HORMONAL REGULATION OF CUTANEOUS WOUND HEALING: EFFECT OF ANDROSTENEDIOL ON STRESS-IMPAIRED WOUND HEALING
DISSERTATION
Presented in Partial Fulfillment of the Requirements for
The Degree Doctor of Philosophy in the Graduate
School of The Ohio State University
By
Cynthia C. Head
*****
The Ohio State University 2007
Dissertation Committee: Approved by Professor David A. Padgett, Advisor ______Professor John F. Sheridan Advisor
Professor Virginia M. Sanders Graduate Program in
Professor John D. Walters Oral Biology
ABSTRACT
Stress activates the hypothalamic-pituitary-adrenal (HPA) axis resulting in
increased serum glucocorticoids (GCs); GCs are used clinically for their potent anti-
inflammatory actions. Thus, because the stress-induced increase in GC is anti-
inflammatory, stress predictably suppresses the inflammatory phase of wound healing
and slows closure of cutaneous wounds. Previous studies from this laboratory suggest
that the steroid hormone dehydroepiandrosterone (DHEA) and its metabolites
androstenediol (AED) and androstenetriol (AET) counter-regulate the immune-
suppressive functions of GCs. Thus we hypothesized that pharmacological treatment of
animals with AED would diminish the health adverse effects of elevated GCs. It is
further hypothesized that by counterbalancing the GC-mediated transcriptional regulation of cytokine gene expression through interactions with the transcriptional activator NF-κB, AED will restore inflammation and improve wound healing in stressed animals.
A murine model of cutaneous wound healing was used. Male CD-1 mice underwent daily cycles of restraint stress (RST), which began three days prior to wounding. Animals were treated with AED at 3 timepoints, while control animals received vehicle treatment. Photoplanimetry was utilized to assess healing kinetics of
ii the wounds. Wounds were harvested at various times and processed for real time PCR analysis, or the TransAMTM assay.
The results show that RST delayed wound closure and altered the kinetics of inflammatory gene expression compared to control animals and did so by modulating
NF-κB activation. Treatment with AED prevented the anti-inflammatory effects of RST and augmented NF-κB driven gene expression above control levels. Preliminary data suggest the effects of AED are manifest at the level of transcription initiation complex formation, and future studies will test this hypothesis. In conclusion, the data indicate that AED may be a viable pharmacological approach to functionally antagonize the effects of stress and presumably glucocorticoids, thereby improving wound healing.
iii
DEDICATION
To my husband Don and my children, who are always there to support me.
To my mother Delores and father John, who always taught me to do my very best.
To my siblings, Jenni and Ben, who share my every joy and sorrow.
iv
ACKNOWLEDGMENTS
I would like to thank my advisor, Dr. David Padgett, for giving me a place in his laboratory and helping me to develop as a scientist. His ability to keep me organized and focused have been priceless in helping me in my dual doctorate quest.
He has taught me study habits that will be priceless in my future as a researcher.
Watching him as a teacher has given me motivation and a model for what kind of teacher I would like to be.
I would like to thank my dissertation committee, Dr. John Sheridan, Dr Virginia
Sanders and Dr. John Walters who have all been helpful in providing me with
intellectual guidance during my training. I am also thankful to the Department of Oral
Biology for allowing me to be one of the first students in the DDS/PhD program. I am
excited to be pursuing a future in academic dentistry that this program has afforded me.
I would like to acknowledge the help and support that I received from the other
students and personnel in our lab. I have consulted with Michael Farrow and Steven
Kinsey numerous times and have always found them to be very helpful and great
resources. I would also like to thank Amy Hufnagle for her technical assistance in
some of the core experiments in this dissertation. I would like to thank all my lab
v mates who stayed here until all hours of the night to help with harvests that occurred in
the middle of the night.
I would like to acknowledge Gary Phillips, who is a Senior Consulting
Research Statistician at the Ohio State University, for his assistance in determining a
suitable approach for the statistical analyses of the real-time PCR data.
On a personal level, I would like to thank Mary Head, for getting my children
off to school every morning and for watching them when they get off the school bus
every day. She has been a wonderful help in keeping the laundry caught up and getting
dinner on the table every night. These are things that would be nearly impossible for me to keep up with considering the demands of my program.
I would also like to thank my parents, Delores and the late Larry Smith and
John and Connie Murray. They have supported me emotionally through some very difficult and trying times over the past 8 years. They have always taught me to reach for the stars and to be the very best that I can be. My siblings Jennifer and Benjamin have also offered me support and have come to help whenever I needed a hand.
I want to thank my husband Don for being very patient and understanding through my whole program. He has sat up late at night with me while waxing dentures, and has sat in the lab for hours in the middle of the night so that I wouldn’t have to be there alone. Without his continuing love and support, I couldn’t have done any of this.
Finally, I want to thank Zachary, Amy, Brianna, Tommy, Jordan and the baby to be. The older kids have all been a great help in watching their little sister. They have all been very understanding when they don’t see me except in passing for days at a time. They help remind me that I need to take a break every once in a while and they
vi help me to laugh more often, especially Jordan. I would like to thank the baby to be, for staying up every night as I was finishing my dissertation and giving me a good kick whenever I started to fall asleep.
vii
VITA
October 7, 1976...... Born – Flint, Michigan
May, 1999...... B.A. Northern Michigan University
PUBLICATIONS
Research Publications
1. Head C.C., Farrow M.J., Sheridan J.F., and Padgett D.A. (2006) Androstenediol reduces the anti-inflammatory effects of restraint stress during wound healing. Brain, Behavior and Immunity. 20: 590-596.
FIELDS OF STUDY
Major Field: Oral Biology Studies on Immunology, Endocrinology and Molecular Biology
viii
TABLE OF CONTENTS
P a g e
Abstract...... ii
Dedication...... iv
Acknowledgments ...... v
Vita ...... viii
List of Tables...... xii
List of Figures ...... xiii
List of Abbreviations...... xiv
INTRODUCTION
Overview...... 1
Section I: Wound healing...... 3
Section II: Stress...... 17
Section III: Transcription factors...... 23
Section IV: Dehydroepiandrosterone (DHEA) and its derivatives...... 30
Summary...... 32
ix
CHAPTERS
Chapter 1: The influence of androstenediol on the healing of cutaneous wounds where
closure has been impaired by restraint stress...... 34
1.1. Introduction...... 34
1.2. Materials and Methods...... 38
1.3. Results...... 40
1.4. Discussion...... 43
Chapter 2: The influence of androstenediol on the healing of cutaneous wounds where
the expression of pro-inflammatory cytokines, chemokines, and growth factors has
been impaired by restraint stress...... 51
2.1. Introduction...... 51
2.2. Materials and Methods...... 64
2.3 Results...... 71
2.4 Discussion...... 75
Chapter 3: The influence of androstenediol on the transcriptional activity of Nuclear
Factor Kappa B (NF-κB) ...... 85
3.1 Introduction...... 85
3.2 Materials and Methods...... 90
3.3 Results...... 98
3.4 Discussion...... 104
x
Chapter 4: GENERAL DISCUSSION: The influences of androstenediol on cutaneous
wound healing...... 116
REFERENCES...... 134
xi
LIST OF TABLES
Table Page
1.1 Effect of RU40555 on Wound Healing Time ...... 47
2.1 Primer and Probe Sequences for Real Time PCR ...... 69
3.1 Primer and Probe Sequences for Real Time PCR ...... 93
xii
LIST OF FIGURES
Figure Page
1.1 Influence of Stress on Wound Closure ...... 48
1.2 Serum Corticosterone Levels...... 49
1.3 Influence of RST and AED on Wound Closure ...... 50
2.1 Influence of Stress and AED on IL-1β Expression...... 81
2.2 Influence of Stress and AED on MCP-1 Expression...... 82
2.3 Influence of Stress and AED on PDGF Expression...... 83
2.4 Influence of Stress and AED on KGF Expression ...... 84
3.1 Pathways for Testicular Androgen and Estrogen Biosynthesis...... 111
3.2 Influence of Stress on IκBα expression in Cutaneous Wounds...... 112
3.3 Influence of AED on Expression of IκBα in Cutaneous Wounds. . . . . 113
3.4 Influence of AED on IκBα Expression in Non-Wounded Skin...... 114
3.5 Influence of Stress and AED on Nuclear Localization of p65...... 115
4.1 Model for transcriptional regulation of inflammatory cytokine genes. .133
4.2 Model for transcriptional regulation of inflammatory cytokine genes. .133
xiii
LIST OF ABBREVIATIONS
AAALAC: American Association for the Accreditation of Laboratory Animal Care
ACTH: Adrenocorticotropic hormone
AED: Androstenediol (5-androstene-3β, 17β-diol)
AET: Androstenetriol (5-androstene-3β-7β-17β-triol) aFGF: Acidic fibroblast growth factor
ANOVA: Analysis of variance
AP-1: Activator protein-1
AR: Androgen receptor
ATF: Activating transcription factor bFGF: basic fibroblast growth factor (FGF-2) bp: basepair
CBP: cAMP response element binding protein cDNA: complimentary Deoxyribonucleic acid
ChIP: Chromatin immunoprecipitation
CRH: Corticotropin-releasing hormone
DBD: DNA binding domain
DHEA: Dehydroepiandrosterone
DMSO: dimethyl sulfoxide
xiv DNA: Deoxyribonucleic acid
EGF: Epidermal growth factor
FADD: Fas associated death domain
FGF: Fibroblast growth factor fMLP: Formyl-Methionyl-Leucyl-Phenylalanine
FWD: Food and water deprived
GC: Glucocorticoid
G-CSF: Granulocyte colony stimulating factor
GM-CSF: Granulocyte-macrophage colony-stimulating factor
GR: Glucocorticoid receptor
GRA: Glucocorticoid receptor antagonist
GRE: Glucocorticoid response element
GRO-α: Growth related oncogene alpha (CXCL1)
HA: Hyaluronic acid
HAT: Histone acetylase
HDAC: Histone deacetylases
HPA: Hypothalamic-pituitary-adrenal axis
HRP: Horseradish peroxidase
HSP: Heat shock protein
ICAM: Intercellular adhesion molecule
IKAP: IκB kinase associated protein
IKK: I kappa B kinase
IFN-γ: Interferon gamma
xv IκB: Inhibitor of nuclear factor kappa B
IL-1: Interleukin-1
IL-1α: Interleukin-1 alpha
IL-1β: Interleukin-1 beta
IL-2: Interleukin-2
IL-6: Interleukin-6
IL-8: Interleukin-8 (KC)
IL-10: Interleukin-10
IP-10: Interferon-inducible protein-10
KGF: Keratinocyte growth factor
KGF-1: Keratinocyte growth factor-1 (FGF-7)
LPS: Lipopolysaccharide
MAPK: Mitogen activated protein kinase
MCP-1: Monocyte chemoattractant protein-1 (CCL2)
M-CSF: Macrophage colony stimulating factor
MIP-1α: Macrophage inflammatory protein-1alpha (CCL3)
MIP-1β: Macrophage inflammatory protein-1beta
MIP-2α: Macrophage inflammatory protein-2alpha
MMP: Matrix metalloproteinase mRNA: messenger ribonucleic acid
NADPH: nicotinamide adenine dinucleotide phosphate
NEMO: NF-κB essential modulator
NF-κB: Nuclear factor-kappa B
xvi NIK: NF-κB-inducing kinase
PCR: Polymerase chain reaction
PD-ECGF: Platelet-derived endothelial cell growth factor
PDGF: Platelet-derived growth factor
RIA: Radio immunoassay
RIP: Receptor interacting protein
RNA: Ribonucleic acid
RST: Restraint stress
SAM: Sympathetic-adrenal-medullary axis
SCF: SKp1-Cullin-F-box
SNS: Sympathetic Nervous System
TGF-α: Transforming growth factor-α
TGF-β: Transforming growth factor-β (TGF-β1, β2, β3)
TIMP: Tissue inhibitor of metalloproteinases
TNF-α: Tumor Necrosis Factor-α
TRADD: TNF receptor associated death domain
TRAF2: TNF receptor associated factor 2
VEGF: Vascular endothelial growth factor
VEH: Vehicle treated
VPF: Vascular permeability factor (VEGF)
xvii
INTRODUCTION
Overview
Stress has been shown to dysregulate wound healing and to slow closure of cutaneous wounds. In a study that was done here at the Ohio State University’s College of Medicine, Kiecolt-Glaser and colleagues showed that the stress of caregiving to an
Alzheimer’s disease patient was sufficient to slow healing. As compared to an age- matched control population, wounds on caregivers took 40% longer to close (Kiecolt-
Glaser et al. 1995). These data were confirmed by a subsequent study here in our
College of Dentistry illustrating that dental students experiencing stress associated with their examination week, healed 3 days slower than they did during their summer vacation period (Marucha et al. 1998). And finally, in an animal model that was established in our own laboratory, we showed that animals subjected to restraint stress took an additional 3.1 days to heal as compared to non-stressed controls (Padgett et al.
1998). In all three of these studies, the stress-associated delay in wound closure was associated with an alteration in cytokine expression (Mercado et al. 2002a).
It has been well established that stress activates the hypothalamic-pituitary- adrenal (HPA) axis resulting in the increased production of glucocorticoids (GCs).
Glucocorticoids are well characterized and widely used for their anti-inflammatory
1 action. Of direct relevance to the above-mentioned studies, treatment of mice with dexamethasone (a synthetic glucocorticoid) inhibited wound repair, and did so, in part, by influencing the expression of important cytokines, chemokines, and growth factors
(Beer et al. 2000; Hübner et al. 1996). Because of this common observation, the link between stress, glucocorticoids, and inflammatory gene expression at or near the wound was investigated. Results from the clinical studies showed that higher perceived stress was associated with lower levels of IL-1α and IL-8 (Kiecolt-Glaser et al. 1995; Glaser et al. 1999). Likewise, the mouse studies illustrated that IL-1α, IL-1β, and KGF-1 are dysregulated in stressed mice as compared to controls. Together these data begged the question of whether restoring cytokine expression to the stressed animals would restore healing to these animals?
To address this question, stressed mice were treated with RU486, which is a glucocorticoid receptor antagonist (GRA). RU486 treatment restored cytokine production, the recruitment of inflammatory cells, and normal wound healing kinetics
(Mercado et al. 2002a; 2002b). Because RU486 restored healing kinetics to the stressed animals, we surmised that the suppressive effect of stress was, in part, due to
GCs. Unfortunately, RU486 is not a viable therapeutic intervention to improve wound healing in stressed individuals as it has substantial contraindications for its use. More specifically, it was originally synthesized as a progesterone receptor antagonist, and as such, is used clinically as an abortificant (Watanabe, 1994). It also has been shown to have detrimental effects on the prostate (Cabeza et al. 2007). Although RU486 may not be a viable therapy, we believe that by antagonizing the influence of the immunosuppressive glucocorticoids, we would be able to prevent the stress-induced
2 delay in healing. Identifying a functional antagonist with few side effects is one of the
overarching objectives of this study.
Previous studies suggest that the steroid hormone dehydroepiandrosterone
(DHEA) and its metabolites androstenediol (5-androstene-3β, 17β-diol, AED) and
androstenetriol (5-androstene-3β-7β-17β-triol, AET) may counter-regulate the immune- suppressive functions of GCs (Loria and Padgett, 1992a; Loria et al. 2000).
Experiments in an infectious model have revealed that AED can block the suppressive
effect of glucocorticoids on pro-inflammatory cytokine production from macrophages
and block the suppression of cellular trafficking (Padgett and Sheridan, 1999). These
data stimulated us to hypothesize that the health adverse effects of highly elevated GCs
will be reduced by pharmacological treatment with AED. The present studies place
particular interest on steroid hormone control of the expression of pro-inflammatory
cytokines, chemokines and growth factors, and the ability of AED to restore normal
wound healing kinetics. It is further hypothesized that by counterbalancing the GC-
mediated transcriptional regulation of cytokine gene expression through interactions
with the transcriptional activator nuclear factor-kappaB (NF-κB), AED will restore the
inflammatory response and, in turn, will improve wound healing in stressed animals.
SECTION I: Wound healing
The function of skin is to serve as a protective barrier against the environment.
It protects against injury, dehydration, and invading microorganisms. It also provides a
mechanism of maintaining body temperature. Damage to the skin results in diminished
integrity of that protective barrier; the loss of integrity can lead to chronic disability or
3 even death. The damage is not only physical it can also be socioeconomic. For example, in the United States, more than 5 million people suffer from chronic non- healing wounds, and $4 billion dollars is spent annually on treatment of these wounds
(The Wound Healing Center, www.stclair.org/Wound_Healing.asp, 2005).
After injury, the objective of wound healing is to restore structure and function to an injured tissue in order to approximate pre-wound characteristics. Wound healing is a multifaceted and protracted phenomenon. It generally proceeds through three stages; an early inflammatory stage, where neutrophils and macrophages limit further tissue damage, a granulation/proliferation stage where fibroblasts deposit new tissue, and a lengthy remodeling stage where the new tissue is progressively re-built to mimic the original. These stages overlap considerably, so that stress-associated alterations in the inflammatory phase can substantially impact the subsequent stages of healing and the overall integrity of the healed tissue (for wound healing reviews see: Clark, 1991a;
Martin et al. 1992; Thomas et al. 1995).
It is believed that stress influences the production of a myriad of cytokines and growth factors whose production is tightly choreographed from the moment of injury and continuing throughout repair. For example, upon wounding, damaged platelets along with platelets entrapped in the blood clot, release factors important for the initiation of healing such as platelet derived growth factor (PDGF). PDGF along with
IL-8 play a pivotal role in the immediate recruitment of neutrophils and later recruitment of other cells to the wound site. (Note: the abundance of neutrophils in circulation plays a major role in their predominance in the early wound). Once neutrophils arrive at the wound site, they become a predominant source of pro-
4 inflammatory cytokines such as tumor necrosis factor-α (TNF-α) and interleukin-1 (IL-
1). These cytokines appear to induce the production of chemokines and growth factors
(Hübner et al. 1996) that trigger the healing process. One cytokine induced by IL-1 is
monocyte chemoattractant protein-1 (MCP-1), and within one day of injury, MCP-1 is
produced by almost 20% of total cells (resident and infiltrating cells). MCP-1 plays a
vital role in the recruitment of macrophages to the wound site. Once at the site, the
macrophage complements the phagocytic activity of the neutrophils, but also becomes a
major source of growth factors that turn the injured tissue into a repairing and
rebuilding tissue (Gillitzer and Goebeler, 2001). The infiltrating cells are not the only
sources of the cytokines that can be influenced by stress and stress-induced
glucocorticoids. Wounding also induces the basal keratinocytes to produce keratinocyte growth factor (KGF), which stimulates the proliferation of primary and secondary keratinocytes that recover the wounded tissue (Marchese et al. 1990). However, regardless of cell source, the production of all of these cytokines and growth factors is
highly interdependent, such that alterations in one factor may influence the production
of one or more of the other factors, and influence the overall integrity of the healing
wound.
Inflammatory Phase
The inflammatory phase begins with the extravasation of blood constituents
with resultant platelet aggregation, blood coagulation and migration of inflammatory cells to the wound site. The immediate necessity for our response to injury is hemostasis, which is wholly dependent on the adhesion and aggregation of platelets.
5 They adhere to exposed interstitial connective tissue and then subsequently aggregate together clogging the open ends of damaged vessels (Clark, 1996). During this process they release mediators and express clotting factors on their surface membranes. In doing so, prothrombin is converted to thrombin; thrombin, in turn, converts fibrinogen to fibrin and a clot is thus created. Although the initial role of the newly formed blood clot is hemostasis, it also serves as a matrix scaffold for recruitment of cells into the wound site. In the clot, fibrin along with fibronectin serves as a provisional matrix for initial neutrophil and subsequent macrophage movement (Lanir et al. 1988). Although immobilized in the clot, the platelets also release low levels of growth factors involved in tissue generation, such as PDGF (Ross and Raines, 1990), TGF-α (Derynck, 1988) and TGF-β (Sporn and Roberts, 1992).
Within minutes of tissue damage, neutrophils are attracted to the wound area by pre-formed mediators released from the damaged keratinocytes and also by α- chemokines produced by fibroblasts and surviving keratinocytes at the wound margin.
Arriving neutrophils in the wound phagocytose contaminating bacteria and destroy them through enzymatic and oxygen radical mechanisms (Elsbach and Weiss, 1992).
Once bacterial contamination is controlled, neutrophils in viable tissue undergo apoptosis and are phagocytosed by infiltrating macrophages. However, before their demise, neutrophils produce large amounts of pro-inflammatory cytokines such as IL-
1β, which aid in the chemoattraction of monocytes to the wound (Leibovich and Ross,
1975). Of particular interest to the studies detailed herein, previous data showed that stress and the associated elevation in GC down-regulates this early production of IL-1β
(Mercado et al. 2002a). However, in a normal healthy individual, the neutrophil and its 6 accompanying cytokines play a crucial role. When neutrophil numbers are high, it is
sign that the wound is contaminated with bacteria, and repair should be delayed. When
neutrophil numbers begin to decline, as contaminating bacteria are no longer a threat,
the wound becomes a reparative tissue as the neutrophil begins to recruit the
macrophage.
Once at the site of injury, the newly recruited macrophages are armed to debride
damaged tissues through phagocytosis, and to digest pathogenic organisms, tissue
debris, and neutrophils. In addition, macrophages produce growth factors, and
cytokines that are necessary for initiation and propagation of new tissue formation.
These factors include IL-1 (Dinarello, 1984), TGF-α (Madtes et al. 1988), TGF-β
(Assoian et al. 1987), PDGF (Shimokado et al. 1985), and FGF (Baird et al. 1985).
Macrophages serve as an important source of mesenchymal cell growth factors,
resulting in the stimulation and the proliferation of fibroblasts, smooth muscle cells and
endothelial cells (Riches, 1996). Studies have shown that macrophage-depleted animals
suffer from defective wound repair, indicating the importance of the macrophage in the
healing process (Leibovich and Ross, 1975).
Granulation/Proliferation Phase
The granulation/proliferation phase is the second phase of the wound-healing cascade. It involves the migration and proliferation of keratinocytes, fibroblasts and endothelial cells, which leads to (a) re-epithelialization, (b) granulation tissue formation and (c) neovascularization.
7 (a) Re-epithelialization: Re-epithelialization (or re-covering of the wound) begins
within hours after injury. Epithelial cells from the wound margins migrate quickly to
divide the damaged stroma from the wound space and re-cover the surface of viable
tissues. To enable migration of these typically adherent cells, the marginal epithelial
cells undergo phenotypic alterations, including retraction of intracellular tonofilaments,
dissolution of most intercellular desmosomes, and the formation of peripheral cytoplasmic actin filaments (Odland and Ross, 1968; Gabbiani et al. 1978). The binding
between the epidermis and dermis is lost due to the dissolution of the hemidesmosome
links (Krawczyk and Wilgram, 1973). These phenotypic alterations confer lateral mobility and the necessary motility apparatus on these epidermal cells.
Within a few days of wounding, epidermal cells begin to proliferate. Along with the up-regulation of growth factor receptors, the production of the corresponding
growth factors by the inflammatory infiltrate is thought to play the key role in initiating
the proliferation of migrating epithelial cells. The growth factors involved, include the
EGF family (Barrandon and Green, 1987), and the FGF family, including KGF (Werner et al. 1992). These growth factors are produced in abundance by the reparative macrophages, but can also originate from surviving epithelial cells themselves. These growth factors have been shown to both stimulate re-epithelialization in animal models
(Hebda et al. 1990), and to be absent in models of deficient repair (Werner et al. 1994), illustrating their importance in the wound-healing cascade. Studies have also shown that expression of KGF is altered by treatment with glucocorticoids (Brauchle et al.1995). In our studies, alterations in the early pro-inflammatory cytokines results in
8 altered expression of several growth factors, and ultimately a delay in the healing process (Mercado et al. 2002a; 2002b).
As re-epithelialization proceeds, the basement membrane proteins reappear at the trailing edge of cell migration – at the closing margin of the wound (Clark et al.
1982). The epidermal cells revert to their normal phenotype and re-attach to the basement membrane via hemidesmosomes and to the neodermis via type VII collagen fibrils (Gipson et al. 1988). And finally desmosomes re-form between adjacent epithelial cells. In effect, the cell to cell and cell to matrix attachments serve to re- anchor and immobilize the new epithelium as it covers the wound.
In summary, the epidermal cells are very active during the re-epithelialization process. They produce growth factors resulting in autocrine and paracrine stimulation.
They migrate and proliferate to re-epithelialize the wound. They release proteases to allow them access to the wound and remove nonviable tissues. They produce extracellular matrix, which serves as a provisional matrix and forms the basement membrane. Finally, they terminally differentiate to reestablish the barrier function
(Clark, 1996).
(b) Granulation Tissue Formation: Closure of the wound surface is not the only process in the initial repair of the injured tissue. Regardless of the size of the void to be filled, new tissue, or granulation tissue, is deposited. Granulation tissue formation consists of fibroplasia and angiogenesis (see next section). Fibroplasia is the process of fibroblast recruitment into the wound site, their proliferation, and the ensuing synthesis and secretion of a temporary extracellular matrix of structural collagens and space-
9 filling sugars (i.e., glycosaminoglycans and proteoglycans) (Metz, 2003). The
provisional and immature matrix produced during the proliferative phase provides for temporary scaffolding upon which the wound heals.
Fibroblasts play a critical role in the repair and production of connective tissue.
In other words, the fibroblast deposits the replacement tissue to fill the void left by
injury. The cytokines and growth factors produced by the macrophage recruit and
stimulate fibroblasts to proliferate (a.k.a. fibroplasia). In fact, almost as soon as the
macrophage arrives in the area of the wound, fibroblasts begin to migrate to the margin
of the wound and begin to proliferate. Much like macrophages during the previous
inflammatory phase of repair, the fibroblast has several varied functions to accomplish
during the proliferative phase of repair. They synthesize the extracellular matrix
components (collagens, fibronectins, and glycosaminoglycans) and additional growth
factors necessary for subsequent aspects of healing.
The first product of the fibroblasts is an appreciable quantity of a
glycosaminoglycan called hyaluronic acid (HA) (Croce et al. 2001). HA has a very
large negative charge, attracts water into the wound, and forms a provisional ‘gel’ that
fills the wound. HA enables the newly deposited tissue to resist compressive forces.
Concomitantly, the fibroblast secretes extensive amounts of type III collagen (Carlson
and Longaker, 2004). The abundance of collagen gives the newly deposited tissue an
ability to resist tensile or tearing forces. Together, the network of type III collagen and
gel-like HA provide structural support to the newly forming tissue and provide a
scaffold for the migration of the many cell types involved in the repair process.
10 Cytokines with chemotactic, mitogenic and modulatory activities, stimulate the formation of fibroplasia. These cytokines are produced by platelets, macrophages and fibroblasts themselves. For example, PDGF and TGF-β play an important role in the production of extracellular matrix, drive the recruitment of fibroblasts (Seppa et al.
1982; Postlethwaite et al. 1987), and stimulate the secretion of proteinases involved in the migration of fibroblasts into the healing wound (Laiho et al. 1986; Overall et al.
1989).
Once fibroblasts are at the wound site, they switch from a migratory phenotype to a protein synthesis phenotype with the production of collagen being a primary goal.
Due to the abundance of TGF-β, and the fact it can induce collagen synthesis, it is suspected to play a causal role in the transition of fibroblasts from the migratory phenotype to the protein synthesis phenotype (Roberts et al. 1986). Fibroplasia is a highly regulated process. Dysregulation of this process results in fibrotic diseases such as keloid formation, morphea and scleroderma (Clark, 1996). Thoroughly understanding the biology of granulation tissue could lead to better therapeutics and the ability to minimize fibrosis.
To summarize, during the granulation/proliferative phase of wound repair, the fibroblasts play an important role. They produce growth factors, resulting in autocrine and paracrine stimulation. They proliferate and migrate to form granulation tissue.
They release proteases for provisional matrix lysis and extracellular matrix remodeling.
The fibroblasts produce the extracellular matrix to reestablish the connective tissue.
They provide a link between actin bundles and the extracellular matrix, which plays a
11 role in tissue contraction. Finally they undergo apoptosis to transition from the cell-rich granulation phase to the cell-poor scar (Clark, 1996).
(c) Neovascularization: The final aspect of granulation tissue formation is neovascularization or angiogenesis, which is the process of new blood vessel formation.
It occurs simultaneously with fibroplasia, commencing within days of injury. The assembly of a dense network of capillaries in the healing scar helps provide the energy and nutrients necessary for the proliferation of fibroblasts, the production of large quantities of provisional matrix, and the secretion of growth factors by macrophages
[for review see Neal, 2001].
Many factors are thought to play a role in the stimulation of angiogenesis.
These factors include aFGF and bFGF (Folkman and Klagsbrun, 1987), TGF-α, TGF-β,
TNF-α, PD-ECGF, angiogenin, angiotropin, VEGF, IL-8, PDGF, and low-molecular- weight substances including the peptide KGHK, low oxygen tension, biogenic amines and lactic acid (Folkman and Shing, 1992; Koch et al. 1992; Battegay et al. 1994; Lane et al. 1994). VEGF plays a role in vasopermeability, and is also known as vascular permeability factor (VPF). It is produced in large quantities by the epidermis during wound healing (Brown et al. 1992). FGF and VEGF both act as mitogens to stimulate a continual supply of endothelial cells for capillary extension. When the angiogenic stimuli are removed, capillaries undergo regression. Overall, angiogenesis is a multifaceted process that relies on the appropriate extracellular matrix, along with the proper phenotype, migration and mitogenic stimulation of endothelial cells.
12 For proper angiogenesis to occur there must be an appropriate extracellular
matrix that is being created during fibroplasia. Thus, there is a biological
interdependence between macrophages, fibroblasts and blood vessels as they migrate
into the wound space. Macrophages supply a source of cytokines for further fibroplasia
and angiogenesis. Fibroblasts provide the extracellular matrix needed for macrophage
migration and blood vessel growth. The blood vessels supply oxygen and nutrients
needed for cellular metabolism. This interdependence should clearly indicate that
alterations in one of these processes could have a substantial impact on the others.
Remodeling Phase
Extracellular Matrix Maturation: Although initial wound closure represents a complex
and well-orchestrated interaction of cells, extracellular matrix, cytokines and growth
factors, the tissue that is initially deposited during the proliferative phase of repair is
temporary. Neither its structure nor its function closely approximates that of the
original tissue. The initial type III collagen deposited during construction of the new
tissue is poorly organized and does not provide sufficient resistance against tensile forces to which mature tissues are subjected. This unfortunate reality is illustrated by the ease at which healing wounds can be re-injured. In addition, the hyaluronic acid
(HA), which was highly capable of resisting compressive forces while new blood
vessels and epithelium were created during the proliferative phase of repair, is quite
unsatisfactory for mature tissues. HA is poorly organized and as such, it does not
facilitate alignment of the extracellular matrix in parallel with tensile forces. Thus, the
13 large quantity of HA in the provisional matrix further limits the ability of the tissue to resist tensile forces. Therefore, over a long period of time that can stretch on for months or years, this provisional tissue is re-crafted during the final phase of wound healing – the long remodeling phase. It begins almost as soon as the first bits of granulation tissue are being deposited in the healing wound site (Kurkinen et al. 1980).
During remodeling, there is a rapid synthesis and degradation of extracellular matrix proteins. The nature of the matrix components in healing tissues changes over time. In an attempt to regenerate the characteristics of the original tissue, mature forms of collagens and proteoglycans progressively replace provisional matrix molecules. For example, fibers of type I collagen, which are characteristic of pre-injury tissues, progressively replace type III collagen (Diegelmann and Evans 2004; Ballas and
Davidson 2001). Similarly, dermatan sulfate and chondroitin sulfate take the place of
HA (Raghow 1994).
Through re-modeling, the highly cellular and highly vascular granulation tissue is gradually replaced, forming scar tissue, which is less cellular and less vascular than the temporary granulation tissue (Diegelmann and Evans 2004). Although repaired tissues will not be identical to the original, the resultant remodeled matrix should resemble it in both strength and function whether it is bone, skin, liver, or any other type of tissue. This remodeling of immature tissues is dependent upon the digestion of the provisional matrix. Matrix metalloproteinases, hyaluronidase, elastase, and collagenases fill this role, and the production of these enzymes is attributed, at least in part, to the macrophage. Thus, the coordinated process of tissue maturation appears to
14 be influenced by the activity of the tissue macrophage that was originally activated
during the inflammatory phase of repair.
The healing wound matures through a predictive sequence of events. With
regard to extracellular matrix proteins, the deposition of granulation tissue proceeds in
an ordered sequence beginning with fibronectin, then type III collagen, and finally type
I collagen (Kurkinen et al. 1980). The synthesis of type I collagen begins at about day
5 post wounding, and greatly increases the wound-breaking strength (Diegelmann et al.
1975; Gabbiani et al. 1976).
Wound Contraction: In addition to the maturation of the extracellular proteins and sugars, a large, open wound that heals by secondary intention can undergo remodeling by an additional and very different process. Fibroblasts in such wounds can undergo a phenotypic change to become myofibroblasts, which remodel the matrix by a process called wound contraction. The myofibroblast is characterized by large bundles of actin-
containing microfilaments, along the cytoplasmic face of the plasma membrane and the establishment of cell-cell and cell-matrix linkages (Welch et al. 1990). Contraction is defined as a mechanism by which forces generated within the wound decrease wound area by physically approximating the wound margins (Nedelec et al. 2000). The cell- cell, cell-matrix, and matrix-matrix links provide the network for traction of fibroblasts on their pericellular matrix across the wound (Singer et al. 1984). Wound contraction is characterized by a well-integrated interaction of cells, extracellular matrix, and cytokines.
15 Studies by Lenco et al. have shown that treatment of rabbits with exogenous
glucocorticoids results in impaired wound contraction (Lenco et al. 1975). Likewise,
mice undergoing restraint stress experience wound contraction diminished by over
45%, (Horan et al. 2005). Maturation of the healing extracellular matrix and the
process of wound contracture are dependent on the wounds microenvironment. More specifically, as there were cytokines, chemokines, and growth factors that drove the earlier inflammatory and proliferative phases of wound repair, there are additional
growth factors that drive wound remodeling. During remodeling, it is thought that
cytokines such as TGF-β, PDGF and IL-1 along with the new and immature
extracellular matrix are important for regulating collagenase and TIMP expression
(Werb et al. 1990; Circolo et al. 1991; Sporn and Roberts, 1992). Collagenases
produced by granulocytes, epidermal cells and macrophages are critical for collagen
catabolism. TIMP is important for controlling the activities of various
metalloproteinases involved in regulating the extracellular matrix (Brenner et al. 1989).
Interestingly, treatment of mice with glucocorticoids results in diminished expression of
TGF-β1 and β2 mRNA (Frank et al. 1996). Thus the effects of stress on wound
remodeling are thought to be dependent on its effects on cytokine and growth factor
production.
Summary of the Wound Healing Cascade: The final remodeling phase is dependent on
the deposition of new stroma and proliferation of fibroblasts during the granulation phase. The granulation phase is dependent on the earlier inflammatory phase where neutrophils and macrophages have initiated the reparative process. The pivotal role that
16 macrophages play in wound healing is illustrated by the experiments of Leibovich and
Ross in which they have shown macrophage-depleted animals have defective wound repair (Leibovich and Ross, 1975). This summary of wound healing illustrates the overall importance of the inflammatory phase in initiating the appropriate cascades to regulate the entire healing process. We believe that alterations in the inflammatory phase will have lasting consequences on the entire wound healing process and result in
delayed closure and diminished wound healing capacity.
SECTION II: Stress
The stress response is important for maintaining internal equilibrium. It is
critical to the organism for preserving homeostasis. The central effectors of the stress
response are the hypothalamic-pituitary-adrenal (HPA) axis and the sympathetic
nervous system (SNS).
Catecholamines
Stress activates the sympathetic-adrenal-medullary (SAM) axis resulting in the
production of catecholamines. The catecholamines, norepinephrine and epinephrine are
the primary neurotransmitters released after stimulation of the sympathetic nervous
system. Modifications in the secretion of catecholamines are primarily responsible for
controlling sympathoadrenal activity. More subtle changes in sympathetic activity are
managed by the receptors and postreceptor events. The physiological effects of
catecholamines include roles in the cardiovascular system, extravascular smooth
muscles, and metabolic effects (Lundberg, 1999; Goldfien, 2001).
17 In the cardiovascular system, the effects of catecholamines lead to an increase in
blood pressure due to the enhanced rate and force of contractions along with sensitivity
of the myocardium. Catecholamines also play a role in controlling the actions of
extravascular smooth muscles. They play a role in regulation of the myometrium of the uterus, and in controlling the smooth muscles of the intestines and bladder. They are responsible in part for relaxation of the smooth muscles of the trachea and dilation of the pupils. The metabolic effects of catecholamines include the regulation of oxygen consumption, heat production, the mobilization of glucose and fat from storage areas and they play a role in the regulation of kidney excretion, including water, sodium, potassium, calcium and phosphate (Goldfien, 2001).
The sympathetic nervous system also plays a regulatory role in the control of hormone secretion at the central and peripheral levels. Centrally, anterior pituitary hormones are regulated by norepinephrine and dopamine, its precursor. Peripherally the SNS plays a role in secretion of renin by controlling the juxtaglomerular cells of the kidney. Catecholamines also play a role in the regulation of thyroxine, calcitonin, parathyroid hormone, and gastrin (Goldfien, 2001). The organization of the SNS is such that its typical regulatory effects are discrete, in contrast to times of stress, when stimulation is more generalized and accompanied by an increase in catecholamines, particularly in the central nervous system.
Catecholamines are also produced by immune cells and help to regulate many immune functions. They utilize a receptor-mediated autocrine/paracrine mechanism, or a receptor-independent intracellular regulatory mechanism to exert their immunomodulatory effects (Jiang et al. 2006). The receptor-mediated pathway is
18 responsible for the immuoregulation of catecholamines in immunocytes. Studies have shown that catecholamines derived from macrophages can modulate production of
TNF-α and IL-1β (Spengler et al. 1994; Engler et al. 2005). The receptor-independent
mechanism plays a role in oxidative stress-induced apoptosis of the cells (Cosentino et
al. 2003). Studies by Bergquist et al. have shown that catecholamines in the nuclei of
immune cells interact with nuclear receptors and regulate lymphocyte function (1994).
In addition, catecholamines have also been shown to influence transcription processes, such as the expression of NF-κB (Bergquist et al. 2000).
Glucocorticoids
Stress activates the hypothalamic-pituitary-adrenal (HPA) axis. The
hypothalamus releases corticotropin-releasing hormone (CRH), which stimulates the
secretion of adrenocorticotropic hormone (ACTH) by the pituitary, which in turn
results in a rapid increase in GCs secreted by the adrenal cortex. The
immunosuppressive effects of the GC hormones are relatively well characterized and
have been shown to affect the circulation and function of many cells in the immune
system (Spry, 1972). GCs influence multiple cell types, including macrophages, eosinophils, T-lymphocytes, mast cells, dendritic cells, endothelial cells and epithelial
cells in a variety of ways. In some cells such as macrophages, GCs exert their effect by
inhibiting the release of inflammatory mediators while in other cells such as the T-
lymphocyte GCs are effective in inhibiting activation, proliferation and survival of
these cells (Barnes, 1998). GCs are small lipophilic molecules that enter the cell
through simple diffusion. In order to understand the mechanisms of GC anti-
19 inflammatory action, it is important to first have a basic understanding of how GCs
bind to their receptors, and also to have an idea how pro-inflammatory transcription
factors work. When GCs enter the cell, they bind to the glucocorticoid receptor (GR).
The GR is held in the cytoplasm associated with a complex that includes 2 heat shock
proteins (HSP90). These HSPs hold the GR in a configuration, which facilitates GC
binding. Upon ligand binding, the HSP90s separate from the GR, allowing the
translocation of the GR into the nucleus. In the nucleus, the GR binds as a homodimer
to the DNA palindromic consensus sequence termed the glucocorticoid response
element (GRE) in the 5’-upstream promoter region of glucocorticoid-responsive genes.
The consensus sequence for GRE binding is the palindromic 15-bp sequence
GGTACAnnnTGTTCT (Barnes, 1998). It utilizes the zinc finger regions of its DNA
binding domain to facilitate binding. The negative GREs have a more variable
sequence, and the majority of genes repressed by GCs have no GRE at all (Barnes,
1998), suggesting a separate mechanism for repression.
Stress, Glucocorticoids and Wound Healing
Several studies have provided evidence that stress delays wound healing and
suppresses the inflammatory response. Marucha et al. showed that students took an
average of 3 days longer to completely heal while undergoing examination stress as compared to the same students during summer vacation (Marucha et al. 1998). This
study also showed that there was a 68% stress-related decrease in the production of IL-
1β in these same subjects. Glaser et al. looked at the relationship between psychological
stress and the secretion of pro-inflammatory cytokines at an actual wound site. The
20 results showed that women with higher perceived stress scores had lower levels of IL-
1α and IL-8 at the wound site. The subjects with lower levels of these cytokines after one day, reported more stress and negative affect and had higher levels of salivary cortisol than did those subjects with high cytokine levels (Glaser et al. 1999). This
increase in psychological stress was associated with a delay in wound closure (Kiecolt-
Glaser et al. 1995). Furthermore, Mercado et al. (2002a) showed that the stress-
associated decrease in IL-1β expression at wound sites could be restored by treatment
with the glucocorticoid receptor antagonist RU486. This indicates that the decrease in
IL-1β expression and ultimately the delay in wound closure are due, at least in part, to elevated glucocorticoids.
In addition, studies by Bitar examined the involvement of glucocorticoids in the
pathogenesis of impaired wound healing in diabetes mellitus. This study found
evidence that hypercortisolemia was associated with diabetes impaired healing (Bitar,
1998). Extending towards a mechanistic understanding of the effect, observations
suggested an improvement in healing when cortisol levels were pharmacologically
normalized. This study found evidence to support the idea that GCs are involved in the
impaired wound healing associated with diabetes. It also provides a rationale for the
therapeutic potential of blocking GC function in order to promote wound repair under
hypercortisolemic conditions (Bitar et al. 1999). Beer et al. put forth an inclusive
review, which indicates that GCs inhibit wound repair in part by influencing key
regulatory molecules including growth factors (KGF, TGF-β1, TGF-β2, TGF-β3, and
PDGF), cytokines (IL-1α, IL-1β, and TNF-α), extracellular matrix molecules, and
matrix metalloproteinases (Beer et al. 2000). These studies provide evidence for the
21 hypothesis that stress and elevated levels of serum GCs delay wound healing and
suppress inflammation by down-regulating certain components vital to the wound-
healing cascade.
Glucocorticoids have been used for decades as a clinical tool to suppress
inflammatory and immune responses. They have been shown to reduce expression of
pro-inflammatory cytokines such as IL-1, TNF-α, and GM-CSF, as well as expression
of chemoattractant molecules such as MCP-1 and IL-8 (Snyder and Unanue, 1982;
Russo-Marie, 1992; Bendrups et al. 1993). Recent studies have begun to show how
GCs may influence gene transcription. GCs bind to cytoplasmic glucocorticoid
receptors (GR), which function through both transcriptional and posttranscriptional
mechanisms. Activation of gene expression by glucocorticoids generally requires
translocation of the activated GR to the nucleus (Hollenberg et al. 1987) and
subsequent binding of GR dimers to a specific site on the DNA called the
glucocorticoid response element (GRE). One dominating thought is that inhibition of
cytokine gene transcription by GCs may be based on protein-protein interactions
between transcription factors and GC induced inhibitors (Auphan et al. 1995;
Scheinman et al. 1995). For example, NF-κB-responsive elements are required for the
function of many cytokine promoters. The transcription factor NF-κB is a heterodimer
that is constitutively present in the cytosol of cytokine producing cells, and it is kept
inactive by association with inhibitor proteins [for reviews of NF-κB structure and
functions see Baldwin, 1996; Baeuerle and Henkel, 1994; Lee and Burckart, 1998]
To summarize, chronic stress will result in an increase in serum glucocorticoids
(Cook, 2002; Padgett et al. 1998), which, due to their strong anti-inflammatory nature, 22 will alter the pro-inflammatory cytokine profile of the early inflammatory phase of wound healing. These alterations will cause a cascade effect and result in a delay of the whole healing process, ultimately jeopardizing the integrity of the repaired tissue.
SECTION III: Transcription factors
As mentioned earlier, the studies described herein place particular interest on steroid hormone control of the expression of pro-inflammatory cytokines, chemokines and growth factors, and the ability of AED to restore normal wound healing kinetics.
As we have described in the preceding sections, regulation of cytokine, chemokine, and growth factor expression controls the sequence of events required to effectively coordinate wound repair. Regulation of those inflammatory factors resides principally at the level of gene transcription. Thus, the following section delineates how glucocorticoids modulate inflammatory gene expression and how we believe AED might function as a transcriptional antagonist.
Glucocorticoid receptors
The activated GR is a transcriptional regulator as has been described above. The ligand-activated GR binds as a homodimer to the DNA palindromic consensus sequence termed the glucocorticoid response element (GRE) in the 5’-upstream promoter region of glucocorticoid-responsive genes. How can activated GRs be anti- inflammatory?
First, one of the mechanisms is through the induction of anti-inflammatory genes. For example, glucocorticoids increase the transcription of genes, which encode
23 for several anti-inflammatory proteins, such as lipocortin-1, interleukin-10, interleukin-
1 receptor antagonist and secretory leukocyte protease inhibitor. The review by Barnes
suggests that glucocorticoids directly inhibit the production of lipocortin-1, interleukin-
1 receptor antagonist and secretory leukocyte protease inhibitor, resulting in anti-
inflammatory actions, while indirectly affecting IL-10 production (Barnes, 1998;
Umland et al. 2002). IL-10 expression is increased in asthmatic patients treated with
glucocorticoids, while macrophages stimulated in vitro with glucocorticoids actually
show diminished IL-10 expression (John et al. 1998).
Second, glucocorticoids can have even wider-reaching effects by modifying the
function of other transcription factors that simultaneously control multiple
inflammatory genes. For example, GR plays a role in the induction of IκBα production.
This protein acts as an inhibitor of NF-κB. IκBα attaches with NF-κB, holding it in the
cytoplasm of the cell. Upon activation of NF-κB, IκBα is phosphorylated by IκB
kinases (IKKs), targeting IκBα for ubiquitination and subsequent degradation. This
degradation of IκBα exposes the nuclear localization signal in the NF-κB complex,
allowing the translocation of NF-κB to the nucleus, where it binds to NF-κB target
genes [for reviews of NF-κB regulation see Li and Verma, 2002; Jobin and Sartor,
2000; Karin and Ben-Neriah, 2000]. This stress-related increase in the NF-κB inhibitor
could play a role in inhibiting the pro-inflammatory activation of NF-κB. The effect of
glucocorticoids on the expression of IκBα is apparently mediated through other
transcription factors, as there is no GRE consensus sequence present (Barnes, 1998).
Third, the activated GR can physically impair the activity of other transcription factors. For example, experiments with GRdim mice, mice that are incapable of forming
24 GR dimers, and therefore incapable of binding DNA are still able to suppress the inflammatory response, indicating that the anti-inflammatory mechanism is not based only upon DNA binding. Further investigation of this ‘transcription-free’ mechanism revealed that GR can associate with NF-κB directly, and interfere with the activation of the AP-1 pathway, which results in mutual antagonism between these transcription factors (Ray and Prefontaine, 1994; McKay and Cidlowski, 1999; Caelles et al. 1997;
De Bosscher et al. 2001).
And fourth, it has further been shown that GR can inhibit NF-κB that is already bound to DNA by interfering with the cofactors involved in transactivation (Barnes,
1998). For example, NF-κB and AP-1 both interact with CBP (cAMP response element binding protein), which is involved with the acetylation and subsequent unwinding of the chromatin at the transcription site (De Bosscher et al. 2000; 2001). CBP utilizes histone acetylases (HATs) for this mechanism. GRs have been shown to bind to this complex and attract histone deacetylases (HDAC), which deacetylate the chromatin and cause it to wind tighter, thereby inhibiting transcription of the pro-inflammatory cytokines (Barnes, 2006).
Even before these mechanisms were identified, the anti-inflammatory actions of
GCs were widely used clinically. Still today, the complete picture as to how glucocorticoids suppress inflammation is not fully understood.
Androgen Receptors
The androgen receptor (AR) and the glucocorticoid receptor (GR) are similar in structure and how they deliver their signal. Both receptors have 3 major regions, the n-
25 terminal, the centrally located DNA binding domain (DBD), which contains 2 zinc fingers important in dimerization and DNA binding, and the ligand binding c-terminal.
Experiments have used GR and AR chimeras of the 3 different regions to determine the role that each plays in binding, and what regions are important for activation (Scheller et al. 1998). These studies illustrated that the DBD was essential for activity, but that the interaction between the N and C terminal play an important role in the entire process (Scheller et al. 1998). The mechanism of action for ARs is very similar to that of GRs. It is a multi-step mechanism, in which the androgen enters the target cell and binds to the androgen receptor. This causes the dissociation of heat shock proteins in the cytoplasm. This is associated with a conformational change of the receptor protein allowing it to translocate to the nucleus. Once in the nucleus it binds to specific DNA sequences and dimerizes with a second molecule (Schoenmakers et al. 2000;
Braunstein, 2001). This entity attracts further proteins, such as coactivators, general transcription factors and RNA-polymerase II (Lee, 2003; Brinkmann 2006). This allows for specific activation of transcription at discrete sites on the chromatin
(Brinkmann, 2006). Both the GR and the AR interact with similar DNA response elements. However, studies have shown that the GR dimer binds its palindromic DNA response elements (GREs) in a head-to-head fashion, but that the AR dimer has the ability to bind in a head-to-tail fashion also (Schoenmakers et al. 2000). It is presumed that this feature may allow the preferential activity of AR over that of the GR.
26
NF-κB
The transcription factor NF-κB is a heterodimer that is constitutively present in the cytosol of cytokine producing cells, and it is kept inactive by association with inhibitor proteins [for reviews of NF-κB structure and functions see Baldwin, 1996;
Baeuerle and Henkel, 1994; Lee and Burckart, 1998]. NF-κB is held inactive in the cytoplasm by association with its inhibitor protein (IκBα). Pro-inflammatory stimuli activate a cascade that results in phosphorylation of IκBα, which marks it for subsequent ubiquitination and degradation by the 26S proteasome. This then allows
NF-κB to translocate to the nucleus and bind to its consensus sequence
(GGGRNNYYCC- N = any base, R = purine, Y = pyrimidine) where it then interacts with cofactor (CBP), which initiates transcription via a TATA box, and also interacts with the RNA polymerase II holoenzyme (Ghosh et al. 1995; Muller et al. 1995; Chen et al. 1998; Matt, 2002; Tetsuka et al. 2004; Hayden and Ghosh, 2004). This results in the transcription of numerous pro-inflammatory mediators, such as IκBα, IL-1, TNF,
IL-6, IL-8, GM-CSF, MCP-1 and beta-interferon (Kaltschmidt et al. 1993; Jobin and
Sartor, 2000; Stifter 2006).
In the cytoplasm, inactivated NF-κB is anchored by several inhibitory proteins and prevented from entering the nucleus. The inhibitory molecules include member of the IκB family (IκBα, IκBβ, IκBε, IκBγ, and Bcl-3), as well as the NF-κB precursor molecules p105 and p100 (NF-κB1 and NF-κB2). These inhibitors all contain a series of ankyrin repeats that are important for interaction with NF-κB (Karin and Ben-
Neriah, 2000). IκBα is the member of the inhibitor family that is most commonly 27 associated with NF-κB. The phosphorylation of IκBα is very important for the activation of NF-κB. There are several cascades that lead to the phosphorylation of
IκBα. Through their specific receptors, TNF-α, IL-1, and LPS are some of the classical triggers for NF-κB activation.
The TNF-α induced cascade which is described here is the canonical pathway and leads to the phosphorylation of IκBα. First, TNF-α binds to its putative receptor.
This causes the trimerization of the receptor with the subsequent association with TNF receptor associated death domain (TRADD), and Fas associated death domain (FADD).
This complex recruits the TNF receptor associated factor 2 (TRAF2) and Receptor interacting protein (RIP) and results in activation of NF-κB-inducing kinase (NIK) and subsequent phosphorylation of IκB kinase (IKK). IKK is a multiunit protein complex including an IKKα component, an IKKβ component, an IKKγ component (a.k.a. NF-
κB essential modulator – NEMO), and an IκB kinase associated protein (IKAP). The
IKKβ subunit is believed to be responsible for the phosphorylation of IκBα (Delhase et al. 1999; Karin and Ben-Neriah, 2000). The phosphorylation of IκBα at serines 32 and
36 in the sequence DSGXXS targets it for ubiquitination by an SKp1-Cullin-F-box
(SCF)-type E3 complex, primarily at lysines 21 and 22 (Traenckner et al. 1995; Scherer et al. 1995; Baldi et al. 1996; DiDonato et al. 1996; Karin and Ben-Neriah, 2000). This ubiquitination targets IκBα for degradation via the 26S proteasome (Alkalay et al.
1995). This then exposes the nuclear localization signal on NF-κB and allows its translocation to the nucleus. Upon nuclear entry, NF-κB is free to interact with the promoter elements of defined DNA sequences called κB binding elements. Binding of
28 NF-κB to its respective κB sequences enhances transcription initiation of inflammatory genes. Of particular importance to this project, it should be noted that expression of
many of the NF-κB driven genes are suppressed by the activated glucocorticoid receptor.
AP-1
The current studies do not address the role of AP-1 in this research model.
However, a brief background is offered due to the fact that it acts synergistically with
NF-ĸB to enhance the inflammatory response (Angel and Szabowski, 2002; De
Bosscher et al. 2001). Such an interaction might also be the target for GR and AR activity.
The AP-1 family consists of Jun, Fos, and ATF proteins. AP-1 is a widely utilized transcription factor that plays a role in embryonic development, tissue remodeling, tumourigenesis, inflammation and apoptosis. The wide variety of roles suggests that each AP-1 transcription factor has defined target promoters and regions
(Angel and Szabowski, 2002). Each AP-1 factor consists of a homo- or heterodimer of members of the Jun, Fos, and ATF protein subfamilies. The formation of dimers relies on their dimerization affinities and their relative abundance. The activation of AP-1 is mediated by increased transcription of fos and jun genes, however post-translational regulation also occurs. These proteins are phosphorylated by kinases, including mitogen activated protein kinase (MAPKs), protein kinase A and protein kinase C
(Yates and Rayner, 2002). This phosphorylation alters the DNA-binding ability and modulates transcriptional activity. AP-1 is thought to be important in wound healing,
29 particularly re-epithelialization. It promotes the production of important factors such as, TGF-β1, MMPs, and adhesion molecules (Yates and Rayner, 2002).
SECTION IV: Dehydroepiandrosterone (DHEA) and its derivatives.
The focus of this project has been upon what we have described as an anti- glucocorticoid function of the steroid hormone androstenediol. We are not the first to hypothesize that there may be native steroid hormones that are natural functional antagonists of glucocorticoids. In fact, Riley (1981) was the first to promote an anti- glucocorticoid hypothesis to describe the function of a steroid hormone called dehydroepiandrosterone (DHEA). Studies performed noted that mice subjected to,
“rotation stress” experienced increased serum corticosterone levels and developed
thymic involution and reduced resistance to transplantable tumors. Those same animals
had lower DHEA levels compared to the non-stressed controls, and the involutional
effects of stress were antagonized by the subcutaneous injection of 1.0 mg/animal of
DHEA (May et al. 1990). These findings and the resulting hypothesis were novel because to that point steroid hormones, at least the corticosteroids, were understood to suppress host immune and inflammatory response in vivo. Because of these observations, much interest was focused on DHEA and its capacity to improve host resistance to infection.
While many reports documented the wide range of effects associated with
DHEA, its precise in vivo mode of action has yet to be understood. For example,
DHEA counter-regulated GC suppression of cytokine secretion from macrophages and other immunologically important cells (Daynes et al. 1990, Suzuki et al. 1991, and
30 Blauer et al. 1991). However, results from our laboratory illustrated that while
glucocorticoid function may indeed be counter-regulated, DHEA is not the steroid
hormone directly mediating this effect. Our data suggest that metabolic conversion of
DHEA to AED offers significantly better protection from infection than that conferred with DHEA (Loria and Padgett, 1992a; 1992b). In addition, the proposed anti- glucocorticoid function of DHEA is not evident in vitro and may be mediated at the cellular level only after conversion to AED (Padgett and Loria, 1994).
Physiology of AED
The enzyme 17beta-hydroxysteroid dehydrogenase converts DHEA/DHEA-
sulphate into AED/AED-sulfate (Adams, 1985). From constant infusion experiments, it
is known that about 75% of circulating AED is produced from DHEA peripherally
(Poortman et al. 1980), and because it is a precursor of AED, serum concentrations of
AED closely follow those of DHEA. In healthy men and pre-menopausal women (mean
age 34.5 years) circulating serum AED levels approximate 3.5 nmol/l (Dikkeschei et al.
1993). In mice, levels are lower, approximating 0.172 nmol/l. Since a large portion of
circulating AED is derived from adrenal DHEA origin, ACTH is involved in its
regulation. However, because of their low metabolic clearance rates, the excretion of
both DHEA and AED in sequential urine samples of healthy subjects over a 5-day
period showed no circadian rhythm (Dikkeschei et al. 1993). Furthermore, there is no
feedback control of DHEA secretion at the hypothalamic-pituitary level. Therefore, the dose of AED we choose to employ undoubtedly raises circulating levels beyond their normal physiologic ranges. In view of the known high affinity of AED for the
31 androgen receptor (Kd approximately 6 nM), the dose of AED is probably sufficiently
high to activate a receptor-mediated response (Adams et al. 1978).
Summary
Stress has been shown to dysregulate wound healing and to slow the contraction
and subsequent closure of cutaneous wounds. This stress-associated delay in wound
closure is associated with an alteration in cytokine expression (Mercado et al. 2002a).
Stress activates the hypothalamic-pituitary-adrenal (HPA) axis resulting in the
increased production of glucocorticoids (GCs). Glucocorticoids are well characterized
and widely used for their anti-inflammatory action. Glucocorticoids inhibit wound
repair, in part by influencing the expression of important cytokines, chemokines,
growth factors and other important regulators of wound healing (Beer et al. 2000;
Hübner et al. 1996). Previous studies suggest that androstenediol; a metabolite of
dehydroepiandrosterone (DHEA) may counter-regulate the immune-suppressive
functions of GCs (Loria and Padgett, 1992a; 1992b; Loria et al. 2000). Experiments in an infectious model have revealed that AED can block the suppressive effect of glucocorticoids on pro-inflammatory cytokine production from macrophages and block the suppression of cellular trafficking (Padgett and Sheridan, 1999). This leads to the
hypothesis that the health adverse effects of highly elevated GCs will be reduced by
pharmacological treatment with AED. The present studies place particular interest on
steroid hormone control of the expression of pro-inflammatory cytokines, chemokines
and growth factors, and the ability of AED to restore normal wound healing kinetics. It
32 is further hypothesized that by counterbalancing the GC-mediated transcriptional
regulation of cytokine gene expression through interactions with the transcriptional
activator nuclear factor-kappaB (NF-κB), AED will restore the inflammatory response and improve wound healing in stressed animals.
33
CHAPTER 1
THE INFLUENCE OF ANDROSTENEDIOL ON THE HEALING OF CUTANEOUS
WOUNDS WHERE CLOSURE HAS BEEN IMPAIRED BY RESTRAINT STRESS
INTRODUCTION
The objective of wound healing is to restore an injured tissue to a state similar to what was present before wounding. As detailed in the preceding chapter, wound healing normally occurs in an orderly and efficient manner characterized by 3 distinct but overlapping phases. These three phases are the inflammatory phase, the granulation or proliferative phase and the long remodeling phase (Clark, 1996). Alterations in any part of the wound-healing cascade that impair that process will result in an overall delay in healing kinetics and deficient repair.
Efficient cutaneous wound healing quickly restores the protective barrier to an injured surface. However, multiple studies from our program (Padgett et al.1998;
Mercado et al. 2002a; Horan et al. 2005) have demonstrated that stress has a significant effect on wound repair. For example, control animals healed 3.10 days faster than mice undergoing restraint stress (Padgett et al. 1998). In a study looking at dental students, it was shown that dental students undergoing stress associated with exams, healed 3 days slower than the same group of students during summer vacation (Marucha et al. 1998).
Studies looking at the effects of stress on caregivers of patients with Alzheimer’s
34 disease showed that these caregivers healed significantly slower than in controls
(Kiecolt-Glaser et al. 1995). This delay in healing was consequential as the delay correlated with an increased susceptibility to infection with organisms such as
Staphylococcus aureus (Rojas et al. 2002). Early events in wound healing, particularly during the inflammatory response, represent a critical period in the overall healing process. Corticosterone, produced by stress-induced activation of the hypothalamic- pituitary-adrenal (HPA) axis, suppressed pro-inflammatory cytokine, chemokine, and growth factor gene expression (Mercado et al. 2002a). These changes delayed wound closure.
Recent reports from our lab and others show that the steroid hormone androstenediol (AED) functions in vivo as a counter-regulator of glucocorticoid hormones (Padgett and Loria, 1994; Padgett and Loria, 1998; Padgett and Sheridan,
1999). Therefore, experiments outlined in this chapter detail our assessment of the hypothesis that “by counterbalancing the immunosuppressive influence of glucocorticoids, AED would restore wound healing kinetics to animals subjected to restraint stress”. These experiments represent the first step towards our long-term goal of understanding the mechanisms by which AED regulates glucocorticoid hormone signaling, gene expression and wound healing kinetics.
The studies described on the following pages focus on the effects of various experimental manipulations on the early inflammatory phase of wound repair, as we hypothesize that influences during this period of healing will influence the overall process. Numerous studies elucidate this effect. Wetzler et al. showed that in the genetically diabetic mouse, impaired wound healing is associated with a sustained
35 inflammatory response and a prolonged expression of macrophage inflammatory
protein-2 and macrophage chemoattractant protein-1 (2000). Studies by Hübner et al.
show that mice treated with glucocorticoids experienced a reduced induction of IL-1α,
IL-1β and TNF-α that was associated with a delay in healing when compared to non- glucocorticoid treated controls (1996). Ashcroft et al. have shown that the delayed healing seen with old age is associated with an altered inflammatory response and endothelial cell adhesion molecular profile (1998). Ashcroft and Mills further showed that there is a direct upregulation of proinflammatory cytokine expression by macrophages in response to testosterone (2002) indicating a role for steroid hormones.
Together, these studies support our assertion that alterations in the inflammatory phase impact the healing process and the integrity of wound healing.
Stress has been shown to dysregulate wound healing and to slow the contraction and subsequent closure of a cutaneous wound. This is accomplished by the stress- induced activation of the hypothalamic-pituitary-adrenal (HPA) axis. Studies in our lab have shown that mice subjected to restraint stress exhibit delayed wound healing. The delay was linked to stress-induced changes in the early inflammatory phase of repair.
For example, studies from our group showed that certain pro-inflammatory cytokines
(i.e., IL-1) are down regulated by stress. These cytokines are important in the inflammatory phase of healing. They are associated with cellular recruitment into the wound margin. The down regulation of these cytokines results in a decrease in cellular recruitment, diminished control of microbial contamination, and a delay in the initiation of repair.
36 When mice are treated with a glucocorticoid receptor antagonist, such as
RU486, cytokine production and the recruitment of inflammatory cells can be restored
(Padgett et al. 1998; Mercado 2002a). Because RU486 is able to restore wound healing
kinetics in stressed mice, it is thought that the suppressive effect of stress is, in part due
to glucocorticoids. Unfortunately, RU486 has powerful anti-progesterone effects, and
therefore would not be considered as a viable therapeutic intervention. Therefore, we
sought to investigate the purported anti-glucocorticoid effects of androstenediol and
assess whether it could improve healing in a mouse where healing was delayed by
restraint stress.
Stress and serious illness cause a shift in pregnenolone metabolism away from
DHEA and AED production to that of GCs (Parker et al. 1985a, 1985b; Stahl et al.
1992). Previous studies suggest that androstenediol (5-androstene-3β, 17β-diol, AED)
and androstenetriol (5-androstene-3β-7β-17β-triol, AET), metabolites of
dehydroepiandrosterone (DHEA), may counter-regulate the immunosuppressive action of glucocorticoids (Padgett and Loria, 1998). Experiments in infectious disease models
have shown that AED and AET can counter-regulate the suppressive function of glucocorticoids during stress and can preferentially augment the production of cytokines necessary for inflammation and resolution of infection (Padgett and Sheridan,
1999). Previous unpublished studies from our lab have shown that AED blocked the suppressive effect of glucocorticoids on pro-inflammatory cytokine production from macrophages. It is thought that if AED can improve the inflammatory immune responses and counterbalance glucocorticoid function, it may also counteract the glucocorticoid-mediated immunosuppressive effects of stress during wound healing.
37 This leads to the hypothesis that the health adverse effects of highly elevated
glucocorticoids during wound healing will be reduced by pharmacological treatment with AED. This chapter will detail the development of the mouse model that enable us to test this hypothesis.
MATERIAL AND METHODS
Animals
Male, outbred CD1 mice, 6-8 weeks of age were obtained from Charles River,
Inc. (Wilmington, MA) and housed in a male-only room. Upon arrival, mice were
randomly distributed into groups of 5 animals per cage. Prior to experimentation, mice
were allowed unlimited access to food and water and left undisturbed for 7-10 days
before the initiation of any experimental manipulation. All experiments were carried
out in a facility accredited by the American Association for the Accreditation of
Laboratory Animal Care (AAALAC). The facility is maintained on a 12-h light/dark
cycle (lights on from 6am-6pm.)
Restraint Stress
The restraint stress (RST) groups were subjected to 15-hour cycles of restraint
beginning 3 days prior to wounding, and continuing for 5 days after wounding. Mice
were placed in well-ventilated 50 ml conical polypropylene tubes at 6:00 PM (lights out
at 6:00 PM) and removed the following morning at 9:00 AM (lights on 6:00AM), as
described previously (Padgett et al., 1998). Because the restraint (RST) mice did not
have access to food or water during these 15-hour cycles, the control groups were food
38 and water deprived (FWD) during this same time period. Mice in the FWD group were
free to roam around their cages. All tubes were cleaned between each session of
restraint.
Treatment with androstenediol (5-androstene-3β, 17β-diol, AED)
Mice were injected with AED (Sigma Chemical Company, St. Louis, Missouri)
three days prior to wounding, one hour post wounding, and again 3 days post
wounding. This dosing regimen was chosen based on the biologic clearance rate for
AED after subcutaneous administration (data not shown). Mice were injected subcutaneously with 0.05 ml of 40 mg/mL (2.0 mg) androstenediol dissolved in a 1:1 mixture of dimethyl sulfoxide (DMSO):ethanol. Control mice were treated with 0.05 ml of the vehicle (VEH) at the same timepoints.
Wounding
Mice were anesthetized intramuscularly using 30μl Ketamine (78
μg/ml)/Xylazine (4.4 μg/ml) diluted in 270μl saline. Mice were then shaved using
electric clippers, cleansed with alcohol swabs and wounded on their dorsal side just
below their shoulder blades. A sterile 3.5-mm biopsy punch was used to create 2
uniform, full-thickness wounds.
Photoplanimetry
The wounds of all mice, 5 from each group were digitally photographed at the
time of wounding and daily for 10 subsequent days. The wounds were standardized
39 against a fixed-size reference placed next to the wound during photography. The area of
each wound was determined using Canvas software (Deneba, Version 6.0).
Statistical Analysis
A two-way repeated measure analysis of variance (ANOVA) was performed
using Sigma Stat statistical software version 2.0. P values of less than 0.05 were
considered significant.
RESULTS
1.1 EFFECT OF RESTRAINT STRESS ON HEALING IN CD-1 MALE MICE:
Stressed CD1 male mice have delayed healing compared to the food and water
deprived control mice (figure 1.1). By 5 days post wounding, control mice have
wounds that are 27.8% of their initial size, indicating 72.2% closure, while restraint animals have wounds that are 63.7% of their initial size, indicating only 36.3% closure.
These results are in agreement with previous studies in inbred C57BL/6 and random-
bred SKH-1 mice that examined the influence of stress on wound repair. It was
important to establish that stress did indeed slow wound closure due to the fact that random-bred CD1 mice were being utilized, and previous wound healing studies in our lab had not utilized this particular strain of mouse. The data show that, comparatively,
RST slowed wound closure (overall p<0.001). The data depict an n of 5 per group; however, this experiment has been performed in triplicate with similar findings.
40 1.2 THE EFFECT OF RESTRAINT STRESS, WHERE WOUND CLOSURE
WAS DELAYED, IS GLUCOCORTICOID-DEPENDENT:
Daily corticosterone levels were obtained each morning at 10:00 AM. Figure
1.2 depicts the influence of restraint stress on serum corticosterone levels. Prior to the beginning of any experimental manipulation, basal levels between control and restraint groups were comparable (approximately 40 ng/ml). After one 12 hour cycle of restraint stress, serum corticosterone levels more than doubled. On the day of wounding, which corresponded to 3 cycles of restraint, serum corticosterone levels were more than 4-fold higher (162.5 versus 34.5 ng/ml) than control animals. Subsequent high levels of circulating corticosterone were maintained by repeated cycles of restraint through 5 days post wounding. Placement of a wound on control, non-stressed mice elevated corticosterone approximately 2-fold.
In light of the observations that the early inflammatory stage of wound healing was influenced by restraint stress and that restraint stress caused an increase in serum corticosterone, we examined the effects of corticosterone on the stress-induced
diminution of wound healing by using the glucocorticoid receptor antagonist RU40555.
Mice received daily RU40555 injections (25mg/kg) beginning 1 day prior to initiation of restraint and continuing throughout the entire stress paradigm. Treatment with
RU40555 blocked the effect of stress. Table 1.1 shows that, on average, restraint stressed mice treated with the glucocorticoid receptor antagonist healed within 1 day of control animals. Furthermore, the healing kinetic was similar to control mice.
Unfortunately, RU40555 was taken off the market and RU486 took its place. RU486 is
41 not specific for the glucocorticoid receptor, and therefore has more side effects, including strong anti-progesterone effects (Watanabe, 1994). This led us to search for an alternative that does not have untoward side-effects.
1.3 ANDROSTENEDIOL TREATMENT IMPROVES CUTANEOUS WOUND
CLOSURE IN STRESSED ANIMALS:
Previous studies suggest that the steroid hormone dehydroepiandrosterone
(DHEA) and its metabolite androstenediol (5-androstene-3β, 17β-diol, AED) oppose the suppressive functions of glucocorticoids (Loria and Padgett, 1992a; 1992b). For example, in an animal model of influenza virus infection, AED blocked the anti- inflammatory effects of restraint stress on cytokine production and lymphocyte recruitment to draining lymph nodes (Padgett and Sheridan, 1999). This led us to hypothesize that the health adverse effects of highly elevated glucocorticoids during wound healing would be reduced by pharmacological treatment with AED. In sum, healing on stressed animals treated with AED would approximate that of controls.
Figure 1.3 shows that control mice (FWD/VEH) achieved 50% closure of their small 3.5 mm circular wounds by day 3. As expected, wounds on restraint stressed mice
(RST/VEH) did not achieve a 50% reduction in wound area until 7 days post wounding
(P<0.001). In contrast RST mice treated with androstenediol (RST/AED) healed with rates similar to the unstressed, vehicle treated controls (FWD/VEH). These data show that treatment with pharmacological levels of AED prevented the stress-induced delay in wound closure.
42
DISCUSSION
Summary: The purpose of the experiments in this chapter served a limited
purpose. First, they confirmed the influence of restraint stress in the outbred CD-1 male
mice. Second and foremost, the data indicated that AED was a viable pharmacological
approach to ameliorate the suppressive effects of restraint stress with regard to wound
healing. Therefore, although this chapter might appear short, the data are the solid
foundation upon which the subsequent chapters have been built.
Discussion: Efficient cutaneous wound healing quickly restores the protective
barrier to an injured surface. However, multiple studies from our program (Padgett et
al.1998; Mercado et al. 2002a; Horan et al. 2005) demonstrate that stress has a
significant effect on wound repair. For example, in dental students reporting high levels
of psychological stress associated with examination and competency testing, the
kinetics of wound repair were slowed in an oral mucosal biopsy model (Marucha et al.
1998). In addition, we have shown in a murine model that the immunosuppressive influences of restraint stress mimicked the delay in wound healing reported in the human studies (Padgett et al. 1998). Furthermore, the delay in healing correlated with an increased susceptibility to infection with organisms such as Staphylococcus aureus
(Rojas et al. 2002). The data from these experiments suggested that early events in wound healing, particularly during the inflammatory response, represent a critical
period in the overall healing process. In support of this concept, a more detailed
analysis of the influences of stress on wound healing revealed that corticosterone,
43 produced by activation of the hypothalamic-pituitary-adrenal (HPA) axis, down-
regulated pro-inflammatory cytokine and chemokine gene expression (Mercado et al.
2002a; 2002b), which in turn delayed cellular recruitment and proliferation at the
wound site. Taken together, these studies suggest that stress delays healing and may
increase the risk of infection following a wound.
The earliest phase of wound healing is characterized by inflammation. Pro-
inflammatory cytokine and chemokine responses are necessary for the accumulation
and activation of polymorphonuclear leukocytes and monocytes at the wound site
(Leibovich and Ross, 1975; Gillitzer and Goebeler, 2001). The subsequent production
of growth factors by the newly recruited cells is necessary for the growth and migration
of keratinocytes across the wound surface in order to restore barrier function.
Therefore, the rapid expression of many genes encoding immunomodulatory proteins and peptides is necessary for efficient healing. As such, it would be economical for the
cells to coordinate these transcriptional events by using a limited number of inducible
transcription factors (e.g. NF-κB and AP-1). For example, there are numerous genes
expressed by various cells in the inflammatory wound site that have been shown to be
induced with the help of NF-κB (Shakhov et al. 1990; Baeuerle and Henkel, 1994;
McDonald and Cassatella, 1997;). However, glucocorticoids negatively regulate the
transcription of many chemokine, cytokine and growth factor genes by inhibiting NF-
κB activity (Beer et al. 2000). Therefore, the stress-related inhibition of NF-κB activity
may be an impediment to the early inflammatory phases of wound healing.
If the early pro-inflammatory cytokine, chemokine and growth factor responses
influence the subsequent contracture and epithelialization phases of wound healing,
44 disruption of the early phases may impact the overall integrity of the healed and
remodeled tissues. Because efficient healing of a cutaneous wound is important to
quickly restore the protective barrier to the injured surface, delayed wound healing
extends the period of time in which bacterial infection may occur. We hypothesize that
the physiological changes associated with stress, down-regulate pro-inflammatory
cytokine, chemokine and growth factor gene expression resulting in alterations in
cellular trafficking and activation, thus impairing wound healing. Therefore, our long-
term goal is to understand the mechanisms underlying stress-related changes between
the neuroendocrine and inflammatory responses, which are responsible for altered
wound healing. Armed with this knowledge, we will then be able to develop therapeutic
strategies to restore wound healing and reduce the risks associated with impaired
healing. The data in this chapter indicate that treatment with AED may be a viable
approach to antagonize the influence of restraint stress.
In conclusion, we have developed a model to test the role of AED on stress-
impaired healing in CD1 male mice. We have established the route, the amount, and
the dosing frequency of AED that is effective in restoring wound healing. This model will be used to further elucidate the mechanism through which androstenediol is able to ameliorate the stress-impaired healing. For example, in the next chapter (Chapter 2), we will illustrate the influence of stress and AED treatment on the pattern and kinetics of chemokine, pro-inflammatory cytokine and growth factor gene expression during the early stages of wound healing. The regulated expression of these early proteins is important for recruitment and activation of neutrophils and macrophages, and for the subsequent initiation of granulation and remodeling. Among the points that we will
45 consider in the next chapter will be; does HPA activation affect cytokine/chemokine/growth factor gene expression? And does treatment with AED ameliorate these effects?
This animal model will also allow us, in Chapter 3, to investigate how AED may influence the ability of glucocorticoids to simultaneously modify the transcription of multiple inflammatory genes. It will investigate how AED modulates the interaction of these powerful transcriptional activators/repressors.
46
Table 1.1: Effect of RU40555 on Wound Healing Time.
Average Healing Time
Treatment Group Experiment 1 Experiment 2
Control 10.4 ± 1.3 11.7 ± 0.65
Restraint 14.1 ± 1.6* 14.8 ± 0.43*
Control + RU40555 9.3 ± 0.9 10.3 ± 0.97
Restraint + RU40555 11.4 ± 1.4** 11.6 ± 1.25**
Table 1.1: Effect of RU40555 on Wound Healing: Beginning 1 day prior to the initiation of restraint and 4 days prior to wounding, mice were treated with 25mg/kg of the type II glucocorticoid receptor antagonist RU40555 or control vehicle. Data represent the average healing time per group (Mean ± SD). * = p < 0.05 compared to
Control, ** = p < 0.05 compared to restraint. Modified from Padgett, Marucha and
Sheridan;1998.
47 Figure 1.1: Influence of Stress on Wound Closure
120 100 80 FWD/VEH 60 RST/VEH 40 20 0
Percent of Initial Wound size Percent Day Day Day Day Day Day Day Day Day Day Day 0 1 2 3 4 5 6 7 8 9 10 Days Post Wounding
Figure 1.1: Influence of Stress on Wound Closure: The data presented here illustrates that stress does indeed slow wound closure in CD1 male mice. A sterile, circular punch biopsy was used to created uniform, full-thickness 3.5 mm cutaneous wounds. Stressed animals underwent 3 nights of restraint (RST) prior to wounding and an additional 5 nights subsequent to injury. Non-stressed animals (FWD) were food and water deprived during the time that RST animals were without access to food or water.
The data show that RST slowed wound closure (Overall p<0.001).
48 Figure 1.2: Effect of RST on Serum Corticosterone Levels in CD1 Male Mice
300
Control Restraint 250
200
150
100 Corticosterone (ng/ml)
50
0 BL-2-10135710 Day
Figure 1.2: Serum Corticosterone Levels. From each group, blood was collected from 4 of 12 mice each day for corticosterone determination by RIA. Baseline (BL) and experimental samples were obtained at 10:00 AM. Stressed animals were restrained for
12 h each night beginning on the evening 3 days prior to wounding. Wounds were made on the evening of day 0. Restraint stress was continued for 5 days after wounding.
Data represent mean +/- SD.
49 Figure 1.3: Effects of Stress and AED on Wound Closure
120 100 FWD/AED 80 RST/AED 60
Size FWD/VEH 40 RST/VEH 20 0 Percent of Initial Wound Percent Day Day Day Day Day Day Day Day Day Day Day 0 1 2 3 4 5 6 7 8 9 10 Days Post Wounding
Figure 1.3: Influence of RST and AED on Wound Closure. A sterile, circular punch
biopsy was used to created uniform, full-thickness 3.5 mm cutaneous wounds. Stressed
animals underwent 3 nights of restraint (RST) prior to wounding and an additional 5 nights subsequent to injury. Non-stressed animals (FWD) were food and water deprived during the time that RST animals were without access to food or water. Mice were treated with 2.0 mg of AED three days before wounding, one hour post wounding, and again 3 days post wounding. Animals not receiving AED received DMSO:EtOH as a control for the vehicle necessary for steroid delivery. The data are presented as group means with regard to wound size as a percentage of the original area of the circular
wound. The data show that RST slowed wound closure (overall p<0.001) while AED
treatment ameliorated the suppressive effect of stress, so that there was no difference between RST/AED and FWD/VEH control animals. The data depict an n of 5 per group; however, this experiment has been performed in triplicate with similar findings.
50
CHAPTER 2
THE INFLUENCE OF ANDROSTENEDIOL ON THE HEALING OF CUTANEOUS
WOUNDS WHERE THE EXPRESSION OF PRO-INFLAMMATORY CYTOKINES,
CHEMOKINES, AND GROWTH FACTORS HAS BEEN IMPAIRED BY
RESTRAINT STRESS
INTRODUCTION
If a tissue injury is substantial, the overall health of the individual can be
compromised. Therefore, the healing cascade is set in motion at the time of injury in an attempt to restore the original properties to the tissue. Coincident with the initial damage, the inflammatory phase of repair begins. It is initiated by factors released by resident cells after their mechanical disruption and also by the immediate response of platelets to ‘damage’ signals in injured blood vessels (King and Reed, 2002). This initial inflammatory response serves to jump-start healing. First, inflammation stabilizes the wound by removing contaminating debris and controlling microbial invasion, and second, it creates an environment conducive to tissue repair. During this inflammatory phase, at least three components are recruited from circulation: (a) platelets are retained in the area for hemostasis, (b) neutrophils flood into the wound
51 margin to control infection, and (c) resident macrophages are activated and circulating monocytes are recruited to prepare the wound for repair (Henry and Garner 2003; Hart
2002).
Traditionally, wound healing is divided into 3 phases; therefore after this inflammatory phase, the proliferative and remodeling phases take place. This division into three phases is not necessarily done to ‘separate’ the events in one phase from another. Instead, the first phase is typically involved in controlling loss of blood and preventing infection with microorganisms; the next phase involves reconstruction of the missing tissue; and the third phase simply represents maturation of the new tissue. Time wise, there is no true demarcation. Although inflammation might begin before the other two phases, in any given wound all three phases are typically occurring at the same time. Thus, we have grown to understand that alterations in any of the phases of wound healing simply affect wound healing --not just that phase. Simply if the kinetics of wound repair are substantially altered it can result in infection, pain, loss of tensile strength, other functional impairments, and fibrosis or unsightly scar formation.
As the preceding chapters should have clearly indicated, we have focused our attention on the events that have been placed into the ‘inflammatory phase of healing’.
Multiple genes are turned on during this phase in an effort to recruit inflammatory cells, fight infection, and to initiate repair. This phase of repair is characterized not only by the processes taking place but also by the numerous cytokines whose expression goes from undetectable to highly expressed. Expression of those cytokines and the influence of stress and androstenediol treatment on their expression is the main focus of this chapter.
52 Treatment of animals with glucocorticoids alters the expression of wound healing mediators and growth factors. Beer et al. illustrated the deleterious effect of glucocorticoids on wound healing. Their studies show that IL-1α, IL-1β, TNF-α, KGF,
TGF-β1, β2, β3 and their receptors, tenascin-C, stromelysin-2, macrophage metalloelastase, and enzymes involved in the generation of nitric oxide are all targets of glucocorticoid action in wounded skin (2000). Chedid et al. have also shown a time and dose dependent influence of glucocorticoids on the inhibition of KGF production in primary dermal fibroblasts (1996). Previous studies in our lab have shown that stress increases the level of serum glucocorticoids, while concomitantly delaying wound repair (Padgett et al. 1998). Thus, our analysis of the effects of AED will focus on its effects during the inflammatory phase of healing paying particular regard to the cytokines, chemokines and growth factors produced during this phase.
Wound Inflammation:
Upon injury, the process of hemostasis serves as the initiating step and foundation for the healing process. The main purpose is to control the bleeding
(Broughton et al. 2006). The clot that is established consists of collagen, platelets, thrombin and fibronectin. Upon injury and concomitant with clot formation, the damaged cells release cytokines and growth factors that initiate the inflammatory phase or repair (Witte and Barbul, 1997). The clot also serves as a scaffold, allowing neutrophils, monocytes, fibroblasts, and endothelial cells to migrate into the wound site
(Kurkinen et al 1980).
53 In principal, the formation of the blood clot is the first step in the inflammatory
phase of repair as platelets, in concert with the injured parenchyma, produce factors that increase blood flow and increase blood vessel permeability (Clark 1991b; Mannaioni et
al. 1997). Likewise, bradykinin from the kinin system, fibrinopeptides released during
fibrinogen cleavage, and histamine released from mast cells all increase blood flow to
the site (Francel 1992; Weisel 2005; Artuc et al. 1999). The resulting increased movement of plasma and the ‘leaky’ blood vessels near the site of injury help produce an environment rich in recruitment factors. Equally important, the platelets that become entrapped in the fibrin clot release their stores of chemotactic and growth factors which include platelet-derived growth factor (PDGF), and transforming growth factors (TGF) alpha and beta (Anitua 2004). Thus shortly after clot formation, inflammatory cells are initially recruited to the wound because of the formation of the blood clot.
The hallmark of the inflammatory stage is the infiltration of massive numbers of neutrophils into the wound margin (Hart 2002; Steed 2003). As neutrophils circulate, they continually survey the endothelial lining of blood vessels. Where the neutrophils stick and leave the circulation is determined by leukocyte-endothelial interactions.
These interactions are substantially increased by a cascade of molecular events, which
are dependent upon the inflammatory signals produced by the injured tissue. Locally produced chemoattractants (e.g., C5a, fMLP), inflammatory cytokines (e.g., IL-1, TNF-
α) and the C-X-C chemokines (e.g., IL-8, MIP-2α) concentrated in the fibrin clot
enhance E and P selectin molecule expression on the luminal side of the blood vessels
proximal to the damaged areas (Wan et al. 2003; Tsang et al. 1997). This reactive
endothelium slows the movement of neutrophils through blood vessels thus promoting
54 attachment. Although selectins only contribute to low affinity binding, the decreased
movement enables the neutrophil to establish additional and stronger attachments
through its integrin molecules (Tsang et al. 1997). The integrins recognize and bind to
adhesion molecules selectively expressed on endothelial cells lining the blood vessels
near sites of injury. These integrin-mediated attachments, which can occur only during
conditions of low flow, promote firm attachment and allow for diapedesis of the
neutrophil through vascular basement membrane and into the wound site (Stein et al.
2003).
Once in the wound area, the neutrophil plays the lead role in controlling microbial contamination. The most common anti-microbial defense attributed to the neutrophil is phagocytosis, and it is ably prepared for this role as it contains multiple cytolytic mechanisms that enable it to kill a wide variety of ingested microorganisms
[see Burg and Pillinger 2001; Karlsson and Dahlgren 2002 for reviews on neutrophil killing mechanisms]. If substantial wound contamination does not occur, neutrophil infiltration usually ceases within a few days, and effete neutrophils become entrapped
within the wound clot, which sloughs during tissue repair. Neutrophils within viable
tissue undergo programmed cell death within a few days and are phagocytosed by
tissue macrophages (whose numbers progressively grow during the first few days after
healing) (Sylvia 2003; Fadeel and Kagan 2003).
However, the neutrophil does not give its life simply to control microbial
contamination. In addition to phagocytosis, the neutrophil plays an important role in
further promoting the inflammatory phase of healing. For example, neutrophils produce
numerous proinflammatory molecules and enzymes that help recruit additional cells
55 and degrade the matrix of the wound bed thus facilitating subsequent cell recruitment
and movement into the wound (Theilgaard-Monch et al. 2004). For example, while in
the wound, neutrophils express a number of proinflammatory cytokine genes (e.g.
TNF-α, interleukin (IL)-1β) and chemokine genes (e.g. IL-8, MIP-1α and MIP-1β) that aid in the recruitment of macrophages to the wound (Theilgaard-Monch et al. 2004;
Scapini et al. 2000). In other words, the neutrophil does not simply travel to the wound to control bacterial contamination; it begins to prepare the tissue environment for subsequent aspects of tissue repair.
In the absence of infection, wounds can heal without the involvement of
neutrophils (Torkvist et al. 2001). On the other hand, as early as 1975, the infiltrating
monocyte/macrophage was thought to be necessary for repair as macrophage-deficient
mice were shown to heal slower, and the healed wounds on such mice had reduced
strength compared to those on wild-type animals (Leibovich and Ross 1975).
However, recent observations cast some doubt on the necessity of the macrophage in
healing. For example, Martin et al., (2003) showed that wounds on the PU.1 null
mouse, which is incapable of raising an inflammatory response due to a lack of both
neutrophils and macrophages, showed no delay in the repair process. In addition, these
authors claimed that the healed wound on the macrophage-less mouse showed fewer signs of scar formation (i.e. fibrosis). This singular publication casts some doubt on the
‘dogma’ that the macrophage is the key to successful wound healing.
Until this recent publication, most wound healing biologist agreed that without the macrophage, wound healing would not proceed correctly. The debate still continues and this chapter will not attempt to reconcile the issue. However, even if the
56 macrophage is not the lynchpin to healing as once thought, it is still one of the most
abundant cell types recruited to the wound during the inflammatory phase of repair.
Furthermore, the extant literature clearly illustrates that the chemokines, cytokines, and
growth factors produced by the macrophage play an important role in coordinating the
wound healing process. For example, DiPietro showed that MCP-1-deficient animals,
which are impaired in their ability to recruit macrophages to their wounds, have
delayed re-epithelialization, angiogenesis, and collagen deposition (DiPietro et al.
1998; Low et al. 2001). In addition, many of the cytokines and growth factors that are
produced by the macrophage during the inflammatory phase of healing play an
important role in coordinating the subsequent proliferative and re-modeling phases of repair. Thus, the cytokines and growth factors that the macrophage produces are among the most important in coordinating the wound healing process.
As it was for the neutrophil, diapedesis of monocytes through vessel endothelium is the first step required for their recruitment into the wound area. The main difference in the recruitment of neutrophils and monocytes is manifest in the different chemokines involved in their recruitment. Due to differential distribution of chemokine receptors on these two cell types, the C-X-C chemokines recruit neutrophils whereas the C-C chemokines are chemoattractant for macrophages (Gillitzer and
Goebeler 2001). In addition, because they precede macrophages at the inflammatory site, neutrophils in the wound contribute to the signals that call in the macrophage.
Once the circulating monocytes have crossed the endothelial barrier, they differentiate into macrophages and migrate to the wound. Activated macrophages complement the neutrophil in its efforts to control microbial contamination and kill
57 much the same way as neutrophils. In addition to the processes that they share with
neutrophils, macrophages also use antibody-dependent cell-mediated cytotoxicity to kill
or damage larger extracellular targets (Dasgupta et al. 2000). Furthermore, the
macrophage not only phagocytoses microbial contaminants but also ingests damaged
cells in the wound margin and effete neutrophils in healing tissues by recognition of
phosphatidylserine expressed on apoptotic cells (Li et al. 2003; Kurosaka et al. 2003).
Although the initial responsibility of the macrophage is control of
contamination, their overall role is much broader than that of the neutrophil. While
wound macrophages continue to eliminate deleterious materials and generate
chemotactic factors that recruit additional inflammatory cells to the injury site, the
macrophage also begins to initiate tissue repair. It produces many products involved in
the preparation of the tissue for healing. For example, macrophages produce enzymes
such as hyaluronidase, elastase, and collagenase, which degrade hyaluronic acid, elastin
and collagen in connective tissue (Hieta et al. 2003; Madlener et al. 1998). In doing so, the macrophage weakens the extracellular matrix to allow for easier migration and in-
growth of fibroblasts, keratinocytes and endothelial cells that build the new tissue. Not only do the macrophages prepare the extracellular matrix for tissue growth, they also synthesize and release multiple growth and regulatory factors, critical to the coordination of granulation tissue formation (the second broad phase of healing). Once
the macrophage begins to produce these growth factors, the repair part of healing
actually begins. For example, the formation of new capillaries from preexisting blood
vessels (angiogenesis) is a key element in the proliferative phase of repair (see Section
II). Macrophages are highly angiogenic when exposed to hypoxic conditions found in
58 the microenvironment of the wound (Bingle et al. 2002). In response to such
conditions, the macrophage secretes several growth factors (e.g. VEGF) that induce
proliferation of capillary endothelium. In addition, as the macrophage digests and
weakens the connective tissue matrix in the wound bed, it releases reserves of growth factors that are concentrated in the extracellular-matrix (Ortega et al. 1998). Such activity allows the macrophage to target the wound bed for the in-growth of new blood vessels.
Therefore, it is believed that the growth factors and chemotactic factors released by macrophages are important in the transition from the inflammatory phase to the proliferative phase of wound repair. Furthermore, the final remodeling phase of wound repair (See Section III), which is necessary for restoration of tissue structure and function, is dependent upon the proliferation of fibroblasts and the deposition of new extracellular matrix during the proliferative phase. Thus, although the primary responsibility of inflammation is to ensure that the appropriate cells and effector functions are activated to control infection before the deposition of new tissue proceeds, the cytokines, chemokines and growth factors involved in the inflammatory phase of healing appear equally important to the overall healing process.
The Chemokines, Cytokines and Growth Factors of the Inflammatory Phase of Wound
Repair:
Chemokines: Chemokines are a family of small chemotactic cytokines that regulate the
movement of many different leukocytes into sites of inflammation [for review see
Rossi and Zlotnik, 2000]. They exert their effects through G-protein linked receptors on
59 the surface of their target cells. As such, they induce the rearrangement of the leading
edge of the target cell and actually stimulate them to crawl towards the source of the
chemokine; in this case, the wound. Members of the C-X-C subclass of chemokines are
generally specific for neutrophils whereas the C-C subclass members are specific for
macrophages (Gillitzer and Goebeler 2001).
Interleukin-8 (IL-8) and GRO-α (which is also called CXCL1) are potent regulators of neutrophil chemotaxis. Both are produced by surviving epidermal cells near the wound edge and by cells entrapped within the blood clot. Gene expression of
IL-8 can be detected within 4 hours of wounding (Engelhardt et al. 1998). Likewise,
CXCL1 mRNA is highly expressed within a day of wounding (Engelhardt et al. 1998).
These C-X-C chemokines induce a wide range of responses in neutrophils including activation of the motile apparatus and directional migration, expression of surface adhesion molecules, release of lysosomal enzymes, and production of reactive oxygen intermediates.
Within hours of wounding, the expression of both Macrophage Chemoattractant
Protein (MCP-1), or CCL2, and Macrophage Inflammatory Protein-1α (MIP-1α), or
CCL3, is induced in surviving keratinocytes. Expression of each reaches peak levels
within 24-36 hours of wounding (Gillitzer and Goebeler 2001; Engelhardt et al. 1998;
DiPietro et al. 1998). These C-C chemokines are necessary for macrophage
recruitment, as neutralizing antibodies to either reduces the number of macrophages
recruited to the wound. MCP-1 is thought to initiate macrophage trafficking towards the
wound and simultaneously sensitize them to MIP-1α signaling (DiPietro et al. 1998). In
addition, resolution of the acute neutrophil-rich inflammatory response is linked to the
60 secretion of MIP-1α from the neutrophils themselves (Sato et al. 1999). The action of these C-C chemokines is not limited to cellular movement as illustrated by delayed wound re-epithelialization, angiogenesis, and collagen synthesis in MCP-1 or MIP-1α deficient mice (Low et al. 2001, DiPietro et al. 1998).
Proinflammatory cytokines: As they arrive in the wound, neutrophils and macrophages begin to synthesize and secrete small amounts of IL-1α, IL-1β, IL-6, TNF-α, and GM-
CSF [for detailed review, see Henry and Garner 2003; Hart 2002; Werner and Grose
2003]. Although neutrophils and macrophages are the major sources, resident cells, such as keratinocytes, are also capable of cytokine production. In concert with the chemokines, proinflammatory cytokines aid in the recruitment of cells into the wound by inducing the expression of adhesion molecules on the luminal side of vessel endothelium proximal to the inflammatory site. Expression of many of the proinflammatory cytokine genes is turned on within the first 24-48 hours of wounding
(Theilgaard-Monch et al. 2004). Many of the activities of the pro-inflammatory cytokines are shared. For example, IL-1α and TNF-α both contribute to the activation of NADPH oxidase thereby enhancing the microbicidal activity of neutrophils and macrophages (Dusi et al. 2001). In addition, proinflammatory cytokines can also prolong neutrophil survival in the wound (Chitnis et al. 1996), and their continued presence can be a sign of continuing bacterial contamination. In addition to enhancing inflammation, IL-1α, IL-1β, IL-6, TNF-α, and GM-CSF play important roles in subsequent aspects of healing including keratinocyte and fibroblast chemotaxis and proliferation, extracellular matrix protein deposition, and tissue remodeling.
61
Growth Factors: Re-epithelialization and granulation tissue formation during repair are
mediated by a wide variety of growth and differentiation factors. Many of those factors
are produced early in the healing process during the inflammatory phase. The
macrophage produces many chemotactic and mitogenic factors that attract fibroblasts,
keratinocytes, and endothelial cells into the wound site and then stimulate them to
proliferate. Thus, the cells involved in inflammation have an important role in driving
the transition from inflammation to the proliferative phase of repair and eventually in
the initiation of remodeling of new tissue. Among the most important growth factors
produced during the inflammatory phase that influence the generation of the new tissue are: PDGF, TGF-β1, β2, β3, FGF, and VEGF.
Platelet-derived growth factor (PDGF) is released from a variety of cells
involved in healing, but degranulating platelets that accumulate at disrupted capillaries
serve as the earliest sources of PDGF. It is the principal inducer of matrix proteins that
are important for creating the provisional matrix that initially fills the void created by
tissue damage (Beer et al. 1997).
Transforming Growth Factor β (TGFβ1, β2 and β3) helps to drive the
chemotaxis of macrophages to the wound bed. As macrophages accumulate in the
wound, concentrations of TGFβ escalate and correspond with the induction of
angiogenesis. TGFβ also contributes to new tissue deposition as it regulates the
production of collagen, proteoglycans and fibronectin (Takehara 2000; Gruss et al.
2003; Ferrara 2001). In fact, its role in new tissue deposition is characterized by its
62 contribution to scar formation. In contrast to adult tissues, fetal tissues heal without scarring and contain substantially less TGF-β (Liu et al. 2004).
Fibroblast Growth Factors (FGF) are a family of growth factors that are mitogenic for a variety of cells involved in the proliferative phase of healing. Some
FGFs drive fibroblast proliferation and new tissue deposition. Other FGFs stimulate endothelial cell proliferation and thus contribute to angiogenesis. Still other FGFs drive keratinocyte proliferation and help drive re-epithelialization (Takehara 2000; Giavazzi et al. 2003).
Vascular Endothelial Growth Factor (VEGF) is known to promote angiogenesis.
Its expression is enhanced by PDGF and TNF-α, which are produced by the macrophage during the inflammatory stage of repair. In the presence of VEGF, neovascularization of the wound margins begins almost immediately (Ferrara 2001;
Diegelmann and Evans, 2004; Jacobi et al. 2004).
Summary:
Alterations in the production of any of the above listed cytokines and growth factors result in down-stream changes in the overall healing process. Outside of the context of stress and in the clinic where physicians desire to accelerate wound repair for the patient’s benefit, treatment of cutaneous wounds with certain cytokines and growth
factors has been shown to accelerate the inflammatory phase of repair and improve wound healing. For example, Pierce et al. showed that exogenously administered recombinant B chain homodimers of PDGF (PDGF-BB) augmented the time dependent influx of inflammatory cells and fibroblasts and accelerated provisional extracellular
63 matrix deposition and subsequent collagen formation. They also showed that wound- breaking strength was increased and that PDGF-BB accelerated wound closure of excisional wounds by 30% (Pierce et al. 1991a; 1991b). Even more relevant to our studies, specifically in models of impaired healing, Pierce et al., showed that in glucocorticoid treated animals, one dose of topically applied TGF-β at the time of wounding, reversed the deficit in skin wound strength (Pierce et al. 1989).
Because of the importance of cytokine expression to the inflammatory phase of repair and because topical administration of many of these cytokines can accelerate repair, we hypothesized that AED’s ability to ameliorate the suppressive influence of stress was mediated by its influence on inflammatory gene expression. To test this hypothesis, we determined the effect of stress and AED on the production of the pro- inflammatory cytokines, chemokines and growth factors important for wound healing.
These include interleukin 1-alpha, interleukin 1-beta (IL-1β), monocyte chemoattractant protein-1 (MCP-1), platelet derived growth factor (PDGF), and keratinocyte growth factor (KGF or FGF-7). Expression of each of these is critical to wound repair and can be altered by glucocorticoids (Beer et al. 2000; Brauchle et al.
1995; Hubner et al. 1996).
MATERIAL AND METHODS
Animals
Outbred-male CD1 mice, 6-8 weeks of age were obtained from Charles River,
Inc. (Wilmington, MA) and housed in a male only room. Upon arrival, mice were
64 randomly distributed into groups of 3 animals per cage. Prior to experimentation, mice
were allowed unlimited access to food and water and left undisturbed for 7-10 days
prior to initiation of any experimental manipulation in order to acclimate. They were divided into a stress group receiving androstenediol (AED) or vehicle (VEH) and a non-stress group receiving AED or VEH. All experiments were carried out in a facility accredited by the American Association for the Accreditation of Laboratory Animal
Care (AAALAC). The facility is maintained on a 12-h light/dark cycle (lights on from
6am-6pm.)
Restraint Stress Paradigm
As described previously (Padgett et al. 1998), restraint stress groups (RST) were
subjected to 15-hour cycles of restraint beginning 3 nights prior to wounding and
continuing for up to 5 nights post wounding. For RST, mice were placed in well-
ventilated 50 ml conical polypropylene tubes at 6:00 PM (lights out at 6:00 PM) and removed the following morning at 9:00 AM (lights on 6:00AM). Because the restraint
(RST) mice did not have access to food or water during these 15-hour cycles, the control groups were food and water deprived (FWD) during this same time period.
Mice in the FWD group were free to roam around their cages. All tubes were cleaned
between each cycle of restraint.
Treatment with androstenediol (5-androstene-3β, 17β-diol, AED)
Mice were injected with AED (Sigma Chemical Company, St. Louis, Missouri)
three days prior to wounding, and one hour post wounding. This dosing regimen was
65 chosen based on the biologic clearance rate for AED after subcutaneous administration
(data not shown). Mice were injected subcutaneously with 0.05 ml of 40 mg/mL (2.0 mg) androstenediol as determined in previous studies. Androstenediol was dissolved in a 1:1 mixture of dimethyl sulfoxide (DMSO):ethanol. Control mice were treated with
0.05 ml of the vehicle (VEH) at the same timepoints.
Wounding and Tissue Harvesting
Mice were anesthetized intramuscularly using 30μl Ketamine (78
μg/ml)/Xylazine (4.4 μg/ml) diluted in 270μl saline. Mice were then shaved using electric clippers, cleansed with alcohol swabs and wounded on their dorsal side just below their shoulder blades. A sterile 3.5-mm biopsy punch was used to create 2 uniform, full-thickness wounds. At 3, 6, 12 and 24 hours post wounding, mice from each group were sacrificed. The wounds were excised using a 6-mm biopsy punch.
Non-wounded skin from a distal region was similarly taken as healthy control tissue.
Samples were placed in microcentrifuge tubes and frozen in liquid nitrogen. Samples were stored at -80˚C until ready for use.
Extraction of total RNA from wounds and synthesis of cDNA
Tissue samples (2 wounds and 1 non-wound control tissue sample for each subject) were homogenized separately using a standard single-step isolation procedure
(TRIzol – GIBCO BRL, Gaithersburg, MD) as per manufacturer’s protocol. After isolation, total RNA was quantified spectrophotometrically at 260 nm and 280 nm.
Total RNA was reverse transcribed into cDNA according to manufacturer’s protocol
66 (Promega, Madison, WI). The reverse transcription system consisted of 25 mM MgCl2,
10X Reverse transcription buffer, 10 mM dNTP mixture, rRNasin ribonuclease inhibitor, avian myeloblastosis virus (AMV) reverse transcriptase, and random primers.
Samples were incubated at 42˚C for 60 minutes, 100˚C for 5 minutes, and then cooled to 4˚C.
Quantitative Real Time PCR Analysis:
All samples underwent Real-time Polymerase Chain Reaction (PCR), in order to amplify the nucleotide sequence of interest (IL-1α, IL-1 β, MCP-1 PDGF, and KGF).
This system is based on the detection and quantification of a fluorescent reporter. Real- time PCR monitors the fluorescence emitted during the reaction as an indicator of amplicon production during each PCR cycle. The cDNA of interest was labeled with
FAM. 18S was used as an internal control, and labeled with VIC.
The sequences used for real time analysis for each of the cytokines is given in
Table 2.1 (primers were purchased from Invitrogen life technologies (Carlsbad, CA), and probes purchased from Applied Biosystems (Foster City, California)). The master mix for real time PCR consisted of 2X Universal Master Mix (PE Biosystems, Roche
Molecular Systems, Branchburg, New Jersey), 0.9 μM of cDNA 5’Primer, 0.9μM of cDNA 3’Primer, and 0.250μM of cDNA Probe. The cycling parameter was 2 minutes at 50˚C, 10 minutes at 95˚C (denature), 15 seconds at 95˚C(separate strands/elongation) and 1 minute at 60˚C(annealing). This was repeated for 40 cycles. This procedure utilized Prism 7000 Sequence Detection System Software (Applied Biosystems)
67 Analysis was performed using Microsoft Excel. The protocol for Real time PCR analysis is available at the website for Applied Biosystems. In short the expression of cytokines in the wound sample is compared to a healthy tissue reference set to a value of 1.
68 Table 2.1: Primer and Probe Sequences for Real Time PCR
Forward primer GTCGGCAAAGAAATCAAGATGG Reverse primer TCAATGGCAGAACTGTAGTCTTCG IL-1α Probe CCTGACTTGTTTGAAGACCTAAAGAACTGTTACAGTGA Forward primer GGCCTCAAAGGAAAGAATCTATACC IL-1β Reverse primer GTATTGCTTGGGATCCACACTCT Probe ATGAAAGACGGCACACCCACCCTG Forward primer TTGGCTCAGCCAGATGCA MCP- Reverse primer CCTACTCATTGGGATCATCTTGC 1 Probe AACGCCCCACTCACCTGCTGCTACT Forward primer ATCTCGCGGAACCTCATCG PDGF Reverse primer ACACAGGGCGGCCACA Probe TCGCACCAACGCCAACTTCCTG Forward primer AAGGGACCCAGGAGATGAAGA KGF Reverse primer TGCCACAATTCCAACTGCC Probe CAGCTACAACATCATGGAAATCAGGACCG Forward primer CGGCTACCACATCCAAGGAA 18S Reverse primer GCTGGAATTACCGCGGCT Probe TGCTGGCACCAGACTTGCCCTC
Table 2.1: Sequences of the primers and probes utilized for real time PCR. The
primers were purchased from Invitrogen life technologies (Carlsbad, CA), and the
probes were purchased from Applied Biosystems (Foster City, California).
69 Data Representation and Statistical Analysis
To assess the influence of stress and/or AED treatment on gene expression
during wound healing, the quantity of specific RNA (i.e., IL-1α, IL-1β, PDGF, KGF,
and MCP-1) obtained from a wound sample was compared to the quantity of the same
RNA species present in non-wounded healthy tissue samples. Briefly, real-time PCR
generates a Ct value, which is the PCR cycle where amplification of the cDNA of
interest begins exponential expansion. For analysis, the Ct value for the internal
standard (i.e., 18S RNA) was first subtracted from the Ct value for the cDNA of
interest (i.e., IL-1α, IL-1β, PDGF, KGF and MCP-1). This subtraction controls for
differences in reverse transcription and sample loading, and the value is denoted as the
ΔCt. Next, the ΔCt value generated from non-wounded tissue samples was then
subtracted from the ΔCt for each experimental sample. This equation sets the control
sample to a reference value of 0 and generates a ΔΔCt for each unknown. And finally,
these values were averaged for each treatment group; these mean values were used to
generate the N-fold difference in RNA expression relative to the control using the
equation: 2(-ΔΔCT); using this equation the control = 1. Although this data transformation accurately illustrates the logarithmic amplification following each PCR cycle and is used in each of the figures, statistical evaluation was performed using the
ΔΔCt value. Ranked sum tests with a student’s t-test were performed using Sigma Stat statistical software version 2.0. Statistical p values of less than 0.05 were considered significant. Due to the logarithmic transformation of the data, it is visually misleading to depict a standard deviation or standard error of the mean; thus the figures that
70 illustrate real-time PCR data do not include such error bars. The error bars depicted represent the 95% confidence interval.
RESULTS
2.1 INFLUENCE OF ANDROSTENEDIOL ON IL-1β GENE EXPRESSION IN
WOUND TISSUE:
Pro-inflammatory cytokines induce expression of adhesion molecules such as
ICAM-1 and E-selectin on endothelial cells allowing leukocytes to adhere to the lumen
of capillaries and extravasate into the wound site. Because it was previously shown that
stress suppressed IL-1β gene expression, and this suppression was associated with
delayed healing (Mercado et al. 2002a), these experiments were designed to determine
the influence of AED treatment on IL-1β gene expression during the early
inflammatory phase of repair. To measure cytokine gene expression, representative
animals from each group were euthanized 3, 6, 12 and 24 hours after wounding.
Wounds and their margins were excised using a 6-mm biopsy punch and real-time PCR
was used to quantify IL-1β RNA. The IL-1β RNA level detected in non-wounded skin
from the control group (FWD/VEH) was set to a reference value of 1 to represent the
level that would be expected to be expressed in tissue not involved in an inflammatory
reaction. Therefore, for comparative analysis of the effects of RST and/or AED
treatment, expression of IL-1β in the experimental samples is expressed relative to this
reference point.
71 The data in figure 2.1 show that IL-1β was up-regulated within 3 hours of
wounding and was elevated more than 1000 fold 24 hours post wounding in control
mice. Although IL-1β was expressed above background in wounds of RST animals,
RNA for this pro-inflammatory cytokine in the wounds of RST/VEH animals was
83.7% lower than the FWD/VEH group 24 hours after injury (p < 0.05). As it did for
wound closure, treatment of RST animals with AED ameliorated the suppressive influence of restraint. IL-1β RNA was 3.5 fold higher in wounds from the RST/AED group at 24 hours as compared to wounds from RST/VEH animals (p<0.05). Moreover, the expression of IL-1β in the RST/AED group did not differ statistically from the unstressed control group.
2.2 INFLUENCE OF ANDROSTENEDIOL ON IL-1α GENE EXPRESSION IN
WOUND TISSUE:
In contrast to findings by Mercado et al. (2002a), we did not see an up- regulation of IL-1α in wounded tissue. Our studies did not show IL-1α expression at any timepoint looked at within the first 24 hours post wounding (Data not shown). This was true for stressed and control animals regardless of whether or not they received treatment with AED.
72 2.3 INFLUENCE OF ANDROSTENEDIOL ON MCP-1 GENE EXPRESSION:
Within hours of wounding, the expression of monocyte chemoattractant protein-
1 (MCP-1; also known as CCL-2) is detectable in wound margins (Gillitzer and
Goebeler, 2001; Low et al. 2001). This C-C chemokine is necessary for macrophage recruitment as neutralizing antibody specific for MCP-1 reduces the number of macrophages recruited to the wound (DiPietro et al. 2001). Upon wounding, MCP-1
gene expression is induced in surviving keratinocytes at the wound margin and by
newly arriving macrophages (Gibran et al. 1997). Thus, the gene expression pattern of
MCP-1 should be expected to closely follow that of IL-1β. The data in figure 2.2 show
that this expectation was correct; wounding induces MCP-1 expression. However,
restraint stress had no significant suppressive effect on its expression during the first 24
hours after injury. In contrast, RST enhanced MCP-1 expression at 6 hours post
wounding (p<0.05). This effect was ameliorated with AED treatment, as MCP-1
expression was returned to levels approximating that of the control group at 6 hours.
2.4 INFLUENCE OF ANDROSTENEDIOL ON PDGF GENE EXPRESSION:
Almost coincident with wounding, pre-formed platelet-derived growth factor
(PDGF) is released from degranulating platelets that accumulate at disrupted capillaries. It is the principal inducer of matrix proteins that are important for creating the provisional matrix that initially fills the void created by tissue damage (Beer et al.
1997). PDGF also plays an important role in the recruitment of inflammatory cells to
73 the wound site. De novo synthesis of PDGF requiring new gene expression begins soon after the initial injury and has been shown to depend on IL-1 signaling (Raines et al.
1989). Figure 2.3 shows that compared to controls, RST prevented the activation of
PDGF gene transcription at 12 and 24 hours after wounding (p<0.05). In wounds from the RST/VEH group, expression of the RNA for PDGF was only 1/3 that of the controls at 24 hours. Although, treatment of the RST animals with AED did not restore
PDGF expression at the 12-hour time point, by 24 hours, PDGF expression in the
RST/AED group approximated that of the unstressed controls (figure 2.3). In fact, the expression of PDGF in the RST/AED group did not differ statistically from the unstressed control group at 24 hours post injury.
2.5 INFLUENCE OF ANDROSTENDIOL ON KGF GENE EXPRESSION:
Keratinocyte Growth Factor (KGF) is a member of the fibroblast growth factor family (FGF-7). Together, this family is mitogenic for a variety of cells involved in the proliferative phase of healing. Some FGFs drive fibroblast proliferation and new tissue deposition. Other FGFs stimulate endothelial cell proliferation and thus contribute to angiogenesis. Still other FGFs, such as KGF drive keratinocyte proliferation and help drive re-epithelialization of the wound surface (Werner et al. 1992). Wounding induces the basal layer of keratinocytes to produce an early round of KGF expression presumably to drive formation of the provisional barrier (Marchese et al. 1990) whereas
subsequent KGF expression (after day 2) is thought to be fibroblast-derived and
important for re-epithelialization, extracellular matrix deposition, and angiogenesis. For
74 these studies, analysis focuses on the initial injury-induced phase of KGF expression,
which is dependent on IL-1 (Tang and Gilchrest, 1996).
As shown in figure 2.4, appreciable KGF RNA was induced in unstressed
controls within 6 hours of wounding; peak levels were measured 12 hours after
wounding and declined thereafter. RST suppressed peak KGF expression 1/3 from
controls, however the statistical evaluation did not yield a significant difference.
Again, treatment with AED prevented the RST-induced suppression of KGF. In fact,
expression of KGF in either stressed or non-stressed animals treated with AED
mirrored that of controls.
DISCUSSION
The major finding of this study shows that AED accelerated wound closure in
subjects where healing had been delayed by an experimental stressor (Chapter 1). In
addition, the data in this chapter show that AED prevented the stress-induced changes
in inflammatory gene expression during the first few hours after injury. In mice
subjected to an experimental stressor, AED prevented the suppression of IL-1β and
PDGF expression. Both of these cytokines play an important role early after wounding to initiate and coordinate the healing process.
Upon wounding, the immediate response is to stop the loss of blood. Platelets, which aggregate at the disrupted ends of blood vessels release activators of the coagulation pathway. The function of platelets, however, is not just to stop the loss of blood; they also release pre-formed cytokines and growth factors that send out the
75 alarm to trigger the healing process. That initial alarm signal, coincident with injury, is
the beginning of the inflammatory phase of healing. Due to their high abundance in
circulation, neutrophils are the first inflammatory cells to respond to the alarm and to reach the wound site in large numbers. Upon arrival, neutrophils engulf and kill contaminating bacteria. They also produce and release cytokines (IL-1β) and chemokines (MCP-1) that help drive the inflammatory response and subsequently recruit macrophages into the wound.
Once at the wound, macrophages are then stimulated by the wound
microenvironment to produce a broad array of cytokines and growth factors involved in
subsequent wound healing processes. For example, IL-1β, produced by the neutrophil drives the production of numerous macrophage-derived cytokines, chemokines and growth factors through activator protein-1 (AP-1) and nuclear factor kappa B (NF-κB) driven gene transcription. One such growth factor that is produced by the wound macrophage is PDGF. Although the name of this growth factor suggests that platelets are the main source of its production, and they do release pre-formed PDGF when initially entrapped in the fibrin clot, platelets are incapable of gene transcription because they contain no nucleus. Instead, expression of the PDGF gene in the wound has been attributed to the IL-1-activated macrophage (Shimokado et al. 1985).
Expression of the PDGF gene augments the proliferation of fibroblasts and drives extracellular matrix deposition. In other words, PDGF is an important growth factor for new tissue deposition necessary to fill the void left by tissue injury. PDGF also induces a phenotypic change in wound fibroblasts; the newly differentiated myofibroblast contracts collagen matrices thereby shrinking the size of the open wound (Heldin and
76 Westermark, 1999; Clark, 1993). As each of these processes suggest, the wound- healing cascade is highly interdependent such that the initial response to injury and the first inflammatory genes expressed can have substantial effects on the later phases of healing. This implies that alterations in IL-1 expression soon after injury can subsequently influence the proliferative and remodeling phases of healing. In fact, previous data from our laboratory showed that restraint stress suppressed IL-1 gene expression, delayed macrophage recruitment, and slowed healing (Padgett et al. 1998;
Mercado et al. 2002a; 2002b).
Stressors, such as restraint, activate the hypothalamic-pituitary-adrenal axis, resulting in the release of glucocorticoids (GC) from the adrenal cortex. It is through the anti-inflammatory actions of GCs that RST is thought to mediate its suppressive influence on wound healing. In support of this hypothesis, treatment of stressed mice with a glucocorticoid receptor antagonist restored IL-1 expression (Mercado et al.
2002a) and prevented the stress-induced delay in wound closure (Padgett et al. 1998).
Unfortunately, because GR antagonists such as RU486 have a strong cross-affinity for the progesterone receptor, they can have substantial side effects particularly in females.
This limits their usefulness in a clinical setting.
In order to further test the recent observations that AED counterbalanced GC function without such untoward effects (Padgett and Loria, 1994; 1998), we hypothesized that pharmacological treatment of stressed animals with AED would prevent the suppression of pro-inflammatory cytokine gene expression and thus restore healing to control levels. In support of this hypothesis, the data described herein indicate that AED treatment of stressed mice restored healing to control levels.
77 Furthermore, the data revealed that AED also restored IL-1β gene expression to levels approximating that of the control group. Considering the important role that IL-1 plays in activation of the wound-healing cascade (i.e., the subsequent induction of PDGF, which was also restored by AED treatment), the ability to modulate IL-1β expression is likely an important mechanism utilized by AED to restore healing.
In contrast, whereas MCP gene expression was induced coincident with IL-1, there was no suppressive effect of stress on its expression during the early hours after injury. In addition, AED treatment had no significant effect on MCP-1 expression whether animals were subjected to stress or not. In further contrast to IL-1, there are very few down-stream direct effects of MCP-1 on gene expression. More specifically, the production of PDGF depends on the production of IL-1 whereas few growth factors involved in tissue repair depend upon MCP-1 signaling. During healing, MCP-1 serves principally as a chemotactic factor specific for those cells that express CC-CKR-2 (also called CCR2) and little more. In fact, wound healing occurs normally in MCP-1 deficient animals (Low et al. 2001). This contrast between the effect of stress and AED on IL-1 and MCP-1 gene expression and the parallel influence on wound closure, speaks to the importance of IL-1 to the overall outcome of repair.
In conclusion, the ability of AED to regulate IL-1β gene expression indicates a possible role for AED as a therapeutic modality to improve wound healing. Restoration of stress-impaired IL-1β expression by AED treatment, along with the subsequent restoration of the wound-healing cascade, including PDGF expression, offers insight into a mechanism through which AED mediates its effect on tissue repair.
78 Keratinocyte growth factor (KGF or FGF-7) is a mitogen for keratinocytes that
is critical to their migration during re-epithelialization (Rubin et al. 1989; Pierce et al.
1994; Werner et al. 1994). Fibroblasts, microvascular endothelial cells and smooth muscle cells all produce this growth factor (Smola et al. 1993; Winkles et al. 1997).
The production of KGF has not yet been detected in cells of epithelial origin (Werner,
1998). KGF is a potent growth factor for skin keratinocytes. It is one of the major factors playing a role in tissue repair following skin injuries (Marchese et al. 1995;
Werner, 1998.) Topical application of KGF has been shown to improve re- epithelialization in wound healing models (Pierce et al. 1994).
MCP-1 and KGF similarly illustrate trends towards stress-associated decreases, however neither were significant and should therefore be interpreted carefully. Both
MCP-1 and KGF were restored with AED treatment, but further studies with more subjects would likely help to elucidate the effect of stress and AED on production of these particular factors. It is interesting to note the variations of MCP-1 expression at 6,
12 and 24 hours, and KGF expression at 12 and 24 hours. This change is in part due to a change in the cellular population present at the wound site. Upon wounding, platelets release their granules, and neutrophils enter the wound site. Numerous cytokines, chemokines and growth factors are released and the inflammatory phase begins. By 24 hours the wound will have a higher amount of macrophages present at the wound site.
Therefore some of the difference seen in expression of these factors is due to a changing of cell populations. At 6 hours, the neutrophils and resident keratinocytes would be the primary source of these factors. At 12 and 24 hours an increasing proportion of these factors will be produced by macrophages. Therefore the ability of
79 AED to restore cytokine and growth factor expression could be dependent on cell type.
Future studies will address this issue. Another possibility for the differences in the 12 and 24-hour timepoints could be due to the fact that the mice harvested at 24 hours experience 1 more cycle of stress than those harvested at 12 hours. The stress- associated trend toward enhanced KGF expression was present regardless of AED treatment, indicating that KGF may not be a target for AED treatment.
The lack of IL-1α expression could be attributed to the early timepoints that were analyzed. Had we looked at later timepoints we may have seen a difference.
Mercado et al. (2002a) saw a stress-associated increase in IL-1α at 5 days post wounding. Perhaps if we looked at timepoints nearer to this, we would see a role for
IL-1α. It is also significant that they utilized female SKH-1 mice while the present studies used male CD-1 mice. These variations likely play a role in the differences seen in our models.
80 Figure 2.1: Influence of Stress and AED on IL-1beta Expression
3000
FWD/VEH RST/VEH 2500 FWD/AED RST/AED
2000
1500
1000
N-fold Difference overControls 500
0 3 Hours 6 Hours 12 Hours 24 Hours Time Post Wounding
Figure 2.1: Influence of Stress and AED on IL-1β Expression: Expression of IL-1β
RNA in non-wounded skin from the FWD/VEH group was assigned the value of 1 to represent the level expected to be expressed in tissue not involved in an inflammatory reaction. For comparative analysis of the effects of RST and/or AED treatment, expression of IL-1β in the experimental samples is expressed relative to this reference point. Data are expressed as group means within a 95% confidence interval. Statistical analysis reveals a significant effect of RST treatment at 24 hours post injury (p<0.05).
AED treatment ameliorated this effect; the expression of IL-1β in the RST/AED group did not differ statistically from the IL-1β in the unstressed control group (FWD/VEH). 81 Figure 2.2: Influence of Stress and AED on MCP-1 Expression
600
FWD/VEH RST/VEH 500 FWD/AED RST/AED
400
300
200
100 N-fold Difference over Control Tissue
0 3 Hours 6 Hours 12 Hours 24 Hours Time Post Wounding
Figure 2.2: Influence of Stress and AED on MCP-1 Expression: Tissue samples were subjected to quantitative real-time PCR to quantify MCP-1 gene expression.
Expression of MCP-1 RNA in non-wounded skin from the FWD/VEH group was assigned the value of 1 to represent the level that represents the expected expression in tissue not involved in an inflammatory reaction. Again, data are expressed relative to this reference point and are illustrated by the mean value within a 95% confidence interval. Statistical analysis revealed RST enhanced MCP-1 expression at 6 hours post wounding (p<0.05) while treatment with AED ameliorated this effect at 6 hours.
82
Figure 2.3: Influence of Stress and AED on PDGF Expression
18
16 FWD/VEH RST/VEH 14 FWD/AED RST/AED 12
10
8
6
4
N-fold Difference over Control Tissue 2
0 3 Hours 6 Hours 12 Hours 24 Hours Time Post Wounding
Figure 2.3: Influence of Stress and AED on PDGF Expression: PDGF RNA in non- wounded skin from the FWD/VEH group was assigned the value of 1 to represent the expected level of expression in tissue not involved in wound healing. Data are expressed relative to this reference point and are illustrated by the mean value within a
95% confidence interval. Statistical analysis revealed a suppressive effect of RST at 12 and 24 hours post injury (p < 0.05). Treatment with AED ameliorated this effect at 24 hours where the expression of PDGF mRNA in the RST/AED group did not differ statistically from the unstressed control group (FWD/VEH).
83
Figure 2.4: Influence of Stress and AED on KGF Expression
16 FWD/VEH 14 RST/VEH FWD/AED RST/AED 12
10
8
6
4
N-fold Difference over Control Tissue 2
0 3 Hours 6 Hours 12 Hours 24 Hours Time Post Wounding
Figure 2.4: Influence of Stress and AED on KGF expression: Samples were subjected to real-time PCR to quantify KGF gene expression. Data are expressed relative to this reference point (non-wounded tissue from FWD/VEH) and are illustrated by the mean value within a 95% confidence interval. There is a stress- associated trend towards diminished KGF expression at 12 hours post wounding, which was ameliorated with AED treatment. There is also a trend towards a stress-associated enhancement of KGF expression at 24 hours post wounding (both AED and VEH treated). There was no statistically significant difference at any timepoint.
84
CHAPTER 3
THE INFLUENCE OF ANDROSTENEDIOL ON THE TRANSCRIPTIONAL
ACTIVITY OF NUCLEAR FACTOR KAPPA B (NF-κB)
INTRODUCTION
Stress has been shown to dysregulate the wound healing process and increases the incidence of opportunistic infection of the wound (Rojas et al. 2002). Associated with the alteration in healing, stress affects the expression kinetics of multiple cytokine, chemokine and growth factor genes, which are involved in the inflammatory phase of healing. The decreased expression of such genes presumably results in a decrease in cellular recruitment to the wound. Through the activation of the hypothalamic- pituitary-adrenal axis (HPA), stress drives the increased production of the anti- inflammatory glucocorticoids (GC). Previous research in the laboratory hypothesized that it was through the anti-inflammatory effect of GCs where the effect of stress on cytokine expression and wound healing was mediated. In support of this earlier hypothesis, when treated with a GC receptor antagonist, such as RU40555, inflammatory cytokine gene and protein production along with the recruitment of inflammatory cells was restored to restraint-stressed mice. Furthermore, the kinetics of healing in stressed animals treated with glucocorticoid receptor antagonists was indistinguishable from that of non-stressed control animals. Thus, we further pursued
85 the hypothesis that wound healing could be improved in stressed individuals if the influence of glucocorticoids could be blocked.
Transcriptional control of gene expression is integral to initiate and coordinate inflammatory responses. During repair of any tissue injury, inflammation, through the recruitment of neutrophils and macrophages, limits infection and initiates repair mechanisms to restore tissue structure and function. It is at the level of transcriptional control of gene expression where glucocorticoids have their most noticeable effects on inflammation. Thus, the goal of this set of experiments is to elucidate the molecular mechanism, by which inflammatory gene expression is regulated, by stress-induced neuroendocrine activation and how that can be modulated by treatment with androstenediol. The overarching hypothesis is “hormonal-modulation of transcriptional activators that control inflammatory gene expression mediates the stress-induced delay in healing”.
Glucocorticoids have been used for decades as clinical tools to suppress both the immune response and the processes of inflammation. They have been shown to reduce expression of proinflammatory cytokines such as IL-1, TNF-α, IFN-γ, and IL-2 as well as expression of chemoattractant molecules such as MCP-1 and IL-8. To carry out its function, GCs bind to and activate cytoplasmic protein receptors, which translocate into the nucleus to modulate the activity of specific genes in a positive or a negative manner (Hollenberg et al. 1987). The positive action requires interaction of glucocorticoid receptor (GR) dimers with discrete nucleotide sequences (hormone response elements) on inducible promoters. Although, this positive regulatory aspect of the GR has been known for some time, the precise mechanisms for GC’s negative
86 action, such as the prominent immunosuppressive activity, is not completely understood. Furthermore, many of the cytokine and chemokine genes that are suppressed by GCs do not carry classical hormone response elements making them unusual targets for GC regulation. It has therefore, been proposed that glucocorticoids may interfere with the activity of other transcription factors such as AP-1 and NF-κB.
Indeed it has been shown that the GR is able to repress AP-1 through a cross-coupling mechanism (Chedid et al. 1994) yet AP-1 regulates only a small number of GC- sensitive cytokine promoters. On the other hand there are a number of inflammatory genes expressed in keratinocytes, neutrophils, macrophages, fibroblasts, and endothelial cells that are induced by NF-κB (McDonald and Cassatella, 1997; Shakhov et al.
1990.). These include the genes that encode for M-CSF, G-CSF, GM-CSF, IL-1, TNF-
α, IL-6, MCP-1, IL-8 (a.k.a., KC), IP10, and nitric oxide synthase (Baeuerle and
Henkel, 1994). Thus, we hypothesize that NF-κB plays a central role in coordinating gene expression during the early inflammatory phase of wound healing. Because NF-
κB is a common transcriptional regulator of the cytokines involved in the inflammatory phase of wound healing, we hypothesize that AED may be regulating GC’s influence on cytokine secretion by interfering with GC’s inactivation of NF-κB.
Initially characterized as a heterodimer of p50 (NF-κB1) and p65 (RelA) subunits, NF-κB is constitutively present in the cytosol and kept inactive by association with inhibitor proteins that contain ankyrin repeat motifs (Read et al. 1994). These inhibitory molecules include the IκB family (IκBα, β, and γ) as well as the NF-κB precursor molecules p105 and p100 (NF-κB1 and NF-κB2). Upon activation by LPS, viral antigen, or proinflammatory cytokines, cells rapidly degrade IκBα. NF-κB then
87 enters the nucleus and interacts with promoter elements of defined DNA sequences,
enhancing transcription initiation of the respective genes.
The answer to how GCs could simultaneously suppress transcription of many
inflammatory genes began to appear in 1995 when two publications presented data that
GCs could interfere with nuclear factor kappa B (NF-κB) activity (Scheinman et al.
1995; Auphan et al. 1995). Specifically, those two studies showed that GCs could
transactivate an inhibitor of NF-κB activity - - GCs induced the transcription of IκBα,
which then sequestered NF-κB in the cytoplasm and prevented it from translocating to
the nucleus and inducing gene activation. This was a logical explanation for the broad
spectrum of cytokine suppression mediated by GCs (Li and Verma, 2002). Because
many inflammatory genes are under the control of NF-κB, if GC could repress
activation, then individual cytokines would not need to possess the putative hormone
response elements for GCs. Instead, by inhibiting NF-κB transcriptional activity,
multiple genes could be turned off simultaneously. However, several subsequent
publications showed that, in some cell types, IκBα synthesis was not necessary for NF-
κB inhibition by GC (Adcock et al. 1999; Wissink et al. 1998). Additionally, the
glucocorticoid receptor antagonist, RU486, was also capable of inhibiting NF-κB to
some extent (Hofmann et al. 1998). Together these observations suggest that de novo
gene transcription by GCs is not required for NF-κB inhibition. Thus, the story was not
so clear. However, these two publications (Scheinman et al. 1995, Auphan et al. 1995) opened the door to a better understanding of how transcription of multiple cytokines could be inhibited. To do so, you need to “turn off” the activators of transcription – turn
88 off NF-κB. Therefore, we sought to investigate whether androstenediol affected the
ability of the activated glucocorticoid receptor to “turn off” NF-κB.
Dehydroepiandrosterone (DHEA) is a ubiquitous adrenal hormone with immunomodulatory properties, which decrease with age (Mills et al. 2005). Converting
DHEA to its downstream steroid hormones results in estrogenic and/or androgenic effects. Androstenediol is one such steroid hormone (see figure 3.1), although not a GC receptor antagonist, androstenediol (5-androstene-3β, 17β-diol, AED) counter-regulates
the suppressive function of glucocorticoids. More specifically, studies in our lab have shown that AED blocked the suppressive effect of glucocorticoids on IL-1 and TNF-α production from macrophages. These and other studies from our lab have led us to hypothesize that AED may prevent GC-mediated inhibition of NF-κB’s activity. NF-
κB is an important transcription factor for many pro-inflammatory cytokines and chemokines involved in the wound healing process, this leads to our hypotheses that treatment of stressed animals with AED would (a) restore healing to control levels (see
Chapter 1), (b) prevent the suppression of pro-inflammatory cytokine gene expression
(Chapter 2), and (c) antagonize glucocorticoid-mediated inhibition of NF-κB
transcriptional activation, which is the focus of this chapter.
Because NF-κB has been shown to play an important role in transcriptional
activation of genes involved in healing, the experiments described below are designed
to determine the effects of stress and the resultant rise in corticosterone levels on the
activation of NF-κB. These experiments will test whether stress impedes NF-κB-driven transcriptional activation thereby inhibiting inflammatory gene transcription. First, we
will examine the level of expression of a surrogate marker of NF-κB activation (e.g., its
89 inhibitor, IκBα) in wound biopsies throughout the early inflammatory phase of healing
and in non-wounded tissue. Then we will assess the influence of AED treatment on
NF-κB activation and nuclear localization.
MATERIALS AND METHODS
Animals
Outbred-male CD1 mice, 6-8 weeks of age were obtained from Charles River,
Inc. (Wilmington, MA) and housed in a male only room. Upon arrival, mice were
randomly distributed into groups of 3 animals per cage. Prior to experimentation, mice
were allowed unlimited access to food and water and left undisturbed for 7-10 days
prior to initiation of any experimental manipulation in order to acclimate. They were divided into a stress group receiving androstenediol (AED) or vehicle (VEH) and a non-stress group receiving AED or VEH. All experiments were carried out in a facility accredited by the American Association for the Accreditation of Laboratory Animal
Care (AAALAC). The facility is maintained on a 12-h light/dark cycle (lights on from
6am-6pm.)
Restraint Stress Paradigm
Restraint stress groups (RST) were subjected to 15-hour cycles of restraint
beginning 3 nights prior to wounding and continuing for up to 5 nights post wounding.
For RST, mice were placed in well-ventilated 50 ml conical polypropylene tubes at
6:00 PM (lights out at 6:00 PM) and removed the following morning at 9:00 AM (lights
90 on 6:00AM). Because the restraint (RST) mice did not have access to food or water during these 15-hour cycles, the control groups were food and water deprived (FWD) during this same time period. Mice in the FWD group were free to roam around their cages. All tubes were cleaned between each use.
Treatment with androstenediol (5-androstene-3β, 17β-diol, AED)
Mice were injected with AED (Sigma Chemical Company, St. Louis, Missouri) three days prior to wounding, one hour post wounding, and three days post wounding.
This dosing regimen was chosen based on the biologic clearance rate for AED after subcutaneous administration (data not shown). Mice were injected subcutaneously with
0.05 ml of 40 mg/mL (2.0 mg) androstenediol as determined in previous studies.
Androstenediol was dissolved in a 1:1 mixture of dimethyl sulfoxide (DMSO):ethanol.
Control mice were treated with 0.05 ml of the vehicle (VEH) at the same timepoints.
Wounding and Harvesting
For PCR samples, mice were anesthetized intramuscularly using 30μl Ketamine
(78 μg/ml)/Xylazine (4.4 μg/ml) diluted in 270μl saline. Mice were then shaved using electric clippers, cleansed with alcohol swabs and wounded on their dorsal side just below their shoulder blades. A sterile 3.5-mm biopsy punch was used to create 2 uniform, full-thickness wounds. At 3, 6, 12 and 24 hours post wounding, mice from each group were sacrificed. The wounds were excised using a 6-mm biopsy punch.
Non-wounded skin from a distal region was similarly taken as healthy control tissue.
Samples were placed in microcentrifuge tubes and frozen in liquid nitrogen. Samples
91 were then stored at -80˚C until ready for use. Animals used in the TransAMTM protocol
were similarly wounded, but their wounds were harvested at 12 hours, 24 hours, 48
hours, 3 days, and 5 days post wounding. This tissue was then used immediately for
the nuclear extraction protocol, as opposed to being frozen and stored at -80˚C.
Extraction of total RNA from wounds and synthesis of cDNA
Tissue samples (2 wounds and 1 non-wound control tissue sample for each
subject) were homogenized separately using a standard single-step isolation procedure
(TRIzol – GIBCO BRL, Gaithersburg, MD) as per manufacturer’s protocol. After
isolation, total RNA was quantified spectrophotometrically at 260 nm and 280 nm.
Total RNA was reverse transcribed into cDNA according to manufacturer’s protocol
(Promega, Madison, WI). The reverse transcription system consisted of 25 mM MgCl2,
10X Reverse transcription buffer, 10 mM dNTP mixture, rRNasin ribonuclease inhibitor, avian myeloblastosis virus (AMV) reverse transcriptase, and random primers.
Samples were incubated at 42˚C for 60 minutes, 100˚C for 5 minutes, and then cooled to 4˚C.
Quantitative Real Time PCR Analysis
All samples underwent Real-time Polymerase Chain Reaction (PCR), in order to
amplify the nucleotide sequence of interest, in this case, IĸBα. This system is based on
the detection and quantification of a fluorescent reporter. Real-time PCR monitors the
fluorescence emitted during the reaction as an indicator of amplicon production during
92 each PCR cycle. The cDNA of interest was labeled with FAM. 18S was used as an internal control, and labeled with VIC.
The sequences used for real time analysis for the cytokine is given in Table 3.1
(primers were purchased from Invitrogen life technologies (Carlsbad, CA), and probes purchased from Applied Biosystems (Foster City, California). The master mix for real time PCR consisted of 2X Universal Master Mix (PE Biosystems, Roche Molecular
Systems, Branchburg, New Jersey), 0.9 μM of cDNA 5’Primer, 0.9μM of cDNA
3’Primer, and 0.250μM of cDNA Probe. The cycling parameter was 2 minutes at 50˚C,
10 minutes at 95˚C (denature), 15 seconds at 95˚C(separate strands/elongation) and 1 minute at 60˚C(annealing). This was repeated for 40 cycles. This procedure utilized
Prism 7000 Sequence Detection System Software (Applied Biosystems) Analysis was performed using Microsoft Excel. The protocol for Real time PCR analysis is available at the website for Applied Biosystems. In short the expression of cytokines in the wound sample is compared to a healthy tissue reference set to a value of 1.
Forward primer ATGACACGGAGTCAGAATTCACA IĸBα Reverse primer CTTATAATGTCAGACGCTGGGCT Probe AGGATGAGCTGCCCTATGATGACTGTGTGT Forward primer CGGCTACCACATCCAAGGAA 18S Reverse primer GCTGGAATTACCGCGGCT Probe TGCTGGCACCAGACTTGCCCTC
Table 3.1: Primer and Probe Sequences for Real Time PCR
93
Nuclear Extract Protocol
A nuclear extract kit was obtained from Active Motif North America (Carlsbad,
California).
Step 1: Tissue Homogenization: Fresh tissue was cut into very small pieces
using clean razor blades. Pieces were collected in pre-chilled, clean homogenizing
tubes. All samples were kept on ice and this procedure was performed in a cold room.
3 mL ice cold 1X Hypotonic Buffer supplemented with 1M Dithiothreitol (DTT) and
detergent (3 μl of provided 1 M DTT and 3 μl of the provided detergent) per gram of
tissue was added to each sample and samples were homogenized. (All buffers and
solutions were made according to manufacturer’s protocol, available at
www.activemotif.com). Samples were centrifuged at 850 g and 4˚C for 10 minutes.
Supernatant was then transferred to a pre-chilled microcentrifuge tube, and stored for
later use.
Step 2: Cytoplasmic Fraction Collection: The cell pellet from step 1 was
resuspended in 500 μl 1X Hypotonic Buffer by pipetting up and down several times. It
was then transferred to a pre-chilled microcentrifuge tube and incubated on ice for 15
minutes. 25 μl of detergent was added and vortexed for 10 seconds. The suspension was then centrifuged for 30 seconds at 14,000 g and 4˚C. Supernatant was then added
to the supernatant collected during step 1. These samples were then stored at –80˚C
until ready to use. These samples represent the cytoplasmic fraction.
Step 3: Nuclear Fraction Collection: The nuclear pellet was resuspended in 50
μl Complete Lysis Buffer by pipetting up and down. It was then vortexed for 10
94 seconds. The suspension was then incubated for 30 minutes on ice on a rocking
platform set at 150 rpm. Samples were vortexed for 30 seconds and centrifuged for 10
minutes at 14,000g at 4˚C. Supernatant was transferred into a pre-chilled tube and
stored at –80˚C. These samples represent the nuclear fraction.
Bradford Assay
This assay was used for total protein quantitation of the cytoplasmic and nuclear
extracts obtained from the above protocol. The Coomassie PlusTM – The Better
Bradford Assay Kit was obtained from Pierce (Rockford, IL). A 96 well microplate
was used. 2 μl of each sample protein was mixed with 8 μl of Complete Lysis Buffer
and then combined with 300 μl of the Coomassie PlusTM assay reagent, samples were
mixed well on a plate shaker for 30 seconds, and then incubated for 10 minutes at room
temperature. A plate reader measured the absorbance at 595 nm. Blank replicates were
subtracted to standardize the samples. A standard curve was prepared by plotting the
average blank-corrected 595 nm measurement for each BSA standard vs. it
concentration in μg/ml. This standard curve was used to determine the protein concentration of each unknown sample.
NFĸB TransAMTM:
This assay is an ELISA–based kit that is able to detect and quantify
transcription factor activation. This assay includes a 96 well plate that has an
oligonucleotide for the NF-ĸB consensus-binding site attached to it. The activated NF-
ĸB in nuclear or whole cell extracts binds to the oligonucleotide. The primary antibody
95 is directed against the NF-ĸB p65 subunit and allows for the detection of the NF-ĸB complex. This primary antibody recognizes an epitope that is accessible only when
NF-ĸB is activated and bound to its target DNA. A secondary antibody conjugated to horseradish peroxidase (HRP) allows for spectrophotometric analysis. An NFĸB
TransAMTM kit was obtained from Active Motif (Carlsbad, California). The Complete
Lysis Buffer, Complete Binding Buffer, 1X Wash Buffer and 1X Antibody Binding
Buffer were prepared according to manufacturer’s protocol (available at www.activemotif.com). A 96 well microplate split into 12 strips of 8 wells was provided with the kit and used for this assay.
Step 1: Binding of NF-ĸB to its consensus sequence: 30 μl of Complete
Binding Buffer was added to each well. For sample wells, 1 μg of the protein sample was diluted in Complete Lysis Buffer for a total volume of 20 μl. For positive controls,
2.5 μg of the provided Jurkat nuclear extract diluted in 20 μl of Complete Lysis Buffer per well (1 μl of extract in 19 μl of Complete Lysis Buffer per well). For blank wells,
20 μl of Complete Lysis Buffer was placed in each well. For protein standard wells, 20
μl of the appropriate protein standard was diluted in Complete Lysis Buffer, and was added to each well being used. The adhesive cover was sealed on the plate and incubated for 1 hour at room temperature with mild agitation. The plate was then washed 3 times with 200 μl 1X Washing Buffer per well.
Step 2: Binding of primary antibody: 100 μl diluted NF-ĸB antibody was added to each well. The plate was covered and incubated for 1 hour at room temperature without agitation. The plate was then washed 3 times with 200 μl 1X Washing Buffer per well.
96 Step 3: Binding of secondary antibody: 100 μl HRP antibody was added to all
wells. The plate was covered and allowed to incubate for 1 hour at room temperature without agitation. The wells were then washed 4 times with 200 μl of 1X Washing
Buffer per well.
Step 4: Colorimetric reaction: 100 μl room temperature Developing Solution
was added to all wells. The samples were allowed to incubate for 2-10 minutes at room
temperature protected from direct light. The color was monitored until it turned
medium to dark blue. At this point, 100 μl of Stop Solution was added to each well.
The absorbances were then read at 450 nm with a reference wavelength of 655 nm.
Step 5: Calculation of results using the standard curve: The duplicate readings
were averaged and the optical density (OD) obtained from the zero standard was subtracted. The ODs for the standards against the quantity were plotted (ng/well), and the best-fit curve was established. This was used to quantify the amount of NF-ĸB in the samples.
Statistical Analysis:
Statistical analysis was performed using Sigma Stat statistical software version
2.0. Ranked sum tests with a student’s t-test were performed to statistically analyze the
PCR data, and to analyze TransAMTM data. Statistical p values of less than 0.05 were
considered significant.
97
RESULTS
3.1 INFLUENCE OF RESTRAINT STRESS ON NF-κB ACTIVATION IN
CUTANEOUS WOUNDS AS MEASURED BY THE QUANTIFICATION OF IκBα:
IκBα acts as an inhibitor of NF-κB. This protein joins with NF-κB in the
cytoplasm of the cell, thereby inhibiting its ability to translocate to the nucleus. A
stimulus resulting in the activation of NF-κB results in the phosphorylation of IκBα by
IκB kinases (IKKs), thereby targeting IκBα for ubiquitination and subsequent degradation. Once IκBα is degraded, a nuclear localization signal in the NF-κB complex is exposed. This allows NF-κB to translocate to the nucleus, where it binds to
NF-κB target genes [for reviews of NF-κB regulation see Li and Verma, 2002; Jobin and Sartor, 2000; Karin and Ben-Neriah, 2000]. One target gene for NF-κB is its
inhibitor (i.e. IκBα). A review by Baldwin (1996) reports that multiple NF-κB binding
sites are found in the promoter region of IκBα. It further reports that these sites up-
regulate gene expression in response to stimuli activating NF-κB (Baldwin, 1996).
This effectively allows NF-κB to promote the activation of its own inhibitor in a
feedback mechanism. These experiments utilized IκBα as a surrogate marker for NF-
κB activation. Mice were split into 2 groups. The first group underwent cycles of
restraint stress, while the second group was food and water deprived, as explained in
the materials and methods section. Mice were wounded, and the wounds were
harvested at 3, 6, 12 and 24 hours post wounding in order to analyze the expression of
98 IκBα (i.e. NF-κB activation) at the wound site. Wound samples, along with control tissue samples were homogenized, RNA was purified, cDNA was synthesized, and samples were subjected to quantitative real-time PCR to quantify IκBα gene expression.
The present studies illustrate no difference in IκBα expression at 3, 6, or 24 hours post wounding (figure 3.2). However, at 12 hours post wounding mice undergoing restraint stress experience a significant decrease in the expression of IκBα mRNA, compared to non-stressed control animals (p<0.05). Control mice experience peak IκBα expression at 12 hours post wounding, there is no such peak seen in the RST mice, as a matter of fact, their levels remain constant at all the timepoints analyzed. These data suggest that there is diminished NF-κB activation at 12 hours post-wounding (figure 3.2).
3.2 INLFUENCE OF ANDROSTENEDIOL ON THE ACTIVATION OF NF-κB
IN CUTANEOUS WOUNDS AS MEASURED BY THE QUANTIFICATION OF
IκBα:
Because we saw a stress-associated decrease in the activation of NF-κB, we wanted to determine whether or not pharmacological doses of AED could counteract this effect. The mice were split into 4 groups, 2 groups that underwent restraint stress,
1 receiving treatment with AED while the other received a vehicle control (VEH). The other 2 groups were non-stressed, with one receiving AED and the other receiving
VEH. The animals were treated at 3 days prior to wounding and 1 hour post wounding as described in the materials and methods section. Mice were wounded, and the wounds were harvested at 3, 6, 12 and 24 hours post wounding in order to analyze the
99 expression of IκBα (i.e. NF-κB activation) at the wound site. Wound samples, along
with control tissue samples were homogenized, RNA was purified, cDNA was
synthesized, and samples were subjected to quantitative real-time PCR to quantify IκBα
gene expression.
Although IκBα expression was not restored in stressed animals treated with
AED at 12 hours post wounding, treatment with AED did result in a significant increase in IκBα expression (i.e. NF-κB activation) at 24 hours post wounding regardless of
whether or not the animals underwent restraint stress (p<0.001) compared to vehicle
treated controls (figure 3.3). This suggests that treatment with AED did indeed enhance
the transcriptional activation of NF-κB at 24 hours post wounding. These data are of
particular interest because the vehicle treated stressed animals do not experience a peak
in their IκBα expression at any point during the first 24 hours post wounding, rather
they maintain an expression level approximating a 2 fold increase over healthy non-
wounded tissue. Treatment with AED allows these same animals to achieve a peak
IκBα expression nearly 4 times that high at 24 hours post wounding. By enhancing NF-
κB activation, AED will be able to activate the transcription of the pro-inflammatory
cytokines that are so important during the early phases of wound healing, including the
activation of the wound-healing cascade. This indicates a possible therapeutic role for
AED in stress-impaired wound healing.
100
3.3 INFLUENCE OF ANDROSTENEDIOL ON NF-κB ACTIVATION IN NON-
WOUNDED TISSUE:
The previous data indicated to us that AED was indeed capable of altering the
expression of IκBα (i.e. NF-κB activation), and ultimately the pro-inflammatory
cytokines important in the wound-healing cascade. The data led us to the question,
“how is AED able to alter these expressions at such early timepoints?” It led us to believe that perhaps treatment with AED was ‘priming’ the skin for some sort of attack,
such as wounding. To test this theory, we decided to look at the expression of IκBα in
non-wounded skin. The animals were split into 4 groups as described previously. The
4 groups were FWD/VEH, RST/VEH, FWD/AED, and RST/AED, as described in the materials and methods section. The animals were treated with AED or VEH, 3 days prior to wounding. Mice were anesthetized and immediately wounded using a 6.0 mm biopsy punch. This tissue that was created by the wounding process was taken at that time and processed for analysis. The tissue samples were homogenized, RNA was purified, cDNA was synthesized, and samples were subjected to quantitative real-time
PCR to quantify IκBα gene expression.
Our data indicate that healthy non-wounded tissue in stressed and non-stressed mice experienced an increase in IκBα RNA expression with treatment of AED. Figure
3.4 illustrates that treatment of stressed and non-stressed mice with AED caused an
increase in expression of IκBα in non-wounded skin compared with mice treated with
vehicle (p<0.05). VEH treated mice experienced similar quantities of IκBα expression
101 regardless of whether or not they had underwent restraint stress, indicating that restraint stress does not alter the expression of IκBα in healthy tissue, as there is no difference in the expression of IκBα in the FWD/VEH group and the RST/VEH group. The animals treated with AED experience a 2.5 fold increase in IκBα expression in non-wounded
tissue, compared to the VEH treated mice. This suggests that AED may be activating the NF-κB transcription pathway even before it is needed. This could act as a ‘primer’
and prime the skin to launch the inflammatory phase of healing as soon as wounding
occurs, ultimately resulting in a more efficient healing cascade.
3.4 INFLUENCE OF ANDROSTENEDIOL ON NF-κB ACTIVATION AS
MEASURED BY THE NUCLEAR LOCALIZATION OF p65:
Activation of NF-κB requires phosphorylation, ubiquitination and degradation of IκBα, its inhibitor. IκBα binds with NF-κB in the cytoplasm of the cell inhibiting its ability to translocate to the nucleus. Once IκBα is degraded, a nuclear localization
signal in the NF-κB complex is exposed. This allows NF-κB to translocate to the
nucleus, where it binds to NF-κB target genes [for reviews of NF-κB regulation see Li
and Verma, 2002; Jobin and Sartor, 2000; Karin and Ben-Neriah, 2000].
The previous data indicate to us that treatment with AED is indeed altering the
activation of NF-κB. We wanted to further analyze the mechanism through which GCs
block the transcription of pro-inflammatory cytokines, chemokines and growth factors
involved in the wound healing process, and AED restores their expression. To do this
102 we utilized a TransAMTM assay. This is an ELISA-based assay that allows us to detect
and quantify transcription factor activation. This kit contains a 96-well plate with an oligonucleotide containing an NF-κB consensus-binding site immobilized. The activated NF-κB within the nuclear extract binds to this oligonucleotide. An antibody against p65, a component of the NF-κB transcription factor, was then used to detect the
NF-κB complex bound to the oligonucleotide. A secondary antibody conjugated with horseradish peroxidase (HRP) was then used to allow for a colorimetric readout that can be quantified by spectrophotometry. This protocol allows us to detect the nuclear localization of activated NF-κB. We hoped that by analyzing samples from stressed and non-stressed animals treated with either AED or VEH, we would be able to determine whether or not activated NF-κB was able to successfully translocate to the nucleus and bind to the DNA in our various treatment groups.
For this experiment, animals were split into 4 treatment groups as described previously (FWD/VEH, RST/VEH, FWD/AED, and RST/AED). The animals were treated with AED or VEH, 3 days prior to wounding, and 1 hour and 3 days post wounding. The animals were wounded using a 3.5 mm biopsy punch, and the wounds were harvested at 12 hours, 24 hours, 48 hours, 3 days and 5 days post wounding. The nuclear extract protocol was then performed as described in the materials and methods.
This separated the nuclear and cytoplasmic fractions of the cells. The total protein was quantified using the Bradford assay, and from here the TransAMTM was performed.
This allowed us to analyze the amount of activated NF-κB present in the nuclear fraction of the cell.
103 The data represented in figure 3.5 indicate that nuclear localization of p65
experienced a significant decrease during the first 24 hours post wounding in the
FWD/VEH control animals (p<0.05). This was followed by a return to its baseline tissue expression of nuclear p65 between 24 and 48 hours post wounding, which remained at that level over the next 4 days. Similar sudden drops in nuclear localization were not seen in other groups. Non-wounded tissue from animals in the
FWD/AED treatment group experienced significantly lower nuclear localization of p65, compared to FWD/VEH control tissue. Restraint did not significantly influence the nuclear localization of p65 during the early timepoints, however by 24 hours post
wounding, both the FWD/AED group and the RST/VEH group experienced
significantly higher nuclear p65 compared to the FWD/VEH control samples (p<0.05).
At 5 days post wounding, RST/VEH samples experienced significantly less nuclear p65
than did the FWD/VEH control samples (p<0.05). Treatment with AED prevented
these effects of RST seen at 5 days post wounding.
DISCUSSION
The results from the real time PCR studies suggest that stress alters the kinetics of NF-κB activation in the wounds of mice, and that this alteration can be offset to some degree by treatment with AED. Although the expression of IκBα (i.e. NFκB activation) was diminished by stress at 12 hours, we didn’t see a restoration of IκBα in the restraint stressed animals until 24 hours post wounding. This could be for several reasons, one theory is that between the 12 and 24 hours harvest the animals undergo one more cycle of restraint. This extra cycle of restraint may play a role in enhancing
104 the effects of AED in RST mice at 24 hours. By undergoing one more night of
restraint, these animals will have another opportunity for their HPA axis to stimulate the increased production of glucocorticoids, thereby further inhibiting their ability to launch an inflammatory response. Another possible reason for the change between 12 and 24 hours is due to the change in the proportion of various cell types present at the wound site. For example, upon wounding, neutrophils are the first inflammatory cells to arrive at the scene. By 24 hours, the cellular profile is changing, and there is an increase in the proportion of macrophages at the wound site (Clark, 1996). It is probable that AED affects these different cells in different ways. Previous studies in our lab have shown that AED blocked the suppressive effect of glucocorticoids on IL-1 and TNF-α production from macrophages. This indicates that AED is likely able to
restore the inflammatory phase of the wound healing cascade, in part, through its affect
on macrophages.
There is an increase in IκBα RNA expression seen in healthy tissue samples of
non-stressed and stressed mice even in the absence of wounding (if treated with AED).
This indicates that AED has an affect on the cells present in the healthy tissue even
before wounding and causes an increase in NF-κB activation. The data show that
treatment of stressed and non-stressed mice with AED caused an increase in expression
of IκBα in non-wounded skin compared with mice treated with vehicle (p<0.05). This
indicates that wounding isn’t necessary to activate NF-κB in animals treated with AED.
The data suggest that AED may be activating the NF-κB transcription factor even
before it is needed. This could offer a mechanism for priming the skin to launch the
inflammatory phase of healing as soon as wounding occurs.
105 The TransAMTM data did not correspond with our anticipated results. Our
previous data had shown an initial RST-mediated suppression of pro-inflammatory
gene expression, and we did not see an early decrease in nuclear localization of p65 associated with stress, in contrast we saw a decrease in p65 nuclear localization in the
FWD/VEH group. It is interesting to note that RST did result in diminished p65 nuclear localization at 5 days post wounding, and this was restored by treatment with
AED. This diminished localization of p65, could be resulting from the early stress- associated alterations in the wound-healing cascade. Overall, our TransAMTM data
indicate we must further pursue the transcriptional mechanism behind the RST-
associated suppression of early gene expression during wound healing. One possible
explanation for the discrepancy between the anticipated results and the actual data is the
mechanism through which IκBα exerts its effect. The decrease in nuclear p65 in the
FWD/VEH group at 24 hours post wounding, could be due to the enhanced expression
of IκBα at earlier timepoints. The increase in the expression of IκBα will result in a
feedback mechanism that inhibits the activation of NF-κB, thus explaining the
diminished nuclear p65 at 24 hours post wounding.
The TransAMTM data did provide some clues as to the mechanism through
which AED treatment exerts its effects. We were able to establish that stress is not
impairing the ability of NF-κB to translocate to the nucleus. We further were able to
determine that AED did not alter NF-κB translocation. This suggests that the
stress/glucocorticoid impaired wound healing is mediated through some other
mechanism. The possible mechanisms could include GCs causing the blockade of the
NF-κB promoter region. Another possibility is that GCs bind to the transcriptional
106 apparatus and allow an inhibitor to bind and stop NF-κB activation. At this point
further intracellular studies and other protocols such as ChIP assays will be necessary to
elucidate the mechanism by which glucocorticoid-associated alterations in the
activation of NF-κB are augmented by treatment with AED.
If glucocorticoids do not affect NF-κB by preventing the nuclear localization of
p65, how does it suppress its activation? Likewise, if AED is not augmenting p65
localization how is it enhancing the transcription of NF-κB controlled genes? To get to
the possible answers to these questions it is important to take a closer look at the
general model for transcription initiation as it is controlled by the activated
glucocorticoid receptor, by NF-κB and by AED (through activated androgen receptors).
Like many DNA-bound transcriptional activators, the GRE-bound GR utilizes
CREB-binding protein (CBP) (which is structurally and functionally related to p300) to
drive assembly of the transcription initiation complex at GR-sensitive promoters (Kino
et al. 1999). CBP/p300 functions as a tether between the GR and the transcriptional
machinery which includes chromatin remodeling enzymes, Mediator, general
transcription factors, and RNA polymerase II [for reviews see: Vo and Goodman, 2001;
Chan and La Thangue, 2001; Schiltz et al. 1999; Roeder, 2005; Deng et al. 2003]. As the activator of transcription, GR serves as the cornerstone or signal-locater where the transcription initiation complex is assembled – at the promoter of GC-responsive genes
(Schoneveld et al. 2004). The following sequence describes the multiple co-activators
involved in GC-driven transcription:
107 Step 1: GR binds to DNA sequences upstream of a target gene – the GRE (La Baer and
Yamamoto, 1994).
Step 2: the DNA-bound activator recruits and binds CBP/p300, which has intrinsic
histone acetylase (HAT) activity (Kino et al. 1999; Chan and La Thangue, 2001).
Step 3: CBP/p300 acetylates histones in the vicinity of the promoter thus marking and
targeting them for chromatin remodeling (Vo and Goodman, 2001; Chan and La
Thangue, 2001; Schiltz et al. 1999).
Step 4: CBP/p300 tethers a large modular complex called SWI/SNF, which remodels
the chromatin where CBP/p300 marked. Remodeling by SWI/SNF (acetylation,
methylation, phosphorylation, and ubiquitination) removes histones thereby
unwrapping DNA in the promoter region (Yudkovsky et al. 1999).
Step 5: together the DNA-bound activator and CBP/p300 serve as a magnet or anchor point for the large co-activator complex called MEDIATOR. Mediator is modular in
nature, sharing and switching subunits depending on the nature of the primary activator
(Roeder, 2005; Boeger et al. 2005; Chadick and Asturias, 2005).
Step 6: In an activating fashion, Mediator enhances binding of RNA polII to the
promoter – specifically it places TFIID on the promoter (Wang et al. 2005).
Step 7: Binding of TFIID causes a large distortion of the DNA at the TATA box and
promotes assembly of the GTFs along with RNA polII to form the complete transcription initiation complex (Gangloff et al. 2001). Specifically, binding of TFIID serves as the landmark for an active promoter. Mediator should be thought of as a
bridge from the activator to the promoter, positioning the general transcription factors
at the correct promoter downstream from the activator sequence.
108 Step 8: After formation of the transcription initiation complex, TFIIH, which contains
DNA helicase activity, unwraps the double strand and provides access to the
transcriptional start point of the template strand. At this point, the RNA polymerase
stays at the promoter until it undergoes a conformational change and is released to
begin transcribing the gene. This conformational change is initiated by phosphorylation
of the C-terminus of RNA polymerase (also performed by TFIIH) (Spangler et al. 2001;
Watanabe et al. 2000). This change enables the polymerase to disengage from the
cluster of general transcription factors, tighten its interaction with DNA, acquire new accessory proteins, and then transcribe for long distances without dissociating.
Still, how do glucocorticoids TURN OFF gene expression? The preceding section describes how glucocorticoids turn on gene expression. However, inflammatory
gene expression is inhibited by GCs, and many of the genes that are regulated by GCs
do not contain an identifiable GRE. Thus, what we have described above does not
satisfactorily explain how GCs can delay tissue repair. Clarifying this issue is one of the
goals of these studies.
As mentioned in the introduction to this chapter, the answer to how GCs can
simultaneously suppress transcription of many inflammatory genes began to appear in
1995 when two publications presented data that GCs could interfere with nuclear factor
kappa B (NF-κB) activity (Scheinman et al. 1995; Auphan et al. 1995). It is worth
mentioning again that those two studies showed that GCs could transactivate an
inhibitor of NF-κB activity - - GCs induced the transcription of IκBα, which then
sequestered NF-κB in the cytoplasm and prevented it from translocating to the nucleus
and inducing gene activation. This was a logical explanation for the broad spectrum of
109 cytokine suppression mediated by GCs (Li and Verma, 2002). However, several
subsequent publications showed that, in some cell types, IκBα synthesis was not
necessary for NF-κB inhibition by GC (Adcock et al. 1999; Wissink et al. 1998).
Additionally, the glucocorticoid receptor antagonist, RU486, was also capable of
inhibiting NF-κB to some extent (Hofmann et al. 1998). Together these observations
suggest that de novo gene transcription by GCs is not required for NF-κB inhibition.
So, how do glucocorticoids turn off NF-κB? Our proposed answer: First, it is
known that DNA binding of the GR is not a pre-requisite for GR binding to CBP/p300
(Kino et al. 1999). Second, together with Mediator, CBP/p300 participates in a broad
range of transcriptional regulatory systems including both the activated GR and NF-κB
(Roeder, 2005; Boeger et al. 2005; Wang et al. 2005). Therefore, we hypothesize that the co-activator complex (involving both CBP/p300 and Mediator) acts as a conduit, binding simultaneously to various transcriptional enhancers or repressors (i.e., GR and
NF-κB) and thus integrates information from various sources. More specifically,
CBP/p300 and Mediator contribute to the normal integration of multiple incoming signals destined to modulate the behavior of a given promoter. For example, if both GR
and NF-κB are activated in the same cell, CBP/p300 may ultimately be prevented from directing the assembly of the transcription initiation complex at either GR- or NF-κB- responsive genes. In effect, both signals would be muted. Investigation of such a model is the focus of current studies ongoing in the laboratory.
110
(1) (2) Cholesterol Pregnenolone Progesterone
(3) (3) (2) 17α-Hydroxypregnenolone 17α-Hydroxyprogesterone
(4) (4)
(2) (8) Dehydroepiandrosterone Androstenedione Estrone
(6) (5) (5)
(2) (8) Androstenediol Testosterone Estradiol
(7)
Dihydrotestosterone
(1) 20,22-desmolase (2) 3β-hydroxysteroid dehydrogenase and Δ5Δ4-isomerase (3) 17α-hydroxylase (4) 17,20-desmolase (5) 17-ketoreductase (6) 17β hydroxysteroid dehydrogenase (7) 5α-reductase (8) aromatase
Figure 3.1 PATHWAYS FOR TESTICULAR ANDROGEN AND ESTROGEN BIOSYNTHESIS (Modified from Braunstein, 2001)
111 Figure 3.2: Influence of Stress on I kappa B alpha Expression
14 12 10 8 FWD/VEH 6 RST/VEH 4
Control Tissue 2
N-fold Difference over 0 3 Hours 6 Hours 12 Hours 24 Hours Time Post Wounding
Figure 3.2: Influence of Stress on IκBα Expression in Cutaneous Wounds: Mice were treated and wounds were harvested as described in the materials and methods section. Expression of IκBα RNA in non-wounded skin from the FWD/VEH group was assigned the value of 1 to represent the level anticipated in tissue not involved in an inflammatory reaction. Therefore, for comparative analysis of the effects of RST treatment, expression of IκBα in the experimental samples is expressed relative to this reference point. Data are expressed as group means within a 95% confidence interval.
There is a significant effect of RST treatment at 12 hours post injury. While the expression of IκBα RNA was up-regulated at 12 hours in non-stressed mice, mice undergoing restraint stress had no such increase in IκBα RNA at 12 hours post wounding (p<0.021). Restraint mice actually experience a significant decrease in the quantity of IκBα expression at 12 hours post wounding compared to the control animals.
112 Figure 3.3: Influence of Stress and AED on IkBa Expression
14 12 10 FWD/VEH 8 RST/VEH 6 FWD/AED 4 RST/AED
Control Tissue 2
N-fold difference over 0 3 Hours 6 Hours 12 Hours 24 Hours Time Post Wounding
Figure 3.3: The Influence of AED on Expression of IκBα in Cutaneous Wounds:
Mice were treated as described previously in the materials and methods section.
Expression of IκBα RNA in non-wounded skin from the FWD/VEH group was
assigned the value of 1 to represent the level anticipated in tissue not involved in an
inflammatory reaction. Therefore, for comparative analysis of the effects of RST
and/or AED treatment, expression of IκBα in the experimental samples is expressed
relative to this reference point. Data are expressed as group means within a 95%
confidence interval. Treatment of mice with androstenediol did not restore the stress-
associated delay in healing seen at 12 hours post wounding, however statistical analysis performed as described in the materials and methods section, reveal a significant effect of AED treatment at 24 hours post wounding (p<0.001). The mice treated with AED experienced greater expression of IκBα expression compared to vehicle treated controls
(both stressed and non-stressed).
113 Figure 3.4: Influence of Stress and AED on IkBa Expression in Healthy Tissue
5
4 FWD/VEH 3 RST/VEH 2 FWD/AED RST/AED 1
0 N-fold Increase over Control Healthy Tissue
Figure 3.4: Influence of AED on IκBα Expression in Non-wounded skin: Mice
were treated as described previously. Expression of IκBα RNA in non-wounded skin
from the FWD/VEH group was assigned the value of 1 to represent the level
anticipated in tissue not involved in an inflammatory reaction. Therefore, for
comparative analysis of the effects of RST and/or AED treatment, expression of IκBα
in the experimental samples is expressed relative to this reference point. Data are
expressed as group means within a 95% confidence interval. Treatment of mice with
androstenediol (both stressed and non-stressed) resulted in increased expression of
IκBα in non-wounded skin compared with mice receiving vehicle treatment (p<0.05).
Healthy, non-wounded tissue from mice receiving AED treatment experienced a 2.5
fold increase in IκBα expression compared with VEH treated animals. These data
further indicate that restraint stress does not alter the expression of IκBα in non-
wounded tissue, as there is no difference in the expression of IκBα in the FWD/VEH
group and the RST/VEH group.
114
Figure 3.5: Influence of Stress and AED on Nuclear Localization of p65
14 12 10 FWD/VEH-N 8 RST/VEH-N 6 FWD/AED-N 4 RST/AED-N 2 0
Concentration (ng/well) Tissue 12 24 48 3 Days 5 Days Hours Hours Hours Time Post Wounding
Figure 3.5: Influence of Stress and AED on Nuclear Localization of p65: Mice were split into 4 treatment groups as described previously in the materials and methods section. They were wounded and the wounds were harvested and treated as also described previously. The data show that the FWD/VEH samples have a decrease in nuclear localization of p65 during the first 24 hours post wounding (p<0.05), followed
by a return to baseline tissue expression of nuclear p65 by 48 hours post wounding.
Similar drops were not seen in other groups. Restraint did not significantly influence
the nuclear localization of p65 during the early timepoints, however by 24 hours post wounding, both the FWD/AED group and the RST/VEH group experienced significantly higher nuclear p65 compared to the FWD/VEH control samples (p<0.05).
By 5 days post wounding, RST/VEH samples experienced significantly less nuclear p65 than did the FWD/VEH control samples (p<0.05). This was prevented by treatment with AED (RST/AED). Error bars indicate the standard error.
115
CHAPTER 4
GENERAL DISCUSSION: THE INFLUENCES OF ANDROSTENEDIOL ON
CUTANEOUS WOUND HEALING
DISCUSSION
Wounding can impair the structure and function of any given tissue whether skin, muscle, or bone. If the injury is substantial, the overall health of the individual can be compromised. Therefore, a healing cascade is set in motion at the time of injury in an attempt to restore the original properties to the tissue (Singer and Clark 1999;
Waldorf and Fewkes 1995). This cascade is quite complex and has been separated into three overlapping phases including: (a) an inflammatory phase comprised of hemostasis or blood clotting and migration of inflammatory cells to the wound; (b) a proliferative phase involving migration and proliferation of keratinocytes, fibroblasts and endothelial cells, leading to re-epithelialization, neovascularization, and granulation tissue formation; and (c) a long remodeling phase involving extracellular matrix maturation aimed at restoring tissue structure and function. When the stages of repair proceed normally, wounds heal without serious consequences. However, the timing of each event during the phases of healing is important, as each component is dependent on the
116 one that came before. Therefore, influences at any of these stages could impact the
healing process and delay wound closure.
In other words, any substantive alterations or modifications in the early
inflammatory phase of healing can result in changes throughout the entire process.
This is clearly evident in the delayed healing kinetics of diabetics (Sweitzer et al. 2006)
and the elderly (Gilliver et al. 2006). Alternatively changes in the inflammatory phase
can also be manifest as enhanced wound closure, as seen in wounds treated with
specific growth factors, such as PDGF (Attinger et al. 2006). We believe that
behavioral stress is one of those influences that can alter healing through its impact on
the inflammatory phase of healing. For the past decade, studies from our group and
others have focused on the effects of stress on wound healing paying particular regard
to the influences during the first few days after injury.
As we have detailed in earlier chapters, studies in both animals and humans have shown that psychological stress (e.g., emotional distress, depression, anxiety, helplessness) can delay the closure of small cutaneous wounds by several days (Derr
1981; Kiecolt-Glaser et al. 1995; Marucha et al. 1998; Kiecolt-Glaser et al. 1998;
Padgett et al. 1998; Glaser et al. 1999; Rojas et al. 2002; Mercado et al. 2002a;
Mercado et al. 2002b; Broadbent et al. 2003; Sheridan et al. 2004; Detillion et al. 2004;
Ebrecht et al. 2004; Horan et al. 2005; Glasper et al. 2005). The data from each of these
experiments suggest that early events in wound healing, particularly during the
inflammatory response, represent a critical period in the overall healing process. We are
just beginning to understand how stress influences the inflammatory phase of wound healing.
117 Psychological stressors activate a body-wide set of physiologic adaptations mediated in part by the hypothalamic-pituitary-adrenal axis. The hypothalamus coordinates responses to environmental stressors through nerves and hormones [for reviews, see Buijs and Van Eden 2000; Sawchenko et al. 1996]. For example, corticotrophin-releasing hormone is secreted from the paraventricular nucleus of the hypothalamus into the hypophyseal portal blood supply and subsequently stimulates the expression of adrenocorticotropic hormone (ACTH) in the anterior pituitary gland.
ACTH then circulates in the bloodstream to the adrenal glands where it induces the expression and release of glucocorticoid hormones (Webster and Sternberg, 2004;
Tsigos and Chrousos, 2002). These hormones affect cardiovascular, renal function and metabolism and act together with the nervous system to adjust our responses to the environment. As one of the ‘core stress responses’ originally described by Selye in
1936 (Selye, 1936), the acute production of glucocorticoid hormones from the adrenal cortex stimulates the metabolism of glucose to provide for energy to flee or combat an immediate threat. However, when chronically activated, the HPA axis can cause deterioration in general health and worsen existing diseases.
Glucocorticoids can regulate a wide variety of immune cell functions. For example, they modulate cytokine expression, chemokine expression, adhesion molecule expression and trafficking, proliferation, differentiation, and effector function of many cells of the immune system [reviewed in Elenkov and Chrousos, 2002; Ashwell et al.
2000; Russo-Marie, 1992]. Their anti-inflammatory activity is so powerful that glucocorticoids have been used clinically for this purpose since the middle of the last century. However, the use of exogenous glucocorticoids has been associated with
118 increased risk of wound contamination and delayed healing of open wounds.
Glucocorticoids produce these effects by interfering, not only with inflammation, but
also with fibroblast proliferation, collagen synthesis and degradation, angiogenesis, wound contraction, re-epithelialization, and remodeling (Beer et al. 2000; Lee et al.
2005).
Glucocorticoids, whether exogenously administered by a physician or endogenously elevated due to psychological stress, regulate the expression of various genes at the wound site that encode key players in each of these wound repair processes. For example, proinflammatory cytokines (IL-1 and TNF-α), growth factors
(KGF, TGF-β and PDGF), and re-modeling enzymes (macrophage- and fibroblast- derived matrix metalloproteinases) are targets of glucocorticoid action in wounded skin
(Lee et al. 2005; Brauchle et al. 1995). More specifically, from in vitro studies, Snyder and Unanue (1982) demonstrated that hydrocortisone reduced the production of IL-1 by phorbol myristate acetate (PMA)-stimulated murine peritoneal macrophages. Similarly, dexamethasone has also been shown to diminish the rate of TNF-α gene transcription in ex-vivo murine macrophages (Beutler et al. 1986). In vivo, and paralleling these findings, Hübner et al. (1996) demonstrated that glucocorticoid-treatment of mice reduced induction of IL-1 and TNF after injury. This effect was associated with reduced infiltration of inflammatory cells into a wound. As a consequence, re- epithelialization was delayed and granulation tissue formation was impaired. It is not just the pro-inflammatory cytokines that are affected by glucocorticoids. Beer, Fassler, and Werner (2000) demonstrated that keratinocyte growth factor, TGF-β1, TGF-β2 and
TGF-β3 and their receptors, PDGFs and their receptors, tenascin-C, stromelysin-2,
119 macrophage metalloelastase, and enzymes involved in the generation of nitric oxide are targets of glucocorticoid action in wounded skin. Together, these findings show that the anti-inflammatory steroids inhibit wound repair at least in part by influencing the expression of these key regulatory molecules.
To bring this back full-circle, multiple experiments suggest that it is the stress- induced glucocorticoids that bear the responsibility for impaired wound healing. For example, experimentally, the circadian pattern of corticosterone synthesis can be disrupted by restraint stress of mice (Hermann et al. 1994). Disruption of the circadian pattern by restraint results in significantly elevated circulating corticosterone in mice.
Using this model, it was demonstrated that wounds on mice subjected to restraint stress healed slower than those on control animals (Padgett et al. 1998). In addition, the production of inflammatory cytokines, the infiltration of inflammatory cells, and the production of various growth factors were depressed by restraint (Mercado et al. 2002a;
2002b). Owing to the importance of glucocorticoids, in animals treated with various glucocorticoid receptor antagonists such as RU486 and RU40555, many of the influences of stress could be prevented or reversed. For example, in restraint-stressed mice treated with RU486, wound IL-1β mRNA levels were restored to normal control levels (Mercado et al. 2002a) and this restoration of inflammatory gene expression correlated with restoration of overall healing kinetics (Padgett et al. 1998).
Thus, when the stages of repair proceed without substantive disruption, wound healing progresses without significant negative consequences. However, because the coordination of the wound-healing cascade begins with inflammatory gene expression, a negative event at this stage can potentially impact the overall healing process and
120 delay wound closure. Psychological or behavioral stressors have been shown to mediate
such an undesirable effect, in part, through the anti-inflammatory influences of glucocorticoid hormones.
Therefore, one might jump to the conclusion that by blocking glucocorticoid function with the readily available glucocorticoid receptor antagonist, RU486, any effects of ‘stress’ on wound healing could be prevented. However, the clinical
usefulness of RU486 is limited both by its physiological side effects as a progesterone
receptor antagonist and for ethical reasons because of its actions as a pharmacologic
abortificant. This has led to the search for something that can work by a similar
mechanism, but without the physiological and ethical side effects.
Recent reports from our lab and others that characterize the immune-regulatory
abilities of DHEA and AED suggest that these hormones function in vivo as counter-
regulators of glucocorticoid function. Riley (1981) first promoted an anti-
glucocorticoid hypothesis to describe the function of DHEA. Mice subjected to
"rotation stress" experienced increased serum corticosterone levels and developed
thymic involution and reduced resistance to transplantable tumors. These involutional
effects of stress were antagonized by the s.c. injection of 1.0 mg/animal of DHEA (May
et al. 1990). Subsequent data from our laboratory have shown that AED (a metabolite
of DHEA) prevented thymic and splenic involution associated with restraint stress.
During serious illness there is a shift in pregnenolone metabolism away from DHEA
and AED production to that of the glucocorticoids (Parker et al. 1985a; 1985b; Stahl et
al. 1992). This typically leads to thymic involution as well as a generalized
immunosuppression. Thus, it was reasonable to speculate that DHEA and AED could
121 act to protect the host by counteracting glucocorticoid-mediated immune suppression.
Since Riley's initial studies, the antiglucocorticoid properties of DHEA have been further expanded to show that, in vivo, DHEA counter-regulated glucocorticoid suppression of cytokine secretion from macrophages and lymphocytes (Daynes et al.
1990; Suzuki et al. 1991; Blauer et al. 1991). However, these data also revealed that
DHEA failed to antagonize GC activity in vitro. Subsequent data show that, AED counterbalanced GC function in vitro (Padgett and Loria, 1994; Padgett and Loria,
1998). These observations provided us the rationale for comparing and contrasting the in vivo functions of AED where the effects of glucocorticoids are relatively well- established.
Therefore, the studies presented herein were designed to test the hypothesis that, if AED can improve the inflammatory immune response and counterbalance glucocorticoid function, AED would counteract the glucocorticoid-mediated immunosuppressive effects of stress during wound healing. In sum, the data support this hypothesis. For example, stressed animals (RST/VEH) experience delayed healing, however treatment of stressed animals with AED (RST/AED) healed with rates similar to the unstressed, vehicle treated controls (FWD/VEH). These data show that treatment with pharmacological levels of AED prevented the stress-induced delay in wound closure. Because it was determined that AED could restore stress-impaired healing, it was decided to determine the mechanism through which AED is able to enhance stress- impaired healing.
During wound healing, chemokines, cytokines, and growth factors are expressed in overlapping cascades. Upon wounding the first act is to stop the blood
122 flow. The platelets and cells that are present immediately upon wounding play a
critical role in this. They release activators of the coagulation pathway, cytokines and
growth factors. Neutrophils are also present almost immediately after wounding. Due to their high abundance in circulation, they are one of the first cell types to reach the
wound site. Upon arrival at the wound site, the neutrophils release chemokines, cytokines, and growth factors including IL-1 and TNF-alpha at the site to help initiate the inflammatory response. These cytokines play a major role in initiating the subsequent events in wound healing. They have been shown to activate the transcription of numerous other cytokines, chemokines and growth factors, via activator protein-1 (AP-1) and nuclear factor kappa B (NF-κB). Studies show that there is high
TNF-α expression at the hyperproliferative epithelium by the keratinocytes and infiltrating neutrophils (Hübner et al. 1996). This TNF-α stimulates the keratinocytes at the hyperproliferative epithelium to release Macrophage chemoattractant protein 1
(MCP-1) (Li et al. 2000).
MCP-1 plays a vital role in the recruitment of macrophages to the wound site.
They are stimulated by pro-inflammatory cytokines (i.e. IL-1) to produce a large
number of growth factors involved in the wound healing process. One such growth
factor that is produced by macrophages is keratinocyte growth factor (KGF). This
growth factor plays a role in keratinocyte proliferation and migration, resulting in re-
epithelialization. Another growth factor produced by macrophages is platelet derived growth factor (PDGF). It plays a role in augmenting the proliferation of fibroblasts and the extracellular matrix. It also induces myofibroblast switch in fibroblasts and results in the contraction of the collagen matrices (Heldin and Westermark, 1999; Clark,
123 1993). This wound-healing cascade is highly interdependent, such that stress-
associated alterations in the early phases and factors of wound healing will ultimately have an affect on the later phases and factors of healing and ultimately, the integrity of
the wound.
Studies by Mercado et al. examined the effects of stress on the kinetics of
certain factors involved in the healing process. The results indicate that IL-1β and
KGF-1 mRNA are significantly lower at one day post wounding compared to controls,
while IL-1α and IL-1β mRNA were both significantly higher at 5 days post wounding.
Together, these data indicated a stress-induced delay in the kinetics of inflammatory
gene expression of approximately 3 days correlating with the three-day delay in wound
closure. When treated with RU486, the expression of IL-1β at 24 hours post wounding
was restored to control levels (Mercado et al. 2002a). Because the pro-inflammatory
cytokines are so important to the wound healing cascade, it was determined that if
stress was altering these cytokines, perhaps the mechanism through which AED was
able to restore healing was by restoring the expression of these important inflammatory
factors. To test this, the animals were wounded and the wounds were harvested at
different time-points after injury. RNA was extracted from the wounds and, because of
their importance during the early inflammatory phase of healing the samples were
analyzed for the expression of RNAs for IL-1α, IL-1β, MCP-1, PDGF, and KGF.
IL-1α was found to be below detectable limits in healthy and wounded skin of
CD1 mice. The lack of expression of IL-1α in our model differs somewhat from that
previously published in the literature. Beer et al. found that IL-1α was expressed in
non-wounded skin, and upregulated after wounding, with a peak at 15-72 hours post
124 wounding (2000). Our results did not detect expression of IL-1α in non-wounded skin, nor did we see an up-regulation upon wounding. Primer design and probe analysis showed no technological failure. Furthermore, our primer and probe set was satisfactory for detection of IL-1α RNA in LPS-activated mouse macrophages (data not shown). The most logical explanation for the apparent discrepancy is due to the fact that we sampled the wounds for IL-1α expression during the first 24 hours whereas
Beer et al. provide expression kinetics focusing on days 2, 3, and 5 post wounding.
However, we have no explanation for the lack of IL-1α RNA in non-wounded skin as previously reported.
In contrast to the alpha isoform of IL-1, the data show that IL-1β was up- regulated within 3 hours of wounding and was elevated more than 1000 fold 24 hours post wounding in control mice. Although IL-1β was expressed above background in wounds of RST animals, RNA for this pro-inflammatory cytokine in the wounds of
RST/VEH animals was 83.7% lower than the FWD/VEH group 24 hours after injury
(p< 0.05). As it did for wound closure, treatment of RST animals with AED ameliorated the suppressive influence of restraint. IL-1β RNA was 3.5 fold higher in wounds from the RST/AED group at 24 hours as compared to wounds from RST/VEH animals (p<0.05). Moreover, the expression of IL-1β in the RST/AED group did not differ statistically from the unstressed control group. To summarize, our results indicate that IL-1β is up-regulated upon wounding, however stressed (RST) animals experienced levels significantly lower than the controls group. Treatment of stressed animals with AED was capable of restoring IL-1β expression to levels approximating
125 that of the control group. These stress and glucocorticoid results agree with what is
found in the literature (Mercado et al. 2002a; Beer et al. 2000).
MCP-1 is a chemotactic cytokine expressed by various cells during wound healing. MCP-1 is expressed almost exclusively during the first week after wounding,
and plays an important role in attracting macrophages to the wound site. Upon
wounding, MCP-1 gene expression is induced in surviving keratinocytes at the wound
margin and by newly arriving macrophages (Gibran et al. 1997). Thus, the gene expression pattern of MCP-1 should be expected to closely follow that of IL-1β. Our
results are in agreement with these expectations; wounding induces MCP-1 expression.
However, restraint stress had no significant suppressive effect on its expression during
the first 24 hours after injury. In contrast, RST enhanced MCP-1 expression at 6 hours post wounding (p<0.05). However, AED treatment returned MCP-1 expression to
levels approximating that of the control group at 6 hours. By 12 hours post wounding,
MCP-1 has returned to levels approximating the control levels. The early stress-induced
increase in MCP-1 may play a role in altering the kinetics of the healing wound. As it
has been stated before, any change in the early inflammatory phase can impact the
overall integrity of the healing process. MCP-1 expression peaks between 24 and 36
hours post wounding, so future studies looking at MCP-1 should evaluate timepoints
later than those observed in these studies. The data suggest that stress has little effect
on MCP-1 expression at the timepoints we looked at, indicating that stress may alter
expression in a cell specific manner. The difference between IL-1β and MCP-1 could
also be due to variable regulation by transcription factors.
126 KGF is a mitogen for keratinocytes that is critical to their migration during re- epithelialization (Rubin et al. 1989; Pierce et al. 1994; Werner et al. 1994). KGF is produced by fibroblasts, microvascular endothelial cells and smooth muscle cells
(Smola et al. 1993; Winkles et al. 1997). It is a potent growth factor for skin keratinocytes, and one of the major factors playing a role in tissue repair following skin injuries (Marchese et al. 1995; Werner, 1998.) Topical application of KGF has been shown to improve re-epithelialization in wound healing models (Pierce et al. 1994; Wu et al. 1996). Our data did not indicate a stress-associated difference in KGF expression at any timepoint observed. However, there was a stress-associated trend towards enhanced KGF expression that was not altered by AED treatment. Future studies incorporating a higher number of animals may help elucidate the effect of stress on
KGF. It would also be beneficial to look at later time points in healing as Beer et al. found that their was a glucocorticoid-associated decrease in Balb/c mice expression of
KGF at 3 days post wounding (2000). It is likely that we were looking at a timepoint that was too early in the wound-healing cascade to see a difference in KGF. Mercado et al. did see a stress-associated decrease in KGF expression at 24 hours post wounding
(2002a). These differences could be due to the mice utilized in these experiments, their model utilized SKH-1 female mice, while ours used CD-1 male mice. Overall, a higher number of subjects and more timepoints need to be studied, in order to truly elucidate the role of stress and AED on KGF expression in our current model.
Platelet derived growth factor (PDGF) is involved in granulation tissue formation. It is a mitogen for mesenchymally derived cells, and a chemokine for immune cells migrating into wounds (Heldin and Westermark, 1996; Werner and
127 Grose, 2003). PDGF augments the proliferation of fibroblasts and the extracellular matrix. It also induces myofibroblast switch in fibroblasts and results in the contraction of the collagen matrices (Heldin and Westermark, 1999; Clark, 1993). Experimental and clinical studies indicate that treatment with PDGF is beneficial for wound healing disorders and necessary for normal wound repair (Heldin and Westermark, 1999 and
Attinger et al. 2006). Our data indicate that RST causes a decrease in PDGF expression at 12 and 24 hours after wounding. These findings are consistent with the findings of other studies (Beer et al. 2000). Our study went on to show that treatment with AED did not restore PDGF expression at the 12-hour time point, however AED treatment did restore PDGF expression 24 hours post wounding. This is probably due to the changing population of cells present at the wound site. Because PDGF is considered to be beneficial for wound healing disorders and necessary for normal repair (Heldin and
Westermark, 1999), the restoration of PDGF by AED likely plays a role in the AED-
associated enhanced wound healing in stressed mice.
Our data indicate a possible therapeutic modality for wound healing. The
restoration of stress-impaired IL-1β expression by treatment with AED, along with the subsequent restoration of PDGF expression indicate a mechanism through which AED is acting to restore stress-impaired wound healing. We can hypothesize that AED
treatment will further help to restore the production of other cytokines that are induced
by IL-1β, but diminished by stress. Future studies will be focusing on AED’s
mechanism of action more closely.
Our lab is particularly interested in the numerous cytokines and growth factors regulated by the transcription factor nuclear factor kappa B (NF-κB) because there are a
128 number of inflammatory genes expressed in keratinocytes, neutrophils, macrophages,
fibroblasts, and endothelial cells that are induced by NF-κB. These include the genes that encode for M-CSF, G-CSF, GM-CSF, IL-1, TNF-α, IL-6, MCP-1, IL-8 (a.k.a.,
KC), IP10, and nitric oxide synthase. Thus, NF-κB plays a central role in coordinating
gene expression during the early inflammatory stages of wound healing. Our findings
up to this point led us to begin investigating the ability of GCs and AED to modulate
NF- κB transcriptional initiation.
In vitro studies in our lab suggest that AED may prevent GC-mediated
inhibition of NF-κB activity (data not shown). Therefore, we hypothesized that AED
would block the stress-mediated inhibition of NF-κB activation in our mouse model of
wound healing. In other words, AED would antagonize glucocorticoid-mediated
inhibition of NF-κB transcriptional activation. To test this hypothesis, we quantified
the expression of IκBα as a surrogate marker for NF-κB activation as NF-κB induces
the expression its own inhibitor IκBα. The studies presented in Chapter 3 indicate that
stress diminished the IκBα RNA expression, suggesting that there was diminished
activation of NF-κB. Whereas IκBα was up-regulated at 12 hours in non-stressed mice,
mice undergoing restraint stress had decreased levels of IκBα RNA at 12 hours post
wounding. Treatment with AED enhanced IκBα expression 24 hours post wounding
(p<0.001) compared to vehicle treated controls in both stressed and unstressed animals.
Of further interest to us, we noted that treatment with AED resulted in an increase in
IκBα RNA expression in non-wounded skin as well. Although not completely
understood, this finding may imply that AED treatment may be inflammatory in nature
itself and may pre-dispose the healthy tissue for an inflammatory reaction.
129 In order to further analyze the role of stress and androstenediol with regard to the regulation of NF-ĸB activation, a TransAMTM ELISA was performed. The
TransAMTM showed that nuclear localization of p65 dropped significantly by 24 hours post wounding (p<0.05) in control animals, while RST animals showed no such decline. At 5 days post wounding nuclear p65 in control animals has returned to baseline levels, while RST animals experience a significant decrease in nuclear localization of p65 (p<0.05). Treatment with AED prevented the effects of restraint stress (RST) at 5 days post wounding. The data from the TransAMTM assay did not correspond with our anticipated results. Our previous data had shown an initial RST- mediated suppression of pro-inflammatory gene expression, and we did not see an early decrease in nuclear localization of p65. Therefore we must further pursue the transcriptional mechanism behind the RST-associated suppression of early gene expression during wound healing. One theory to explain the discrepancy between out anticipated results, and the actual data is: the decrease in nuclear p65 in the FWD/VEH group at 24 hours post wounding, could be due to the enhanced expression of IκBα at earlier timepoints. The increase in the expression of IκBα will result in a feedback mechanism that inhibits the activation of NF-κB, thus explaining the diminished nuclear p65 at 24 hours post wounding.
The TransAMTM data did provide some clues as to the mechanism of AED treatment. We were able to establish that stress is not impairing the ability of NF-κB to translocate to the nucleus, nor does AED effect the nuclear translocation of NF-κB.
This suggests that the stress/glucocorticoid impaired wound healing is mediated through some other mechanism. The possible mechanisms could include GC causing
130 the blockade of the NF-κB promoter region. Another possibility is that GCs bind to the transcriptional apparatus and allow an inhibitor to bind and stop NF-κB activation.
Figures 4.1 and 4.2 illustrate a hypothesized model for transcriptional regulation of pro- inflammatory cytokines. At this point further studies would be necessary to elucidate the intracellular mechanism through which GCs impair healing, and AED is able to restore it. Other specific protocols such as ChIP assays will be necessary to elucidate the mechanism by which stress alters the activation of NF-κB and AED restores it.
The overall findings of this project are multifold. First, the data confirm that wound healing is delayed by restraint stress and the kinetics of pro-inflammatory gene expression is also delayed compared to control animals. Treatment with AED prevented these effects. Second, experiments described herein show that restraint stress inhibits NF-κB activation as illustrated by an inhibition of NF-κB-dependent gene expression (i.e., IκBα). Treatment with AED blocked this effect of restraint stress and augmented NF-κB driven gene expression above controls. And third, data indicate that stress inhibits NF-κB driven gene transcription by a mechanism that does not involve nuclear translocation of p65. Likewise, AED’s anti-stress effect is independent of p65 compartmentalization within the nucleus. We presume the effect upon NF-κB is at the level of transcription initiation complex formation, but additional studies are necessary to test this hypothesis. In conclusion, the data indicate that AED may be a viable pharmacologic approach to functionally antagonize the effects of stress and presumably glucocorticoids, and thereby improve wound healing.
131
Figure 4.1 and 4.2: A Model for transcriptional regulation of inflammatory cytokine genes: NF-κB is a transcription factor for many pro-inflammatory genes involved in wound healing; GCs suppress expression of many genes activated by NF-
κB. Both the glucocorticoid receptor (GR) and NF-κB drive assembly of the RNA polymerase holoenzyme at the promoter of GC or NF-κB sensitive genes. Mediator proteins, such as CBP, are thought to be involved in the interaction between GR and
NF-κB and recruit activating or repressing co-factors that turn on or off transcription.
We hypothesize that AED modifies assembly of the polymerase holoenzyme through interactions with CBP.
132
Figure 4.1
Figure 4.2
133
REFERENCES
Adams J.B., Archibald L., and Clarke C. (1978) Adrenal dehydroepiandrosterone and human mammary cancer. Cancer Res. Nov;38(11 Pt 2):4036-4040.
Adams J.B. (1985) Control of secretion and function of C19-delta-5-steroids of the human adrenal gland. Mol Cell Endocrinol. Jun;41(1):1-17.
Adcock I.M., Nasuhara Y., Stevens D.A., and Barnes P.J. (1999) Ligand-induced differentiation of glucocorticoid receptor (GR) trans-repression and transactivation: preferential targetting of NF-kappaB and lack of I-kappaB involvement. Br J Pharmacol. Jun;127(4), 1003-1011.
Alkalay I., Yaron A., Hatzubai A., Orian A., Ciechanover A., and Ben-Neriah Y. (1995) Stimulation-dependent I kappa B alpha phosphorylation marks the NF-kappa B inhibitor for degradation via the ubiquitin-proteasome pathway. Proc Natl Acad Sci USA. Nov 7;92(23):10599-10603.
Angel P., and Szabowski A. (2002) Function of AP-1 target genes in mesenchymal- epithelial cross-talk in skin. Biochem Pharmacol. Sep;64(5-6):949-956.
Anitua E., Andia I., Ardanza B., Nurden P., and Nurden A.T. (2004) Autologous platelets as a source of proteins for healing and tissue regeneration. Thromb Haemost. Jan;91(1):4-15.
Artuc M., Hermes B., Steckelings U.M., Grutzkau A., and Henz B.M. (1999) Mast cells and their mediators in cutaneous wound healing—active participants or innocent bystanders? Exp Dermatol. Feb;8(1):1-16.
Ashcroft G.S., Horan M.A., and Ferguson M.W. (1998) Aging alters the inflammatory and endothelial cell adhesion molecule profiles during human cutaneous wound healing. Lab Invest. Jan;78(1):47-58.
Ashcroft G.S., and Mills S.J. (2002) Androgen receptor-mediated inhibition of cutaneous wound healing. J Clin Invest. Sep;110(5):615-624.
Ashwell J.D., Lu F.W., and Vacchio M.S. (2000) Glucocorticoids in T cell development and function. Annu Rev Immunol. 18:309-345.
134
Assoian R.K., Fleurdelys B.E., Stevenson H.C., Miller P.J., Madtes D.K., Raines E.W., Ross R., and Sporn M.B. (1987) Expression and secretion of type beta transforming growth factor by activated human macrophages. Proc Natl Acad Sci USA. Sep;84(17):6020-6024.
Attinger C.E., Janis J.E., Steinberg J., Schwartz J., Al-Attar A., and Couch K. (2006) Clinical approach to wounds: debridement and wound bed preparation including the use of dressings and wound-healing adjuvants. Plast Reconstr Surg. June;117 (7 Suppl): 72S-109S.
Auphan N., DiDonato J.A., Rosette C., Helmberg A., and Karin M. (1995) Immunosuppression by glucocorticoids: inhibition of NF-kappa B activity through induction of I kappa B synthesis. Science. Oct 13;270(5234):286-290.
Baeuerle P.A., and Henkel T. (1994) Function and activation of NF-kappa B in the immune system. Annu Rev Immunol. 12:141-179.
Baird A., Mormede P., and Bohlen P. (1985) Immunoreactive fibroblast growth factor in cells of peritoneal exudate suggests its identity with macrophage-derived growth factor. Biochem. Biophys. Res. Commun. Jan 16;126(1):358-364.
Baldi L., Brown K., Franzoso G., and Siebenlist U. (1996) Critical role for lysines 21 and 22 in signal-induced, ubiquitin-mediated proteolysis of I kappa B-alpha. J Biol Chem. Jan 5;271(1):376-379.
Baldwin A.S. Jr. (1996) The NF-kappa B and I kappa B Proteins: new discoveries and insights. Annu Rev Immunol. 14: 649-683.
Ballas C.B. and Davidson J.M. (2001) Delayed wound healing in aged rats is associated with increased collagen gel remodeling and contraction by skin fibroblasts, not with differences in apoptotic or myofibroblast cell populations. Wound Repair Regen. May- Jun;9(3), 223-237.
Barnes P.J. (1998) Anti-inflammatory actions of glucocorticoids: molecular mechanisms. Clin Sci (Lond). Jun;94(6):557-572.
Barnes P.J. (2006) Transcription factors in airway diseases. Lab Invest. Sep;86(9):867- 872.
Barrandon Y., and Green H. (1987) Cell migration is essential for sustained growth of keratinocyte colonies: The roles of transforming growth factor-alpha and epidermal growth factor. Cell. Sep 25;50(7):1131-1137.
135 Battegay E.J., Rupp J., Iruela-Arispe L., Sage E.H., and Pech M. (1994) PDGF-BB modulates endothelial proliferation and angiogenesis in vitro via PDGF beta-receptors. J Cell Biol. May;125(4):917-928.
Beer H.D., Longaker M.T., and Werner S. (1997) Reduced expression of PDGF and PDGF receptors during impaired wound healing. J Invest Dermatol. Aug;109(2):132- 138.
Beer H.D., Fassler R., and Werner S. (2000) Glucocorticoid-regulated gene expression during cutaneous wound repair. Vitam Horm. 59:217-239.
Bendrups A., Hilton A., Meager A., and Hamilton J.A. (1993) Reduction of tumor necrosis factor alpha and interleukin-1 beta levels in human synovial tissue by interleukin-4 and glucocorticoid. Rheumatol Int. 12(6): 217-220.
Bergquist J., Tarkowski A., Ekman R., and Ewing A. (1994) Discovery of endogenous catecholamines in lymphocyte evidence for catecholamine regulation of lymphocyte function via an autocrine loop. Proc Natl Acad Sci USA. Dec 20;91(26):12912-12916.
Bergquist J., Ohlsson B., and Tarkowski A. (2000) Nuclear factor-kappa B is involved in the catecholaminergic suppression of immunocompetent cells. Ann NY Acad Sci. 917:281-289.
Beutler B., Krochin N., Milsark I.W., Luedke C., and Cerami A. (1986) Control of cachectin (tumor necrosis factor) synthesis: mechanisms of endotoxin resistance. Science. May 23;232(4753):977-980.
Bingle L., Brown N.J., and Lewis C.E. (2002) The role of tumour-associated macrophages in tumour progression: implications for new anticancer therapies. J Pathol. Mar;196(3):254-265.
Bitar M.S. (1998) Glucocorticoid dynamics and impaired wound healing in diabetes mellitus. Am J Pathol. Feb;152(2):547-554.
Bitar M.S., Farook T., Wahid S., and Francis I.M. (1999) Glucocorticoid-dependent impairment of wound healing in experimental diabetes: amelioration by adrenalectomy and RU 486. J Surg Res. Apr;82(2):234-243.
Blauer K.L., Poth M., Rogers W.M., and Bernton E.W. (1991) Dehydroepiandrosterone antagonizes the suppressive effects of dexamethasone on lymphocyte proliferation. Endocrinology. Dec;129(6):3174-3179.
Boeger H., Bushnell D.A., Davis R., Griesenbeck J., Lorch Y., Strattan J.S., Westover K.D., and Kornberg R.D. (2005) Structural basis of eukaryotic gene transcription. FEBS Lett. Feb 7;579(4):899-903.
136
Brauchle M., Fassler R., and Werner S. (1995) Suppression of keratinocyte growth factor expression by glucocorticoids in vitro and during wound healing. J Invest Dermatol. Oct;105(4):579-584.
Braunstein G.D., (2001) Testes. In Basic and Clinical Endocrinology (Sixth Edition), Edited by Greenspan F.S., and Gardner D.G. Lange Medical Books/McGraw-Hill Medical Publishing Division, New York, pp 422-452.
Brenner C.A., Adler R.R., Rappolee D.A., Pedersen R.A., and Werb Z. (1989) Genes for extracellular-matrix-degrading metalloproteinases and their inhibitor, TIMP, are expressed during early mammalian development. Genes Dev.Jun; 3(6):848-859.
Brinkmann A.O. (2006) Chapter 3: Androgen Physiology: Receptor and Metabolic Disorders. In Endocrinology of Male Reproduction, Robert McLachlan-Editor. Endotext.com – Your Endocrine Source.
Broadbent E., Petrie K.J., Alley P.G., and Booth R.J. (2003) Psychological stress impairs early wound repair following surgery. Psychosom Med. Sep-Oct;65(5):865- 869.
Broughton G. 2nd, Janis J.E., and Attinger C.E. (2006) The basic science of wound healing. Plast Reconstr Surg. Jun;117(7 Suppl):12S-34S.
Brown L.F., Yeo K.T., Berse B., Yeo T.K., Senger D.R., Dvorak H.F., and van de Water L. (1992) Expression of vascular permeability factor (vascular endothelial growth factor) by epidermal keratinocytes during wound healing. J Exp Med. Nov 1;176(5):1375-1379.
Buijs R.M., and Van Eden C.G. (2000) The integration of stress by the hypothalamus, amygdala and prefrontal cortex: balance between the autonomic nervous system and the neuroendocrine system. Prog Brain Res. 126:117-132.
Burg N.D., and Pillinger M.H. (2001) The neutrophil: function and regulation in innate and humoral immunity. Clin Immunol. Apr;99(1):7-17.
Cabeza M., Bratoeff E., Heuze I., Guzmán A, Gómez G., Berrios H., and Rosales A.M. (2007) Antiandrogenic and apoptotic effects of RU-486 on animal prostate. J Steroid Biochem Mol Biol. May;104(3-5):321-325.
Caelles C., Gonzalez-Sancho J.M., and Munoz A. (1997) Nuclear hormone receptor antagonism with AP-1 by inhibition of the JNK pathway. Genes Dev. Dec 15;11(24):3351-3364.
137 Carlson M.A., and Longaker M.T. (2004) The fibroblast-populated collagen matrix as a model of wound healing: a review of the evidence. Wound Repair Regen. Mar- Apr;12(2):134-47.
Chadick J.Z., and Asturias F.J. (2005) Structure of eukaryotic Mediator complexes. Trends Biochem Sci. May;30(5):264-271.
Chan H.M., and La Thangue N.B. (2001) p300/CBP proteins: HATs for transcriptional bridges and scaffolds. J Cell Sci. Jul;114(Pt 13):2363-2373.
Chedid M., Rubin J.S., Csaky K.G., and Aaronson S.A. (1994) Regulation of keratinocyte growth factor gene expression by interleukin 1. J Biol Chem. Apr 8;269(14):10753-10757.
Chedid M., Hoyle J.R., Csaky K.G., and Rubin J.S. (1996) Glucocorticoids inhibit keratinocyte growth factor production in primary dermal fibroblasts. Endocrinology. Jun;137(6):2232-2237.
Chen Y.Q., Ghosh S., and Ghosh G. (1998) A novel DNA recognition mode by the NF- kappa B p65 homodimer. Nat Struct Biol. Jan;5(1):67-73.
Chitnis D., Dickerson C., Munster A.M., and Winchurn R.A. (1996) Inhibition of apoptosis in polymorphonuclear neutrophils from burn patients. J Leukoc Biol. Jun;59(6):835-839.
Circolo A., Welgus H.G., Pierce G.F., Kramer J., and Strunk R.C.(1991) Differential regulation of the expression of proteinases/antiproteinases in fibroblasts. Effects of interleukin-1 and platelet-derived growth factor. J Biol Chem. Jul 5;266(19):12283- 12288.
Clark R.A., Lanigan J.M., Dellapelle P., Manseau E., Dvorak H.F., and Colvin R.B. (1982) Fibronectin and fibrin provide a provisional matrix for epidermal cell migration during wound reepithelialization. J Invest Dermatol. Nov;79(5):264-269.
Clark R.A.F. (1991a) Cutaneous Wound Repair. In Goldsmith LA (ed) Physiology, Biochemistry, and Molecular Biology of the Skin. Oxford Press. Oxford. Pp 576-601.
Clark R.A. (1991b) Growth factors and wound repair. J Cell Biochem. May;46(1):1-2.
Clark R.A. (1993) Regulation of fibroplasia in cutaneous wound repair. Am J Med Sci. Jul;306(1):42-48.
Clark R.A.F. (1996) Wound Repair and General Considerations. In The Molecular and Cellular Biology of Wound Repair. (Second Edition), edited by Richard A.F. Clark, Plenum Press, New York. Pp 3-50.
138
Cook C.J. (2002) Glucocorticoid feedback increases the sensitivity of the limbic system to stress. Physiol Behav. Apr 1;75(4):455-464.
Cosentino M., Marino F., Bombelli R., Ferrari M., Lecchini S., and Frigo G. (2003) Unravelling dopamine (and catecholamine) physiopharmacology in lymphocytes: open questions. Trends Immunol. Aug;24(8):438-443.
Croce M.A., Dyne K., Boraldi F., Quaglino D. Jr., Cetta G., Tiozzo R., and Pasquali Ronchetti, I. (2001) Hyaluronan affects protein and collagen synthesis by in vitro human skin fibroblasts. Tissue Cell. Aug;33(4):326-31.
Dasgupta D., Chakraborty P., and Basu M.K. (2000) Ligation of Fc receptor of macrophages stimulates protein kinase C and anti-leishmanial activity. Mol Cell Biochem. Jun;209(1-2):1-8.
Daynes R.A., Dudley D.J., and Araneo B.A. (1990) Regulation of murine lymphokine production in vivo. II. Dehydroepiandrosterone is a natural enhancer of interleukin 2 synthesis by helper T cells. Eur J Immunol. Apr;20(4):793-802.
De Bosscher K., Vanden Berghe W., Vermeulen L., Plaisance S., Boone E., and Haegeman G. (2000) Glucocorticoids repress NF-kappaB-driven genes by disturbing the interaction of p65 with the basal transcription machinery, irrespective of coactivator levels in the cell. Proc Natl Acad Sci USA. Apr 11;97(8):3919-3924.
De Bosscher K., Vanden Berghe W., and Haegeman G. (2001) Glucocorticoid repression of AP-1 is not mediated by competition for nuclear coactivators. Mol Endocrinol. Feb;15(2): 219-227.
Delhase M., Hayakawa M., Chen Y., and Karin M. (1999) Positive and negative regulation of IkappaB kinase activity through IKKbeta subunit phosphorylation. Science. Apr 9;284(5412):309-313.
Deng Z., Chen C.J., Chamberlin M., Lu F., Blobel G.A., Speicher D., Cirillo L.A., Zaret K.S., and Lieberman P.M. (2003) The CBP bromodomain and nucleosome targeting are required for Zta-directed nucleosome acetylation and transcription activation. Mol Cell Biol. Apr;23(8):2633-2644.
Derr R.F. (1981) Restraint stress inhibited healing in rats. Physiol Behav. Nov;27(5):941-942.
Derynck R. (1988) Transforming growth factor-α. Cell. Aug 26;54(5):593-595.
Detillion C.E., Craft T.K., Glasper E.R., Prendergast B.J., and DeVries A.C. (2004) Social facilitation of wound healing. Psychoneuroendocrinology. Sep;29(8):1004-1011.
139
DiDonato J.A., Mercurio F., Rosette C., Wu-li J., Suyang H., Ghosh S., and Karin M. (1996) Mapping of the inducible IkappaB phosphorylation sites that signal its ubiquitination and degradation. Mol Cell Biol. Apr;16(4):1295-1304.
Diegelmann R.F., Rothkopf L.C., and Cohen I.K. (1975) Measurement of collagen biosynthesis during wound healing. J Surg Res. Oct;19(4):239-243.
Diegelmann R.F. and Evans, M.C. (2004) Wound healing: an overview of acute, fibrotic and delayed healing. Front Biosci. Jan 1;9: 283-289.
Dikkeschei L.D., Willemse P.H., Wolthers B.G., de Ruyter-Buitenhuis A.W. and Nagel G.T. (1993) Delta-5-androstenediol and its sulphate in serum and urine of normal adults and patients with endocrine diseases. Clin Endocrinol (Oxf). Oct;39(4):475-482.
Dinarello C.A. (1984) Interleukin-1 and the pathogenesis of the acute-phase response. N Engl J Med. Nov 29;311(22):1413-1418.
DiPietro L.A., Burdick M., Low Q.E., Kunkel S.L., and Strieter R.M. (1998) MIP- 1alpha as a critical macrophage chemoattractant in murine wound repair. J Clin Invest. Apr 15;101(8):1693-1698.
Dipietro L.A., Reintjes M.G., Low Q.E., Levi B., and Gamelli R.L. (2001) Modulation of macrophage recruitment into wounds by monocyte chemoattractant protein-1. Wound Repair Regen. Jan-Feb;9(1):28-33.
Dusi S., Donini M., Lissandrini D., Mazzi P., Bianca V.D., and Rossi F. (2001) Mechanisms of expression of NADPH oxidase components in human cultured monocytes: role of cytokines and transcriptional regulators involved. Eur J Immunol. Mar;31(3):929-938.
Ebrecht M., Hextall J., Kirtley L.G., Taylor A., Dyson M., and Weinman J. (2004) Perceived stress and cortisol levels predict speed of wound healing in healthy male adults. Psychoneuroendocrinology. Jul;29(6):798-809.
Elenkov I.J., and Chrousos G.P. (2002) Stress hormones, proinflammatory and anti- inflammatory cytokines, and autoimmunity. Ann N Y Acad Sci. Jun;966:290-303.
Elsbach P., and Weiss J. (1992) Oxygen-independent antimicrobial systems of phagocytosis, in: Inflammation: Basic Principles and Clinical Correlates. (J.I Gallin, I.M. Goldstein, and R. Snyderman, eds.) Raven Press, New York. Pp 603-636.
Engelhardt E., Toksoy A., Goebeler M., Debus S., Brocker E.B. and Gillitzer R. (1998) Chemokines IL-8, GROalpha, MCP-1, IP-10, and Mig are sequentially and
140 differentially expressed during phase-specific infiltration of leukocyte subsets in human wound healing. Am J Pathol. Dec;153(6):1849-1860.
Engler K.L., Rudd M.L., Ryan J.J., Stewart J.K., and Fischer-Stenger K. (2005) Autocrine actions of macrophage-derived catecholamines on interleukin-1 beta. J Neuroimmunol. Mar;160(1-2):87-91.
Fadeel B., and Kagan V.E. (2003) Apoptosis and macrophage clearance of neutrophils: regulation by reactive oxygen species. Redox Rep. 8(3):143-150.
Ferrara N. (2001) Role of vascular endothelial growth factor in regulation of physiological angiogenesis. Am J Physiol Cell Physiol. Jun;280(6):C1358-C1366.
Folkman J., and Klagsbrun M. (1987) Angiogenic factors. Science. Jan 23;235(4787):442-447.
Folkman J., and Shing Y. (1992) Angiogenesis. J Biol Chem. Jun 5;267(16):10931- 10934.
Francel P.C. (1992) Bradykinin and neuronal injury. J Neurotrauma. Mar;9 Suppl 1:S27-S45.
Frank S., Madlener M., and Werner S. (1996). Transforming growth factors beta1, beta2, and beta3 and their receptors are differentially regulated during normal and impaired wound healing. J Biol Chem. Apr 26;271(17):10188-10193.
Gabbiani G., Le Lous M., Bailey A.J., Bazin S., and Delaunay A. (1976) Collagen and myofibroblasts of granulation tissue. A chemical, ultrastructural and immunologic study. Virchows Arch B Cell Pathol. Aug 11;21(2):133-145.
Gabbiani G., Chapponnier C., and Huttner I. (1978) Cytoplasmic filaments and gap junctions in epithelial cells and myofibroblasts during wound healing. J Cell Biol. Mar;76(3):561-568.
Gangloff Y.G., Romier C., Thuault S., Werten S., and Davidson I. (2001) The histone fold is a key structural motif of transcription factor TFIID. Trends Biochem Sci. Apr;26(4):250-257.
Ghosh G., van Duyne G., Ghosh S., and Sigler P.B. (1995) Structure of NF-kappa B p50 homodimer bound to a kappa B site. Nature. Jan 26;373(6512):303-310.
Giavazzi R., Sennino B., Coltrini D., Garofalo A., Dossi R., Ronca R., Tosatti M.P., and Presta M. (2003) Distinct role of fibroblast growth factor-2 and vascular endothelial growth factor on tumor growth and angiogenesis. Am J Pathol. Jun;162(6):1913-1926.
141
Gibran N.S., Ferguson M., Heimbach D.M., and Isik F.F. (1997) Monocyte chemoattractant protein-1 mRNA expression in the human burn wound. J Surg Res. Jun;70(1):1-6.
Gillitzer R., and Goebeler M. (2001) Chemokines in cutaneous wound healing. J Leukoc Biol. Apr;69(4):513-521.
Gilliver S.C., Ashworth J.J., Mills S.J., Hardman M.J., and Ashcroft G.S. (2006) Androgens modulate the inflammatory response during acute wound healing. J Cell Sci. Feb 15;119(Pt 4):722-732. Epub 2006 Jan 31.
Gipson I.K., Spurr-Michaud S.J., and Tisdale A.S. (1988) Hemidesmosomes and anchoring fibril collagen appear synchronously during development and wound healing. Dev Biol. Apr;126(2):253-262.
Glaser R., Kiecolt-Glaser J.K., Marucha P.T., MacCallum R.C., Laskowski B.F., and Malarkey W.B. (1999) Stress-related changes in proinflammatory cytokine production in wounds. Arch Gen Psychiatry. May;56(5):450-456.
Glasper E.R., and Devries A.C. (2005) Social structure influences effects of pair- housing on wound healing. Brain Behav Immun. Jan;19(1):61-68.
Goldfien A. (2001) Adrenal Medulla. In Basic and Clinical Endocrinology (Sixth Edition), Edited by Greenspan F.S., and Gardner D.G., Lange Medical Books/McGraw- Hill, Medical Publishing Division, New York, Pp 399-421.
Gruss C.J., Satyamoorthy K., Berking C., Lininger J., Nesbit M., Schaider H., Liu Z.J., Oka M., Hsu M.Y., Shirakawa T., Li G., Bogenrieder T., Carmeliet P., El-Deiry W.S., Eck S.L., Rao J.S., Baker A.H., Bennet J.T., Crombleholme T.M., Velazquez O., Karmacharya J., Margolis D.J., Wilson J.M., Detmar M., Skobe M., Robbins P.D., Buck C., and Herlyn M. (2003) Stroma formation and angiogenesis by overexpression of growth factors, cytokines, and proteolytic enzymes in human skin grafted to SCID mice. J Invest Dermatol. Apr;120(4):683-692.
Hart J. (2002) Inflammation. 1: Its role in the healing of acute wounds. J Wound Care. Jun;11(6);205-209.
Hayden M.S., and Ghosh S. (2004) Signaling to NF-kappaB. Genes Dev. Sept 15;18(18):2195-2224.
Hebda P.A., Klingbeil C.K., Abraham J.A., and Fiddes J.C. (1990) Basic fibroblast growth factor stimulation of epidermal wound healing in pigs. J Invest Dermatol. Dec 95(6): 626-631.
142 Heldin C.H. and Westermark B. (1996). Role of Platelet-derived growth factor in vivo. In The Molecular and Cellular Biology of Wound Repair. (Second Edition), edited by Richard A.F. Clark, Plenum Press, New York. pp249-273.
Heldin C.H., and Westermark B. (1999) Mechanism of action and in vivo role of platelet-derived growth factor. Physiol Rev. Oct;79(4):1283-1316.
Henry G., and Garner W.L. (2003) Inflammatory mediators in wound healing. Surg Clin North Am. Jun;83(3):483-507.
Hermann G., Tovar C.A., Beck F.M., and Sheridan J.F. (1994) Kinetics of glucocorticoid response to restraint stress and/or experimental influenza viral infection in two inbred strains of mice. J Neuroimmunol. Jan;49(1-2):25-33.
Hieta N., Impola U., Lopez-Otin C., Saarialho-Kere U., and Kahari V.M. (2003) Matrix metalloproteinase-19 expression in dermal wounds and by fibroblasts in culture. J Invest Dermatol. Nov;121(5):997-1004.
Hofmann T.G., Hehner S.P., Bacher S., Droge W., and Schmitz M.L. (1998) Various glucocorticoids differ in their ability to induce gene expression, apoptosis and to repress NF-kappaB-dependent transcription. FEBS Lett. Dec 28;441(3), 441-446.
Hollenberg S.M., Giguere V., Sequi P., and Evans R.M. (1987) Colocalization of DNA- binding and transcriptional activation functions in the human glucocorticoid receptor. Cell. Apr 10;49(1):39-46.
Horan M.P., Quan N., Subramanian S.V., Strauch A.R., Gajendrareddy P.K., and Marucha P.T. (2005) Impaired wound contraction and delayed myofibroblast differentiation in restraint-stressed mice. Brain Behav Immun. May;19(3):207-216.
Hübner G., Brauchle M., Smola H., Madlener M., Fassler R., and Werner S. (1996) Differential regulation of pro-inflammatory cytokines during wound healing in normal and glucocorticoid-treated mice. Cytokine. Jul;8(7):548-556.
Jacobi J., Tam B.Y., Sundram U., von Degenfeld G., Blau H.M., Kuo C.J., and Cooke J.P. (2004) Discordant effects of a soluble VEGF receptor on wound healing and angiogenesis. Gene Ther. Feb;11(3):302-309.
Jiang J.L., Qiu Y.H., Peng Y.P., and Wang J.J. (2006) Immunoregulatory role of endogenous catecholamines synthesized by immune cells. Acta Physiologica Sinica. Aug 25;58(4):309-317.
Jobin C., and Sartor R.B. (2000) The I kappa B/NF-kappa B system: a key determinant of mucosalinflammation and protection. Am J Physiol Cell Physiol. Mar;278(3):C451- 462.
143
John M., Lim S., Seybold J., Jose P., Robichaud A., O’Connor B., Barnes P.J., and Chung K.F. (1998) Inhaled corticosteroids increase interleukin-10 but reduce macrophage inflammatory protein-1 alpha, granulocyte-macrophage colony-stimulating factor, and interferon-gamma release from alveolar macrophages in asthma. Am J Respir Crit Care Med. Jan;157(1)256-262.
Kaltschmidt B., Baeuerle P.A., and Kaltschmidt C. (1993) Potential involvement of the transcription factor NF-kappa B in neurological disorders. Mol Aspects Med. 14(3):171- 190.
Karin M., and Ben-Neriah Y. (2000) Phosphorylation meets ubiquitination: the control of NF-kappaB activity. Annu Rev Immunol. 18:621-663.
Karlsson A., and Dahlgren C. (2002) Assembly and activation of the neutrophil NADPH oxidase in granule membranes. Antioxid Redox Signal. Feb;4(1):49-60.
Kiecolt-Glaser J.K., Marucha P.T., Malarkey W.B., Mercado A.M., and Glaser R. (1995) Slowing of wound healing by psychological stress. Lancet. Nov 4;346(8984):1194-6.
Kiecolt-Glaser J.K., Page G.G., Marucha P.T., MacCallum R.C., and Glaser R. (1998) Psychological influences on surgical recovery. Perspectives from psychoneuroimmunology. Am Psychol. Nov;53(11):1209-1218.
King S.M., and Reed, G.L. (2002) Development of platelet secretory granules. Semin Cell Dev Biol. Aug;13(4), 293-302.
Kino T., Nordeen S.K., and Chrousos G.P. (1999) Conditional modulation of glucocorticoid receptor activities by CREB-binding protein (CBP) and p300. J Steroid Biochem Mol Biol. Jul-Aug;70(1-3):15-25.
Koch A.E., Polverini P.J., Kunkel S.L., Harlow L.A., DiPietro L.A., Elner V.M., Elner S.G., and Strieter R.M. (1992) Interleukin-8 as a macrophage-derived mediator of angiogenesis. Science. Dec 11;258(5089):1798-1801.
Krawczyk W.S., and Wilgram G.F. (1973) Hemidesmosome and desomosome morphogenesis during epidermal wound healing. J Ultrastruct Res. Oct;45(1):93-101.
Kurkinen M., Vaheri A., Roberts P.J., and Stenman S., (1980) Sequential appearance of fibronectin and collagen in experimental granulation tissue. Lab Invest. Jul;43(1):47-51.
Kurosaka K., Takahashi M., Watanabe N., and Kobayashi Y. (2003) Silent cleanup of very early apoptotic cells by macrophages. J Immunol. Nov 1;171(9):4672-4679.
144 La Baer J. and Yamamoto K.R. (1994) Analysis of the DNA-binding affinity, sequence specificity and context dependence of the glucocorticoid receptor zinc finger region. J Mol Biol. Jun 24;239(5), 664-688.
Laiho M., Saksela O., and Keski-Oja J. (1986) Transforming growth factor beta alters plasminogen activator activity in human skin fibroblasts. Exp Cell Res. Jun;164(2):399- 407.
Lane T.F., Iruela-Arispe M.L., Johnson R.S., and Sage E.H. (1994) SPARC is a source of copper-binding peptides that stimulate angiogenesis. J Cell Biol. May;125(4):929- 943.
Lanir N., Ciano P.S., Van de Water L., McDonagh J., Dvorak A.M., and Dvorak H.F. (1988) Macrophage migration in fibrin gel matrices. II. Effects of clotting factor XIII, fibronectin, and glycosaminoglycan content on cell migration. J Immunol. Apr 1;140(7):2340-2349.
Lee B., Vouthounis C., Stojadinovic O., Brem H., Im M., and Tomic-Canic M. (2005) From an enhanceosome to a repressosome: molecular antagonism between glucocorticoids and EGF leads to inhibition of wound healing. J Mol Biol. Feb 4;345(5):1083-1097.
Lee H.J., and Chang C (2003) Recent advances in androgen receptor action. Cell Mol Life Sci. Aug;60(8):1613-1622.
Lee J.I., and Burckart G.J. (1998) Nuclear factor kappa B: important transcription factor and therapeutic target. J Clin Pharmacol. Nov;38(11): 981-993.
Leibovich S.J., and Ross R. (1975) The role of the macrophage in wound repair: A study with hydrocortisone and antimacrophage serum. Am J Pathol. Jan;78(1):71-100.
Lenco W., Mcknight M., and Macdonald A.S. (1975) Effects of cortisone acetate, methylprednisolone and medroxyprogesterone on wound contracture and epithelialization in rabbits. Ann Surg. Jan;181(1):67-73.
Li J., Farthing P.M., and Thornhill M.H. (2000) Oral and skin keratinocytes are stimulated to secrete monocyte chemoattractant protein-1 by tumour necrosis factor- alpha and interferon-gamma. J Oral Pathol Med. Oct;29(9);438-444.
Li M.O., Sarkisian M.R., Mehal W.Z., Rakic P., and Flavell R.A. (2003) Phosphatidylserine receptor is required for clearance of apoptotic cells. Science. Nov 28;302(5650), 1560-1563.
Li Q., and Verma I.M. (2002) NF-kappaB regulation in the immune system. Nat Rev Immunol. Oct;2(10):725-734.
145
Liu W., Wang D.R., and Cao Y.L. (2004) TGF-beta: a fibrotic factor in wound scarring and a potential target for anti-scarring gene therapy. Curr Gene Ther. Mar;4(1):123- 136.
Loria R.M., and Padgett D.A. (1992a) Androstenediol regulates systemic resistance against lethal infections in mice. Arch Virol. 127(1-4):103-115.
Loria R.M., and Padgett D.A. (1992b) Mobilization of cutaneous immunity for systemic protection against infections. Ann N Y Acad Sci. Apr 15;650:363-366.
Loria R.M., Conrad D.H., Huff T., Carter H., and Ben-Nathan D. (2000) Androstenetriol and androstendiol. Protection against lethal radiation and restoration of immunity after radiation injury. Ann N Y Acad Sci. 917:860-7.
Low Q.E., Drugea I.A., Duffner L.A., Quinn D.G., Cook D.N., Rollins B.J., Kovacs E.J., and DiPietro L.A. (2001) Wound healing in MIP-1alpha(-/-) and MCP-1(-/-) mice. Am J Pathol. Aug;159(2):457-463.
Lundberg U. (1999) Coping with Stress: Neuroendocrine Reactions and Implications for Health. Noise Health. 1(4):67-74.
Madlener M., Parks W.C., and Werner S. (1998) Matrix metalloproteinases (MMPs) and their physiological inhibitors (TIMPs) are differentially expressed during excisional skin wound repair. Exp Cell Res. Jul 10;242(1):201-210.
Madtes D.K., Raines E.W., Sakariassen K.S., Assoian R.K., Sporn M.B., Bell G.I., and Ross R. (1988) Induction of transforming growth factor-alpha in activated human alveolar macrophages. Cell. Apr 22;53(2):285-293.
Mannaioni P.F., Di Bello M.G., and Masini E. (1997) Platelets and inflammation: role of platelet-derived growth factor, adhesion molecules and histamine. Inflamm Res. Jan;46(1):4-18.
Marchese C., Rubin J., Ron D., Faggioni A., Torrisi M.R., Messina A., Frati L., and Aaronson S.A., (1990) Human keratinocyte growth factor activity on proliferation and differentiation of human keratinocytes: differentiation response distinguishes KGF from EGF family. J Cell Physiol. Aug;144(2):326-332.
Marchese C., Chedid M., Dirsch O.R., Csaky K.G., Santanelli F., Latini C., LaRochelle W.J., Torrisi M.R., and Aaronson S.A. (1995) Modulation of keratinocyte growth factor and its receptor in reepithelializing human skin. J Exp Med. Nov 1;182(5):1369-1376.
Martin P., Hopkinson-Woolley J., and McCluskey J. (1992) Growth factors and cutaneous wound repair. Prog Growth Factor Res. 4(1):25-44.
146
Martin P., D’Souza D., Martin J., Grose R., Cooper L., Maki R., and McKercher S.R. (2003) Wound healing in the PU.1 null mouse—tissue repair is not dependent on inflammatory cells. Curr Biol. Jul 1;13(13):1122-1128.
Marucha P.T., Kiecolt-Glaser J.K., and Favagehi M. (1998) Mucosal wound healing is impaired by examination stress. Psychosom Med. May-Jun;60(3):362-5.
Matt T. (2002) Transcriptional control of the inflammatory response: a role for the CREB-binding protein (CBP). Acta Med Austriaca. 29(3):77-79.
May M., Holmes E., Rogers W., and Poth M. (1990) Protection from glucocorticoid induced thymic involution by dehydroepiandrosterone. Life Sci. 46(22):1627-1631.
McDonald P.P., and Cassatella M.A. (1997) Activation of transcription factor NF- kappa B by phagocytic stimuli in human neutrophils. FEBS Lett. Aug 4;412(3):583- 586.
McKay L.I., and Cidlowski J.A. (1999) Molecular control of immune/inflammatory responses: interactions between nuclear factor-kappa B and steroid receptor-signaling pathways. Endocr Rev. Aug;20(4):435-459.
Mercado A.M., Padgett D.A., Sheridan J.F., and Marucha P.T. (2002a) Altered kinetics of IL-1 alpha, IL-1 beta, and KGF-1 gene expression in early wounds of restrained mice. Brain Behav and Immun. Apr;16(2):150-162.
Mercado A.M., Quan N., Padgett D.A., Sheridan J.F., and Marucha P.T. (2002b) Restraint stress alters the expression of interleukin-1 and keratinocyte growth factor at the wound site: an in situ hybridization study. J Neuroimmunol. Aug; 129(1-2):74-83.
Metz C.N. (2003) Fibrocytes: a unique cell population implicated in wound healing. Cell Mol Life Sci. Jul;60(7):1343-50.
Mills S.J., Ashworth J.J., Gilliver S.C., Hardman M.J., and Ashcroft G.S. (2005) The sex steroid precursor DHEA accelerates cutaneous wound healing via the estrogen receptors. J Invest Dermatol. Nov; 125(5):1053-1062.
Muller C.W., Rey F.A., Sodeoka M., Verdine G.L., and Harrison S.C. (1995) Structure of the NF-kappa B p50 homodimer bound to DNA. Nature. Jan 26;373(6512)311-317.
Neal M.S. (2001) Angiogenesis: is it the key to controlling the healing process? J Wound Care. Jul;10(7):281-287.
Nedelec B., Ghahary A., Scott P.G., and Tredget E.E. (2000) Control of wound contraction. Basic and Clinical features. Hand Clin. May;16(2):289-302.
147
Odland G., and Ross R. (1968) Human wound repair. I. Epidermal regeneration. J Cell Biol. Oct;39(1):135-157.
Ortega N., L’Faqihi F.E., and Plouet J. (1998) Control of vascular endothelial growth factor angiogenic activity by the extracellular matrix. Biol Cell. Sep;90(5):381-390.
Overall C.M., Wrana J.L., and Sodek J. (1989) Independent regulation of collagenase, 72- kDa progelatinase, and metalloendoproteinase inhibitor expression in human fibroblasts by transforming growth factor-beta. J Biol Chem. Jan 25;264(3):1860-1869.
Padgett D.A., and Loria R.M. (1994) In vitro potentiation of lymphocyte activation by dehydroepiandrosterone, androstenediol, and androstenetriol. J Immunol. Aug 15;153(4):1544-1552.
Padgett D.A., and Loria R.M. (1998) Endocrine regulation of murine macrophage function: effects of dehydroepiandrosterone, androstenediol and androstenetriol. J. Neuroimmunol. Apr 1;84(1):61-68.
Padgett D.A., Marucha P.T., and Sheridan J.F. (1998) Restraint stress slows cutaneous wound healing in mice. Brain Behav Immun. Mar;12(1)64-73.
Padgett D.A., and Sheridan J.F. (1999) Androstenediol (AED) prevents neuroendocrine-mediated suppression of the immune response to an influenza viral infection. J Neuroimmunol. Aug 3;98(2):121-129.
Parker L.N., Levin E.R., and Lifrak E.T. (1985a) Evidence for adrenocortical adaptation to severe illness. J Clin Endocrinol Metab. May;60(5):947-952.
Parker L.N., Eugene J., Farber D., Lifrak E., Lai M., and Juler G. (1985b) Dissociation of adrenal androgen and cortisol levels in acute stress. Horm Metab Res. Apr;17(4):209-212.
Pierce G.F., Mustoe T.A., Lingelbach J., Masakowski V.R., Gramates P., and Deuel T.F. (1989) Transforming growth factor beta reverses the glucocorticoid-induced wound-healing deficit in rats: possible regulation in macrophages by platelet-derived growth factor. Proc Natl Acad Sci USA. Apr;86(7):2229-2233.
Pierce G.F., Vande Berg J., Rudolph R., Tarpley J., and Mustoe T.A. (1991a) Platelet- derived growth factor-BB and transforming growth factor beta 1 selectively modulate glycosaminoglycans, collagen, and myofibroblasts in excisional wounds. Am J Pathol. Mar;138(3):629-646.
Pierce G.F., Mustoe T.A., Altrock B.W., Deuel T.F., and Thomason A. (1991b) Role of platelet-derived growth factor in wound healing. J Cell Biochem. Apr;45(4):319-326.
148
Pierce G.F., Yanagihara D., Klopchin K., Danilenko D.M., Hsu E., Kenney W.C., and Morris C.F. (1994) Stimulation of all epithelial elements during skin regeneration by keratinocyte growth factor. J Exp Med. Mar 1;179(3):831-840.
Poortman J., Andriesse R., Agema A., Donker G.H., Schwarz F. and Thijssen J.H.H. (1980) In: Adrenal Androgens. Editors Genazzani A.R., Thijssen J.H.H., and Siiteri P.K. Raven Press, New York, pp. 219-240.
Postlethwaite A.E., Keski-Oja J., Moses H.L., and Kang A.H. (1987) Stimulation of the chemotactic migration of human fibroblasts by transforming growth factor-beta. J Exp Med. Jan 1;165(1):251-256.
Raghow R. (1994) The role of extracellular matrix in postinflammatory wound healing and fibrosis. FASEB J. Aug;8(11), 823-831.
Raines E.W., Dower S.K., and Ross R. (1989) Interleukin-1 mitogenic activity for fibroblasts and smooth muscle cells is due to PDGF-AA. Science. Jan 20;243(4889)243:393-396.
Ray A., and Prefontaine K.E. (1994) Physical association and functional antagonism between the p65 subunit of transcription factor NF-kappa B and the glucocorticoid receptor. Proc Natl Acad Sci USA. Jan 18;91(2):752-756.
Read M.A., Whitley M.Z., Williams A.J., and Collins T. (1994) NF-kappaB and I kappa B alpha: an inducible regulatory system in endothelial activation. J Exp Med. Feb 1;179(2):503-512.
Riches D.W.H. (1996) Macrophage Involvement in Wound Repair, Remodeling and Fibrosis. In The Molecular and Cellular Biology of Wound Repair. (Second Edition), edited by Richard A.F. Clark, Plenum Press, New York Pp 95-141.
Riley V. (1981) Psychoneuroendocrine influences on immunocompetence and neoplasia. Science. Jun 5;212(4499):1100-1109.
Roberts A.B., Sporn M.B., Assoian R.K., Smith J.M., Roche N.S., Wakefield L.M., Heine U.I., Liotta L.A., Falanga V., Kehrl J.H., and Fauci A.S. (1986) Transforming growth factor beta: rapid induction of fibrosis and angiogenesis in vivo and stimulation of collagen formation in vitro. Proc Natl Acad Sci USA. Jun;83(12):4167-4171.
Roeder R.G. (2005) Transcriptional regulation and the role of diverse coactivators in animal cells. FEBS Lett. Feb 7;579(4):909-915.
149 Rojas I.G., Padgett D.A., Sheridan J.F., and Marucha P.T. (2002). Stress-induced susceptibility to bacterial infection during cutaneous wound healing. Brain, Behav Immun. Feb;16(1): 74-84.
Ross R.R., and Raines E.W. (1990) Platelet-derived growth factor and cell proliferation, in: Growth Factors: From Genes to Clinical Application. (V.R. Sara et al., eds.), Raven Press, New York, pp. 193-199.
Rossi D., and Zlotnik A. (2000) The biology of chemokines and their receptors. Annu Rev Immunol. 18:217-242.
Rubin J.S., Osada H., Finch P.W., Taylor W.G., Rudikoff S., and Aaronson S.A. (1989) Purification and characterization of a newly identified growth factor specific for epithelial cells. (1989) Proc Natl Acad Sci USA. Feb;86(3):802-806.
Russo-Marie F. (1992) Macrophages and the glucocorticoids. J Neuroimmunol. Oct;40(2-3):281-286.
SatoY., Ohshima T., and Kondo T. (1999) Regulatory role of endogenous interleukin- 10 in cutaneous inflammatory response of murine wound healing. Biochem Biophys Res Commun. Nov;265(1):194-199.
Sawchenko P.E., Brown E.R., Chan R.K., Ericsson A, Li H.Y., Roland B.L., and Kovacs K.J. (1996) The paraventricular nucleus of the hypothalamus and the functional neuroanatomy of visceromotor responses to stress. Prog Brain Res. 107:201-222.
Scapini P., Lapinet-Vera, J.A., Gasperini S., Calzetti F., Bazzoni F., and Cassatella M.A. (2000) The neutrophil as a cellular source of chemokines. Immunol Rev. Oct;177:195-203.
Scheinman R.I., Cogswell P.C., Lofquist A.K., and Baldwin A.S. Jr. (1995) Role of transcriptional activation of I kappa B alpha in mediation of immunosuppression by glucocorticoids. Science. Oct 13;270(5234):232-233.
Scheller A., Hughes E., Golden K.L., and Robins D.M. (1998) Multiple receptor domains interact to permit, or restrict, androgen-specific gene activation. J Biol Chem. Sep 11;273(37):24216-24222.
Scherer D.C., Brockman J.A., Chen Z., Maniatis T., and Ballard D.W. (1995) Signal- induced degradation of I kappa B alpha requires site-specific ubiquitination. Proc Natl Acad Sci USA. Nov 21;92(24):11259-11263.
Schiltz R.L., Mizzen C.A., Vassilev A., Cook R.G., Allis C.D., and Nakatani Y. (1999) Overlapping but distinct patterns of histone acetylation by the human coactivators p300 and PCAF within nucleosomal substrates. J Biol Chem. Jan 15;274(3):1189-1192.
150
Schoenmakers E., Verrijdt G., Peeters B., Verhoeven G., Rombauts W., and Claessens F. (2000) Differences in DNA binding characteristics of the androgen and glucocorticoid receptors can determine hormone-specific responses. J Biol Chem. Apr 21;275(16):12290-12297.
Schoneveld O.J., Gaemers I.C., and Lamers W.H. (2004) Mechanisms of glucocorticoid signalling. Biochim Biophys Acta. Oct 21;1680(2):114-128.
Selye H. (1998) A syndrome produced by diverse nocuous agents. 1936. J Neuropsychiatry Clin Neurosci. Spring;10(2):230-231.
Seppa H.E.J., Grotendorst G.R., Seppa S.I., Schiffman E., and Martin G.R. (1982) Platelet-derived growth factor is chemotactic for fibroblasts. J Cell Biology. Feb;92(2):584-588.
Shakhov A.N., Collart M.A., Vassalli P., Nedospasov S.A., and Jongeneel C.V. (1990) Kappa B-type enhancers are involved in lipopolysaccharide-mediated transcriptional activation of the tumor necrosis factor alpha gene in primary macrophages. J Exp Med. Jan 1;171(1):35-47.
Sheridan J.F., Padgett D.A., Avitsur R., and Marucha P.T. (2004) Experimental models of stress and wound healing. World J Surg. Mar;28(3):327-330.
Shimokado K., Raines E.W., Madtes D.K., Barrett T.B., Benditt E.P., and Ross R. (1985) A significant part of macrophage-derived growth factor consists of at least two forms of PDGF. Cell. Nov;43(1):277-286.
Singer A.J., and Clark R.A. (1999) Cutaneous wound healing. N Engl J Med. Sep 2;341(10):738-746.
Singer I.I., Kawka D.W., Kazazis D.M., and Clark R.A. (1984) In vivo co-distribution of fibronectin and actin fibers in granulation tissue: immunofluorescence and electron microscope studies of the fibronexus at the myofibroblast surface. J Cell Biol. Jun;98(6):2091-2106.
Smola H., Thiekotter G., and Fusenig N.E. (1993) Mutual induction of growth factor gene expression by epidermal-dermal cell interaction. J Cell Biol. Jul;122(2):417-429.
Snyder D.S., and Unanue E.R. (1982) Corticosteroids inhibit murine macrophage Ia expression and interleukin 1 production. J Immunol. Nov;129(5):1803-1805.
Spangler L., Wang X., Conaway J.W., Conaway R.C., and Dvir A. (2001) TFIIH action in transcription initiation and promoter escape requires distinct regions of downstream promoter DNA. Proc Natl Acad Sci U S A. May 8;98(10):5544-5549.
151
Spengler R.N., Chensue S.W., Giacherio D.A., Blenk N., and Kunkel S.L. (1994) Endogenous norepinephrine regulates tumor necrosis factor-α production from macrophages in vitro. J Immunol. Mar 15;152(6):3024-3031.
Sporn M.B., and Roberts A.B. (1992) Transforming growth factor-beta: recent progress and new challenges. J Cell Biol. Dec;119(5): 1017-1021.
Spry C.J. (1972) Inhibition of lymphocyte recirculation by stress and corticotropin. Cell Immunol. May;4(1):86-92.
Stahl F., Schnorr D., Pilz C., and Dorner G. (1992) Dehydroepiandrosterone (DHEA) levels in patients with prostatic cancer, heart diseases and under surgery stress. Exp Clin Endocrinol. 99(2):68-70.
Steed D.L. (2003) Wound-healing trajectories. Surg Clin North Am. Jun;83(3):547-555, vi-vii.
Stein B.N., Gamble J.R., Pitson S.M., Vadas M.A., and Khew-Goodall Y. (2003) Activation of endothelial extracellular signal-regulated kinase is essential for neutrophil transmigration: potential involvement of a soluble neutrophil factor in endothelial activation. J Immunol. Dec 1;171(11):6097-6104.
Stifter S. (2006) The role of nuclear factor kappaB on angiogenesis regulation through monocyte chemotactic protein-1 in myeloma. Med Hypotheses. 66(2):384-386.
Suzuki T., Suzuki N., Daynes R.A., and Engleman E.G. (1991) Dehydroepiandrosterone enhances IL2 production and cytotoxic effector function of human T cells. Clin Immunol Immunopathol. Nov;61(2 Pt 1):202-211.
Sweitzer S.M., Fann S.A., Borg T.K., Baynes J.W., and Yost M.J. (2006) What is the future of diabetic wound care? Diabetes Educ. Mar-Apr;32(2):197-210.
Sylvia C.J. (2003) The role of neutrophil apoptosis in influencing tissue repair. J Wound Care. Jan;12(1):13-16.
Takehara K. (2000) Growth regulation of skin fibroblasts. J Dermatol Sci. Dec;24 Suppl 1;S70-S77.
Tang A., and Gilchrest B.A. (1996) Regulation of keratinocyte growth factor gene expression in human skin fibroblasts. J Dermatol Sci. Jan;11(1):41-50.
Tetsuka T., Uranishi H., Sanda T., Asamitsu K., Yang J.P., Wong-Staal F., and Okamoto T. (2004) RNA helicase A interacts with nuclear factor kappaB p65 and functions as a transcriptional coactivator. Eur J Biochem. Sep;271(18):3741-3751.
152
Theilgaard-Monch K., Knudsen S., Follin P., and Borregaard N. (2004) The transcriptional activation program of human neutrophils in skin lesions supports their important role in wound healing. J Immuno. Jun 15;172(12):7684-7693.
Thomas D.W., O’Neill I.D., Harding K.G., and Shepherd J.P. (1995) Cutaneous wound healing: A current perspective. J Oral Maxillofac Surg. Apr;53(4):442-447.
Torkvist L., Mansson P., Raud J., Larsson J., and Thorlacius H. (2001) Role of CD18- dependent neutrophil recruitment in skin and intestinal wound healing. Eur Surg Res. Jul-Aug;33(4):249-254.
Traenckner E.B., Pahl H.L., Henkel T., Schmidt K.N., Wilk S., and Baeuerle P.A. (1995) Phosphorylation of human I kappa B-alpha on serines 32 and 36 controls I kappa B-alpha proteolysis and NF-kappa B activation in response to diverse stimuli. EMBO J. Jun 15;14(12):2876-2883.
Tsang Y.T., Neelamegham S., Hu Y., Berg E.L., Burns A.R., Smith C.W., and Simon S.I. (1997) Synergy between L-selectin signaling and chemotactic activation during neutrophil adhesion and transmigration. J Immunol. Nov 1;159(9):4566-4577.
Tsigos C., and Chrousos G.P. (2002) Hypothalamic-pituitary-adrenal axis, neuroendocrine factors and stress. J Psychosom Res. Oct;53(4):865-871.
Umland S.P., Schleimer R.P., and Johnston S.L. (2002) Review of the molecular and cellular mechanisms of action of glucocorticoids for use in asthma. Pulm Pharmacol Ther. 15(1):35-50.
Vo N., and Goodman R.H. (2001) CREB-binding protein and p300 in transcriptional regulation. J Biol Chem. Apr 27;276(17):13505-13508.
Waldorf H., and Fewkes J. (1995) Wound healing. Adv Dermatol. 10:77-96.
Wan M.X., Wang Y., Liu Q., Schramm R., and Thorlacius H. (2003) CC Chemokines induce P-selectin-dependent neutrophil rolling and recruitment in vivo: intermediary role of mast cells. Br J Pharmacol. Feb;138(4):698-706.
Wang G., Balamotis M.A., Stevens J.L., Yamaguchi Y., Handa H., and Berk A.J. (2005) Mediator requirement for both recruitment and postrecruitment steps in transcription initiation. Mol Cell. Mar 4;17(5):683-694.
Watanabe M.E. (1994). RU 486 research forges on, despite political hurdles. Scientist. Jan 24;8(2):14-15.
153 Watanabe Y., Fujimoto H., Watanabe T., Maekawa T., Masutani C., Hanaoka F., and Ohkuma Y. (2000) Modulation of TFIIH-associated kinase activity by complex formation and its relationship with CTD phosphorylation of RNA polymerase II. Genes Cells. May;5(5):407-423.
Webster J.I., and Sternberg E.M. (2004) Role of the hypothalamic-pituitary-adrenal axis, glucocorticoids and glucocorticoid receptors in toxic sequelae of exposure to bacterial and viral products. J Endocrinol. May;181(2):207-221.
Weisel J.W. (2005) Fibrinogen and fibrin. Adv Protein Chem. 70:247-299.
Welch M.P., Odland G.F., and Clark R.A. (1990) Temporal relationships of F-actin bundle formation, collagen and fibronectin matrix assembly, and fibronectin receptor expression to wound contraction. J Cell Biol. Jan;110(1):133-145.
Werb Z., Tremble P., and Damsky C.H (1990) Regulation of extracellular matrix degradation by cell-extracellular matrix interactions. Cell Differ Dev. Dec 2;32(3):299- 306.
Werner S., Peters K.G., Longaker M.T., Fuller-Pace F., Banda M.J., and Williams L.T. (1992) Large induction of keratinocyte growth factor expression in the dermis during wound healing. Proc Natl Acad Sci USA. Aug 1;89(15):6896-6900.
Werner S., Breeden M., Hubner G., Greenhalgh D.G., and Longaker M.T. (1994) Induction of keratinocyte growth factor expression is reduced and delayed during wound healing in the genetically diabetic mouse. J Invest Dermatol. Oct;103(4):469- 475.
Werner S. (1998) Keratinocyte growth factor: a unique player in epithelial repair processes. Cytokine Growth Factor Rev. Jun;9(2):153-165.
Werner S. and Grose R. (2003). Regulation of wound healing by growth factors and cytokines. Physiol Rev. Jul;83(3): 835-870.
Wetzler C., Kämpfer H., Stallmeyer B., Pfeilschifter J., and Frank S. (2000) Large and sustained induction of chemokines during impaired wound healing in the genetically diabetic mouse: prolonged persistence of neutrophils and macrophages during the late phase of repair. J Invest Dermatol. Aug;115(2).245-253.
Winkles J.A., Alberts G.F., Chedid M., Taylor W.G., DeMartino S., and Rubin J.S. (1997) Differential expression of the keratinocyte growth factor (KGF) and KGF receptor genes in human vascular smooth muscle cells and arteries. J Cell Physiol. Dec;173(3):380-386.
154 Wissink S., van Heerde E.C., vand der Burg B., and van der Saag P.T. (1998) A dual mechanism mediates repression of NF-kappaB activity by glucocorticoids. Mol Endocrinol. Mar;12(3), 355-363.
Witte M.B., and Barbul A. (1997) General principles of wound healing. Surg Clin North Am. Jun;77(3):509-528.
The Wound Healing Center (2005) www.stclair.org/Wound_Healing.asp
Wu L., Pierce G.F., Galiano R.D., and Mustoe T.A. (1996). Keratinocyte growth factor induces granulation tissue in ischemic dermal wounds. Importance of epithelial- mesenchymal cell interactions. Arch Surg. Jun;131(6):660-666.
Yates S., and Rayner T.E. (2002) Transcription factor activation in response to cutaneous injury: role of AP-1 in reepithelialization. Wound Repair Regen. Jan- Feb;10(1):5-15.
Yudkovsky N., Logie C., Hahn S., and Peterson C.L. (1999) Recruitment of the SWI/SNF chromatin remodeling complex by transcriptional activators. Genes Dev. Sep 15;13(18):2369-2374.
155