735 , ON GSE70 N S morphological reconstruction of biocytin-filled morphological reconstruction of biocytin-filled T E R

31 E Science 874 STS , 10948–10970 (2011). 10948–10970 , 4 .

c-Fos 321 , 53–57 (2008). 53–57 , (also know as as know (also http://www.nature.c Hippocampus Fos 5 online online ), ), 0 . The The . Jun Nat. om/

6 - - - , ,

21. 20. 19. 18. 17. 16. 29. 28. 27. 26. 25. 24. 23. 22. 15. 14. 13. 12. 11. 10. 9. 8. 7. 40. 39. 38. 37. 36. 35. 34. 33. 32. 31. 30.

Hashimoto, T. Hashimoto, Freund, T.F. Interneuron Diversity series: Rhythm and mood in perisomatic inhibition. S. Qiu, ion- single-cell Quantitative D.J. Snyders, & E. Schutter, De A.J., Labro, K., Veys, Citri, A., Pang, Z.P., Südhof, T.C., Wernig, M. & Malenka, R.C. Comprehensive qPCR Subkhankulova, T., Yano, K., Robinson, H.P. & Livesey, F.J. Grouping and classifying sa, S. Islam, of connections synaptic and features Neurochemical Y. Kubota, rapid & Y. Kawaguchi, for CLARITY Advanced K. Deisseroth, & B. Hsueh, L., Ye, R., Tomer, E.A. Susaki, K. Tainaka, Z. Máté, N. Tamamaki, M.J. Schmidt, kt, .. Sgn, . Nlo, .. qatttv cmaio o cell-type- of comparison quantitative A S.B. Nelson, & K. Sugino, B.W., Okaty, in the transcriptomics type-specific Cell S.B. Nelson, & K. Sugino, B.W., Okaty, D. Usoskin, Romanov, R.A. A. Zeisel, project. brain blue The H. Markram, Gupta, A., Wang, Y. & Markram, H. Organizing principles for a diversity of GABAergic B. Cauli, B. Cauli, su K, rw, . Sñd-ea MC, ake K & akr J.M. Walker, & K. Mackie, I. Katona, M.C., Sañudo-Peña, S., Brown, K., Subunit J. Tsou, Rossier, & S. Hestrin, E., Audinat, B., Lambolez, M.C., Angulo, subunits Kv3.4 Surmeier,D.J. & Yeh, T.,J.Z. K., Tkatch, Nagata, G., Baranauskas, channels. chloride ClC M. Maduke, & J.A. Mindell, bursting spike adapt pumps Sodium to G.G. Polavieja, de & R. Guantes, key S., Arganda, another dynamics: Sodium A. Verkhratsky, & V. Parpura, S., Kirischuk, Kaneko, T., Fujiyama, F. & Hioki, H. Immunohistochemical localization of candidates R.T.Jr. Fremeau, F.A.Chaudhry, S. Islam, TrendsNeurosci. Genet. Front. clamp. patch cell whole with channel gene expression profiling through an improved qRT-PCR technique combined cells. neuronal (2012). insingle expression gene of profiling profiling. expression genome whole- cell, single by neurons neocortical of classes electrophysiologically-defined mousebrain. inthe One methods profiling expression gene microarray specific brain. sequencing. RNA single-cell release. hormone stress RNA-seq. single-cell by revealed neocortex. the in synapses and interneurons clustering. unsupervised 4544–4558 (1999). 4544–4558 interneurons. hippocampal specific of terminals axon from release system. nervous central rat the in receptors CB1 cannabinoid of distribution Immunohistochemical single in receptors AMPA of properties cells. nonpyramidal neocortical permeation and kinetic, composition, neurons. infast-spiking channels Kv3.1 Neurosci. Nat. of efficiency repolarizing the enhance (2001). statistics. stimulus to excitability? astroglial (2002). brain. rat the in transporters glutamate vesicular for synapse. excitatory of classes two neurons. GABAergic as well (1998). as 9733–9750 glycinergic of sets in vesicles Methods Nat. sequencing. 85 large physiologically-identified GABAergic cells in the rat frontal cortex. tissues. intact of (2014). imaging high-resolution and analysis. computational and cocktails decolorization. Res. mice. transgenic in plexus myenteric of development postnatal during mouse. knock-in GAD67-GFP the Neurol. Comp. J. in somatostatin and parvalbumin, calretinin, inactivation. schizophrenia. (2008). with subjects of cortex prefrontal J. Neurosci. J. , 677–701 (1998). 677–701 ,

6 352 advance online publication online advance , e16493 (2011). e16493 , J. Neurosci. J. t al. et et al. et , 199–206 (2013). 199–206 , et al. et et al. et et al. et et al. et t al. et t al. et

Nat. Protoc. Nat. t al. et 17 Mol. Psychiatry Mol.

et al. et

t al. et 3 igenuo RASq tcncl esblt ad reproducibility. and feasibility technical RNA-Seq: Single-neuron 11

Spatiotemporal expression pattern of DsRedT3/CCK gene construct gene DsRedT3/CCK of pattern expression Spatiotemporal Molecular and physiological diversity of cortical nonpyramidal cells. nonpyramidal cortical of diversity physiological and Molecular et al. et Quantitative single-cell RNA-seq with unique molecular identifiers. molecular unique with RNA-seq single-cell Quantitative t al. et et al. et et al. Cell 6 , 124 (2012). 124 , t al. et , 3894–3906 (1997). 3894–3906 , Brain structure. Cell types in the mouse cortex and hippocampus and cortex mouse the in types Cell structure. Brain Presynaptically located CB1 cannabinoid receptors regulate GABA regulate receptors cannabinoid CB1 located Presynaptically Highly multiplexed and strand-specific single-cell RNA 5 RNA single-cell strand-specific and multiplexed Highly

, 258–266 (2003). 258–266 , Neuroscience Classification of fusiform neocortical interneurons based on interneurons neocortical fusiform of Classification

, 163–166 (2014). 163–166 , 26 467 et al. et Unbiased classification of sensory neuron types bylarge-scale types neuron sensory of classification Unbiased Whole-brain imaging with single-cell resolution using chemical using resolution single-cell with imaging Whole-brain

31 hl-oy mgn wt snl-el eouin y tissue by resolution single-cell with imaging Whole-body 159 Alterations in GABA-related transcriptome in the dorsolateral the in transcriptome GABA-related in Alterations A secretagogin locus of the mammalian hypothalamus controls , 489–495 (2003). 489–495 , Green fluorescent protein expression and colocalization with and colocalization expression protein fluorescent Green Modulation of behavioral networks by selective interneuronal selective by networks behavioral of Modulation h vsclr AA rnpre, GT lclzs o synaptic to VGAT, localizes transporter, GABA vesicular The , 60–79 (2003). 60–79 , , 6939–6943 (2011). 6939–6943 , TrendsNeurosci. Nat. Neurosci. Nat. The expression of vesicular glutamate transporters defines transporters glutamate vesicular of expression The , 911–924 (2014). 911–924 , EMBO J. EMBO

Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc. 7 , 813–828 (2012). 813–828 ,

Nat. Neurosci. Nat. 19 Front. Mol. Neurosci. Mol. Front. J. Neurosci. Methods Neurosci. J.

83 , 580–587 (2014). 580–587 , J. Neurosci. J.

Science , 393–411 (1998). 393–411 , 34 Neuron

, 36–54 (2015). 36–54 , Nat. Rev. Neurosci. Rev. Nat. 10 Cell

35 , 1467–1473 (2007). 1467–1473 ,

347

31 , 497–506 (2012). 497–506 , 157

18 17 Science , 247–260 (2001). 247–260 ,

, 1138–1142 (2015). 1138–1142 , , 145–153 (2015). 145–153 , , 726–739 (2014). 726–739 , , 6685–6696 (1997). 6685–6696 , nature biotechnology nature

o. Psychiatry Mol. 3 a. Protoc. Nat. 209

J. Comp. Neurol. Comp. J. , 10 (2010). 10 ,

97 287 , 6144–6149 (2000). 6144–6149 , a. Protoc. Nat. , 227–234 (2012). 227–234 , eoe Biol. Genome

7 , 273–278 (2000). 273–278 , , 153–160 (2006). 153–160 ,

. Neurosci. J. J. Neurosci. J. 9

1682–1697 , 13

Neuroscience

7 444

147–161 , 118–127 , Cell Tissue Cell 2 S3003 , , 39–62 , ′ PLoS end

19 18 , ,

© 2015 Nature America, Inc. All rights reserved. 45. 44. 43. 42. 41. nature biotechnology nature

aá, . Bh, .. Lrnz A & ooy, . rxmly agtd GABAergic targeted Proximally P. Somogyi, & A. Lörincz, E.H., Buhl, G., Tamás, Caiati, M.D. & Cherubini, E. Fluoxetine impairs GABAergic signaling in hippocampal I. Férézou, V.Varga, A.B. Muñoz-Manchado, slices from neonatal rats. neonatal from slices 22 interneurons. peptide/cholecystokinin intestinal vasoactive neocortical 326 2014). August (21 366–371 (2000). 366–371 interneurons. cortical synchronize junctions gap and synapses aee i te H3EF Mouse. 5HT3aEGFP the in Labeled , 7389–7397 (2002). 7389–7397 , , 449–453 (2009). 449–453 , et al. et et al. et Fast synaptic subcortical control of hippocampal circuits. hippocampal of control subcortical synaptic Fast 5-HT3 receptors mediate serotonergic fast synaptic excitation of excitation synaptic fast serotonergic mediate receptors 5-HT3 t al. et Front. Cell. Neurosci. Cell. Front.

oe Sraa GBegc nenuo Populations Interneuron GABAergic Striatal Novel advance online publication online advance ee. Cortex Cereb.

7 , 63 (2013). 63 ,

doi:10.1093/cercor/bhu17 a. Neurosci. Nat. J. Neurosci. J.

Science

3 9 ,

50. 49. 48. 47. 46.

cwnäse, B. Schwanhäusser, perspectives new decentralized: dogma central The E.M. Schuman, & C.E. Holt, K.H. Zivraj, Morozov, Y.M. & Freund, T.F. Postnatal development and migration of cholecystokinin- to impregnation silver from corticoneurogenesis: in progress of century P.A Rakic, control. neurons. in translation local and (2013). function RNA on mRNAs. cone (2010). growth of repertoire regulated (2003). hippocampus. rat in interneurons immunoreactive engineering. genetic Nature t al. et

473 Subcellular profiling reveals distinct and developmentally distinct reveals profiling Subcellular , 337–342 (2011). 337–342 , t al. et Cereb. Cortex Cereb. Global quantification of mammalian gene expression gene mammalian of quantification Global

16 (suppl. 1), i3–i17 (2006). i3–i17 1), (suppl. . Neurosci. J. Neuroscience Neuron ticles e l c i rt A

30 15464–15478 ,

120 80 648–657 , 923–939 , 

© 2015 Nature America, Inc. All rights reserved. state negative voltage at a voltage response to hyperpolarizing current injec current hyperpolarizing to response voltage a at voltage negative state current ( depolarization, cationic nonselective sag The of hyperpolarization-activated the activation indicating exponential. single a with fitted and steps current from 20 successive electrotonic voltage responses to (−40 pA) hyperpolarizing amplitude (10 pA Membrane increments). time constant ( ( responses age volt electrotonic between established regression linear using calculated was ( resistance Input current. pA 0 at mode rent-clamp ( potential membrane Resting intracellular and recording solutions, as measured against a 3 M KCl-electrode. −9.99 for corrected were (HEKA, controlled byGermany) PatchMaster 2.80. Current clamp recordings amplifier triple on were made an EPC-10 recordings patch-clamp Whole-cell N 8 ATP-Naphosphocreatine-Na 4 NaCl, 6 K-gluconate, 130 mM): (in containing (Sutter,solution with an were instrument filled intracellular Electrodes USA). M 3–4 of Germany) (Hilgenberg, electrodes glass cate electrophysiology. Patch-clamp °C. at out 33 carried was interneurons the of probing Pharmacological intervals. s 30 with used were capillaries 10 with glass M) 3-4 (Hilgenberg, borosilicate filling microinjector after a Germany) using Npi, performed (PDES-02TX-LA, was ejection 5-HT Focal above. as rates 5 of concentrations final at nm)). >575 emission: nm; U-MWIBA3 530-550 (excitation: DsRed: for nm); 510–550 emission: nm; 460–495 (excitation: U-MWIG3 (for GFP: filters excitation/emission combina and long-pass of band- tions appropriate and USHIO) (USH-1030L, source light arc mercury a using microscopy epifluorescence by confirmed was interneurons in and GFP DsRed of co-existence the Next, microscope. BX51WI Olympus an on ml/min. 4–6 of at rate a ‘recording’ with solution chamber. the recording were superfused Brain slices CO (5% stituents were from Sigma-Aldrich. Both solutions were aerated with carbogen Na 1.25 KCl, 2.5 NaCl, 124 mM): for (in °C containing solution 22–24 recording at a in min 60 incubated then were slices Brain 7.4). (pH Na-ascorbate 5 mM): 10 (in 4-(2-hydroxyethyl)-1-piperazineethanesulfonic containing acid fluid (HEPES), 3 Na-pyruvate, cerebrospinal 90 NaCl, 2.5 artificial KCl, 1.25 Na ice-cold in Germany) (300- slices Coronal (S1). cortex somatosensory primary the of L1/2 in performed were superfusion. microscopy, epifluorescence Preparation of brain slices, correlated differential-interference contrast and Nr. 114/2012). BGBI, 2012, Tierversuchsgesetz N512/12; Nämnd; Djuretiska Norra (Stockholm ethics animal on authorities regional live animals conformed to and directive the 86/609/EEC were approved by the on Experiments 17–23. days postnatal during experiments neurophysiology libitum ad 1a Fig. eration, migration ( prolif cell normal including to structures, its fine or to size brain deformities GAD67 glutamate decarboxylase 67 gene (GAD67 chromosome (BAC/CCK-DsRed) artificial bacterial a on promoter (CCK) cholecystokinin the Discosoma ( husbandry. and Animals METHODS ONLINE nature biotechnology nature tions in resulting a voltage of steady-state −100 mV. AP (AP threshold upeetr Fg 1a Fig. Supplementary , N Serotonin (5-HT; Tocris) was directly dissolved in the recording solution solution recording the in dissolved directly was Tocris) (5-HT; Serotonin microscopy contrast interference differential by visualized were Neurons 2 HPO , N ′ , ). Animals were group-housed under 12:12 h/h light/dark cycle with with cycle light/dark h/h 12:12 under group-housed were Animals ). N +/gfp 2 I 4 /95% O /95% ′ h -tetraacetate (EGTA) and 0.5 mg/ml biocytin (pH 7.2 set with KOH). , 2 CaCl 2 , ) ) was as calculated the ratio of the negative peak voltage and steady- access to water and food. Animals of both sexes were used for for used were sexes both of Animals food. and water to access red fluorescent protein (DsRed) under regulatory elements of of elements regulatory under (DsRed) protein fluorescent red µ line appeared anatomically normal, particularly without changes without particularly normal, anatomically appeared line m thickness) were prepared on a VT1200S vibratome (Leica, (Leica, vibratome VT1200S a on prepared were thickness) m ± 2 15 mV from from mV 15 ). Temperature was set to 33 °C (TC-10, Npi, Germany) in in Germany) Npi, (TC-10, °C 33 to set was Temperature ). 2 , 2 MgSO 2 , data not shown 2 4 2 or green fluorescent protein (GFP) knocked into the the into knocked (GFP) protein fluorescent green or , 10 HEPES, 0.5 ethyleneglycol-bis(2-aminoethylether)- 2 HPO ) by crossing parental lines that either expressed expressed either that lines parental crossing by ) ± 0.38 mV liquid junction potential between the the between potential junction liquid mV 0.38 We generated a dual reporter mouse line line mouse reporter dual a generated We µ 4 µ , 26 NaHCO 26 , M, 10 10 M, 4 V M 5-HT. Pressure pulses of 500 mbar for 0.5 s 0.5 for mbar 500 of pulses 5-HT. M Pressure V , 0.5 CaCl rest rest Recordings were carried out with borosili with out carried were Recordings ) ) and laminar distribution ( , expressed as mVs) was measured in cur in measured was mVs) as expressed , ) and 500-ms current steps of increasing increasing of steps current 500-ms and ) µ M and 25 25 and M 2 +/gfp , 8 MgSO 3 All experiments on interneurons interneurons on experiments All , 10 10 , ) 2 3 . The resulting CCK d µ -glucose (pH 7.4). All con All 7.4). (pH -glucose 4 M, and superfused at flow flow at superfused and M, , 26 NaHCO R Ω m , expressed as M as expressed , pulled on a P-1000 P-1000 a on pulled τ , , ms) was averaged 2 , 0.35 GTP-Na 0.35 , Supplementary Supplementary 3 , 20 BAC/DsRed d -glucose, thr , , mV) Ω 2 :: ------) ,

procedures custom-written in Matlab (MathWorks, USA). Matlab in custom-written procedures ( were measured parameters All in mVs). defined (difference AP peaks five to first the relative AP peaks three as a was ratio determined of amplitude the accommodation average of AP the last trains. spike producing injections current (Hz) saturating at frequency determined Firing was intervals. interspike five first interspike the to last the relative of interval ratio the as calculated was ratio Adaptation injected. was current rheobasic the of double of a deflection on voltage the as trace generated 750-ms APs three first the (iii) and pA 0–150 of ramp current 1-s a along evoked AP first the (ii) step; current rheobasic by 500-ms a elicited AP first the (i) for measured were parameters These respectively. down-stroke, AP from times the were times down-stroke and up- Maximum respectively. (mV/ms), AP the of differential geometrical up- of the minimum and AP maximum the as determined were Maximum down-stroke AP and repolarization. fast of peak the and voltage steady-state between potential membrane AHP, as the most-positive ADP was recognized of of a lack In case peak. repolarization fast the and peak AHP voltage between value most-positive the and peak AHP between difference the as the defined as was (mV) amplitude calculated AHP. ADP the of was peak the to time AP’speak the from decay time AP AHP. the during attained potential AP between as the was difference defined of (mV) The amplitude AHP repolarization. during value voltage to same the the AP AP between potential first in membrane trajectory as the difference AP was 10 defined amplitude mV/ms. reached slope upstroke’s the where point voltage the as defined was were thawed and lysed at 72 °C for 3 min, then cooled to 4 °C. Immediately Immediately °C. 4 to cooled then min, 3 for °C 72 at lysed and thawed were samples transcription, reverse Before at processing. batch stored °C −80 until TTTTTT-3 TTTTTTTTTTTTTTTTTTTTTTTTT TGATACGGCGACCACCGATCG 4 inhibitor, RNase into pensed ~0.5 preparation. library and synthesis cDNA Lysis, (RT). transcription reverse in-tube to subjected later and °C −80 at stored tube, conical the of bottom the to °C 24 at s) (1.5 (20 down sample resultant The (TubeOne). tube tight-lock ml 0.2 0.6- a onto ejected was 0.2 expelling an over rotated carefully then and chamber recording the from out pulled was pipette recording the contact, broke we When solution. pipette the in molecules RNA the keeping by RNA loss minimize to and seal a tight retain to us allowed procedure This micropipette slowly (~1–2 min) by applying mild negative pressure (−50 mPa). V from pulses (5 ms at 5 ms intervals) were applied voltage rectangular for of depolarizing a series continuous 6–7procedure, harvesting min with amplitudes of 25 mV micropipette was clamped to a ( holding potential for sequencing. harvesting Cell Bioscience). Mbf (cx9000, 300 from cells DAB-stained of filaments Three-dimensional Zeiss). software, ZEN2013 and (LSM780 micro scope laser-scanning a on imaged were (Olympus tissues cleared microscope Optionally, light BX51). a on objectives 60× and 40× using performed for X-100) Triton v/v% 0.1% clearing. and further 2,20,20’-nitrilotriethanol wt% 10 urea, rewashed in PB and submerged in “CUBIC reagent 2” (50 wt% sucrose, 25 wt% chromogen and H 3,3 using Elite) (Vectastain peroxidase radish in PB, biocytin localization was visualized using streptavidin-conjugated horse ether/Triton for isooctylphenyl X-100) 2 mono- d (refs. glycol polyethylene wt% 15 and ethylenediamine hydroxypropyl) and PB in washed “CUBIC 25 repeatedly 1” using wt% reagent (25 wt% urea, cleared were Slices overnight. °C 4 at 7.8) pH 0.1M, (PB, buffer phosphate in paraformaldehyde 4% in post-fixed were neurons microscopy. and light clearing Tissue thr hold to from AP the AP’s interval was (ms) AP the time duration peak. . The entire soma of each recorded neuron was aspirated into the the into aspirated was neuron recorded each of soma entire The . ′ , 3.5 mM dNTP and 17.5 mM DTT. Samples were collected and and collected were DTT.Samples mM 17.5 and dNTP mM 3.5 , µ Post hoc Post 2 O l l lysis mix consisting of 0.15% Triton X-100, 1 U/ µ 2 M reverse transcription primer C1-P1-T31 5 C1-P1-T31 primer transcription reverse M (0.05%) as substrate (in Tris-HCl, pH8.0). Slices were then thr µ and AP at peak. AP rise time (ms) was the time from time the was (ms) time AP rise and AP at peak. l drop of lysis buffer pre-placed onto the side of a of side the onto pre-placed buffer lysis of drop l neuroanatomy and neuronal reconstructions were were reconstructions neuronal and neuroanatomy µ Supplementary Table 1 Supplementary At the end of protocol, the each patch-clamp m slices were reconstructed in Neurolucida Neurolucida in reconstructed were slices m Brain slices containing biocytin-filled biocytin-filled containing slices Brain µ l tube, where its content (0.8–0.9 (0.8–0.9 content its where tube, l thr thr and the most membrane negative to reach maximum AP up- and maximum to reach ′ -diaminobenzidine (DAB) as as (DAB) -diaminobenzidine 25 V , hold 2 el siae wr dis were aspirates Cell 6 ). ). After repeated washes ) ) of −5 mV. Prior to the N ) ) by manual applying doi: , N , N 10.1038/nbt.3443 ′ , N µ ′ l) was spun spun was l) -tetrakis(2- µ ′ l l TaKaRa -Bio-AA µ thr p l) l) - - - -

© 2015 Nature America, Inc. All rights reserved. distance. As feature selection is an important parameter for classification classification for parameter important an is Euclidian than selection rather feature As measures distance. correlation on classifier our designed we Because of a significant difference in the number of mRNA molecules detected, or groups interneuron 22 (Int1-16), groups (S1PyrL1-L6) cell cohorts in total. cells). First, we narrowed down our search to one of the layer-specific pyramidal dissociated >3,000 (from groups template one of into the cells pyramidal and used our recently described cortical data set template. on a cortical cells pyramidal and of interneurons Alignment available. was read-outs patch-clamp of catalog a complete if and rRNA) and repeat mitochondrial, (excluding cell recently reported analysis. Data primer. nt) (8 CTGTCTCTTATACACATCTGACGC read index as PHO- as and (50 nt) C1-TN5-U read1 primer C1-P1-PCR2 using instrument sequencing. Illumina described as tagmentation using done was preparation and by quantified qubit (Life Technologies) PCR on an Agilent bioanalyzer. Library Subsequently, min. 7 Coulter) °C Beckman ratio; 72 (1:1 beads s, AMPure-XP using 30 cleaned were samples °C 68 s, 30 °C, 98 cycles) (7 min, 6 °C 72 s, 30 °C 68 s, 20 °C 98 cycles) (9 min, 6 °C 72 min, 4 °C 62 s, 20 °C 98 cycles), (5 min 3 for °C 95 follows: as cycling thermal using PCR-amplified 5 C1-P1-PCR2 8 transcription, Following reverse min. 10 for °C 72 by followed min 90 for °C 42 at incubated and U/ 21 NGGG-3 5 C1-P1-RNA-TSO oligo Technologies) supplemented with 10.6 mM MgCl following the lysis step, 2 doi: 10.1038/nbt.3443 µ l Superscript II reverse transcriptase (Life Technologies)) were added added were Technologies)) (Life transcriptase reverse II Superscript l ′ , 1.5 U/ 1.5 , ′ Read processing and molecule counts were performed as as performed were counts molecule and processing Read -Bio-GAATGATACGGCGACCACCGAT-3 µ 1 1 l TaKaRa RNase inhibitor (Clontech), 1.45 M betaine and and betaine M 1.45 (Clontech), inhibitor TaKaRa RNase l . We only analyzed cells with >1,500 mRNA molecules/ mRNA >1,500 with cells analyzed only We . Libraries were sequenced on an Illumina Hiseq2000 Hiseq2000 Illumina an on sequenced were Libraries µ µ l l PCR mix (1× KAPA HiFi 2× ready mix and 240 nM ′ l l RT mix (1× SuperScript II First-Strand Buffer; Life -Bio-AAUGAUACGGCGACCACCGAUNNNNN 1 1 to resolve each of the interneurons 2 , , 3.6 µ 2 M M template-switching 9 . ′ ) ) were and added We

value showed similar results). For each gene separately, we used a false recovery (permutation were calculated variables of independent hypothesis null the correlation, the with Along (110). parameters electrophysiology is, (that all against of ~12% points) data expression, nonzero with criteria cells more five than baseline our passed that (5,600) genes all between relation cor the Wetested experimentally. tested be might interpretation biological whose genes of sets as proteins transmission-related synaptic and receptors channels, elec ion for for coding mRNAs on predictors Wefocused be parameters. might trophysiology that mRNAs identify to aimed was parameters. analysis electrophysiology and expression gene of Correlation to group. particular assigned that was cell Patch-seq the left, was group candidate single a only If of candidate groups contained more than one group we back looped to step iii. list the if (vii) correlation; their with <50% were that groups candidate those of removal (vi) lowest); to (highest cell Patch-seq the to correlation their by between a Patch-seq cell and all candidate groups; (v) ranking neuronal groups current iteration, std the for genes of selection (iii) cortex; somatosensory the of groups neuronal 47 all contain to groups candidate of list the setting (ii) classification; for cell over Patch-seq a of >1.5 selection (i) follows: as was being process The compared. groups s.d. the of threshold fixed a using (features) genes selected we expression, mean on their strongly not did depend groups) (along expression median genes’ the of s.d. the Because calculated. was set) data cortex the (in group every for expression median the First, compared. groups the for tures fea the updated continuously classifier the use”), “in are genes which (e.g., genes that exhibited correlation (or anti-correlation) greater than 0.4. than greater anti-correlation) (or correlation exhibited that genes in shown coefficients Correlation criteria). ion our above on passed of these (167 genes only and synapse-related receptors channels, focused we Next, violated. were FDR for assumptions the and the otherwise because gene every for performed separately was This correlation. significant a declare to 10% of (FDR) rate (gene median expression) >1.5; (iv) calculation of the correlation Supplementary Figure 4 Figure Supplementary nature biotechnology nature P -values strongly correlated correlated strongly -values P -values for for -values are for for are This This P - - - -