Activation Specificity of Cpg-Induced Immune CXCL16 Influences The

CXCL16 Influences the Nature and Specificity of CpG-Induced Immune Activation

This information is current as Mayda Gursel, Ihsan Gursel, Howard S. Mostowski and of September 26, 2021. Dennis M. Klinman J Immunol 2006; 177:1575-1580; ; doi: 10.4049/jimmunol.177.3.1575 http://www.jimmunol.org/content/177/3/1575 Downloaded from

References This article cites 39 articles, 17 of which you can access for free at: http://www.jimmunol.org/content/177/3/1575.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

by guest on September 26, 2021 *average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2006 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

CXCL16 Inﬂuences the Nature and Speciﬁcity of CpG-Induced Immune Activation1,2

Mayda Gursel,3 Ihsan Gursel,3 Howard S. Mostowski, and Dennis M. Klinman4

Unmethylated CpG motifs are present at high frequency in bacterial DNA. They provide a danger signal to the mammalian immune system that triggers a protective immune response characterized by the production of Th1 and proinflammatory cyto- kines and chemokines. Although the recognition of CpG DNA by B cells and plasmacytoid dendritic cells is mediated by TLR 9, these cell types differ in their ability to bind and respond to structurally distinct classes of CpG oligonucleotides. This work establishes that CXCL16, a membrane-bound scavenger receptor, influences the uptake, subcellular localization, and cytokine profile induced by D oligonucleotides. This is the first example of a surface receptor modifying the cellular specificity and nature of the immune response mediated by an intracellular TLR. The Journal of Immunology, 2006, 177: 1575–1580. Downloaded from lymphocytes and plasmacytoid dendritic cells (pDC)5 selectively recognizes and mediates the subcellular localization of play key roles in protecting the host from bacterial in- D ODN. B fection. Both cell types express TLR9, a pattern-recognition molecule that contributes to the detection of unmethylated Materials and Methods CpG motifs present at high frequency in bacterial DNA (1–3). Reagents Synthetic oligonucleotides (ODN) that express CpG motifs mimic Endotoxin-free ODN were synthesized at the Center for Biolgoics Evalu- http://www.jimmunol.org/ the immunostimulatory activity of bacterial DNA and have shown ation and Research core facility (Bethesda, MD). Sequences of ODN used efficacy in clinical trials as immunoprotective agents, vaccine ad- (5Ј33Ј) were: K3, ATCGACTCTCGAGCGTTCTC; K3-flip, ATG juvants, and/or for cancer therapy (4–6). CACTCTGCAGGCTTCTC; K23, TCGAGCGTTCTC; K24, TCGTTC Several structurally distinct classes of CpG ODN have been GTGTTCT; D19, GgtgcatcgatgcagGGGGG; D29, GgtgcacggtgcagGGGG; D35, GGtgcatcgatgcaggggGG; D no poly(G), GGtgcttcgatgcaaaaaAA and identified that differentially activate pDC vs B cells (7–8). D class D3CG, GGtcgatcgatcgaggggGG. Bases shown in capital letters are phos- ODN (also referred to as A class (7–9), contain a single palin- phorothioate, and those in lower case are phosphodiester. Note that control dromic CpG motif linked to a poly(G) tail at the 3Ј end. D ODN ODN maintained the structure and phosphorothioate composition of CpG trigger pDCs to produce high levels of IFN-␣ but fail to stimulate ODN. FITC or Cy3 was conjugated to the 5Ј end of some ODN. FITC- and PE-conjugated BDCA-2 and BDCA-4 magnetic cell isolation kits were B cells (9, 10). K-class ODN, referred to as B class by some in- by guest on September 26, 2021 purchased from Miltenyi Biotec. All other FITC-, PE-, and PE-Cy5-con- vestigators (7, 11–13), typically express multiple CpG motifs but jugated Abs were purchased from BD Pharmingen. lack a poly(G) tail. K ODN stimulate B cells to produce IgM and Polyclonal goat anti-human CXCL16 (purified and biotin labeled) and IL-6 while triggering pDC to produce TNF-␣ rather than IFN-␣ (7, matching affinity-purified isotype control goat IgG were obtained from 8, 11–13). Despite these differences in cellular specificity and R&D Systems. The CXCL16 encoding plasmid was obtained from Invi- voGen. Fucoidan and chondroitin sulfate were purchased from Sigma- functional activity, both K- and D-class CpG ODN are recognized Aldrich, GM6001 from Calbiochem, and O-sialoglycoprotein endopepti- by the same intracytoplasmic receptor (TLR 9) and signal through dase from Cedarlane Laboratories. LysoTracker Green and AlexaFluor a conserved TLR9–MyD88 pathway (14). Neither the mechanism 488-conjugate transferrin were purchased from Molecular Probes. underlying the differential cellular specificity of D vs K ODN, nor Cells and cell cultures their distinct functional effects, have been elucidated. In this study, we show that these differences can be attributed to CXCL16, a PBMCs and elutriated monocytes (2–4 ϫ 106/ml) from normal donors scavenger receptor expressed on human pDC but not B cells, that were obtained from the National Institutes of Health Department of Trans- fusion Medicine (Bethesda, MD). These were cultured in RPMI 1640 medium containing 5% FCS, 50 U/ml penicillin, 50 ␮g/ml streptomycin, 0.3 ␮g/ml L-glutamine, 1 ␮M nonessential amino acids, 1 ␮M sodium pyru- vate, 10 mM HEPES, and 10Ϫ5 M 2-ME. Cells were stimulated with 1–3 Section of Retroviral Research, Center for Biologics Evaluation and Research, Food ␮M ODN. Surface protein expression was modified/blocked by treating and Drug Administration, Bethesda, MD 20892 cells with 50 ␮M GM6001, 25 ␮g/ml O-sialoglycoprotein endopeptidase ␮ Received for publication February 15, 2006. Accepted for publication April 28, 2006. (from Pasteurella hemolytica), or 50 g/ml dextran sulfate, fucoidan, or chondroitin sulfate for 30 min at 37°C. The costs of publication of this article were defrayed in part by the payment of page HEK293 cells and stably transfected HEK293 cells expressing hTLR9 charges. This article must therefore be hereby marked advertisement in accordance were maintained in complete DMEM (10% FCS) medium as described with 18 U.S.C. Section 1734 solely to indicate this fact. previously (2). In some experiments, anti-CXCL16 or its isotype control 1 This work was supported in part by Military Interdepartmental Purchase Request were added to cells at a final concentration of 25 ␮g/ml. ODN binding was MM8926, and is not subject to US copyright. analyzed after 1 h, while changes in cytokine production and cell surface 2 The assertions in this study are the private ones of the authors and are not to be marker expression were examined after 4–48 h. construed as official or as reflecting the views of the Food and Drug Administration. 3 M.G. and I.G. contributed equally to this work. Flow cytometric analysis 4 Address correspondence and reprint requests to Dr. Dennis M. Klinman, Building Cells were washed in cold PBS and then fixed and stained with CD19 (B 29A, Room 3D 10, Center for Biologics Evaluation and Research, Food and Drug cells) or CD123 plus BDCA-2 (pDC) as described previously (10). Data Administration, Bethesda, MD 20892. E-mail address: [email protected] (20,000–50,000 events) were obtained using a FACSCalibur flow cytom- 5 Abbreviations used in this paper: pDC, plasmacytoid dendritic cell; ODN; oligo- eter (BD Biosciences) and analyzed using CellQuest software (BD nucleotide, SR; scavenger receptor; PRR, pattern-recognition receptor. Biosciences).

ELISA receptor might contribute to the recognition of D ODN. To eval- The 96-well microtiter plates (Millipore) were coated with Abs that rec- uate this possibility, pDC were treated with O-sialoglycoprotease ognize human IFN-␣, TNF-␣, IL-6, or IFN-␥-inducible protein 10 (10). (which digests membrane-bound receptors) or GM6001 (which The plates were blocked with PBS-5% BSA. Supernatants from cultured stabilizes membrane-bound molecules). Consistent with our hy- cells were added, and their cytokine content quantitated by the addition of pothesis, O-sialoglycoprotease significantly reduced D ODN me- biotin-labeled anti-cytokine Ab followed by phosphatase-conjugated avi- diated pDC activation, while GM6001 significantly increased this din and phosphatase-specific colorimeteric substrate. Standard curves were Ͻ generated using known amounts of recombinant human cytokine. All as- response ( p 0.05 for both parameters; Fig. 1A). Neither treat- says were performed in duplicate. ment had any effect on the stimulatory activity of K ODN, nor did an excess of K ODN block D ODN binding (Fig. 1B). Taken TLR9 assay together, these findings suggested that a molecule on the surface of A total of 5 ϫ 104 cells was transfected using FuGENE 6 (Roche) plus 0.5 pDC contributed to the recognition of D ODN but not of K ODN. ␮g of p5xNF-␬B-luc (both from Stratagene) and/or 1 ␮g of a CXCL16 ODN of the D class are characterized by their expression of a 3Ј expression vector for 24 h as described previously (2). Following stimu- poly(G) tail (7–9). Previous studies showed that removing this tail lation with ODN for 24 h, NF-␬B activation was determined using the luciferase assay as recommended by the manufacturer (Promega). Confocal microscopy CXCL16 or mock-transfected HEK293 cells expressing hTLR9 were incubated with 3 ␮M FITC-conjugated CpG ODN at 37°C for 20Ј and then stained for CXCL16 expression. To assess the subcellular distribution of Downloaded from ODN, cells were incubated with 3 ␮M Cy3-CpG ODN at 37°C for 60Ј together with 1 ␮M LysoTracker-Green (marker for the lysosomal com- partment) or 20 ␮g/ml transferrin-AlexaFluor 488 conjugate (marker for early endosomes). All samples were then analyzed using a confocal mi- croscope under a ϫ63 objective (Zeiss).

Results http://www.jimmunol.org/ D ODN activity is influenced by modifications of the pDC membrane Previous studies established that TLR9 alone is sufficient to confer cellular responsiveness to K but not to D ODN. For example, HEK293 cells became responsive to K but not D ODN when transfected to express TLR9 (8, 15). We postulated that a cell surface by guest on September 26, 2021

FIGURE 2. CXCL16 selectively interacts with D ODN. a, 0.04Ϫ1.0 ␮M biotin-conjugated K (f)orDODN(ⅷ) were incubated on plates coated FIGURE 1. D ODN activity is influenced by treatments that alter the with anti-CXCL16 Ab (dashed lines) plus recombinant CXCL16 (dark lines). cell surface proteins. A, PBMC from three to six donors were treated with ODN binding was detected colorimetrically using phosphatase-conjugated avi- 50 M GM6001 or 25 g/ml O-sialoglycoprotein endopeptidase for 30 min at din followed by K-Gold PNPT substrate. Results represent the average Ϯ SD 37°C. The cells were then stimulated with 3 ␮M D ODN or 1 ␮M K ODN of three independent experiments. b, HEK293 cells were transfected to express for 24 h and cytokine production monitored by ELISA. The change in CXCL16 and/or TLR9. Forty-eight hours later, cells were washed and incu- cytokine levels was calculated for each donor independently, and then av- bated with 1 ␮M FITC-ODN for 10 min at 37°C. Mean fluorescence intensity eraged. B, Purified pDC were incubated with 50 g/ml the SR ligands dex- (MFI) determined by flow cytometry is shown for mock-transfected cells tran sulfate (DS) or fucoidan or a 50-fold molar excess of cold-competitor (open bars), cells transfected with CXCL16 (black stripes), TLR9 (gray bars) ODN. Chondroitin sulfate (CS) was included as a negative control. The or CXCL16 plus TLR9 (gray bars with black stripes). Results represent the binding of 1 ␮M FITC-conjugated ODN was monitored by flow cytometry. mean Ϯ SD of four independent experiments. c, CXCL16 transfected HEK293 Results represent the mean Ϯ SD of three independent experiments. C, cells were incubated with 3 ␮M FITC-conjugated CpG ODN (green) at 37°C Purified pDC were stimulated with K or D ODN with or without dextran for 20 min and then stained for CXCL16 expression (red). Confocal micros- sulfate. Up-regulation of HLA-DR and CD54 expression was analyzed by copy identifies the colocalization of ODN with CXCL16 (yellow). Results are ;p Ͻ 0.01 ,ءء ;p Ͻ 0.05 ,ء .FACS. Note that dextran sulfate significantly reduced the ability of D, but representative of six independent experiments .p Ͻ 0.05. Student’s t test ,ء .not, K ODN to up-regulate HLA-DR/CD54 expression The Journal of Immunology 1577

CXCL16 in D ODN binding, HEK293 cells transfected to express CXCL16 significantly improved their recognition of D but not K ODN ( p Ͻ 0.001, Fig. 2b). Confocal microscopy of these transfected cells showed that the D ODN colocalized with CXCL16 on the cell surface (Fig. 2c). The effect of CXCL16 expression on responsiveness to D and K ODN was then evaluated. Consistent with previous results, HEK 293 cells transfected with TLR9 alone gained responsiveness to K but not D ODN. This was reflected by a significant increase in their expression of NF-␬B and secretion of IL-8 ( p Ͻ 0.01, Fig. 3). In FIGURE 3. HEK293 cells (open bars) were transfected with p5xNF- ␬B-luc plus CXCL16 (black stripes), TLR9 (gray bars), or CXCL16 plus contrast, responsiveness to D ODN required that HEK293 cells be Ͻ TLR9 (gray bars with black stripes). Cells were then stimulated with ODN transfected to express both TLR9 and CXCL16 ( p 0.01, Fig. 3). for 24 h. a, NF-␬B production was monitored by luciferase expression. Both the binding and activation of CXCL16 transfected cells were Fold induction in NF-␬B production over control ODN-treated samples is abrogated by removal of the poly(G) tail from the D ODN (Fig. 2b shown. b, IL-8 levels in culture supernatants were measured by ELISA. and data not shown). Taken together, these findings indicate that D Data represent the average of three independent experiments. Similar re- ODN preferentially bind to cells that express CXCL16 but that sults were obtained in studies of three different D and K ODN (see Mate- cells must express both CXCL16 and TLR9 to become function- .p Ͻ 0.01, Student’s t test. ally responsive to D ODN ,ءء .(rials and Methods for sequence data Downloaded from D ODN preferentially activate pDCs expressing CXCL16 reduced the binding and abrogated the stimulatory interaction of D ODN with target cells (7, 16–18). Because members of the scav- FACS analysis of human PBMCs showed that 25–40% of pDC enger family of surface receptors are known to bind molecules expressed CXCL16 on their surface, whereas B cells were expressing poly(G) motifs (19, 20), we examined whether ligands CXCL16negative (Fig. 4). This pattern of CXCL16 expression (con- that block scavenger receptors (SR) might inhibit D ODN-medi- firmed by RT-PCR analysis of mRNA from purified cell popula- ated cellular activation. As seen in Fig. 1B, two different SR li- tions) paralleled the ability of D ODN to stimulate pDC but not B http://www.jimmunol.org/ gands, dextran sulfate and fucoidan, significantly reduced D ODN cells. It also raised the possibility that only those pDC that ex- binding to pDC ( p Ͻ 0.01). Dextran sulfate also inhibited the pressed CXCL16 might be responsive to D ODN. Consistent with ability of D ODN to up-regulate HLA-DR/CD54 expression by such a possibility, CXCL16bright pDC were uniquely triggered by pDCs (Fig 1C). These SR ligands had no effect on the binding or D ODN to secrete IFN-␣ (p Ͻ 0.001, Fig. 5). By comparison, both activity of K ODN (which do not express a poly(G) tail). the CXCL16bright and CXCL16dull/negative pDC responded to K ODN by producing TNF-␣ (Fig. 5). Similar results were obtained CXCL16 enhances the uptake and stimulatory activity of when pDC were sort purified on the basis of CXCL16 expression: D ODN bright

only the population enriched for CXCL16 cells up-regulated by guest on September 26, 2021 CXCL16 is a scavenger receptor when expressed on the surface of HLA-DR/CD86 expression in response to D ODN whereas both bright dull/negative pDCs and acts as a chemokine when proteolytically cleaved and CXCL16 and CXCL16 populations responded to K released into the circulation (21–27). Based on the ﬁnding that SR ODN (Fig. 6). ligands block the recognition of D ODN, we examined whether CXCL16 played a role in D ODN uptake. In vitro studies showed that recombinant puriﬁed CXCL16 bound to various D-type ODN in a dose-dependent manner but did not bind to K ODNs ( p Ͻ 0.001, Fig. 2a and data not shown). Consistent with a role for

FIGURE 5. D ODN selectively stimulate pDCs that express CXCL16. PBMCs were cultured with control, K, or D ODN in the presence of brefel- FIGURE 4. CXCL16 is present on the surface of pDCs but not B cells. din A (10 g/ml) for 4.5 h (TNF-␣) or 12 h (IFN-␣, with brefeldin A being PBMCs were stained with anti-CXCL16 or an isotype-matched control added after 8-h incubation). Intracytoplasmic staining was used to identify serum. pDCs were enriched from human PBMC using the BDCA-4 mag- cells secreting TNF-␣ or IFN-␣, while pDC were identified on the basis of netic cell separation kit, and identified on the basis of CD123 and BDCA-2 size, CD123 and BDCA-2 expression. Cross-grids were established based expression. B cells were identified on the basis of CD19 expression. Cross- on staining with the control serum. Results are representative of three in- grids were established based on staining with the control serum. Data are dependent experiments showing that CXCL16 expression influences pDC representative of five independent experiments. responsiveness to D ODN. 1578 CXCL16 MEDIATES RECOGNITION OF CpG ODNs

FIGURE 6. pDC lacking CXCL16 do not respond to D ODN. BDCA-

2/CD123 double-positive pDC were sorted on the basis of CXCL16 ex- Downloaded from pression. Sorting parameters were established to yield a CXCL16 negative population that was 99% pure, while enriching the CXCL16 positive population to 35%. Both populations were stimulated with K or D ODN for 24 h. Note that K ODN stimulated both populations to up-regulate expression of HLA-DR/CD86, while D ODN stimulated only that population containing CXCL16-positive pDC. FIGURE 7. Expression of CXCL16 by HEK293 cells stably transfected with TLR9 alters intracellular trafficking of D ODN. HEK293 cells stably http://www.jimmunol.org/ transfected with TLR9 were mock transfected or transfected with CXCL16. Anti-CXCL16 Ab blocks D ODN-mediated immune activation Cells were incubated with Cy3-CpG ODN plus either the lysosomal marker pDC were stimulated with K or D ODN in the presence of 25 LysoTracker-Green or the early endosomal marker transferrin-Alexa488 at ␮g/ml polyclonal goat anti-human CXCL16 Ab. As seen in Table 37°C. The localization of ODN in specific vesicles was determined after Ј I, this treatment significantly reduced the binding and stimulatory 60 by confocal microscopy. activity of D ODN ( p Ͻ 0.001). Isotype-matched control goat antiserum had no such effect, while anti-CXCL16 Abs did not reduce the binding or stimulation mediated by K ODN (Table I). examined whether CXCL16 altered the intracellular localization of by guest on September 26, 2021 These findings support the conclusion that CXCL16 recognizes CpG ODN. and contributes to the activation mediated by D, but not K, ODN. HEK293 cells stably transfected to express TLR9 were used to examine the effect of CXCL16 on D ODN internalization. As CXCL16 alters the intracellular localization of D ODN shown previously, K ODN accumulated in the lysosomal vesicles of these HEK293/TLR9 cells (Fig. 7). Neither the uptake nor lo- Although both classes of CpG ODN bind to and activate pDC, K calization of K ODN was affected by coexpression of CXCL16 ODN stimulate these cells to produce TNF-␣ whereas D ODN (Fig. 7). In contrast, the presence of CXCL16 significantly altered trigger them to secrete IFN-␣ (8, 9, 14). Recent findings demon- the uptake and intracellular localization of D ODN (Fig. 7). In the strate that TNF-␣ production dominates when CpG stimulation absence of CXCL16, D ODN mimicked K ODN by trafficking to proceeds through the TLR9–MyD88–IRF5 pathway, whereas lysosomal vesicles. When CXCL16 was present, the uptake of D IFN-␣ production dominates when the TLR9–MyD88–IRF7 path- rose significantly, and the ODN then localized to transferrin-con- way is used (28, 29). Because the former pathway dominates in taining recycling endosomes (Fig. 7) (30). lysosomal vesicles and the latter in early endosomes (28, 29), we Discussion Table I. Anti-CXCL16 Ab selectively blocks the binding and activity of This work demonstrates that CXCL16, a receptor expressed on the D ODN surface of pDC, contributes to the binding, uptake, and stimulatory activity of D-type CpG ODN. This interaction resulted in the ac- Percent Inhibition of cumulation of D ODN in early endosomes rather than lysosomal Stimulus Blocker Bindinga Cytokineb HLA-DR/CD8c vesicles, thereby altering the type of cytokine produced by acti- vated pDC. In this context, the TLR9-MyD88 signaling pathway D ODN Anti-CXCL16 78.4 Ϯ 0.4* 85.0 Ϯ 7.6* 68.7 Ϯ 8.9** triggered by D ODN in early endosomes proceeds through IRF7 Ϯ Ϯ Ϯ D ODN Control Ab 5.3 4.4 12.2 8.7 6.7 3.9 and culminates in the production of IFN-␣, whereas the TLR9- K ODN Anti-CXCL16 10.7 Ϯ 3.4 14.4 Ϯ 20.8 1.4 Ϯ 5.8 MyD88 signaling pathway that occurs in lysosomal vesicles uses PBMCs were stimulated with 3 ␮MDor1␮M K ODN. The percentage of IRF5 and culminates in the production of TNF-␣ (28, 29). Our inhibition of ODN-induced binding, cytokine production, and HLA-DR/CD86 expression mediated by the addition of 25 ␮g/ml anti-CXCL16 or isotype matched observation that CXCL16 impacts the intracellular localization of control Ab is shown. Results represent the mean Ϯ SD of three independently eval- D ODN is supported by the recent work of Honda et al. (28) show- uated donors per group. ing that K ODN localize to lysosomal vesicles whereas D ODN a Binding of FITC-conjugated ODN to CD123/BDCA-2 double-positive pDC was monitored by FACS. persist in early endosomal vesicles. The effect of ODN location on b Cytokine levels in culture supernatants after 24 h of stimulation (IFN-␥-induc- cytokine production is consistent with evidence that K ODN tar- ible protein 10 for K ODN and IFN-␣ for D ODN) were assessed by ELISA. c Changes in HLA-DR and CD86 expression were determined by FACS. geted to early endosomes (by encapsulation in DOTAP liposomes) *, p Ͻ 0.05; **, p Ͻ 0.01. trigger the production of IFN-␣ rather than TNF-␣ (28, 31–32). The Journal of Immunology 1579

The observation that a cell surface receptor contributes to D Acknowledgments ODN recognition is supported by several findings. 1) Treatment We thank Jacquelin Conover for technical assistance, and Drs. William that inhibited the degradation of surface membrane proteins Paul, Fred Steinberg, and Georgio Trinchieri for helpful comments on the (GM6001) increased D mediated pDC activity, while digestion of manuscript. membrane proteins (O-sialoglycoprotease) had the opposite effect (Fig. 1). Of note, GM6001 and O-sialoglycoprotease are known to Disclosures modulate CXCL16 expression (23, 24, 26), with the magnitude of M. Gursel, I. Gursel, and D. M. Klinman are inventors on patents con- this effect being proportional to observed changes in D ODN-me- cerning the use of CpG DN and the influence of CXCL16. These patents diated pDC activation (data not shown). 2) The scavenger receptor are owned by the Food and Drug Administration, and some are licensed to Coley Pharmaceuticals. ligands dextran sulfate and fucoidan selectively inhibited the pDC activation mediated by D but not K ODN (Fig. 1). 3) Both in vitro References binding studies and in vivo confocal analysis indicated that 1. Hemmi, H., O. Takeuchi, T. Kawai, S. Sato, H. Sanjo, M. Matsumoto, CXCL16 interacted with D ODN (Fig. 2). 4) Transfection studies K. Hoshino, H. Wagner, K. Takeda and S. Akira. 2000. A Toll-like receptor established that CXCL16 expression improved cellular uptake of recognizes bacterial DNA. Nature 408: 740–745. 2. Takeshita, F., C. A. Leifer, I. Gursel, K. Ishii, S. Takeshita, D ODN, although activation required that cells express both M. Gursel and D. M. Klinman. 2001. Cutting edge: role of Toll-like receptor 9 in CXCL16 and TLR9 (Fig. 3). 5) D ODN binding and activation CpG DNA-induced activation of human cells. J. Immunol. 167: 3555–3558. were abrogated by the addition of anti-CXCL16 Ab (Table I). Fi- 3. Hornung, V., S. Rothenfusser, S. Britsch, A. Krug, B. Jahrsdorfer, T. Giese, S. Endres and G. Hartmann. 2002. Quantitative expression of Toll-like receptor nally, only those pDCs expressing CXCL16 were responsive to D 1–10 mRNA in cellular subsets of human peripheral blood mononuclear cells and ODN, whereas both CXCL16-positive and CXCL16-negative sensitivity to CpG oligodeoxynucleotides. J. Immunol. 168: 4531–4537. Downloaded from 4. Klinman, D. M. 2004. Immunotherapeutic uses of CpG oligodeoxynucleotides. pDC responded to K ODN (Figs. 5 and 6). In all experiments, Nat. Rev. Immunol. 4: 249–258. CXCL16 expression had no impact on the binding or activation 5. Klinman, D. M., D. Currie, I. Gursel, and D. Verthelyi. 2004. Use of of CpG mediated by K ODN, while control antiserum had no effect on D oligodeoxynucleotides as immune adjuvants. Immunol. Rev. 199: 201–216. 6. Krieg, A. M. 2004. Antitumor applications of stimulating Toll-like receptor 9 ODN-mediated cell activation. with CpG oligodeoxynucleotides. Curr. Oncol. Rep. 6: 88–95. An important distinction between CpG ODN classes is that D 7. Verthelyi, D., K. J. Ishii, M. Gursel, F. Takeshita, and D. M. Klinman. 2001. ODN uniquely express a poly(G) tail. Previous studies established Human peripheral blood cells differentially recognize and respond to two distinct http://www.jimmunol.org/ CpG motifs. J. Immunol. 166: 2372–2377. that these poly(G) motifs contribute to the formation of higher- 8. Vollmer, J., R. Weeratna, P. Payette, M. Jurk, C. Schetter, M. Laucht, T. Wader, ordered structures (G-tetrads) via intermolecular Hoogsteen bonds S. Tluk, M. Liu, H. L. Davis, and A. M. Krieg. 2004. Characterization of three CpG oligodeoxynucleotide classes with distinct immunostimulatory activities. (19, 20, 33–35). Although the molecular specificity of CXCL16 is Eur.J. Immunol. 34: 251–262. not well known, a number of scavenger receptors recognize struc- 9. Krug, A., S. Rothenfusser, V. Hornung, B. Jahrsdorfer, S. Blackwell, tures containing G-tetrads (19, 20, 34–35). In this context, control Z. K. Ballas, S. Endres, A. M. Krieg and G. Hartmann. 2001. Identification of CpG CpG oligonucleotide sequences with high induction of interferon-␣␤ in ODNs lacking a poly(G) tail, but otherwise identical in sequence plasmacytoid dendritic cells. Eur. J. Immunol. 31: 2154–2163. to stimulatory D ODNs, were unable to bind CXCL16 in vitro or 10. Gursel, M., D. Verthelyi, I. Gursel, K. J. Ishii, and D. M. Klinman. 2002. Dif- ferential and competitive activation of human immune cells by distinct classes of stimulate pDCs in vivo (Fig. 2 and data not shown). These findings CpG oligodeoxynucleotide. J. Leukocyte Biol. 71: 813–820. by guest on September 26, 2021 indicate that the poly(G) tail of D ODN may play an important role 11. Hartmann, G., and A. M. Krieg. 2000. Mechanism and function of a newly in CXCL16 recognition. identified CpG DNA motif in human primary B cells. J. Immunol. 164: 944–953. 12. Hartmann, G., G. J. Weiner, and A. M. Krieg. 1999. CpG DNA: a potent signal Cells of the innate immune system rely on a restricted number for growth, activation and maturation of human dendritic cells. Proc. Natl. Acad. of germline encoded pattern recognition receptors (PRR) to detect Sci. USA 96: 9305–9310. invasive pathogens. Most PRRs are expressed on the cell surface, 13. Kwon, H. J., K. W. Lee, S. H. Yu, J. H. Han and D. S. Kim. 2003. NF-␬B- dependent regulation of tumor necrosis factor-␣ gene expression by CpG-oli- where they come into direct contact with circulating pathogens. godeoxynucleotides. Biochem. Biophys. Res. Commun. 311: 129–138. Ancillary receptors have been described that improve pathogen 14. Hemmi, H., T. Kaisho, K. Takeda, S. Akira. 2003. The roles of Toll-like receptor 9, MyD88, and DNA-dependent protein kinase catalytic subunit in the effects of recognition by surface bound TLRs (such as dectin-1 with TLR2 two distinct CpG DNAs on dendritic cell subsets. J. Immunol. 170: 3059–3064. and CD36 with TRL2/6). However, these interactions do not alter 15. Klinman, D. M., F. Takeshita, I. Gursel, C. Leifer, K. J. Ishii, D. Verthelyi, and the specificity of ligand binding or the nature of the ensuing im- M. Gursel. 2002. CpG DNA: Recognition by and activation of monocytes. Mi- crobes Infect. 4: 897–901. mune response (36–38). In contrast, intracellular PRRs (e.g., 16. Dalpke, A. H., S. Zimmermann, I. Albrecht, and K. Heeg. 2002. Phosphodiester TLRs 7–9) cannot directly sense circulating pathogens (39). In the CpG oligonucleotides as adjuvants: polyguanosine runs enhance cellular uptake case of TLR9, current findings indicate that this limitation can be and improve immunostimulative activity of phosphodiester CpG oligonucleotides in vitro and in vivo. Immunology 106: 102–112. overcome by an ancillary surface receptor. Results show that 17. Bartz, H., Y. Mendoza, M. Gebker, T. Fischborn, K. Heeg, and A. Dalpke. 2004. CXCL16 both improves the uptake of D ODN and directs them Poly-guanosine strings improve cellular uptake and stimulatory activity of phosphodiester CpG oligonucleotides in human leukocytes. Vaccine 23: 148–155. into endosomes rather than lysosomal vesicles, thereby shifting the 18. Lee, S. W., M. K. Song, K. H. Baek, Y. Park, J. K. Kim, C. H. Lee, H. K. Cheong, response of pDC away from TNF-␣ and toward IFN-␣ production. C. Cheong, and Y. C. Sung. 2000. Effects of hexameric deoxyriboguanosine run Current findings demonstrate that CXCL16 contributes to the rec- conjugation into CpG oligodeoxynucleotides on their immunostimulatory poten- tials. J. Immunol. 165: 3631–3639. ognition of D ODN but do not exclude the possibility that other 19. Pearson, A. M., A. Rich, and M. Krieger. 1993. M. Polynucleotide binding to cell surface receptors contribute to the uptake of this or other TLR macrophage scavenger receptors depends on the formation of base-quartet sta- bilized four-stranded helices. J. Biol. Chem. 268: 3546–3554. ligands. 20. Suzuki, K., T. Doi, T. Imanishi, T. Kodama, T. Tanaka. 1999. Oligonucleotide In a broader context, these results indicate that ancillary mem- aggregates bind to the macrophage scavenger receptor. Eur J. Biochem. 260: brane receptors can influence the cellular specificity, magnitude 855–860. 21. Shimaoka, T., N. Kume, M. Minami, K. Hayashida, H. Kataoka, T. Kita, and and nature of the immune response induced by TLR ligands. This S. Yonehara. 2000. Molecular cloning of a novel scavenger receptor for oxidized could benefit the host by expanding the repertoire of responses low density lipoprotein, SR-PSOX on macrophages. J. Biol. Chem. 275: generated by a limited number of highly conserved PRR. Because 40663–40666. 22. Shimaoka, T., T. Nakayama, N. Kume, S. Takahashi, J. Yamaguchi, M. Minami, members of the TLR family must recognize and protect against a K. Hayashida, T. Kita, J. Ohsumi, O. Yoshie, and S. Yonehara. 2003. Cutting wide array of infectious pathogens, the possibility that TLR activ- edge: SR-PSOX/CXC chemokine ligand 16 mediates bacterial phagocytosis by APCs through its chemokine domain. J. Immunol. 171: 1647–1651. ity is modified by additional surface receptors has broad biologic 23. Gough, P. J., K. J. Garton, P. T. Wille, M. Rychlewski, P. J. Dempsey, and implications. E. W. Raines. 2004. A disintegrin and metalloproteinase 10-mediated cleavage 1580 CXCL16 MEDIATES RECOGNITION OF CpG ODNs

and shedding regulates the cell surface expression of CXC chemokine ligand 16. dritic cells profoundly affects innate resistance functions. J. Immunol. 174: J. Immunol. 172: 3678–3685. 727–734. 24. Matloubian, M., A. David, S. Engel, J. E. Ryan, and J. G. Cyster. 2000. A 32. Wattiaux, R., M. Jadot, N. Laurent, F. Dubois, and S. Wattiaux-De Coninck. transmembrane CXC chemokine is a ligand for HIV-coreceptor Bonzo. Nat. Im- 1996. Cationic lipids delay the transfer of plasmid DNA to lysosomes. Biochem. munol. 1: 298–304. Biophys. Res. Commun. 227: 448–454. 25. Tabata, S., N. Kadowaki, T. Kitawaki, T. Shimaoka, S. Yonehara, O. Yoshie, and 33. Kerkmann, M., L. T. Costa, C. Richter, S. Rothenfusser, J. Battiany, V. Hornung, T. Uchiyama. 2005. Distribution and kinetics of SR-PSOX/CXCL16 and CXCR6 ϩ J. Johnson, S. Englert, T. Ketterer, W. Heckl, et al. 2005. Spontaneous formation expression on human dendritic cell subsets and CD4 T-cells. J. Leukocyte Biol. of nucleic-acid based nanoparticles is responsible for high interferon-␣ induction 77: 777–786. by CpG-A in plasmacytoid dendritic cells. J. Biol. Chem. 280: 8086–8093. 26. Shimaoka, T., T. Nakayama, N. Fukumoto, N. Kume, S. Takahashi, 34. Kaur, H., L. Jaso-Friedmann, and D. L. Evans. 2003. Identification of a scavenger J. Yamaguchi, M. Minami, K. Hayashida, T. Kita, J. Ohsumi, et al. 2004. Cell- receptor homologue on nonspecific cytotoxic cells and evidence for binding to surface anchored SR-PSOX/CXC chemokin ligand 16 mediates firm adhesion of oligodeoxyguanosine. Fish Shellfish Immunol. 15: 169–181. CXC chemokine receptor 6-expressing cells. J. Leukocyte Biol. 75: 267–274. 35. Kaur, H., L. Jaso-Friedmann, J. H. Leary III, and D. L. Evans. 2004. Single-base 27. Abel, S., C. Hundhausen, R. Mentlein, A. Schulte, T. A. Berkhaut, N. Broadway, oligodeoxyguanosine-binding proteins on nonspecific cytotoxic cells: identifica- D. Hartmann, R. Sedlacek, S. Dietrich, B. Muetze, et al. 2004. The transmem- tion of a new class of pattern-recognition receptor. Scand. J. Immunol. 60: brane CXC-chemokine ligand 16 is induced by IFN-␥ and TNF-␣ and shed by the 238–248. activity of the disintegrin-like metalloproteinase ADAM 10. J. Immunol. 172: 6362–6372. 36. Mukhopadhyay, S., J. Herre, G. D. Brown, and S. Gordon. 2004. The potential 28. Honda, K., Y. Ohba, H. Yanai, H. Negishi, T. Mizutani, A. Takaoka, C. Taya, and for Toll-like receptors to collaborate with other innate immune receptors. Immu- T. Taniguchi. 2005. Spatiotemporal regulation of MyD88-IRF-7 signalling for nology. 112: 521–530. robust type-I interferon induction. Nature 434: 1035–1040. 37. Gantner, B. N., R. M. Simmons, S. J. Canavera, S. Akira, and D. M. Underhill. 29. Asselin-Paturel, C., and G. Trinchieri. 2005. Production of type I interferons: 2003. Collaborative induction of inflammatory responses by dectin-1 and toll-like plasmacytoid dendritic cells and beyond. J. Exp. Med. 202: 461–465. receptor 2. J Exp. Med. 197: 1107–1117. 30. Baravalle, G., D. Schober, M. Huber, N. Bayer, R. F. Murphy, and R. Fuchs. 38. Hoebe, K., P. Georgel, S. Rutschmann, X. Du, S. Mudd, K. Crozat, S. Sovath, 2005. Transferrin recycling and dextran transport to lysosomes is differentially L. Shamel, T. Hartung, U. Zahringer, and B. Beutler. 2005. CD36 is a sensor of affected by bafilomycin, nocodazole and low temperature. Cell Tissue Res. 320: diacylglycerides. Nature 433: 523–527. Downloaded from 99–113. 39. Nishiya, T., and A. L. DeFranco. 2004. Ligand-regulated chimeric receptor ap- 31. Gerosa, F., A. Gobbi, P. Zorzi, S. Burg, F. Briere, G. Carra, and G. Trinchieri. proach reveals distnctive subcellular localization and signaling properties of the 2005. The reciprocal interaction of NK cells with plasmacytoid or myeloid den- Toll-like receptors. J. Biol. Chem. 279: 19008–19017. http://www.jimmunol.org/ by guest on September 26, 2021