Impact of Floods/ Landslides on Biodiversity”

PROJECT REPORT

2 RIVERINE BIODIVERSITY 0 MONITORING - IMPACT OF FLOODS/ 1 LANDSLIDES ON BIODIVERSITY

NIRMALA ARTS AND SCIENCE COLLEGE

DEPARTMENT OF BOTANY (Affiliated to Mahatma Gandhi University, Kottayam) Kizhakkekara, Ernakulam District, Muvattupuzha, Kerala - 686661

KERALA STATE BIODIVERSITY BOARD

Thiruvananthapuram, Kerala- 695 011

Kerala State Biodiversity Board Nirmala arts and Science College.

Dr. N. Shibin Mohanan (Principal Investigator) Dr. Sibi C Varghese (Co- Principal Investigator)

All rights reserved. No part of this litterature may be reproduced in any written, electronic, recording, or photocopying without written permission of the publisher or author. The exception would be in the case of brief quotations embodied in the critical articles or reviews and pages where permission is specifically granted by the publisher or author. No liability is assumed for damages that may result from the use of information contained within.

Cover Design (edited): Wafha K.A Photographes: Jibin James & Bibinlal Ramakrishnan Images displayed are the property of their respective photographers. Images may not be redisplayed on another web site without permission of the photographer and pei cobb freed & partners.

2 “RIVERINE BIODIVERSITY MONITORING - IMPACT OF FLOODS/ LANDSLIDES ON BIODIVERSITY”

Submitted to

Nirmala Arts and Science College Name and address of the institute Muvattupuzha Ernakulam

“Riverine Biodiversity Monitoring - Impact of Title of the Project floods/ landslides on Biodiversity” Project sanction number A8/3371/2018/KSBB Date of Project sanction 15/12/2018 Fund released 7,00,000/- Fund Utilised 7,01,483/- Dr. N. Shibin Mohanan (Principal Investigator) Dept. Of Botany, Nirmala college

Dr. Sibi C Varghese (Co- Principal Name and address of Project investigators Investigator) Dept. Of Botany, Nirmala College

Mr. Jibin James (M.Sc. Biotechnology) Mr. Bibinlal Ramakrishnan (M.Sc. Environment science and Management) Project staffs Ms. Wafha K.A (M.Sc. Microbiology) Ms. Logia Jolly (M.Sc. Biotechnology) Ms. Neena Benny (M.Sc. Microbiology)

Date of commencement of actual work on January 1 2019 the project Period completed April 31 2019

4 Microbes an integral part of ecosystem known to influence on surrounding ecosystem stability. Therefore, the landslides are crucial in microbial biodiversity disturbance, caused by the natural and anthropogenic activities. Which alter the soil profile, texture and washout the microbes, effect plant growth promotion and may also result in the invasion of pathogens. The present study concentrates on the landslides that have occurred in the Udumbanchola Taluk in Idukki district during the deluge in August 2019. During the course of the present study, soil samples collected from twenty-three landslide-affected sites along with control from Idukki district of Kerala after five months of land disturbance. The preliminary analysis of our study shows that there is a notable loss in microbial diversity and population in top soil when compared to that in the control samples. To study the NPK retention and restoration capacity. Analysis of the bacteria with the ability to contribute to the NPK ratio of the soil done by culturing isolates on special Medias such as Alexandrows media, Ashbys media, Starkeys media and Pikovaskys media. About 90 percentage of them were Nitrogen fixing and few were phosphate solubilizing and very few were potassium solubilizers. In order to validate our preliminary results, Barcoding of selected samples done using 16S rRNA gene. Several plant pathogens (Bacillus sp), clinical pathogens (Clostridium sp, Marseille sp, Roseomonas sp, Staphylococcus sp, Arthrobacter sp, Serratia sp, and Bacillus sp) and plant growth promoters (Bacillus sp, Staphylococcus sp, Effusibacillus sp, Sinomonas sp, Streptomyces sp, Pseudarthrobacter sp, Arthrobacter sp, Paenibacillus sp, Rhodococcus sp, Brachybacterium sp, and Lysinibacillus sp) were isolated from affected area. The results of the present study show that microbial diversity is severely altered by landslides and may impact secondary succession. Based on the microbial isolates identified a possible role of microbial population in determining landslide susceptible areas is suggested. A string of indicative factors for possible prediction of landslide susceptible area as well as mitigation methods have been suggest to restore the areas affected by landslides.

6 16SrRNA Primers

PCR cycling conditions

Landslided areas of Udumbanchola Taluk preferred for soil sample collection significant difference of soil samples especially in soil texture

The total plate count results of all 55 soil samples (NB01- NB55), expressed as log of CFU (colony forming unit) per 1 g dry soil. NPK profile of selected dominant isolated from each soil sample (NB01-NB55) The colony characteristics of all isolates obtained from soil sample (NB01-NB55) of Udumbanchola Taluk of Idukki District by spread plate method

Blast results of isolates with its similarity

Characteristics of selected dominant isolates from each sample site

7 Landslided areas of Udumbanchola Taluk selected for soil sample collection

Soil Samples collected from 23 locations of Udumbanchola Taluk

Serial dilution and agar plate method of all soil samples (NB01-NB55) on three different medias (Nutrient agar, Ashby’s media and LB agar) from each dilution 10-3,10-4 and 10-5 Subcultured microbial isolates of all soil samples (NB01- NB55) obtained from serial dilution and spread plating methods Nitrogen fixing, Potassium solubilisation, Phosphate solubilisation and Sulphur degradation test results of selected isolates from soil sample (NB01-NB55)

1500bp long 16SrRNA gene PCR amplification product

Eluted PCR amplified product 1500bp length

Eluted PCR amplified product 1500bp length.

8 Comparison of microbial population between top and bottom 29 soil of post-flood affected areas Comparison of microbial diversity between top and bottom 30 soil of post-flood affected areas. The overall Microbial Population variation/loss on affected 30 areas by compared with unaffected. Graphical representation of colony characteristics of all 39 isolates obtained from soil samples (NB01-NB55) The presence of pathogens and growth promoters of 56 Udumbanchola Taluk by pre flood analysis The presence of pathogens and growth promoters of 56 Udumbanchola Taluk by post flood analysis

Landslides or landslips are natural disasters, which involves falling, toppling, sliding, spreading or flowing of rocks and other debris of variable sizes due to gravity. Landslides have multiple causes. It can be trigger by various environmental factors like rainfall, snowmelt, changes in water level, stream erosion, changes in ground water level, volcanic activity, earthquakes and human activities. It occurs throughout the world, especially in certain hotspots (Nadim et al., 2006). In India, landslide are among the major hydro-geological hazard especially in Himalayas, the north eastern hill ranges, the Western Ghats, Eastern Ghats, Nilgiri etc. Similarly, Western Ghats in the peninsular shield area are prone to landslides by the climatic change. In Kerala, Idukki is located in Western Ghats densely covered with forest and are highly populated. Idukki district was one of the worst affected areas due to the landslides triggered by the heavy rainfall in August 2018 (Central Water Commission, 2018). From data of state government authorities, these areas are highly fragile (District Disaster Management Plan Idukki, 2015).

The intensity of landslide in these regions were directly correlated to the magnitude of rainfall, vegetative cover, sharpness of slope, degree of folding, faulting and bedding plane of rocks. Combination of such environmental and human activities make a slope vulnerable to sliding. Moreover, the impact of landslide will also cause significant ecological disturbance (Geertsema and Pojar, 2007) like change in biodiversity distribution, density and abundance, and vegetative loss by the depletion of natural resources. Biodiversity, a hereditary based variation of local community and extremely important part of life on earth (Wilson et al., 1997). Which is closely relate to the environmental stability, have significance in understanding the composition, updates of life sustaining goods and services particular in soil habitat. So the conservation strategies for biodiversity benefits to livelihood sustainability, especially during the natural disasters (Marten et al., 2009).

Microbial biodiversity, which is significant in soil carbon turnover, organic matter decomposition, soil fertility, water quality, respond rapidly to the environmental change, (Van et al., 2008). These approaches should try to understand and predict the changes in microbial diversity on soil ecosystem (Pierre et al., 2018). Billions of microbial species suspected to exist yet less than 5% have characterized. Microbes play critical role in modifying the physical structure of soil and in making it habitable for plants. Microbial products also determine the

1 hydrophobicity and wettability of soil (Aislabie and Deslippe, 2013). However, anthropogenic environmental changes leads to rapid decline of soil microbial diversity. Such disturbances negatively impacts these diverse inter relationships (Galand et al., 2016).

Ecosystem stability is strongly relate to human induced and natural disturbances. Therefore, understanding the effects of these disturbances is required to understand the challenge faced by the ecosystem and to anticipate the dynamic response to multiple sequential disturbances (O’Gorman et al., 2012). Disturbance are a strong driver of microbial dynamics, and have major influence on earth’s biogeochemical cycle (Falkowski et al., 2008). On sequential disturbance, the first one could mediate the ecosystem response to second disturbance (Crain et al., 2008; Darling and Côte, 2008; Philippot et al., 2008; Jackson et al., 2016; Jurburg et al., 2017), so the increased ecosystem adaptability and survival of microbial communities highlight history of disturbance regimes. However, this approach undeniably contribute to improving the understanding of soil texture, function, mineral composition and stability. It gives limited information regarding the prediction of ecosystem response to the next disturbance (Calderón et al., 2018). The disturbance that affect the diversity can be heat , heavy metal (Griffiths et al., 2001; Kuan et al., 2006; Banning and Murphy, 2008), antibiotics (Westergåård et al., 2001), oil (Franco et al., 2004), heavy rainfall (Steenwerth et al., 2005), landslides (Marten et al., 2009), earthquakes, tsunami, wildfire, violent windstorms, floods etc.

Another important factor that disturb soil microbes are degree availability of organic matter. Usually it is found in all soil layers and tend to be higher in top layers due to the absence of organic matter. It plays critical role in ecosystem services such as, decomposition and cycling of major elements such as carbon, nitrogen and phosphorous. These microbes provide important macro-micro nutrients and tolerance towards drought, heat, insects and diseases to plants (Marilyn, 2008). So the disturbance made by landslide shows variability especially in the distribution of soil organic matter which may result in the loss of microbial diversity (Blonska et,al, 2016). Usually the upper part strongly eroded, which restrict the biological activities (Blonska et,al, 2018) and the nutrients wash out causing disturbances to microbial diversity in areas adjacent to landslide (Larsen et al, 2010). Moreover, the invasive microbes could play a role in disturbed ecosystem (Liebhold et al., 1995; Gerlach, 2001; Jules et al., 2002; Niwa et al., 2004; Waring and O’Hara, 2005) in regulating patterns of symbiosis, pathogenicity and even decomposition process. More recently, ecologist became aware that,

2 microbial pathogens plays a major role in evolution (Clay and Kover, 1996; Burdon, 1993). To date, only few studies focused on the influence on microbial diversity after landslide.

The present work focused on Udumbanchola taluk of Idukki district, which faced intensive landslide events last year due to the heavy rain. The root cause for the destabilization of the land was heavy urbanization and increase in cultivable land at the cost of forest area. Therefore, the rapid land use changes due to massive population and improper management practices has increased the intensity of landslides. These kind of heavy landslides drastically effects the soil structure in terms of physical, chemical and biological parameters. So a detailed study is required to understand the structural changes of soil after the landslide. During the course of the present work, it was evaluate using microbial indicators, which is a major contributor for the fertility of the soil. The assessment of microbial biodiversity in Udumbanchola taluk provide a picture to explain how soil fertility and vegetation was affected post landslide and the precautions that need to take to survive against such threats.

 Collection of soil samples from the flood affected area of Udumbanchola Taluk  Microbial analysis of the soil samples by preparing aseptic cultures  Isolation and identification of microorganisms using Molecular techniques  Characterization of microorganisms and their role in soil enrichment  Comparison of microflora in the soil samples of flood affected and non-flood affected areas  Identify the possible measures for the recovery of soil richness.

As per the objectives given above, soil samples collected from different landslide sites in Udumbanchola Taluk of Idukki district to analyze the diversity and frequency of microbial flora. Fifty-five samples aseptically collected from 23 different locations including top soil (10 cm) and bottom soil (20 cm). Soil samples collected from unaffected areas taken as the control.

The soil samples analyzed for different soil physical properties (color, type and texture).

Microorganisms present in the collected soil samples were isolated aseptically by serial dilution- agar plate method. Microbial suspension was prepared by mixing 1gm of soil sample in 10 ml sterile distilled water and by serially diluting up to 10-5 dilutions. 0.1 ml from 10- 3,10-4 and 10-5 dilutions were spread plated on Nutrient agar, Ashby’s mannitol medium and Lauria bertani medium to analyze microbial flora. The plates incubated for 48 hrs at 28° C (Debojyoti et al., 2017).

After 2 days of incubation, the bacterial inoculum taken from the isolated colonies streaked on to Nutrient agar, Ashby’s mannitol medium and Lauria bertani medium and then incubated at 28° C for 48 hrs for the isolation of single colonies.

In order to identify and isolate the microorganism helps in mineralization, inoculums from the selected dominant isolates streaked on to various special media (Ashby’s mannitol agar, Pikovskayas agar, Aleksandrow agar and Starkey agar). Based on the response of microbes in those media, we can identify the type of microorganism and its role in mineralization process of soil.

Ashby’s mannitol agar medium used for the identification of microbes involved in nitrogen fixation. A loop full of inoculum from the microbial isolates cultured on Ashby’s mannitol agar medium and incubated for 2 or 3 days at 28°C. Presence of the microorganism in the medium indicates the ability of that organism in the fixation of atmospheric nitrogen. (Debojyoti et al., 2017).

Pikovskayas agar is a growth medium used for the identification of phosphate-solubilizing soil microorganisms. A loop full of pure culture placed on Pikovaskaya agar medium plates and incubated at 28°C for 48 hrs. The presence of phosphate solubilizing bacteria indicated by the solubilization zone formed around the bacterial colony. Solubilization zone measured by subtracting the diameter of bacterial colony from the diameter of total zone (Sonam et al., 2011).

Aleksandrow agar medium used for the detection of potassium solubilizing bacteria in the sample. A loop full of inoculum from the selected isolates inoculated onto the Aleksandrow medium and the plates incubated for 3 days at 28°C. The presence of halo zone around the colony revealed the presence of potassium solubilizing bacteria in the sample. (Hassan et al., 2017).

Starkey agar medium used for the detection of sulphate solubilizing bacteria in the sample. A loop full of microbial isolates streaked on Starkey agar medium and incubated at 28°C for 5 days in anaerobic condition. The agar plates should use within 1-4 hrs after solidification to prevent saturation with oxygen. To prevent moisture condensation on petri dish covers, replace covers with sterile absorbent tops within 10-15 minutes after solidification. Blackening around the colonies within 2-5 days in the media revealed the presence of sulphate reducing bacteria in the sample. (Kambam et al., 2014).

6 After 48 hrs of incubation, the isolated and purified microbial cultures subjected to cultural- morphological and molecular analysis for the identification and confirmation of the type of microorganism present in the soil sample.

Growth pattern and colony morphology observed on Nutrient agar, Ashby’s medium and Lauria bertani plates.

A loop full of culture mixed with a drop of sterile distilled water on a clean grease free glass slide to form thin film. The slides were heat fixed for 1 to 3 sec by gently passing over Bunsen burner. The fixed smear first stained with Crystal violet (primary stain) for 1 min and rinsed with tap water. The smear was fix with iodine solution (mordant) for 1 min and rinsed with running tap water. Then the smear washed with Acetone for 10 to 15 sec. Finally, smear stained with Safranin (counter stain) and left for 30 sec. The slides then washed with tap water and left for drying on paper towel. The dry slides examined under the oil immersion objective of microscope. Then they examined for colour and morphology. The Gram-positive cells appears as purple and Gram negative appears pink in colour. Rod shaped structures are bacilli and round shaped structures are cocci.

Place a drop of 3% KOH on a glass slide. Using a loop, bacterial culture added and stir continuously and by slowly lifting the loop, formation of a string gives positive result indicate that the given culture is gram negative (Halebian et al., 1981).

The bacterial DNA was isolated using HiPurATM bacteriological DNA isolation kit, Himedia from overnight grown bacterial cultures.

7 16SrRNA gene amplified using the isolated genomic DNA as a template.

Table 1: 16SrRNA Primers

PRIMER Gene Nucleotide Sequence PCR Product Size 16SrRNA Forward 5’AGATTTGATCMTGGCTCAG3’ 1500bp

Reverse 5’CGGTTACCTTGTTACGACTT3’

PCR reaction carried out in 20μl reaction volume. 2ul of DNA, 0.5uM of each primer (Forward and Reverse), 0.2ul of Taq DNA polymerase from 5U/ul stock, 1X Taq reaction buffer, 0.2mM dNTP’s and made up to 20ul using sterile deionized water.

Table 2: PCR cycling conditions

Steps Temperature Time

Initial denaturation 95°C 2 min

Denaturation 94°C 30 sec

Annealing 59°C 30 sec

Extension 72°C 30 sec

The PCR amplification of 16SrRNA Gene performed without DNA isolation procedure by Colony PCR.

 The colony from the culture plate picked and added in to a PCR tube containing 10ul sterile deionized water using sterile toothpick.  The water-containing colony boiled at 900C for 10 min using thermal cycler.

8  Centrifuge the tube at 10000rpm for 3min.  The supernatant collected from the tube used as template for the PCR reaction.  PCR reaction carried out in 20μl reaction volume. 2ul of supernatant, 0.5uM of each primer (Forward and Reverse), 0.2ul of Taq DNA polymerase from 5U/ul stock, 1X Taq reaction buffer, 0.2mM dNTP’s and make up to ul using sterile deionized water.  The PCR reaction conditions carried out as per the details in the table2.

The PCR product was confirmed by agarose gel electrophoresis using a 1% gel prepared in 1 X TAE buffer (EtBr 1ul/10ml buffer) and the bands were visualized under UV transilluminator. The size of the product was estimated with the help of a 1 Kb ladder.

The amplicons eluted from the agarose gel and cleaned-up by Nucleospin Gel and PCR clean- up kit manufactured by Macherey-Nagel (REF740609.50).

The eluted PCR product was confirmed by agarose gel electrophoresis using a 1% gel prepared in 1 X TAE buffer (EtBr 1ul/10ml buffer) and the bands were visualized under UV transilluminator. The size of the product was estimated with the help of a 1 Kb ladder.

Sequencing of the eluted samples done at Barcode Bioscience, Bangalore using Sanger method.

The sequences for 16SrRNA gene of different soil bacteria obtained. The end of each sequence trimmed and aligned using BIOEDIT software.

9 The obtained sequence was analyzed using Basic Local Alignment Search tool (BLAST), which is the most frequently used tool for calculating the sequence similarity. From the BLAST analysis highly, similar sequences were downloaded in FASTA format.

Sample collection (top soil (10 cm), bottom soil (20 cm) & control soil)

Soil profile (physical parameters)

Serial dilution and agar plate method

Purification of the organism

Screening of the organism which helps in mineralization (Nitrogen fixation, Pottassium solubilization, Phosphate solubilization & Sulphate reduction)

Cultural & morphological identification (Gram staining, KOH string test)

Molecular identification (DNA isolation, PCR amplification, Colony PCR, Sequencing & BLAST analysis)

Soil samples collected from 23 locations of landslide areas coming under Udumbanchola Taluk of Idukki District and recorded the GPS data (Table 3 & Fig. 1). They collected from the top and bottom region of the affected area in separate sterile polythene bags and the soil sample taken from the non-affected region of the same location considered as the control (Fig. 2)

Table 3 - Landslided areas of Udumbanchola Taluk preferred for soil sample collection

Sample GPS Sample details Location name coordinates

Sample 1 top soil NB01 9°51'26.0"N 77°06'22.5"E Manjappara, Vathikudy, Sample 1 bottom soil NB03 Udumbanchola Taluk Sample 1 control soil NB02

Sample 2 top soil NB05 9°52'06.5"N 77°05'17.1"E Near Vathikudy, Udumbanchola Taluk Sample 2 bottom soil NB04

Sample 4 top soil NB06 9°51'05.6"N Near Thodupuzha, Puliyanmala Rd, 76°56'57.4"E Sample 4 bottom soil NB07 Udumbanchola Taluk

Sample 5 top soil NB09 9°50'40.8"N Near Thodupuzha, Puliyanmala Rd, 76°56'36.7"E Sample 5 bottom soil NB08 Udumbanchola Taluk

Sample 6 top soil NB11 9°49'34.6"N 76°55'10.5"E Near Idukki, Udumbanchola Taluk Sample 6 bottom soil NB10

Sample 7 top soil NB12 9°58'11.1"N 77°05'58.4"E Sample 7 bottom soil NB13 Rajakkad, Udumbanchola Taluk

Sample 7 control NB14

Sample 8 top soil NB15 9°57'29.4"N 77°06'25.4"E Adivaram, Rajakkad, Udumbanchola Sample 8 bottom soil NB16 Taluk Sample 8 control soil NB17

Sample 9 top soil NB19 9°57'27.0"N Near Adimaly-Rajakkad Road, 77°04'41.9"E Sample 9 bottom - 1 soil NB20 Ponmudi, Udumbanchola Taluk

12 Sample 9 bottom - 2 soil NB21

Sample 9 control soil NB18

Sample 10 top soil NB22 9°58'05.1"N 77°03'46.1"E Near Ponmudi, Rajakkad, Sample 10 bottom soil NB23 Udumbanchola Taluk Sample 10 control soil NB24

Sample 11 top soil NB27 9°58'01.5"N 77°04'54.8"E Valiya Mullakkanam, Rajakkad, Sample 11 bottom soil NB25 Udumbanchola Taluk Sample 11 control soil NB26

Sample 12 top soil NB28 9°58'34.5"N 77°03'28.7"E Kambalikandam Parathode, Adimaly- Sample 12 bottom soil NB29 Rajakkad Road, Udumbanchola Taluk

Sample 13 top soil NB30 9°51'03.4"N 77°08'53.8"E Kalkoondhal Village, Nedumkandam Sample 13 bottom soil NB31 Udumbanchola Taluk Sample 13 control soil NB32

Sample 14 top soil NB33 9°51'12.7"N 77°08'53.2"E Kalkoondhal Village, Nedumkandam, Sample 14 bottom soil NB34 Udumbanchola Taluk Sample 14 control soil NB35

Sample 15 flooded soil NB36 9°52'34.1"N Near Nedumkandom Parathode, 77°09'58.2"E Sample 15 control soil NB37 Udumbanchola Taluk

Sample 16 bottom soil NB39 10°00’18.3” N Eden Valley, Ellakal, Udumbanchola 77°04’15.2” E Sample 16 control NB39 Taluk

Sample 17 top soil NB41 10°00’47.7” N Anachal- Kunchithanny- Rajakad Rd, 77°03’47.0” E Sample 17 bottom soil NB40 Kunchithanny, Udumbanchola Taluk

Sample 18 top soil NB43 10°00’20.4” N

Ellackal, Udumbanchola Taluk 77°03’53.2” E Sample 18 bottom soil NB42

Sample 19 flooded soil NB44 Uppar, Udumbanchola Taluk

13 9°59’56.9” N Sample 19 flooded sandy soil NB45 77°04’02.6” E Sample 19 control NB46

Sample 20 top soil NB48 9°59’29.9” N Josegiri, Bison Valley, Udumbanchola Taluk Sample 20 bottom soil NB47 77°04’16.1” E

Sample 21 top soil NB49 9°59’33.5” N Ratnagiri, Bison Valley, Udumbanchola Taluk Sample 21 bottom soil NB50 77°05’10.1” E

Sample 22 top soil NB51 9°59’30.7” N Thekkumkanam, Bison Valley, Udumbanchola Taluk Sample 22 bottom soil NB52 77°04’34.0” E

Sample 23 top soil NB54 10°03’42.6” N

Sample 23 intermediate soil NB55 77°06’20.0” E Devikulam

Sample 23 bottom soil NB53

The soil samples collected from different locations of Udumbanchola Taluk showed significant difference in its physical properties especially in soil texture (Table 4). On comparing the soil samples from both affected and unaffected areas of landslide, it found that the landslide completely disturbs the texture of the soil, especially in the organic matter and humus composition. Brown/Red/White powdery textured soil with lateral deposits found common in affected site. This indicates the iron oxidation process and the presence of calcium carbonate in the soil. The red soils of the humid tropics served as an indicator of the intensity of weathering and the white carbonaceous rocks represent soil alkalinity. Such changes can seriously affect the microbial population, which in turn leads to the degradation of nutritional quality of the soil. The places prone to landslides and floods tagged with the aid of Geographic Positioning System and recorded for further studies.

Fig.1. Landslided areas of Udumbanchola Taluk selected for soil sample collection

Fig.2. Soil Samples collected from 23 locations of Udumbanchola Taluk

16 Table 4 - significant difference of soil samples especially in soil texture

Sample location Top soil Bottom soil Control soil

1.Manjappara, Humus rich soil, light brownish, Wet, and had little Humus rich, Vathikudy, wet, coarse and fine grained, humus content dark, wet, silty Udumbanchola Taluk slightly loose and trace amount of white rock aggregates.

2. Near Vathikudy, Red soil with dry texture and Light brownish soil High in organic Udumbanchola Taluk laterite depositions. with dry texture matters and wet in appearance

4. Near Thodupuzha, Calcium carbonate rocks; high White powdery Humus rich, Puliyanmala Rd, alkaline nature. appearance dark, wet, silty Udumbanchola Taluk

5. Near Thodupuzha, Higher iron oxides , wet, coarse Carbonate rocks High in organic Puliyanmala Rd, grained, humus rich and consisting high, red and white matters and wet Udumbanchola Taluk lot of rock aggregates and moisture coloured mixtures in appearance

6. Near Idukki, Little deposits of Calcium carbonate Wet, and had less Humus rich, Udumbanchola Taluk rocks, Humus rich soil, red soil and humus content. dark, wet, silty, trace amount of white rock

7. Rajakkad, Dry and clumped, lightly darker Deterioration of High in organic Udumbanchola Taluk organic part, matters and wet Carbonate rocks in appearance high, red and white coloured mixtures

8. Adivaram, Rajakkad, Calcium carbonate rocks , loose Carbonate rocks Oxidation state Udumbanchola Taluk sediments , light brownish and high, red and white of iron present organic matter was present in very coloured mixtures in the soil was small amount. very limited

9. Near Adimaly- Brightly pink coloured deposits, Organic root High in organic Rajakkad Road, light brown with dominant pink particles where matters and wet Ponmudi, coloured, organic root particles completely absent in appearance Udumbanchola Taluk where completely absent , loose was bright pink, property of the soil dry, very loose, shiny, and the granular size of the soil was very small

17 10. Near Ponmudi, Good amount of organic carbon Dry, clumped, hard, Very humus Rajakkad, rich particles and light brown rich, dark, wet, Udumbanchola Taluk coloured. silty, and consisted with nutritive sediments

11. Valiya Humus contents were very less, Humus contents Also lacks Mullakkanam, very white, powdery, and absence were very less, very organic particles Rajakkad, of humidity white, powdery, Udumbanchola Taluk and absence of humidity

12. Kambalikandam Good amount of humus and Good amount of High in organic Parathode, Adimaly- appeared to have red, brown to humus and matters and wet Rajakkad Road, black coloured, very dry and hard appeared to have in appearance Udumbanchola Taluk red, brown to black coloured

13. Kalkoondhal Very dry and hard, Large Light shades of Very humus Village, Nedumkandam aggregated of soil clumps was dry, brown colour and rich, dark, wet, Udumbanchola Taluk dark and mixed with red soil and little appearance of silty, root parts reddish tinge.

14. Kalkoondhal Organic detritus and decomposed Also lightly High in organic Village, Nedumkandam, particles where highly packed , brownish and wet matters Udumbanchola Taluk darker, brownish and little wet

15. Near Nedumkandom Flooded soil: Reddish soil White carbonaceous rocks High in organic Parathode, matters and wet Udumbanchola Taluk with high humus matter in appearance

16. Eden Valley, Humus contents were very less, Humus contents Red soil was Ellakal, Udumbanchola very white, powdery, and absence were very less, very prominent in the Taluk of humidity white, powdery, control soil. and absence of humidity

17. Anachal- Calcium carbonate rocks; high The red soil was High in organic Kunchithanny- Rajakad alkaline nature. Humus contents reported to have matters Rd, Kunchithanny, were very less humidity were small in amount Udumbanchola Taluk absent in the soil. Top soil was very dry and clumped after the post flood events

18 18. Ellackal, Red soil with dry texture and the Light brownish soil High in organic Udumbanchola Taluk surroundings laterite depositions. with dry texture matters

19. Uppar, Flooded soil: The sample is from river bank, hence the High in organic Udumbanchola Taluk sedimentation was higher. Nutrient content, humus etc was matters rich.

20. Josegiri, Bison Light brown with dominant pink Dark brown soil. Very humus Valley, Udumbanchola coloured and bottom soil was bright rich, dark, wet, Taluk pink, dry, very loose, shiny, and the silty, granular size

21. Ratnagiri, Bison Humus rich soil, red soil and trace Light brownish soil High in organic Valley, Udumbanchola amount of white rock aggregates with dry texture matters and wet Taluk also were present in appearance

22. Thekkumkanam, Humus rich soil, red soil and trace Light brownish soil Very humus Bison Valley, amount of white rock aggregates with dry texture rich, dark, wet, Udumbanchola Taluk also were present in this region. The silty, top soil was humus incorporated, light brownish, wet, coarse and fine grained, and the texture was not so loose. Bottom soil was wet, and had little humus content.

23. Devikulam Texture of the top soil samples were Large aggregated of High in organic very dry and hard. soil clumps here matters and wet formed due to the in appearance results of flood and large erosions

Serial dilution and agar plate method for each soil samples (NB01-NB55) from different sites on three different medias (Nutrient agar, Ashby’s media and LB agar) with each dilution 10-3, 10-4 and 10-5 was used for the enumeration of microbial count (Fig. 3). Its quantitative details by total plate count method, expressed as log of CFU (colony forming unit) per gram of soil (Table 5). With the help of this enumeration technique, the distribution pattern of microflora in top and bottom soil could identified and it represented in graph. (Graph1). It was observed that in majority of sample locations, microbial population was high in bottom soil compared to top soil (location 07, 08, 09, 11, 10, 12, 14, 18, 20, 22, and 23) and in few locations microbial population was high in top soil (01, 02, 04, 05, 13, 17, and 21). On comparing the microbial

19 diversity of all locations, high diversity found in location 10 and low in location 01 (Graph 2). On comparing the microbial diversity of different locations of flood/landslide affected and non- affected areas, it found that flood/landslide heavily influenced the microbial flora of affected areas (Graph 3) and in which the sample location 19 showed maximum loss of microbial population.

For further analysis and detailed study purpose, the microbial isolates obtained by serial dilution and agar plate method from each sample location subcultured (Fig.4).

Table 5 - The total plate count results of all 55 soil samples (NB01-NB55), expressed as log of CFU (colony forming unit) per 1 g dry soil.

Number of colonies

Sample name Nutrient agar LB agar Ashby’s medium

10-3 10-4 10-5 10-3 10-4 10-5 10-3 10-4 10-5

NB01 2416 816 176 1376 528 24 2860 1216 60

NB02 1008 712 13 888 45 2 1056 150 8

NB03 1620 1200 840 3788 1728 176 3308 1304

NB04 3444 1816 4 3632 3105 4 3568 1600 10

NB05 3996 2792 1200 3680 2568 4 3664 1984 124

NB06 23 7 6 186 15 3 46 31 0

NB07 136 9 6 480 24 20 496 62 53

NB08 10 10 2 53 10 6 52 50 23

NB09 12 7 3 20 2 1 76 26 20

NB10 59 3 2 310 3 1 47 32 2

NB11 1024 135 90 TNC 448 5 1584 200 20

NB12 33 2 0 6 2 0 39 2 0

NB13 104 0 0 72 1 0 173 0 0

20 NB14 86 2 1 120 13 0 8 3 0

NB15 2323 1 0 8 0 0 10 6 0

NB16 9 1 0 5 2 1 8 0 0

NB17 25 2 0 96 0 0 172 3 0

NB18 190 16 2 117 95 13 136 24 5

NB19 23 3 0 19 5 1 31 0 0

NB20 22 9 1 21 7 2 24 10 0

NB21 19 0 0 222 18 6 14 1 0

NB22 184 47 20 808 136 60 200 42 9

NB23 120 17 8 268 91 12 540 37 6

NB24 108 54 18 1000 843 492 736 224 110

NB25 660 130 0 3000 1000 2 17 14 3

NB26 183 9 8 2410 950 17 520 25 2

NB27 34 5 1 1064 298 243 89 2 6

NB28 34 8 2 19 8 2 88 23 8

NB29 13 5 5 8 8 2 33 9 0

NB30 35 12 3 15 3 0 184 60 19

NB31 132 69 2 151 21 2 212 112 31

NB32 83 18 12 74 20 3 116 24 13

NB33 44 4 2 34 4 0 752 50 12

NB34 36 18 0 21 5 1 224 124 4

NB35 161 36 8 156 96 9 288 62 20

NB36 24 11 6 65 8 1 149 103 56

NB37 392 67 11 370 162 54 127 115 14

21 NB38 2018 517 3 1984 849 7 64 60 7

NB39 84 10 0 99 28 29 75 17 2

NB40 27 15 5 29 12 6 42 4 1

NB41 1745 76 12 1982 7 1 54 12 6

NB42 21 19 5 1869 178 3 38 7 3

NB43 26 5 1 28 3 1 1788 3 1

NB44 82 13 4 62 35 2 96 28 1

NB45 347 34 6 280 112 14 192 26 6

NB46 2978 2123 2 943 10 4 1218 897 5

NB47 1987 92 8 856 112 37 1254 80 4

NB48 2175 1878 31 1267 581 15 1312 42 20

NB49 945 125 7 1965 875 125 1875 965 24

NB50 985 28 14 896 345 25 2541 44 10

NB51 34 2 1 125 39 3 32 0 0

NB52 118 80 4 219 6 2 148 25 5

NB53 159 2 1 10 8 3 89 5 3

NB54 52 9 5 35 22 14 48 32 2

NB55 78 15 0 4 0 0 7 0 0

NB01 NB02 NB03

NB04 NB05 NB06

NB07 NB08 NB09

NB10 NB11 NB12

NB13 NB14 NB15

NB16 NB17 NB18

NB19 NB20 NB21

NB22 NB23 NB24

NB25 NB26 NB27

NB28 NB29 NB30

NB31 NB32 NB33

NB34 NBNB35 NB36

NB37 NB38 NB39

NB40 NB41 NB42

NB43 NB44 NB45

NB46 NB47 NB48

NB49 NB50 NB51

NB52 NB53 NB54

NB55

Fig.3 - Serial dilution and agar plate method of all soil samples (NB01-NB55) on three different medias (Nutrient agar, Ashby’s media and LB agar) from each dilution 10-3,10-4 and 10-5

MICROBIAL POPULATION

bottom soil top soil

7 22 47 23 26 18 63 309 93 45 614 3996 12 1584 1595 2416 165

1024 1863 97 241 1037 136 116 78 161 614 201 86 642 3444 10 1365 1474 1620 91

59 32

Graph 1 - Comparison of microbial population between top and bottom soil of post-flood affected areas.

29 MICROBIAL DIVERSITY

bottom soil top soil

40 19 90 42 17 20 20 34 20 12 16 14 13 21 13 10 28 37 37 30 25 23 20 20 4 16 16 17 12 17 15 18 11 3 4 10

Graph 2 - Comparison of microbial diversity between top and bottom soil of post-flood affected areas.

MICROBIAL COMPARISON

Location 19 Location 14 Location 13 Location 11 Location 10 Location 9 Location 8 Location 7 Location 1

0 1000 2000 3000 4000 5000 6000

sample control

Graph 3 - The overall Microbial Population variation/loss on affected areas by compared with unaffected.

30 The dominant isolates selected by quantitative method from each locations including top, bottom and control samples checked for the NPK profile properties such as, nitrogen fixation, potassium solubilization, phosphate solubilization and sulphur degradation. Almost all isolates have nitrogen fixing ability in landslide prone areas, potassium and phosphate solubilization were shown by few isolates and there is no isolates have sulphur degradation properties (Table 6 and Fig.5).

Table 6 - NPK profile of selected dominant isolated from each soil sample (NB01-NB55)

Gram Nitrogen Potassium Sulphate Phosphate Isolates staining fixation solubilisation reducing solubilisation

S12 + + - - -

NB01 S13 + + - - -

S14 + + - - -

S01 + + - - -

S04 + + - - -

SAMPLE 1 SAMPLE NB02 S06 + + - - -

S09 + + - - -

S11 + + - - -

S19 + + - - -

S20 + + - - - NB05 S21 + + - - -

S22 + + - - -

S15 + + - - -

SAMPLE 2 SAMPLE S16 + + - - - NB04 S17 + + - - -

S18 + + - - -

S30 + + - - -

S38 + + - - - NB06 S47 + + - - -

S48 + + - - -

SAMPLE 4 SAMPLE NB07 S78 + + - - -

31 S79 + + - - -

S83 + + - - -

S84 + + - - -

S88 - - - - -

S89 + + - - -

NB08 S100 + + - - -

S94 + + - - -

S99 + + - - -

SAMPLE 5 SAMPLE J13 + - - - NB09 J14 + + - - -

J15 + - - - J44 + + - - -

NB11 J45 + + - - -

J49 + + + - -

J23 + + - - -

J28 + + - - -

SAMPLE 6 SAMPLE NB10 J22 + - - - -

J36 + - - - -

J29 + - - - J70 + + - - -

J71 + + - - - NB12 J67 + + - - -

J72 + + - - -

J91 + + - - -

NB13 J93 + + - - -

J99 + - - -

SAMPLE 7 SAMPLE B02 + + - - -

B03 + + - - - NB14 B06 + + - - -

B11 + + - - -

NB15 B98 + + - - -

32 C01 + + - - -

C03 + + - - -

C08 + + - - -

NB16 C09 + + - - -

C16 + - - - C26 + - - - -

NB17 C32 + + - - -

C35 + + - - -

B59 + + - - -

NB19 B68 + + - - -

B70 + - - - B51 + + + - -

B52 + + + - -

NB20 B54 + + - - -

B56 + + - - -

SAMPLE 9 SAMPLE B84 + + - - - NB21 B90 + - - - B15 + + - - -

NB18 B19 + + - - -

B22 + + - - -

C73 + + - - -

C74 + + - - -

C76 - - - - - NB22 C19 + + - - -

C58 + - - - -

C81 - - - - -

F59 + + - - -

SAMPLE 10 SAMPLE F62 - + - - - NB23 F13 + + - - -

F63 + + - - -

NB24 F91 + - - -

33 G15 + + - - -

G32 + + - - +

G01 + + - - -

G14 + + - - -

G06 + + - - -

G33 + - - - -

G71 + + - - -

G72 + + - - -

G86 + + - - -

NB27 G95 + + - - -

G92 + - - - G96 + + - - -

G99 + + - - -

G48 + - - - -

G49 + + - - -

SAMPLE 11 SAMPLE NB25 G51 + + - - -

G55 + + - - -

G60 + + - - -

H41 + + - - -

H59 + + - - - NB26 H61 - + - - -

H60 + + - - -

K39 + + - - -

NB29 K46 + + - - -

K47 + + - - -

K05 + + - - -

SAMPLE 12 SAMPLE NB28 K17 + - - - -

K29 + + - - -

K67 + + - - - NB30 K70 + + - - -

NB31 K85 + - - - -

SAMPLE 13 SAMPLE

34 K89 + + - - -

N11 + + - - -

NB32 N15 + + - - -

N18 + - - - -

N26 + - - - -

N27 + + - - -

NB33 N28 + + - - -

N29 + + - - -

N36 + - - - -

N69 + + - - -

N73 - - - - - NB35 N78 + + - - -

SAMPLE 14 SAMPLE N79 + + - - -

N37 + + - - -

N39 + + - - - NB34 H81 + + - - -

N50 + + - - -

N99 + + - - -

NB36 P31 + - - - P32 + + - - -

M16 + - - -

15 M22 + + - - -

M28 + - - - - SAMPLE SAMPLE NB37 M20 - - - - M29 + + - - -

M56 + + - - -

P56 + + - - -

NB38 P57 + + - - -

P58 + - - - P69 + + - - - SAMPLE 16 SAMPLE NB39 P82 + + - - -

35 P93 + - - - -

P99 + + - - -

NB40 Q21 + + - - -

Q22 + + - - -

Q30 + + - - -

SAMPLE 17 SAMPLE NB41 Q31 + + - - -

Q32 + + - - -

Q40 + + - - -

NB42 Q42 + + - - -

Q53 + + - - -

Q70 - - - - -

SAMPLE 18 SAMPLE NB43 Q71 + + - - -

Q72 + + - - -

Q88 + + - - -

NB44 Q95 + + - - -

R04 + + - - -

R21 + + - - -

NB45 R25 + + - - -

R47 + - - - -

SAMPLE 19 SAMPLE R66 + + - - -

NB46 R67 + - - - -

R71 + + - - -

R86 + + - - -

R91 + - - - NB47 R92 + + - - -

R95 + + - - -

T04 + + - - -

SAMPLE 20 SAMPLE NB48 T16 + + - - -

T17 + + - - -

T21 + + - - - NB49 21 T26 + + - - -

SAMPLE SAMPLE

36 T36 - + - - -

T43 + - - - NB50 T45 + + - - -

T60 + + - - -

T67 + + - - -

NB51 T77 + + - - -

T78 + - - - -

T79 + + - - -

SAMPLE 22 SAMPLE NB52 T82 - + - - -

T92 + + - - -

T100 - - - - NB53 U01 + + - - -

U02 + + - - -

U15 + - - - NB54 U22 + + - - -

SAMPLE 23 SAMPLE U32 + + - - -

U42 + - - - - NB55 U45 + + - - -

Pikovaskey’s media Starkey’s media

Alexandrow’s media Ashby’s media Fig. 5 - Nitrogen fixing, Potassium solubilisation, Phosphate solubilisation and Sulphur degradation test results of selected isolates from soil sample (NB01-NB55)

38 Flat Raised Convex Umbonate Crateriform Flat Raised Convex UmbonateCrateriform Flat Raised Convex UmbonateCrateriform VL

S Moist

CONSISTANCY Mucoid

Dry Dry S

R U L F Z R U L F Z R U L F Z R U L F Z R U L F Z R U L F Z R U L F Z R U L F Z R U L F Z R U L F Z R U L F Z R U L F Z R U L F Z R U L F Z R U L F Z

Opaque Translucent Transparent

Graph 4 - Graphical representation of colony characteristics of all isolates obtained from soil samples (NB01-NB55) (graph code; VL- very large, L- large,M-Moderate, S-Small, VS-very small, PP-pin point, R- Round entire, U- Undulate, L- Lobate, Z- rhizoid, F- Filamentous).

For the primary identification, the details of colony morphology of all isolates obtained from the soil samples (NB01-NB55) were analyzed (Table.7) and it represented in Graph 4. Several pigmented colonies are also identifies from the soil samples. The Gram staining results of selected dominant isolates from each soil sample already showed in Table 6.

200ul of bacterial DNA of selected dominant isolates of each sample site from Udumbanchola Taluk was isolated using Bacteriological DNA isolation kit (Himedia) procedure and the isolates was used for PCR reaction.

The 16SrRNA gene was amplified using primers 16SrRNA F and 16SrRNA R. The PCR product run on 1% agarose gel, in order to confirm the size of amplified gene fragment a 1kb DNA ladder was also loaded in the adjacent wells. The bands visualized under UV transilluminator. Amplicons of size 1500bp observed (Fig. 6).

Elution of 16SrRNA gene from 1% agarose gel done by Nucleospin Gel and PCR clean-up kit manufactured by Macherey-Nagel (REF740609.50). Eluted product run on 1% agarose gel in order to confirm the product. The size of eluted PCR product confirmed by 1kb DNA ladder loaded in the adjacent wells. The bands visualized under UV transilluminator. Amplicons of size 1500bp observed (Fig. 7 and 8).

The eluted PCR products were sequenced by Sanger’s method at an automated sequencing facility (Barcode Biosciences, Banglore) with the gene specific primers 16SrRNA F and16SrRNA R. The sequence results obtained in the format of AB1, FASTA and PDF.

40 BLAST tool used for searching high scoring sequence alignment between the query sequences in the database. The Clustal W program through the European Bioinformatics Institute (EBI) server used to determine percentage of identity and similarity between sequences (Table 8).

The molecularly identified isolates compared with its general properties. That gives the evidence that the emergence of plant pathogens in affected areas by comparing with unaffected area (Table 9, Graph 5 and 6).

Fig. 6 - 1500bp long 16SrRNA gene PCR amplification product

Fig.7 - Eluted PCR amplified product 1500bp length.

Fig.8 - Eluted PCR amplified product 1500bp length.

42 Table 8 Blast results of isolates with its similarity

Eluted sample Culture BLAST result Similarity % no. name E1 G14 Bacillus toyonensis 99.61% E2 G15 Bacillus aryabhattai 99.73% E3 J22 Staphylococcus haemolyticus 99.69% E4 G32 Staphylococcus warneri 99.30% E5 G86 Bacillus luciferensis/Bacillus acidiceler 99.38% E6 B90 Bacillus cereus/Bacillus amyloliquefaciens 100% E7 G71 Uncultured bacteria found in brassica rhizosphere 98.35% E8 C9 Streptomyces gamaensis 98.71% E9 H59 Kocuria rhizhophila 99.23% E10 B88 Staphylococcus sps 99.38% E11 H61 Sulphitobacter donghicola 99.20% E12 G72 Uncultured Bacillales bacterium 95% E13 G99 Bacillus substilis 98% E14 G49 Bacillus aerophilus 97% E15 N28 Effusibacillus consociatus 95% E16 N37 Bacillus substilis 96% E17 G96 Bacillus xiamenesis 97% E18 N69 Arthrobacter woluwensis 97% E19 G60 Bhargavaea cecembensis 97% E20 G51 Bacillus cereus 98% E21 N15 Bacillus samanii 99% E22 G48 Pseudarthrobacter 97.79% E23 G95 B. cereus 96.57% E24 N78 Bacillus firmus 98.66% E25 N79 Streptomyces griseorubiginosus 99.32% E26 N36 Arthrobacter sp. 82.38% E27 N18 Uncultured bacillus sp. clone 91.25% E28 G33 Brachybacterium saurashtrense 99.12% E29 N99 Micrococcus caseolyticus 99.21% E31 S19 Uncultured bacterium clone 75.00% E32 S20 Uncultured fusibacter sp./uncultured bacterium clone 75.29% E33 S22 Bacillus parabrevis 84.44%

43 E34 S79 Bacillus thuringiensis 87.64% E35 S15 Asaccharospora irregularis 98.64% E36 S9 Clostridium sp. 81.87% E37 S6 Clostridium sp. 88.56% E38 S48 B. licheniformis 99.90% E39 S13 Bacillus cereus 93.59% E40 S4 C. punense 75.91% E41 S78 Clostridium sp. marseille 97.23% E42 S16 C. irregulare 80.96% E43 S1 B. licheniformis 91.12% E44 S99 B. paramycoides 87.01% E45 S47 Bacillus cereus 90.88% E46 S30 B. cereus 89.20% E47 S83 Asaccharospora irregularis 90.60% E48 K17 Effusibacillus consociatus 96.89% E49 K39 Staphylococcus pasteuri 99.50% E50 S38 Clostridium species 99.49% E51 S11 Bacillus thuringiensis 91.67% E52 C81 Paenibacillus glucanolyticus 100% E54 H60 Bacillus megaterium 99.82% E56 S84 Clostridium sp. 98.75% E57 C35 Arthrobacter pascens 99.31% E58 K70 Bacillus cereus 81.62% E59 N39 Bacillus sp. 99.33% E60 P99 Bacillus sp/ Bacillus mycoides 99.51% E61 Q21 Bacillus megaterium 94.58% E62 Q70 Bacillus subterraneus 98.05% E63 R21 Bacillus cereus 88.02% E64 S17 Staphylococcus ariettae 98.03% E65 C32 Pseudarthrobacter chlorophenolicus 95.81% E66 N11 Uncultured organism clone ELU0024-T375-S-NIPCR 72.46 AMgANb E67 G71 Effusibacillus consociatus 96.03% E68 R91 Bacillus sp. 96.27% Uncultured bacterium clone CP59

44 E69 N73 Serratia marcescens 99.51% E70 F13 Effusibacillus consociatus 96.47% E71 H81 Bacillus licheniformis 94.92% E72 J36 Effusibacillus consociatus 96.80% E73 C58 Bacillus bataviensis 81.76% E74 J67 Effusibacillus consociatus 96.55% E75 C19 Effusibacillus consociatus 94.74% E76 S89 Effusibacillus consociatus 95.60% E77 G1 Rhodococcus sp. 97.96% E78 M28 Bacillus licheniformis 99.04% E79 G6 Bacillus aquimaris 98.87% E80 G28 Effusibacillus consociatus 96.86% E81 M20 Bacillus halkouensis 97.54% E82 S88 Roseomonas 99% E83 T16 Arthrobacter 99.10% E84 T21 Bacillus pumilus 98.56% E85 T45 Lysinibacillus 97.13% E86 T60 Bacillus mycoides 98.57% E87 T92 Effusibacillus consociatus 94.80% E88 U1 Effusibacillus consociatus 96.55% E89 U2 Bacillus safensis 99.09% E90 U22 Staphylococcus epidemidis 98.19% E91 C1 Effusibacillus consociatus 92.98% E92 P32 Brevibacterium 97.58% E93 P56 Bacillus safensis 98.74% E94 P57 Bacillus cereus 98.82% E95 P69 Lysinibacillus 99.52% E96 P82 Bacillus thuringiensis 98.77% E97 P93 Bacillus flexus 80.65% E134 C3 Sinomonas atrocyanea 98%

45 Table 9 Characteristics of selected dominant isolates from each sample site

Isol General Organism Property ates property

plant pathogens, B. cereus spore is refractory to extreme environmental conditions (Jensen et al., 2003), suppress plant pathogens has also been reported

(Pinchuk et al, 2002; Stabb et al., 1994).disease plant S13 Bacillus cereus suppression, enhanced mutualisms plant growth pathogen

NB01 promotion, and yield increases in several systems (Berger et al., 1996; Brannen and Kenney, 1997; Halverson and Handelsman, 1991; Handelsman et al., 1990; Kim et al., 1997; Kim at al., 1997).

Biofertilizers or biocontrol agent and pant growth promoting microbe (Jose et. al, 2004), inhinbit

Plant detrimental effects of salt stress (Goswami et al., S01 B. lichniformis growth 2014). Reduce toxic metal level in soil (Brunetti et al., promoter 2012).highly resistant to pesticides and enhance growth (Jose et al, 2004). Increased total nitrogen and

SAMPLE 1 SAMPLE phosphorus content (Hyun et al., 2017).

Isolated from human faeces, and sulfur-reducing S04 C. punense activity (Lanjekar et al., 2015).

NB02 Clinical Clinically significant infections (Sathish and S06 Clostridium sp. pathogen Swaminathan, 2009; Bernhard et al., 1981).

Clinical Clinically significant infections (Sathish and S09 Clostridium sp. pathogen Swaminathan, 2009; Bernhard et al., 1981).

Plant Insect control (Mohamed et al., 2010), genetic Bacillus S11 growth engineering in agriculture, biopesticide worldwide. thuringiensis promoter (Vincent et al., 2008)

Uncultered fusibacter sp./ S20 unculctured bacterium clone

NB05

SAMPLE 2 SAMPLE Uncultured S19 bacterium clone

Plant extracellular protease, ability to biodegrade low S22 Bacillus parabrevis growth density polyethylene, ability to act as a candidate bio- promoter control agent (Panda et al., 2014)

46 Asaccharospora S15 Gut isolate (Gerritsen et al., 2014) irregularis

Gut microbes after probiotic therapy (Jacoline et al., S16 C.irregulare

NB04 2011)

Plant Staphylococcus Antibiotics resistance, plant growth promoting S17 growth arlettae property (Vasudevan et al., 2012) promoter

Plant pathogens, B. cereus spore is refractory to extreme environmental conditions (Jensen et al., 2003), suppress plant pathogens has also been reported (Pinchuk et al, 2002; Stabb et al., 1994).disease plant S30 B.cereus suppression, enhanced mutualisms plant growth pathogens promotion, and yield increases in several systems (Berger et al., 1996; Brannen and Kenney, 1997; Halverson and Handelsman, 1991; Handelsman et al.,1990; Kim et al., 1997; Kim at al., 1997).

Clinical Clinically significant infections (Sathish and S38 Clostridium species pathogen Swaminathan, 2009; Bernhard et al., 1981).

Plant pathogens, B. cereus spore is refractory to extreme environmental conditions (Jensen et al., 2003), suppress plant pathogens has also been reported

NB06

(Pinchuk et al, 2002; Stabb et al., 1994).disease plant S47 Bacillus cereus suppression, enhanced mutualisms plant growth pathogens promotion, and yield increases in several systems (Berger et al., 1996; Brannen and Kenney, 1997;

SAMPLE 4 SAMPLE Halverson and Handelsman, 1991; Handelsman et al., 1990; Kim et al., 1997; Kim at al., 1997).

Biofertilizers or biocontrol agent and pant growth promoting microbe (Jose et. al, 2004), inhinbit Plant detrimental effects of salt stress (Goswami et al., S48 B. lichniformis growth 2014). Reduce toxic metal level in soil (Brunetti et al., promoter 2012).highly resistant to pesticides and enhance growth (Jose et al, 2004). Increased total nitrogen and phosphorus content (Hyun et al., 2017).

Clostridium sp. Clinical S78 From clinical sample (Bilen et al., 2018) marseille pathogen

Plant Insect control (Mohamed et al., 2010), genetic NB07 Bacillus S79 growth engineering in agriculture, biopesticide worldwide. thuringiensis promoter (Vincent et al., 2008)

47 Asaccharospora S83 Gut microbe (Gerritsen et al., 2014) irregularis

Clinical Clinically significant infections (Sathish and S84 Clostridium sp. pathogen Swaminathan, 2009; Bernhard et al., 1981).

Clinical pathogen (Rihs et al., 1993; Han et al., 2003; Alauzet et al., 2010; Shokar et al., 2002;Dé et al., Clinical 2004;Sipsas et al., 2006;Wang et al., 2012; Michon et S88 Roseomonas pathogen al., 2014), And also isolated from an agricultural soil cultivated with Chinese cabbage (Brassica campestris)

(kim and ka, 2014).

Plant Fruit juice spoilage (Huang et al., 2015; Chang et al.,

NB08 Effusibacillus S89 growth 2004).reduce Nitrate to nitrite and it also produces acid

SAMPLE 5 SAMPLE consociatus promoter from glucose (Minho et al., 2014)

Plant Isolated in 2017 (Liu et al., 2017), Plant growth- Bacillus S99 growth promoting rhizobacteria (PGPR)( Noha and Osman, paramycoides promoter 2018)

Staphylococcus Clinical Clinical pathogen, antimicrobial resistance (Czekaj et J22

haemolyticus pathogen al., 2015)

Plant fruit juice spoilage (Huang et al., 2015; Chang et al., NB10 Effusibacillus J36 growth 2004).reduce Nitrate to nitrite and it also produces acid SAMPLE 6 SAMPLE consociatus promoter from glucose (Minho et al., 2014)

Plant fruit juice spoilage (Huang et al., 2015; Chang et al., Effusibacillus J67 growth 2004).reduce Nitrate to nitrite and it also produces acid consociatus

NB12 promoter from glucose (Minho et al., 2014)

SAMPLE 7 SAMPLE

Plant fruit juice spoilage (Huang et al., 2015; Chang et al., Effusibacillus C01 growth 2004).reduce Nitrate to nitrite and it also produces acid consociatus promoter from glucose (Minho et al., 2014)

Increasing soil fertility by nitrate reduction, source for NB15 Plant Sinomonas important enzymes and plant growth promoters. C03 growth atrocyanea reported for synthesizing silver nanoparticles, fuel promoter efficacy and for bioremediation (Zhou Y, et al, 2018)

SAMPLE 8 SAMPLE

Plant Streptomyces C09 growth antifungal activity (Zhao et al., 2016) gamaensis

NB19 promoter

48 Plant Pseudarthrobacter C32 growth bioremediation (Karolina et al., 2000) chlorophenolicus promoter

NB16 Plant promote plant growth, phyohormone prduction C35 Arthrobacter pascens growth (Mengsha et al., 2018) promoter

Clinical B88 Staphylococcus sp. Clinical pathogen (Dwivedi et al., 2016) pathogen

plant pathogens, B. cereus spore is refractory to extreme environmental conditions (Jensen et al., 2003), suppress plant pathogens has also been reported Bacillus (Pinchuk et al, 2002; Stabb et al., 1994).disease NB21 Plant B90 cereus/Bacillus suppression, enhanced mutualisms plant growth SAMPLE 9 SAMPLE pathogen amyloliquefaciens promotion, and yield increases in several systems (Berger et al., 1996; Brannen and Kenney, 1997; Halverson and Handelsman, 1991; Handelsman et al.,1990; Kim et al., 1997; Kim at al., 1997).

Plant fruit juice spoilage (Huang et al., 2015; Chang et al., Effusibacillus C19 growth 2004).reduce Nitrate to nitrite and it also produces acid consociatus promoter from glucose (Minho et al., 2014)

Plant wood decomposing bacteria (Akinyemi et al., 2017), C58 Bacillus bataviensis growth ethylene producers (Ochiai and Ishii, 2008)

NB22 promoter

Plant Promote crop growth and release of siderophores that Paenibacillus C81 growth enable iron acquisition, biocontrol agent (Elliot et al., glucanolyticus promoter 2013).

Plant fruit juice spoilage (Huang et al., 2015; Chang et al., Effusibacillus F13 growth 2004).reduce Nitrate to nitrite and it also produces acid consociatus

NB23 promoter from glucose (Minho et al., 2014)

SAMPLE 10 SAMPLE Plant plant growth promoting rhizobacteria (PGPR) G15 Bacillus aryabhattai growth (Chandrima et al., 2017), production of phytohormones promoter (Yeon et al., 2017)

Staphylococcus Clinical G32 Clinical pathogen (Leighton and little, 1986), warneri pathogen

NB24 Bioremediation of pollutants (Alvarez and Héctor, Plant 2010)., nitrogen fixation (Blasco and Rafael, 2001), G01 Rhodococcus sp growth someof the sp. are plant pathogen, causes leafy gall promoter disease (Muscatello et al., 2007). degraders of hydrocarbons in soil (Bell et al., 1999; Bell et al.,

49 1998), animal and opportunistic human pathogen (R. equi) (Finnerty, 1992),

Probiotics (Jiménez et al, 2013), antimicrobial G14 Bacillus toyonensis properties (Janssens et al, 2017)

Isolated only from sea water of a tidal flat of the Yellow Sea in Korea (Yoon et al., 2003). Produce G06 Bacillus aquimaris Extracellular cellulase exhibited high temperature (Trivedi et al., 2011).

Plant Brachybacterium G33 growth Plant growth promoter (Iti et al., 2011), saurashtrense promoter

Plant fruit juice spoilage (Huang et al., 2015; Chang et al., Effusibacillus G71 growth 2004).reduce Nitrate to nitrite and it also produces acid consociatus promoter from glucose (Minho et al., 2014)

Uncultured G72 Bacillales bacterium

Bacillus Just from volcanic soil (Logan et al., 2001)and soil G86 luciferensis/Bacillus (Loni et al., 2016)

acidiceler

plant pathogens, B. cereus spore is refractory to NB27 extreme environmental conditions (Jensen et al., 2003), SAMPLE 11 SAMPLE suppress plant pathogens has also been reported (Pinchuk et al, 2002; Stabb et al., 1994).disease Plant G95 B. cereus suppression, enhanced mutualisms plant growth pathogen promotion, and yield increases in several systems (Berger et al., 1996; Brannen and Kenney, 1997; Halverson and Handelsman, 1991; Handelsman et al., 1990; Kim et al., 1997; Kim at al., 1997).

The Bacillus xiamenensis strain VV3 is a novel bacterium isolated from the fermented rice and showing the hyper activity in regards to the fibrinolysis G96 Bacillus xiamenesis production. Found to grow at salinities of 0-12 % and at temperatures of 8-45 °C. but was unable to reduce nitrate to nitrite.( Lai et al., 2014).

50 Biocontrol, plant growth promotion, sulphur (S) oxidation, phosphorus (P) solubilization and production of industrially important enzymes (amylase and cellulase). (Ashraf et al., 2004; Barnawal et al., 2013; Radhakrishnan and Lee, 2016), Enhance fruits Plant and grains yield (Kilian et al., 2000; Dursun et al., G99 Bacillus substilis growth 2010), Synthesis of plant growth hormones (IAA, GAs, promoter cytokinins and spermidines) trigger plant growth (Arkhipova et al., 2005; Xie et al., 2014; Radhakrishnan and Lee, 2016), Secretes ACC deaminase to inhibit plant senescence (Xu M. et al., 2014; Pourbabaee et al., 2016). Pest control (Gadhave and Gange, 2016).

Plant G48 Pseudarthrobacter growth bioremediation (Karolina et al., 2000) promoter

Plant pathogen (Elbanna et al, 2014) and can produce Plant G49 Bacillus aerophilus thermostable serine alkaline protease (Kumar t al., pathogen 2011; Madhuri et al., 2012; D'Costa et al., 2013).

plant pathogens, B. cereus spore is refractory to extreme environmental conditions (Jensen et al., 2003),

suppress plant pathogens has also been reported (Pinchuk et al, 2002; Stabb et al., 1994).disease

NB25 Plant G51 Bacillus cereus suppression, enhanced mutualisms plant growth pathogen promotion, and yield increases in several systems (Berger et al., 1996; Brannen and Kenney, 1997; Halverson and Handelsman, 1991; Handelsman et al., 1990; Kim et al., 1997; Kim at al., 1997).

Newly found bacteria in soil of coalmine generated Bhargavaea G60 wasteland (Payel and Debnath, 2017). Thermophilic cecembensis cellulases producers (Tai et al., 2004; Li et al, 2008).

industrial applications, decomposition of plant H59 Kocuria rhizhophila materials (Takarada et al., 2008)

Sulphitobacter H61 Noval enzyme producer (Yoon et al., 2007) donghicola

NB26

Plant biocontrol of plant diseases and Nitrogen fixation H60 Bacillus megaterium growth (Sang et al., 2014) promoter

51 Clinical pathogen, agent of nosocomial infections,

express resistance against several antibiotic Staphylococcus Clinical K39 compounds (Vincenzo et al., 2009). Isolated from pasteuri pathogen

NB29 rhizome of ginger as plant growth promoting endophytic bacteria (Jasim et al., 2013)

Plant fruit juice spoilage (Huang et al., 2015; Chang et al., SAMPLE 12 SAMPLE Effusibacillus K17 growth 2004).reduce Nitrate to nitrite and it also produces acid consociatus

NB28 promoter from glucose (Minho et al., 2014)

plant pathogens, B. cereus spore is refractory to extreme environmental conditions (Jensen et al., 2003), suppress plant pathogens has also been reported

(Pinchuk et al, 2002; Stabb et al., 1994).disease Plant K70 Bacillus cereus suppression, enhanced mutualisms plant growth pathogen

NB30 promotion, and yield increases in several systems (Berger et al., 1996; Brannen and Kenney, 1997; Halverson and Handelsman, 1991; Handelsman et al., 1990; Kim et al., 1997; Kim at al., 1997).

Uncultured organism clone ELU0024- N11 T375-S-NIPCR

SAMPLE 13 SAMPLE AMgANb

NB32 Bacillus samanii by Saman et al. 2010. Bacillus N15 Bacillus samanii samanii so nov that was isolated from snow covered soil.

Uncultured bacillus N18 sp. clone

Plant fruit juice spoilage (Huang et al., 2015; Chang et al., Effusibacillus N28 growth 2004).reduce Nitrate to nitrite and it also produces acid consociatus promoter from glucose (Minho et al., 2014)

NB33 Cause severe irritaions to humans, and they are also Clinical N36 Arthrobacter known to degrade agricultural pesticides (Camargo at pathogen al., 2003; Westerberg et al., 2000).

SAMPLE 14 SAMPLE Clinical pathogen (Funke et al., 1996; Hou et al., Arthrobacter Clinical 1998). Cause of infective endocarditis (Enos et al., N69 woluwensis pathogen 2014). Catheter-Related Bacteremia by Arthrobacter NB35 woluwensis (Shin et al., 2006).

52 Clinical clinical pathogen (Sueharu et al., 2010; Anne and jose, N73 Serratia marcescens pathogen 2007)

Alkaline-tolerant (GUFFANTI et al., 1980), N78 Bacillus firmus biopesticide (Crow, 2014)

Streptomyces N79 antibacterial activity (Amano et al., 2011) griseorubiginosus

Biocontrol, plant growth promotion, sulphur (S) oxidation, phosphorus (P) solubilization and production of industrially important enzymes (amylase and cellulase). (Ashraf et al., 2004; Barnawal et al., 2013; Radhakrishnan and Lee, 2016), Enhance fruits Plant and grains yield (Kilian et al., 2000; Dursun et al., N37 Bacillus substilis growth 2010), Synthesis of plant growth hormones (IAA, GAs, promoter cytokinins and spermidines) trigger plant growth (Arkhipova et al., 2005; Xie et al., 2014; Radhakrishnan and Lee, 2016), Secretes ACC deaminase to inhibit plant senescence (Xu M. et al.,

2014; Pourbabaee et al., 2016). Pest control (Gadhave and Gange, 2016).

NB34 Plant ISR (induced systemic resistance) and increases plant N39 Bacillus sp. growth stress tolerance (Joseph at al., 2014; Ramalingam et al., promoter 2017)

Biofertilizers or biocontrol agent and pant growth promoting microbe (Jose et. al, 2004), inhinbit Plant detrimental effects of salt stress (Goswami et al., Bacillus H81 growth 2014). Reduce toxic metal level in soil (Brunetti et al., licheniformis promoter 2012).highly resistant to pesticides and enhance growth (Jose et al, 2004). Increased total nitrogen and phosphorus content (Hyun et al., 2017).

Micrococcus Opportunistic pathogen (Tsubakishita et al., 2010), N99 caseolyticus helps in chees maturation (Kloos et al., 1998)

NB36

Siderophore producers (Noordman et al., 2006), P32 Brevibacterium opportunistic pathogens (Kumar et al., 2011).

Biofertilizers or biocontrol agent and pant growth promoting microbe (Jose et. al, 2004), inhinbit

SAMPLE 15 SAMPLE

Plant detrimental effects of salt stress (Goswami et al., M2 Bacillus growth 2014). Reduce toxic metal level in soil (Brunetti et al., 8 licheniformis

NB37 promoter 2012).highly resistant to pesticides and enhance growth (Jose et al, 2004). Increased total nitrogen and phosphorus content (Hyun et al., 2017).

53 M2 facultatively anaerobic halotolerant bacterium isolated Bacillus haikouensis 0 from a paddy soil (Li et al., 2014).

Synthsize lipase (Kumar et al., 2014), inulinase P56 Bacillus safensis activity (Singh et al., 2013)

plant pathogens, B. cereus spore is refractory to extreme environmental conditions (Jensen et al., 2003),

suppress plant pathogens has also been reported (Pinchuk et al, 2002; Stabb et al., 1994).disease Plant NB38 P57 Bacillus cereus suppression, enhanced mutualisms plant growth pathogen promotion, and yield increases in several systems

(Berger et al., 1996; Brannen and Kenney, 1997; Halverson and Handelsman, 1991; Handelsman et al., 1990; Kim et al., 1997; Kim at al., 1997).

Plant produce phytohormone (Fitriatin et al., 2013), SAMPLE 16 SAMPLE P69 Lysinibacillus growth biofertilizer (Istifadaha et al., 2017; Rahman et al., promoter 2014)

Plant Insect control (Mohamed et al., 2010), genetic Bacillus P82 growth engineering in agriculture, biopesticide worldwide. thuringiensis

NB39 promoter (Vincent et al., 2008)

Clinical pathogen (Zhao et al., 2008; Jebeli et al., Clinical P93 Bacillus flexus 2017), synthesis of potential silver nanoparticles pathogen (Priyadarshini et al., 2012)

Plant ISR (induced systemic resistance) and increases plant Bacillus sp/ Bacillus P99 growth stress tolerance (Joseph at al., 2014; Ramalingam et al., mycoides promoter 2017)

NB40 Plant biocontrol of plant diseases and Nitrogen fixation SAMPLE 17 SAMPLE Q21 Bacillus megaterium growth (Sang et al., 2014) promoter

Plant

Bacillus Q70 growth plant growth promoter (Sungwan et al., 2002)

18 subterraneus

NB43 promoter

SAMPLE SAMPLE plant pathogens, B. cereus spore is refractory to extreme environmental conditions (Jensen et al., 2003),

suppress plant pathogens has also been reported

(Pinchuk et al, 2002; Stabb et al., 1994).disease Plant R21 Bacillus cereus suppression, enhanced mutualisms plant growth pathogen

NB45 promotion, and yield increases in several systems

SAMPLE 19 SAMPLE (Berger et al., 1996; Brannen and Kenney, 1997; Halverson and Handelsman, 1991; Handelsman et al., 1990; Kim et al., 1997; Kim at al., 1997).

54 Bacillus sp.

Plant ISR (induced systemic resistance) and increases plant Uncultured R91 growth stress tolerance (Joseph at al., 2014; Ramalingam et al., bacterium clone

NB47 promoter 2017) CP59

SAMPLE 20 SAMPLE

Cause severe irritaions to humans, and they are also Clinical T16 Arthrobacter known to degrade agricultural pesticides (Camargo at pathogen

NB48 al., 2003; Westerberg et al., 2000).

Plant proteases producers (Pan et al., 2004), antimicrobials, T21 Bacillus pumilus growth antifungals and plant growth promoting rhizobacteria

NB49 promoter (Thomas et al., 2004; Sari et al., 2007)

Plant produce phytohormone (Fitriatin et al., 2013), T45 Lysinibacillus growth biofertilizer (Istifadaha et al., 2017; Rahman et al.,

promoter 2014)

SAMPLE 21 SAMPLE Plant ISR (induced systemic resistance) and increases plant

NB50 T60 Bacillus mycoides growth stress tolerance (Joseph at al., 2014; Ramalingam et al., promoter 2017)

Plant fruit juice spoilage (Huang et al., 2015; Chang et al., Effusibacillus T92 growth 2004).reduce Nitrate to nitrite and it also produces acid consociatus

NB52 promoter from glucose (Minho et al., 2014)

SAMPLE 22 SAMPLE Plant fruit juice spoilage (Huang et al., 2015; Chang et al., Effusibacillus U01 growth 2004).reduce Nitrate to nitrite and it also produces acid consociatus promoter from glucose (Minho et al., 2014)

NB53 Synthsize lipase (Kumar et al., 2014), inulinase U02 Bacillus safensis activity (Singh et al., 2013)

SAMPLE 23 SAMPLE Staphylococcus U22 epidemidis form biofilms (Salyers et al., 2002), clinical pathogen NB54 often resistant to antibiotics, (Otto, 2010)

55 MICROBIAL DISTRIBUTION IN UNAFFECTED SITES clinical pathogns

others

uncultured plant growth promoter

Graph 5 The presence of pathogens and growth promoters of Udumbanchola Taluk by pre flood analysis

MICROBIAL DISTRIBUTION IN AFFECTED SITES clinical others pathogns

uncultured

plant pathogens

plant growth promoter

Graph 6 The presence of pathogens and growth promoters of Udumbanchola Taluk by post flood analysis

August 2018 flood was a major natural disaster in Kerala history. It was the worst flood of the century to affect Kerala. It caused extensive damage to property and many lives were lost. The poorer sections of the society were worst affected by the flood and landslides. The rainfall pattern in Kerala controlled by South-West and Northeast monsoons. Usually Kerala state receives an average annual precipitation of about 3000 mm. However, there was an abnormal increase in the rainfall received between 1st June 2018 and19th August 2018. It was 42% higher than the normal range. Increasing population pressures and human activities in Udumbanchola Taluk of Idukki district, considerably increased the environmental and socio-economic problems, which resulted in increased number of landslides. The most common effects of landslide are the loss of soil texture, natural forest, grassland, cultivable land, and deteriorated quality of water bodies, loss of native fauna and other ecosystems.

5.1. Social impact

Landslides usually triggered without any warning and makes devastations resulting in significant losses. People lost their lives and livelihood to the flood. On August 8, Benny Kunnel, from Nedumkandam in Idukki, lost his house and one-acre of his cardamom in the flood. People witnessed their houses, crops and properties being washed away leaving behind infertile farmlands. M J Joseph, a cardamom farmer in Anakkara of Idukki lost 80% of his crops (The News Minute, March 2019). Agricultural losses resulting from flood pushed farmers into heavy debts led to several farmer suicides in Idukki district (The Economic Times, 2019).

In addition, post-flood diseases played havoc in Idukki disctrict. In Nedumkandam, over one- lakh patients reported during past one year due to the post-flood infections. Typhoid, jaundice, rat fever, malaria, dengue, chicken pox were rampant (Manorama Online, October 2018). Increased humidity and water logging are the major challenges, which led to higher frequency of disease outbreaks (The Hindu, September 2018).

5.2. Economic Impact

Considering the recent year reports, increased development and investment in landslide prone area resulted in huge economic loss. The damage incurred to the land, private and public

57 property resulted in financial ruin for property owners. Incessant rain, landslide and water stagnation caused devastating effect on sensitive crops including diseases like capsule rot. In Kerala a total of 45% plant loss reported. Based on this, recently spices board revived a plan for flood hit cardamom plantation, which owned predominantly by small and marginal growers (The Hindu, 2019). Idukki is the largest producer of cardamom in India. Due to flood, cardamom fields destroyed and out of 40000 cardamom farmer families, 60% lost their crops. Crops damaged by stagnant floodwater and landslides. Idukki was one of the worst affected areas during flood/landslide. The cost for one kilogramme of cardamom was between Rs 600 - 1,000. In the post-floods market, farmers had only 40% to 60% of their original crops and the yield had dropped to 20%. Though prices have now hiked to Rs 4,000 - 6,000 per kilogram and traders argue that this will help compensate the farmers, the growers say otherwise. Those who have lost most or all their crops say that the price rise is a useless form of compensation if there is no yield (The News Minute, March 2019). The estimated economic loss in tuber crop cultivation was to the tune of rupees 7.5 crores for cassava, 1.05 crores for other tuber crops and 1.8 crores for elephant foot yam totaling to rupees 10.5 crores (Byju et al., 2018).

5.3. Environmental Impact

Landslides also create environmental issues and the problems continue to effect local farmers of Idukki District. The changes in the topography of earth surface, quality, vegetation etc. mainly effected. As a result, the cardamom yield has reduced by 100 kilograms and stunted growth reported (The News Minute, March 2019).

Among the tuber crops in idukki, cassava is cultivated in an area of 8092 ha and the total production of the major crop cassava is 2.98 lakh tonnes in Kattappana, Adimaly, Idukki, Nedumkandom, Elamdesom, Thodupuzha, Devikulam and Peerumedu/ Azhutha, where 8 blocks was affected (Byju et al., 2018). Over 11,000 hectares of farmland estimated to have ruined. With the top soil being washed away and soil composition, itself is believed to have changed, thereby affecting the yield. It has not been easy for the small and marginal farmers who make up the bulk of the farming population here (The Economic Times, 2019).

P Indira Devi, Director of Research, KAU, told Business states that the damages to the farming sector were going to affect the agricultural economy, food security, and ecological safety in the forthcoming years. The soil quality loss due to floods is to be assessed based on tests. Though floods are believed to improve soil structure due to organic matter deposits, there are reports

58 that floods also cause nutrient leaching (especially potash) and that there can be an imbalance of secondary and micronutrients. The persistent flooding in the uplands reports root damage and secondary infections (The Hindu, September 2018).

Landslides are a serious geological hazard common to hilly regions. In the present study, Udumbanchola Taluk of Idukki District selected for sample collection, because this region is more susceptible to landslides during monsoon season, which makes the slopes of hilly areas vulnerable to landslides. Studies on soil are extremely relevant, enabling better choices for conservation and management of vegetation. The soil texture varies according to each site of sample were collected. Because the soil physical characteristics vary with vegetation cover, topography, climate, weathering processes, microbial activities, and several other biotic and abiotic factors.

By the sample site analysis, in location 01, large portion wasting of land has been observed with light brownish, wet, coarse and fine-grained, humus incorporated top soil and wet with less humus containing bottom soil. Mainly Humic substances makes the soil productive, include three main fractions: humin, humic acid and fulvic acids, which are soluble under all pH conditions (Guimarães et al. 2013). Such conditions in soil exert direct or indirect influence on the microbial floral and faunal population (Sudhansu et al., 2018). In the case of sample location 05 and 21, have similar property with rich in organic matter. The organic matter composition commonly increases by annual precipitation and the elevated humidity of soil result in greater biomass production, generally require, 60-percent water-filled pore space (Linn and Doran, 1984). Along with above properties, sample location 07 shows loose laterite powdered soil, this texture because of weathered tropical or sub-tropical soil (Oyelami and Van. 2016) and intense chemical weathering (Luis et al., 2011). This kind of soil type has less than 30% silt content, between 25-63 % liquid limit and 5-42 % plasticity index (Nwaiwu et al., 2006; Badmus, 2010; Quadri et al., 2012; Eluozo and Nwaobakata., 2013). On basis of these observations, the properties of soil should improve before there utilization for engineering purposes due to the permeability density and porosity (Osula, 1996; Odoeyo et al., 2006) for stabilization. It enhances the strength, control soil dust and ensures soil waterproofing (Amu and Adetuberu, 2010). Similar to the above, the sample location 12 and 18 was shown high organic matter and all samples including top, bottom and control has good amount of humus and appeared to have red, brown to black colored, and was dry and hard. The Basic soil pigments responsible for red and black are the organic matter and hematite αFe2O3 (red) (Yu et al., 2007; Yu et al., 2005; Yu et al., 2004). According to the elevation, the humus content can seen as gradient pattern (Griffiths et al., 2009). Variation in color provides the

60 information on the formation, constituent, and other properties of soil (Buol et al. 2011). Despite, Humus, gave black and greyish pigments, iron hydroxides show reddish pigments, and silicic acid, kaolinite and calcium carbonate results in white and greyish pigments (Bogrekci and Lee 2005; Christensen et al. 2004; Schwertmann 1993; Simonson 1993). Such changes in the parameters of soil humus status can serve as a diagnostic index of evolutional trends in the irrigated soils (Stoma et al., 2015).

This pattern variation also observed in location 14, where, organic detritus and decomposed particles where highly packed on the topmost layer of the soil i.e. the organic horizon of the soil. Here topsoil was very darker, brownish and little wet and the bottom soil lightly brownish and wet. The composition of organic material responsible for the colour gradients in soil and also can regulate microbial abundance and function (Zhang et al., 2012; Song et al., 1983; Liu et al., 2014). However, the content of soil organic matter in turn associated with high microbial abundance and diversity (Staddon et al., 1997; Fu et al., 2015) by providing energy to microbes (Staddon et al., 1997; Bending et al., 2002; Malosso et al., 2015; Hao et al., 2008; Luo et al., 2015). Organic matter is the most important pigment that colors in black. In recent years, organic pollutants that exacerbate the soil blackness contaminate soils (Yu et al., 2015). Several Statistical approach are widely used to establish a connection between the color of soil and content of organic matter (Yu et al., 2016; Mikhaylova and orlo., 1986; Yu et al., 1978; Franzmeier., 1988; Konen et al., 2003; Lindbo et al., 1998). The degree of soil darkening also depends on the degree of humus acids (Lindbo et al., 1998).

The sample 10, located just above a settlement of human lives, without adopted suitable measures was extremely risky for the survival of humans. Here, the landslide seriously affected the cultivable land and deteriorated the settlement property underneath the disaster location. From this site, control soil sample was very humus rich, dark, wet, silty, and consisted of nutritive sediments, the topsoil with good amount of organic carbon-rich particles and the bottom soil with dry, clumped, hard, and light brown coloured. The above changes associated with the amount of soil organic matter, nutrients, and other physical properties, in each location have different intensification in the landslides and are strongly influence the processes of soil cover and vegetation restoration (Pickett et al. 1999; Shiels et al. 2006). These are mainly due to their ability to adsorb ions to form soil and its role in the physical structure (Riding and Awramik, 2000). Walker et al. (1996) suggest that organic matter and nutrients are a limiting factor for succession to start in landslide hit area. The landslide deposits characterized by high

61 variability of properties, especially the distribution of the soil organic matter (Błońska et al. 2016). The contents of soil organic matter are often used as an indicator of soil quality, and it helps determine the physical (Masri and Ryan 2006), biological (Valarini et al. 2003; Arandá et al. 2015) and chemical (Sebastia et al. 2007) properties of soil.

So the organic matter used in the evaluation of soil quality in addition to biological indicators (Fliessbach et al. 2007). In such situation, Soil microbial biomass carbon usually used to characterize the activity of soil organic carbon (Yang et al. 2016). In the sample location 11, reported human settlement loses, deaths and huge devastation of properties including shops, roads, and surroundings completely affected by the impacts of landslides. The humus contents were very less in the whole area as it was totally wasted the land by the sliding of earth. Top and bottom samples seem to have very white, powdery, and absence of humidity. The white powdery accumulation was mainly due to the salt. By enough rainfall, from the soil began to dry out and begins to rise to the soil surface (Brouwer et al, 1985). Salts can be naturally occurring, such as from deposits of gypsum in the soil, or from sodium salts. The temperature in this location 11 found to have very high and control soil lacks organic particles. In such a situation, it causes poor water infiltration and poor plant growth (Maomao et al, 2014).

Sample location 19 is a river basin mainly lying in the slope regions of Bison Valley. These areas seriously affected by the flood of August 2018. Washing out of topsoil were the most extremely reported phenomena in this region. In addition, sand with silt deposition seems higher in post-flood events. It was very difficult to sample the soil samples as the whole topsoil parts completely covered with a thick sand layer. Bottom layer seems darker, very humid, and rich in humus matters. Most interestingly, the control soil collected from this region containing red and dark coloured soil. Microbial diversity in floodwater is highly related to the decomposition of organic matters and other biochemical activities, which are directly affect water properties (Alongi., 1994). The microbial community in floodwater is temporally variable and has an impact on human habitat and public health issues (Taylor et al., 2011; ten et al., 2010). Therefore, without a proper information about can cause widespread health public problems in the area (Chaturongkasumrit et al., 2013). Studies related to this area was limited only a few studies have examined microbial diversity during flooding (Ten et al., 2010). The Humus contents in location 16, were very less, very white, powdery, and absence of humidity. Conversely, high-carbonate soils and can lead to decreased pH due to soil decarbonatization (Séré et al. 2010). In location 08 with very high steep of eroded land where

62 lemon grasses and small shrubs thrived in the top portion with light brownish due to that the oxidation state of the iron and organic matter was present in a very small amount.

In the sample location 02, 15, 17 and 23 soil samples are red - brown with a dry texture and the surroundings were having the presence of laterite depositions. These lateral deposition of sediments become important as the stream meanders across the valley floor (Ritter and Michael, 2006) and the red soil is composed of iron oxides coated soil particles formed in warm, temperate, humid climates, and in regions covered with deciduous or mixed forests (Zhao, 2002). However, it is worth noting that in China, red soil landscapes have been suffering from unprecedentedly strong disturbances due to rapid urbanization and industrialization since the 1980s (Bian et al., 2014). The presence and abundance of iron oxides in the soil sample, depending on the conditions of soil evolution (Bortoluzzi et al., 2015). The iron oxides and organic matter in the soil strongly affecting the reactions and rate of phosphorus adsorption and desorption in highly weathered soils (Fink et al, 2016). Such an arrangement of soil texture was mainly due to the interaction between them via ligand exchange (Cesco et al. 2000). Part of these, organic ligands released by plants in the rhizosphere, particularly under Fe shortage (Jones 1998). These humic fractions in the soil can act efficiently as natural substrates for Fe acquisition by roots of monocots and dicots (Pinton et al. 1997, 1999; Cesco et al. 2002). The similar property also reported that in location 22 with red dry soil texture and the surroundings were having the presence of laterite depositions. Hence, the soil appeared as red and brown due to the presence of organic matter. Red soils of the humid tropics served as indicators of the intensity of weathering. This is because of the parent materials of these soils, derived from Fe- rich mafic rocks, exhibit red coloration upon weathering (Eswaran and Sys 1970; Kampf and Schwertmann 1983).

The landslide completely disturbs the texture in the location 07. The topsoil becomes very dry and clumped after the post-flood events. There was much deterioration of the organic part in bottom soil in contrast to the topsoil. It was completely showing red and white coloured mixtures of laterite and white carbonaceous rocks. The carbonate rocks usually covered with thick lateritic soils because of the humid and mild monsoon climate. Like the above, in location 04, 16 and control sample of location 17 Due to the presence of calcium carbonate rocks, the soil appeared to be white in colour and supposed to have high alkaline nature. These humic substances, from calcium carbonates, can liberate carbon dioxide (CO2) within the soil, taken up by the plant or it may form carbonic acids to act on minerals to release plant nutrients. So

63 in the absence of humic substance trace minerals elements are converted to insoluble precipitates including metal carbonates (Robert., 2017). Carbonate minerals one of the major components of calcareous soils and may represent adsorptive surfaces for heavy metals (McBride, 1980). The presence of these carbonate minerals in soils expected have direct and indirect effects on heavy metal mobility and reactivity through increased soil adsorptive capacity (Kinniburgh & Jackson, 1981; Leeper, 1978). The sandy patches on slopes, white grit on hilltops related to soil mineralogy, which indicates soil acidity and nutrient availability (Ana et al., 2016). Extracting of iron oxide from the soil by the influencing the decreased level of aluminum results the change of brownish colour to white colour soil (Sarbatly et al., 2009).

Weathering of these carbonaceous rocks is an important link with exogenic biogeochemical cycle of elements in the environment (Zhu and Li, 2004). It also affects the microbial population also (Muentz., 1890). Usually, landslide-prone area has subjected to have low stability on comparing with the lands, which is low risk to the hazards. The loose sediments on the topsoil and the unstable physical geographic position of the sampling area show unstable features by water penetration to the place and which makes an extremely risky way of living in such circumstances. In the location 06, found to be little deposits of Calcium carbonate rocks. The lower concentration of carbonates in the soil increases the porosity in the soil (Falsone et al., 2010). Weathering and decomposition increased the dissolving and leaching of carbonate minerals ratio (Wei et al., 2018).

The most interesting spotting was the brightly pink coloured deposits of soil after the landslides in the location 09. Its topsoil was light brown with dominant pink colored and bottom soil was bright pink, dry, very loose, shiny, and the granular size of the soil was very small in contrast to the control soil .This was also due to the very light oxidation of the iron in the soil with the presence of lateritic powdered rocks. Calcium carbonate buffers soils generally give the pH range of 7.4 to 8.5. In this pH range, iron oxides attain their minimum solubility, and iron deficiency in plants is most severe. (Thorne et al.,1951). In location 13 also shows the light shades of brown colour and little appearance of a reddish tinge. Moreover, in location 20, were pink coloured deposits due to the light very light oxidation of the iron in the soil with the presence of lateritic powdered rocks. There also contributed the white powdery as well as hard soil from the region. The topsoil was light brown with dominant pink coloured and bottom soil was bright pink, dry, very loose, shiny, and the granular size of the soil was very small in

64 contrast to the control soil. The pink colour was due to the NaOCl activity in the soil, in turn, reduces the organic matter content (Anderson et al., 1972).

According to Dekker and Ritsema (1994), soil moisture zone can be important for stability in a landslide. The bottom zone determines a limit below which the soil is water repellent; the top zone determines the water content above which the soil is wettable (Dekker et al. 2001, 2003; Ziogas et al. 2003). Several studies have conducted on the importance and the hydrological impact of water repellency in soils (Dekker et al. 2001; Doerr and Thomas 2003) to predict the landslide. In the location 13, the top soil were very dry and hard due to the inability of waterlogging capacity in this region, where very dry and brittle type and mixed with red soil and root parts. Large aggregated of soil clumps here formed due to the results of flood and large erosions. The soil hydrological properties like, runoff, and sediment concentration is as an indicator of soil degradation. These studies found that, in addition to climatic variations, soil properties are highly affected. (Boix et al., 1995, Chesnokov et al., 1997, Dunne and Black, 1970, Govorun et al., 1994). These soil clumps/aggregated material can move with water on forest slopes because the shielding effect of large particles has been destroyed (An et al., 2010). Previous studies show that runoff from sandy and gravelly soils have generally focused on erosion by raindrops or erosion of bare land (Cai and Barry, 1996).

Roots not only stabilize the soil by simple mechanical effects, but the finer roots with fungal hyphae and the associated microbial communities aggregate finer soil particles and organic components into soil aggregates by means of both physical action and the production of organic compounds. The binding of soil particles into stable aggregates of various sizes provides a range of pore sizes for storage of organic matter and water, as well as root growth. But here in the sample location 09 and 20, the organic root particles were completely absent in the top and bottom soil in this post-landslide times with loose soil texture, which give rise to frequent erosion and land sliding again in the heavy rain seasons if the area has not protected with precaution methods. Likewise in the location 15, the plantain crops where prominent before 18th August flood. Moreover, this area where seriously devastated with the after effects of the same. White carbonaceous rocks also seem to be high in number this region. There was attainment of angle 45o in order to retain the stability of land by itself. The cultivable region prone to landslide can be a lot of reason. Usually, the rhizospheric microbes in the region increase the organic matter content, which supports the soil aggregation (Fageria and Stone 2006). However, in case of root penetration is less than that in lower-bulk-density soils result

65 in week channel wall (Kar and Ghildyal 1975). Therefore, the spaces between roots and channels cause the roots to move and displace soil (Hintikka 1972) very easily by the external force and may contribute to landslide initiation. The report has shown that when more spaces exist between the root and the soil, root hairs grown more numerous (Van Noordwijk et al., 1992) but they may not be tightly bound to the soil (Kooistra et al. 1992; Bailey et al. 2002). Where in location 14 had rills like rifts where formed during landslides and flood. Rift margins mainly found in the steep escarpments up to several hundred-meter high area (Gouin, 1979).

The soil microbial communities are dynamic and capable of significant changes at temporal scales in relation to seasonal variations. The microbial activities and its counts also monitored as a part of research projects using total plate method, at 23 localities on topsoil, bottom soil, flooded soil and control sample. The diversity and population show high in bottom soil when compared to topsoil, unfortunately, with the control sample, it is low. Arunachalam & Upadhyaya (2005) found that there was 2-20 times more microbial biomass in landslide unaffected area than the affected area. Among the localities, there was only a slight difference. It is because of bacteria in soil samples was evidently dependent on the presence of fresh organic matter (Kubát et al. 1999). By landslide the soil microbial biomass is greatly reduced, carbon and nitrogen (Błońska et al. 2016) and enzyme activity (Pająk et al. 2016).

It is a general tendency, decreasing soil microbial populations with increasing vertical depths of soil. Microbial community composition decreased with increase in soil depth that might be due to the gradual decrease in soil organic carbon (Corg) and total nitrogen content with increasing depths (Buckley and Schmidt., 2003). Here from these soil samples (01, 02, 05, 06, 13, 17 20 and 21), the microbial population is high in top soil compared to bottom soil with no comparable change in diversity in location, 01 and 02. Nevertheless, in the case of location 04, 07, 08, 09, 10, 11, 12, 14, 18, 22 and 23 the microbial population was high in bottom soil. This not only served as a source of food but also influenced the amount of living space available for many soil organisms (Sudhansu et al., 2018). Comparing to the control sample, the high microbial diversity shows only in sample location 1 and 8, and considering top and bottom soil, topsoil with high diversity in location 05.07, 09, 11, 12, 13 and 23 and bottom soil in 04, 06, 10, 17, 18, 20, and 22.

In nutritionally rich soil, gram-negative organisms found to be dominant and it would seem that certain of the gram-negative are inhibited over many of the other species of both gram-

66 positive (Lawrence et al 1986). Landslides result in depletion of nutrients, soil organic matter, etc. (Acharya and Kafle, 2009) here from the soil sample, the majority of them were gram- positive bacteria.

The microbes are the primary biological indicators of soil quality. The microorganisms are important in landslide colonists that often improve the nutrient conditions through their metabolism, symbioses, and role in decomposition and nutrient cycling. Majority of dominant bacteria isolated from the sample have the enzyme nitrogenase, which allows them to convert atmospheric nitrogen to forms of nitrogen. Without bacteria providing such forms of nitrogen, could not exist with their present physiology and biochemistry (Schlesinger, 1991).The microbial activities were evaluated using NPK profile contain nitrogen-fixing, potassium solubilization, phosphate solubilization, and Sulphur degradation property. The availability of Sulphur, potassium, and phosphorus are especially scarce in the available form in the majority of areas, while nitrogen fixation activity can achieve high amount. Such enzymatic activity quickly changes in soil conditions and soil quality (Jin et al. 2009; Klamerus-Iwan et al. 2015). Obviously, the microbiological activity is residual to return the soil back to vegetative. Therefore, when appropriate measures taken, the landscape back to productive fast.

Considering NPK activity, majority of selected dominant microes from the soil samples have nitrogen-fixing ability. It occurs, generally at mild temperatures, by nitrogen ﬁxing microorganisms, which are widely distributed in nature (Raymond et al., 2004). Furthermore, Biological nitrogen fixers represents an economically beneﬁcial and environmentally sound an alternative to chemical fertilizers (Ladha et al., 1997). The Number of nodules produced by this nitrogen-fixing ability decreased as root distortion and CaCO3 accumulation increased (William et al, 1977). In addition, When Ca increased in the soil, Al toxicity decreased and it will be beneficial for the plant growth (Wallace et al., 1966). Munns (1970) showed that alkaline pH was required to obtain nodulation. Here from the sample only few of them show potassium and phosphate solubilisation property. potassium is required to activate over 80 different enzymes responsible for plant and animal processes such as starch synthesis, nitrate reduction, photosynthesis, energy metabolism, and sugar degradation (Almeida et al., 2015; Cecílio Filho et al., 2015; Gallegos-Cedilloet al., 2016; Hussain et al., 2016; White and Karley, 2010; Yang et al., 2015). Various studies showed that the increase in temperature and soil water content leads to an increase in N2O emission and soil respiration rates as a positive feedback response of increased microbial metabolism (Cai et al., 2016; Oertel et al., 2016). The soil

67 bacterial community structures in response to the increased air humidity have a higher chance to produce greenhouse gas N2O via denitrification process (Truu et al, 2017).

By the molecular identification, the selected dominant isolates identified from each sample location include plant pathogens, clinical pathogens and plant growth promoter. Most of the plant diseases caused by soil borne pathogens, those are difficult to predict, detect and diagnose. Investigations on these pathogen invasions are limited and gain attention only when they become virulence, influence the yield of cultivations and particularly when it became a challenging aspect in community. In this work, the plant pathogens such as Bacillus cereus and Bacillus aerophilus identified by molecular technique from the location 01, 04, 09, 11, 13, 16 and 19 of the landslide affected area. The ability of plant pathogens to survive in the stressful conditions could affect the post landslide cultivation. These microbes have strong influence to cause disease and close connection with the soil for the survival. During the stressful condition, usually these kinds of pathogens exist in soil in inactive form (Katan, 2017).

The soil bacteria important in biogeochemical cycle can used for the crop production, improving plant health and soil fertility. From the sample location 01, 02, 04, 05, 07, 08, 10, 11, 12, 16, 14, 15, 17, 18, 21, 22 and 23, the microbes identified as plant growth promoters such as, B. lichniformis, Bacillus thuringiensis, Bacillus parabrevis, Staphylococcus ariettae, Effusibacillus consociatus, Bacillus paramycoides, Sinomonas atrocyanea, Streptomyces gamaensis, Pseudarthrobacter chlorophenolicus, Arthrobacter pascens, Bacillus bataviensis, Paenibacillus glucanolyticus, Bacillus aryabhattai, Rhodococcus sp, Brachybacterium saurashtrense, Bacillus substilis, Pseudarthrobacter, Bacillus megaterium, Lysinibacillus, Bacillus megaterium, Bacillus subterraneus, Bacillus pumilus and Bacillus mycoides. Generally these bacteria function in three ways, such as microbe derivative for plant, solubilisation of minerals and antibacterial and antifungal property. Besides that, microbes include indirect plant growth promoters like the prevention of the deleterious effects by the production of siderophore. The direct plat growth promoters comprise to symbiotic and non- symbiotic microbes, function by the production of Phytohormone, and solubilisation of minerals (Rifat et al., 2010). From the soil sample locations 01, 04, 05, 06, 09, 12, 10, 14, 16 and 20, Clostridium sp, Clostridium sp. Marseille, Roseomonas, Staphylococcus haemolyticus, Staphylococcus sp, Staphylococcus warneri, Staphylococcus pasteuri, Arthrobacter, Arthrobacter woluwensis, Serratia marcescens and Bacillus flexus were molecularly identified and are reported as clinical pathogens. However, it also contained soil borne pathogens capable

68 of causing disease in humans and animals, act either opportunistic. These organisms have the ability to survive for extended periods.

The presence of nitrogen-fixing microbes in the soil somehow shows the scarcity of its availability in landslide area and can considered as an indicator of natural reuptake. The nitrogen limitation under high level of carbon dioxide may promote a microbial community with enzymatic capacities for the oxidation of more recalcitrant forms of organic matter, which mineralize more N and release more CO2 from the soil (Billings and Ziegler, 2008; Ziegler and Billings, 2011). Therefore, the Changes in the microbial community from the control and sample provide a parsimonious explanation for the increased oxidation state of the soil (William et al, 2015). Soil microbial functional diversity linked with the stability of soil microbial communities and levels of soil biodiversity (Theuerl et al., 2010). Microorganisms are key mediators in the formation, mobilization, transformation, and storage of organic matter in various environments (Carlson et al., 2004; Young et al., 2004; Jiao et al., 2010; Lin et al., 2014; Neumann et al., 2014; Xue et al., 2016).

Considering our report, only lower portion of landslide soil is potential for the cultivation, because of the low soil aggregate stability, soil moisture (Alexander., 1992; Malgot and Baliak., 2002) and considering the microbial population. Furthermore, it contains mixed soil materials with weak soil aggregates, and hence, it was easier for vegetation. In such areas of active landslide, the environmental conditions seemed to be more favourable for the survival of living creatures. It is because of the presence of the soil cracks ensured air and water movement in the soils that enabled vegetation to grow better, that gradually enhances the microbial population. This study concludes that the lower portion of active landslide areas may having better vegetation cover. Therefore, the use of land resources in an appropriate natural arrangement of landform can achieve land sustainability and can avoid unexpected landslide event in the future.

The overall objective of this study is to suggest an integrated analysis of microbial diversity loss due to landslide based on the comprehensive study on Udumbanchola Taluk, Idukki district. This considered as the one of the most affected Taluk under the Idukki district administration and monitoring the measures to mitigate the impact of landslides. A preliminary study carried out to investigate about the landslide triggering factors, they are commonly by external stimuli, including slope stability conditions, increasing stress and the human invade activity, economic objects and infrastructure. In addition, microbial analyses incorporated to find out the mechanism of presence soil property against vegetation. A framework for interpreting data gives the actual microbial scale in landslides occurring in basins and has clearly demonstrated the heavy microbial loss compared to unaffected site. With the aid of experimental data, following conclusions derived from the results of this study

 The landslide was primarily dependent on manmade genesis and with heavy rainfall, soil properties etc. These were the relative importance factors in inducing instability of unsaturated soil slopes and with appropriate measures can reduced such dangerous atmosphere.

 The integrated analysis microbial activity with unaffected area, demonstrated heavy loss microbial diversity and population reduced the soil fertility properties, which means that these landslides were also make difficulties in upcoming cultivations/ vegetation.

 The presence of plant pathogens in such cultivable land could affect the yield of cultivation and it spreading to nearby areas through irrigation process; make a sudden outbreak of diseases in vegetation. In addition, in the case of clinical pathogens, without proper precaution make the present condition serious.

 The sudden invasion of clinical pathogen due to this disaster creates a sudden disease outbreak in the area are possible, without proper precaution and awareness to the public.

The dominating plant growth promoters in the landslide area could bring back the fertile soil and enhancing such situation will help make speedy action.

8.1 Issues

In this work, a major issue can be demonstrate by interpreting the data, which gives the actual microbial scale in landslides occurring in basins and has clearly demonstrated the heavy microbial loss compared to the unaffected site. This microbial disturbance because of the loss of surface soil organic matter and decline in the concentration of available nutrients. The microorganisms are the primary indicators of soil quality, have a critical role in the maintenance of soil function. So proper pre-treatment has to done in the area before the cultivation begin otherwise, it may affect the yield of crops.

The Idukki district, India’s largest cardamom producer but unfortunately it was one the worst affected areas during the floods. Udumbanchola, has the largest cardamom plantations in the district. A large part of it was affected or destroyed due to heavy rains for one month due to the rotting in vegetation (Manorama online August 2018). In November 2018, Manargadu Social Service Society (Mas), a team of 6000 organic managers of Idukki, Kottayam and Wayanad districts, is trying not only to calculate the damage but also to increase the resurrection of the middle and small farmers in Idukki. MAS president Bijumon Kurien said that if required, 100% 'buy back' will be signed if required. Support units that will targeted for further value addition of crops also supported. At about the same time, Idukki planting of 2 lakh seedlings in different districts of the district aimed at strengthening the Idukki farm mechanism (Manorama online, November 2018).

The microbial isolates in the present study contain plant pathogens, which can become a next upcoming threat to the vegetation, so proper precaution and preventions will help to the farmers. In Nedugandam several diseases after these natural disasters reported in high range farm crops. Pepper, cardamom, cocoa, cabbage, and cloves mostly reported. The major diseases reported are rapid growth, leaf fall, leaf blight, ripening, etc. If the disease progresses, it will adversely affect the harvesting (Manorama online, October 2018).

Another issue reported is that, with the rise of the temperature immediately after the floods influence the earthworm. In the district, vermi compost took a severe hit including 20 acres of land, Kunjithanni, Nedumkandam and various parts of Wayanad, results in the death of earthworm due to the rise of daytime temperatures and declining nightly temperatures (Manorama online September 2018). This mass change in the minute living creatures in the

71 area, which may influence the environment indirectly. So without any evidence, we can say that it may also affect the microbial biomass too. However, the intensity and how it’s after effect is far unpredictable without performing further studies. To strengthen the above point, Our preliminary data shows that there is a reduction in microbial count in the top soil compare to the control sample this indicate that the useful microbes could washed off through landslide. This would leads into the formation of infertile land low yield of crops.

The agriculture sector in Idukki is far more serious than what was earlier. The farmers are worried that the floods in Idukki have changed soil structure and will affect yield very much. That is the reason behind the suicide of 5 farmers (Mathrubhumi news March 2019). The floods that hit not only the crops but also the agricultural productivity and soil fertility of the district. About 30% loss of yield reported after flood, Cardamom Research Institute team found that, the reason behind this difference due to the soil structural change. They noticed loss of soil nutrients including nitrate, phosphate, potassium, sulphur and boran. Therefore, the decrease in the soil acidity affect the root growth of plants. In addition, the farmers claim that the reduction in crop production is due to the topsoil washed away and covered with sand and debris hence the soil must have lost its fertility (The news minute, March 2019).

V.S Sunil Kumar, agriculture minister of Kerala has one said that there is changes in the chemical and physical constitution of the soil, it is very agreeable that the influence of landslide on soil texture has a greater impact on soil fertility. In many affected areas slit has accumulated over the soil, this obstructs the oxygen supply.

8.2 Suggested Restoration Activities

 The sudden invasion of plant pathogens after the flood will be problematic on coming year, so proper awareness should give to the local farmers to take precautions.

 The sudden increase of atmospheric temperature adversely affect the living creatures and the microbial diversity in soil. So microbe dominating compost can entire prescribed for the recovery.

 An effective crop rotation awareness can given to the local farmers to increase the yield and it will helpful to give an idea, how to withstand in such situation.

 By studying the effect of soil essential elements in the present situation, soil reclamation can done using, green leaf manures, composts, lime, coir pith, bio-fertilizers etc.

72  Give awareness to the local farmers about the sudden climatic changes and how they affect each crop yield

 Advice the local farmers, to primary cultivate of those lands with low microbial population and diversity with the cultivation that enhance the population.

 By developing the hybrid verities of plants that withstand the abiotic and biotic stress will helpful to overcome the problem to a particular extent

 The use of pre-treated seed with microbes or microbial suspension available in market, applying to the soil before cultivation will restore the microbial diversity and soil nutrition.

 There is a presence of clinical pathogens in the soil, instead of spread panic to the community give them an awareness to take proper medication to the diseased people (if any), especially near the landslide prone area.

 Identify the landslide risky area and make them strong using plants like shrubs, which hold them to a particular extent and prevent inappropriate human interventions in this zone.

 Further studies require in the affected area to explore more issues that faced by farmer rather than that listed above and how the microbe related to such disaster.

Landslide being one of the prime geological hazards occurring in all the hilly districts of Kerala cause heavy damage to property. Despite this study carried out at landslide-prone areas, there is a lack of information in depth scientifically to express; this report is an attempt to bring the variation of microbial biomass. Further studies can be conduct to get more supportive data to this work

The conditions of susceptibility to landslides can be define by considering the following in detail, such as hydrological processes associated with soil, the water infiltration and storage capacity in the soil, soil texture. Additionally, the presence of vegetation and its influence in erosion leading to landslide gives the data to predict the possibility of the occurrence of landslides. These studies satisfactory for understanding the vulnerability by governing soil parameters depict the actual occurrence of the landslide events. A vast amount of research has done on other nations for the prediction of landslide occurrence by considering the scientific data. The attention for quantifying the effect of earlier landslide determines the susceptibility for the future landslide. For example, the common hypothesis is that the occurrence of the landslide is high in the same place. This was assumed without considering any role of intrinsic attributes, so more scientific evidence will offer a clear contrast with existing approaches

The microorganisms are the primary indicators of soil quality, have a critical role in the maintenance of soil function. In this work, the actual microbial scale in landslides occurring in basins and has been clearly demonstrated the heavy microbial loss compared to the unaffected site, which intern means the heavy loss of soil quality in landslide-prone areas. Further studies are necessary to understand the depth of current situation quantitatively. The microbial involvement is a key process in soil structure formation, decomposition of organic matter, toxin removal, and the cycling of carbon, nitrogen, phosphorus, and sulphur. So the analysis of these parameters in detail will give more information about loss of soil properties and how much they are going to affect the coming vegetation/ cultivations in the area and what kind of precautions we have to take in advance. In addition, the prediction of a landslide by bacterial assemblages on the recovery time and its detailed comparison on each site will highlight the potential role in relation to a disturbance.

In order to get clear cut information about the microbial diversity and its evolutionary change of the new microbial invaders in the area, and how they related to existing microorganism, their

74 relationship can be evaluated by the addition of bioinformatics tools. Here in this work, due to the time limit, the domination microbes from each sample site identified. Therefore, the use of molecular techniques adds more precision and accuracy to the phylogenetic identification and also to the true reflection of microbial diversity in the landslide-prone areas. The effect of disturbance on diversity, community structure, ecosystem functioning and primary succession environments has not studied in terms of detailed community composition. There are several uncultured and recently discovered bacteria without much information obtained in this study, so further studies will offer more data regarding the new microbial sp.

The microorganisms from these extreme conditions commonly have unusual properties and activities. So various studies we have to undertake to examine to identify such properties and characteristics. Such unique functionality which arises from their biological system can contribute more informative data to the scientific world and also can evaluate how they beneficial for agriculture.

The higher microbial biomass in the bottom soil than in the topsoil of the landslides suggests that landslide disturbance altered the composition. The soil microorganisms were particularly important to increasing soil fertility and accelerating the re-vegetation process in disturbed soils. The loss of surface soil organic matter and decline in the concentration of available nutrients is also a fact of microbial disturbance. According to this involvement in the community/ecosystem repair and resilience, in the present condition, the degree to which types of organisms are involved to exploit different stages of the recovery after disturbance can be studied in further. In detail, which the soil community and what kind of its function return to its original state and how much time does it take can be evaluated.

The microbial isolates in the present study contains plant pathogens and also clinical pathogens. Their invasion in these areas can affect the community to a particular extent. In the case of plant pathogen, which can become a next upcoming threat to the vegetation, so proper precaution and preventions will help to the farmers and in the case of clinical pathogens, the lack of information becomes crucial so further studies required to fetching the data regarding the landslide and how we can manage it.

A.L. Michon, L. Saumet, A. Bourdier, S. Haouy, N. Sirvent, H. (2014), MarchandinBacteremia due to imipenem-resistant Roseomonas mucosa in a child with acute lymphoblastic leukemia J Pediatr Hematol Oncol, 36, pp. e165-e168

Akinyemi BT, Buraimoh OM, Ogunrinde OO, Amund OO (2017) Pectinase Production by Bacillus megaterium, Bacillus bataviensis and Paenibacillus sp. Isolated from Decomposing Wood Residues in the Lagos Lagoon. J. Trop. Life. Science 7 (3): 204 – 207

Alvarez, Héctor (2010). Biology of Rhodococcus. Springer Science & Business Media. pp. 231–256

Amano, S., Sakurai, T., Endo, K., Takano, H., Beppu, T., Furihata, K.,Ueda, K. (2011). A cryptic antibiotic triggered by monensin. The Journal of Antibiotics, 64(10), 703– 703.doi:10.1038/ja.2011.69

Anne Van Dommelen, Jos Vanderleyden (2007), in Biology of the Nitrogen Cycle.

Arkhipova T. N., Veselov S. U., Melentiev A. I., Martynenko E. V., Kudoyarova G. R. (2005). Ability of bacterium Bacillus subtilis to produce cytokinins and to influence the growth and endogenous hormone content of lettuce plants. Plant Soil. 272, 201–209.

Ashraf M., Hasnain S., Berge O., Mahmood T. (2004). Inoculating wheat seedlings with exopolysaccharide-producing bacteria restricts sodium uptake and stimulates plant growth under salt stress. Biol. Fertil. Soils 40, 157–162.

B. Jasim, Aswathy, Agnes Joseph, C. Jimtha John, Jyothis Mathew and E. K. Radhakrishnan (2013), “Isolation and characterization of plant growth promoting endophytic bacteria from the rhizome of Zingiber officinale” Springer.

Barnawal D., Maji D., Bharti N., Chanotiya C. S., Kalra A. (2013). ACC deaminase- containing Bacillus subtilis reduces stress ethylene-induced damage and improves mycorrhizal colonization and rhizobial nodulation in Trigonella foenum-graecum under drought stress. J. Plant Growth Regul. 32, 809–822.

Bell, K. S., Kuyukina, M. S., Heidbrink, S., Philp, J. C., Aw, D. W. J., Ivshina, I. B., and Christofi, N. (1999). Identification and environmental detection of Rhodococcus species by 16S rDNA-targeted PCR. J. Appl. Microbiol. 87:472-480

Bell, K. S., Philp, J. C., Aw, D. W. J., and Christofi, N. (1998). The genus Rhodococcus. J. Appl. Microbiol. 85:195-210.

Berger, F., Hong, L., White, D., Frazer, R., and Leifert, C. (1996). Effect of pathogen inoculum, antagonist density, and plant species on biological control of Phytophthora and Pythium damping-off by Bacillus subtilis Cot1 in high-humidity fogging glasshouses. Phytopathology 86:428-433.

76 Bernhard Schink, James C. Ward, and J. GREGORY Zeikusl (1981), “Microbiology of Wetwood: Importance of Pectin Degradation and Clostridium Species in Living Trees” applied and environmental microbiology, september.

Bilen M, Founkou MDM, Cadoret F, Dubourg G, Daoud Z, Raoult D (2018). Sanguibacter massiliensis sp. nov., Actinomyces minihominis sp. nov., Clostridium minihomine sp. nov., Neobittarella massiliensis gen. nov. and Miniphocibacter massiliensis gen. nov., new bacterial species isolated by culturomics from human stool samples. New Microbes New Infect. 24:21–25. Published 2018 Mar 16.

Blasco, Rafael (2001). "Rhodococcus sp. RB1 grows in the presence of high nitrate and nitrite concentrations and assimilates nitrate in moderately saline environments". Archives of Microbiology. 175 (6): 435–440

Brannen, P. M., and Kenney, D. S. (1997). Kodiak: A successful biologicalcontrol product for suppression of soil-borne plant pathogens of cotton. J. Ind. Microbiol. Biotech. 19:169-171.

Brunetti G., Farrag K., Soler-Rovira P., Ferrara M., Nigro F., Senesi N. (2012). The effect of compost and Bacillus licheniformis on the phytoextraction of Cr, Cu, Pb and Zn by three brassicaceae species from contaminated soils in the Apulia region, Southern Italy. Geoderma 170, 322–330.

C. Alauzet, C. Teyssier, E. Jumas-Bilak, A. Gouby, R. Chiron, C. Rabaud (2010), et al, Gluconobacter as well as Asaia species, newly emerging opportunistic human pathogens among acetic acid bacteria J Clin Microbiol, 48, pp. 3935-3942

C.-M. Wang, C.-C. Lai, C.-K. Tan, Y.-C. Huang, K.-P. Chung, M.-R. Lee, et al. (2012), Clinical characteristics of infections caused by Roseomonas species and antimicrobial susceptibilities of the isolates Diagn Microbiol Infect Dis, 72, pp. 199-203

Chandrima Bhattacharyya, Utpal Bakshi, Ivy Mallick, Shayantan Mukherji, Biswajit Bera and Abhrajyoti Ghosh (2017), “Genome-Guided Insights into the Plant Growth Promotion Capabilities of the Physiologically Versatile Bacillus aryabhattaiStrain AB211” frontiers in microbiology.

Chang S-S, Kang D-H (2004). Alicyclobacillus spp. in the fruit juice industry: history, characteristics, and current isolation/detection procedures. Crit Rev Microbiol.;30:55–74.

Crow WT (2014). Effects of a Commercial Formulation of Bacillus firmus I-1582 on Golf Course Bermudagrass Infested with Belonolaimus longicaudatus. J Nematol. 46(4):331–335.

Czekaj T , Ciszewski M, Szewczyk EM (2015), “Staphylococcus haemolyticus - an emerging threat in the twilight of the antibiotics age”, Microbiology.

D'Costa, Brenda Shamim, Kashif Dubey, S. K (2013), Characterization of thermostable serine protease from Bacillus altitudinis strain BR1, JOURNAL OF SCIENTIFIC & INDUSTRIAL RESEARCH, volume- 72. Issue-3

77 Dursun A., Ekinci M., Donmez M. F. (2010). Effects of foliar application of plant growth promoting bacterium on chemical contents, yield and growth of tomato (Lycopersicon esculentum L.) and cucumber (Cucumis sativus L.). Pak. J. Bot. 42, 3349–3356.

Dwivedi, Pratistha & Tomar, Rajesh Singh. (2016). Growing of Staphylococcus aureus cells with soil components enhances virulence in mice caused by soft tissue infections. International Journal of Pharma and Bio Sciences. Spl Ed. 230-235.

Elbanna, Khaled & Elnaggar, Sameh & Bakeer, Abdelradi. (2014). Characterization of Bacillus altitudinis as a New Causative Agent of Bacterial Soft Rot. Journal of Phytopathology. 162. 10.1111/jph.12250

Elliot Nicholas Grady, Jacqueline MacDonald, Linda Liu, Alex Richman, and Ze-Chun Yuan (2016), “Current knowledge and perspectives of Paenibacillus: a revie, in Microbial Cell Factories.

Enos Bernasconi, Claudio Valsangiacomo, Raffaele Peduzzi, Antonio Carota, Tiziano Moccetti, and Guido Funke (2004), Arthrobacter woluwensis Subacute Infective Endocarditis: Case Report and Review of the Literature, Endocarditis Due to A. woluwensis • CID:38

F.A.O. Camargo; F.M. Bento; B.C. Okeke & W.T. Frankenberger (2003). "Hexavalent chromium reduction by an actinomycete, Arthrobacter crystallopoietes ES 32". Biological Trace Element Research. 97 (2): 183–194.

Finnerty, W. R. (1992). The biology and genetics of the genus Rhodococcus. Annu. Rev. Microbiol. 46:193-218.

Fitriatin, B.N., A. Yuniarti, T.Turmuktini and M. Saman. (2013). Effect of P solubilizing microbe producimg growth regulators to increase solubilizing of soil phosphate and yield of maize on marginal soil. Soil –Water Journal. Vol 2. Number 2 (1). pp. 547 – 554.

Funke G., Hutson R. A., Bernard K. A., Pfyffer G. E., Wauters G., Collins M. D. (1996) Isolation ofArthrobacter spp. from clinical specimens and description of Arthrobacter cumminsii sp. nov. and Arthrobacter woluwensis sp. nov. J. Clin. Microbiol. 34:2356–2363.

Gadhave K. R., Gange A. C. (2016). Plant-associated Bacillus spp. alter life-history traits of the specialist insect Brevicoryne brassicae L. Agric. For. Entomol. 18, 35–42.

Gerritsen J,Fuentes S,Grievink W,van Niftrik L,Tindall BJ,Timmerman HM,Rijkers GT,Smidt H (2014). Characterization of Romboutsia ilealis gen. nov., sp. nov., isolated from the gastro- intestinal tract of a rat, and proposal for the reclassification of five closely related members of the genus Clostridium into the genera Romboutsia gen. nov., Intestinibacter gen. nov., Terrisporobacter gen. nov. and Asaccharospora gen. nov. Int. J. Syst. Evol. Microbiol. 64, 1600-16

Goswami D., Dhandhukia P., Patel P., Thakker J. N. (2014). Screening of PGPR from saline desert of Kutch: growth promotion in Arachis hypogea by Bacillus licheniformis A2. Microbiol. Res. 169, 66–75. 10.1016/j.micres.

78 Guffanti, A. A.; blanco, R.; benenson, R. A.; krulwich, T. A. (1980). "Bioenergetic Properties of Alkaline-tolerant and Alkalophilic Strains of Bacillus firmus". Microbiology. 119 (1): 79– 86

Halverson, L. J., and Handelsman, J. (1991). Enhancement of soybean nodulation by Bacillus cereus UW85 in the field and in a growth chamber. Appl. Environ. Microbiol. 57:2767-2770.

Handelsman, J., Raffel, S., Mester, E., Wunderlich, L., and Grau, C. (1990). Biological control of damping-off of alfalfa seedlings with Bacillus cereus UW85. Appl. Environ. Microbiol. 56:713-718.

Hou X.-G., Kawamura Y., Sultana F., Shu S., Hirose K.,Goto K., Ezaki T. (1998) Description of Arthrobacter creatinolyticus sp. nov., isolated from human urine. Int. J. Syst. Bacteriol. 48:423–429.

Huang X-C, Yuan Y-H, Guo C-F, Gekas V, Yue T-L (2015). Alicyclobacillus in the fruit juice industry: spoilage, detection, and prevention/control. Food Rev Int.;31:91–124.

Hyun-Gyu Park, Yong-Seong Lee, Kil-Yong Kim, Yun-Serk Park, Ki-Hyung Park, Tae-Ho Han, Chong-Min Park, and Young Sang Ahn (2017), Inoculation with Bacillus licheniformis MH48 Promotes Nutrient Uptake in Seedlings of the Ornamental Plant Camellia japonica grown in Korean Reclaimed Coastal Lands, Hortic. Sci. Technol. 35(1):11-20.

I. Dé, K.V.I. Rolston, X.Y (2004). HanClinical significance of Roseomonas species isolated from catheter and blood samples: analysis of 36 cases in patients with cancer Clin Infect Dis, 38, pp. 1579-1584

Istifadaha, N., Ningtyasb, D., Suryatmana, P., & Fitriatin, B. (2017). The Abilities of Endophytic and Biofertilizing Bacteria and Their Combinations to Suppress Bacterial Wilt Disease (Ralstonia solanacearum) of Chili. KnE Life Sciences, 2(6), 296-304.

Iti Gontia, Kumari Kavita, Michael Schmid, Anton Hartmann and Bhavanath Jha (2011), Brachybacterium saurashtrense sp. nov., a halotolerant root-associated bacterium with plant growth-promoting potential, International Journal of Systematic and Evolutionary Microbiology, 61, 2799–2804

J.D. Rihs, D.J. Brenner, R.E. Weaver, A.G. Steigerwalt, D.G. Hollis, V.L. Yu (1993), Roseomonas, a new genus associated with bacteremia and other human infections J Clin Microbiol, 31 , pp. 3275-3283

Jacoline Gerritsen, Harro M. Timmerman, Susana Fuentes, L. Paul van Minnen, Henk Panneman, Sergey R. Konstantinov, Frans M. Rombouts, Hein G. Gooszen, Louis M. A. Akkermans, Hauke Smidt and Ger T. Rijkers (2011), Correlation between Protection against Sepsis by Probiotic Therapy and Sti mul ation of a Novel Bacterial Phylotype, applied and environmental microbiology, 77;21

Janssens TKS, de Boer TE, Agamennone V, Zaagman N, van Straalen NM, Roelofs D. (2017). Draft genome sequence of Bacillus toyonensis VU-DES13, isolated from Folsomia candida (Collembola: Entomobryidae). Genome Announc 5:e00287-17.

79 Jebeli, Mohammad Ahmadi; Maleki, Afshin; Amoozegar, Mohammad Ali; Kalantar, Enayatollah; Izanloo, Hassan; Gharibi, Fardin (2017). "Bacillus flexus strain As-12, a new arsenic transformer bacterium isolated from contaminated water resources". Chemosphere. 169: 636– 641. doi:10.1016/j.chemosphere.2016.11.129. ISSN 0045-6535. PMID 27912188.

Jensen, G. B., B. M. Hansen, J. Ellenberg, and J. Mahillon. (2003). The hidden lifestyles of Bacillus cereusand relatives. Environ. Microbiol. 5:631-640

Jiménez G, Urdiain M, Cifuentes A, López-López A, Blanch AR, Tamames J, Kämpfer P, Kolstø AB, Ramón D, Martínez JF, Codoñer FM, and Rosselló-Móra R (2013), “Description of Bacillus toyonensis sp. nov., a novel species of the Bacillus cereus group, and pairwise genome comparisons of the species of the group by means of ANI calculations” , Elsevier.

Jose Antonio lucus, Agustin Probanza, Beatriz romes, Maria, Francisco Javier (2004), “Effect of inoculation of Bacillus licheniformis on tomato and pepper”, INRA- EDP sciences.

Joseph W. Kloepper, Choong-Min Ryu, and Shouan Zhang (2004), “Induced Systemic Resistance and Promotion of Plant Growth by Bacillus spp”, The Nature and Application of Biocontrol Microbes: Bacillus spp.

K Westerberg; AM Elvang; E Stackebrandt; JK Jansson (2000). "Arthrobacter chlorophenolicus sp. nov., a new species capable of degrading high concentrations of 4- chlorophenol". International Journal of Systematic and Evolutionary Microbiology. 50 (6): 2083–2092.

Karolina Westerberg, Annelie M. Elvasng, Erko Stackebrandt and Janet K. Jansson (2000), “Arthrobacter chlorophenolicus sp. nov., a new species capable of degrading high concentrations of 4-chlorophenol”, International Journal of Systematic and Evolutionary Microbiology.

Kilian M., Steiner U., Krebs B., Junge H., Schmiedeknecht G., Hain R. (2000). FZB24® Bacillus subtilis – mode of action of a microbial agent enhancing plant vitality. Pflanzenschutz Nachr. Bayer.1, 72–93.

Kim DU1, Ka JO (2014), Roseomonas soli sp. nov., isolated from an agricultural soil cultivated with Chinese cabbage (Brassica campestris), Int J Syst Evol Microbiol. 64(3):1024-9

Kim, D.-S., Cook, R. J., and Weller, D. M. (1997). Bacillus sp. L324-92 for biological control of three root diseases of wheat grown with reduced tillage. Phytopathology 87:551-558

Kim, D.-S., Weller, D. M., and Cook, R. J. (1997). Population dynamics of Bacillus sp. L324- 92R12 and Pseudomonas fluorescens 2-79R10 in the rhizosphere of wheat. Phytopathology 87:559-564.

Kloos, W. E., D. N. Ballard, C. G. George, J. A. Webster, R. J. Hubner, W. Ludwig, K. H. Schleifer, F. Fiedler, and K. Schubert. (1998). Delimiting the genus Staphylococcus through description of Macrococcus caseolyticus gen. nov., comb. nov. and Macrococcus

80 equipercicus sp. nov., and Macrococcus bovicus sp. nov, and Macrococcus carouselicus sp. nov. Int. J. Syst. Bacteriol. 48:859-877

Kumar, Davender; Rajinder Parshadb; Vijay Kumar Gupta (2014). "Application of a statistically enhanced, novel, organic solvent stable lipase from Bacillus safensis DVL- 43" (PDF). International Journal of Biological Macromolecules. 66: 97–107.

Kumar, E. Vijay Srijana, M. Kumar, K. Kiran Harikrishna, N. Reddy, Gopal (2011), A novel serine alkaline protease from Bacillus altitudinis GVC11 and its application as a dehairing agent, Bioprocess And Biosystems Engineering, volume- 34. Issue-4

Kumar, V Anil; Augustine, Deepthi; Panikar, Dilip; Nandakumar, Aswathy; Dinesh, Kavitha R; Karim, Shamsul; Philip, Rosamma (2011), Brevibacterium casei as a cause of brain abscess in an immunocompetent patient., PubMed.

Lai Q, Liu Y, Shao Z (2014), Bacillus xiamenensis sp. nov., isolated from intestinal tract contents of a flathead mullet (Mugil cephalus), Antonie Van Leeuwenhoek. ;105(1):99-107. doi: 10.1007/s10482-013-0057-4. Epub 2013 Oct 25

Lanjekar, V.B., Marathe, N.P., Shouche, Y.S., and Ranade, D.R (2015). "Clostridium punense sp. nov. an obligate anaerobe isolated from healthy human faeces." Int. J. Syst. Evol. Microbiol. 65:4749-4756

Leighton PM, Little JA. (1986) Identification of coagulase-negative Staphylococci isolated from urinary tract infections. Am. J. Clin. Pathol. 85(1):92-95

Li J1, Yang G, Lu Q, Zhao Y, Zhou S (2014), Bacillus haikouensis sp. nov., a facultatively anaerobic halotolerant bacterium isolated from a paddy soil, Antonie Van Leeuwenhoek. Oct;106(4):789-94

Li W, Zhang W-W, Yang M-M, and Chen Y-L (2008), Mol. Biotechnol., 40, 195–201.

Liu Y,Du J,Lai Q,Zeng R,Ye D,Xu J,Shao Z (2017). Proposal of nine novel species of the Bacillus cereus group. Int. J. Syst. Evol. Microbiol. 67, 2499-2508

Logan, N.A., Lebbe, L., Verhelst, A., Goris, J., Forsyth, G., Rodriguez-Diaz, M., Heyndrickx, M., and De Vos, P. (2002) "Bacillus luciferensis sp. nov., from volcanic soil on Candlemas Island, South Sandwich archipelago." Int. J. Syst. Evol. Microbiol. 52:1985-1989

Loni Townsley, Lews Caro, Hemant Kelkar, Elizabeth A. Shank (2016) Genome Announcements, 4 (5) e01140-16;

Madhuri, A. Nagaraju, B. Harikrishna, N. Reddy, Gopal (2012), Production of Alkaline Protease by Bacillus altitudinis GVC11 using Castor Husk in Solid-State Fermentation, APPLIED Biochemistry And Biotechnology, volume- 167. Issue-5

Mengsha Li , Rui Guo, Fei Yu, Xu Chen, Haiyan Zhao, Huixin Li and Jun Wu (2018), “Indole- 3-Acetic Acid Biosynthesis Pathways in the Plant-Beneficial Bacterium Arthrobacter pascens ZZ21”, International journal of molecular science.

81 Miho Watanabe, Hisaya Kojima and Manabu Fukui (2014). “Proposal of Effusibacillus lacus gen. nov., sp. nov., and reclassification of Alicyclobacillus pohliae as Effusibacillus pohliae comb. nov. and Alicyclobacillus consociatus as Effusibacillus consociatus comb. Nov”. Systematic and evolutionary microbiology.

Mohamed A Ibrahim, Natalya Griko , Matthew Junker, and Lee A Bulla (2010), “Bacillus thuringiensis A genomics and proteomics perspective, Bioeng Bugs, February.

Muscatello, G.; Leadon, D. P.; Klay, M.; Ocampo-Sosa, A.; Lewis, D. A.; Fogarty, U.; Buckley, T.; Gilkerson, J. R.; Meijer, W. G.; et al. (2007). "Rhodococcus equi infection in foals: the science of 'rattles'". Equine Vet. J. 39 (5): 470–478.

N.K. Shokar, G.S. Shokar, J. Islam, A.R (2002). Cass Roseomonas gilardii infection: case report and review J Clin Microbiol, 40, pp. 4789-4791

N.V. Sipsas, J. Papaparaskevas, I. Stefanou, K. Kalatzis, P. Vlachoyiannopoulos, A.Avlamis (2006), Septic arthritis due to Roseomonas mucosa in a rheumatoid arthritis patient receiving infliximab therapy Diagn Microbiol Infect Dis, 55, pp. 343-345

Noha Ibrahim Osman1, 2 and Shixue Yin1, Isolation and characterization of pea plant (Pisum sativum L.) growth-promoting Rhizobacteria, African Journal of Microbiology Research, Vol. 12(34), pp. 820-828, 14 September, 2018

Noordman, W H; Reissbrodt, R; Bongers, R S; Rademaker, J L W; Bockelmann, W; Smit, G (2006), Growth stimulation of Brevibacterium sp. by siderophores., PubMed.

Ochiai, S. and Ishii, T. (2008). Identification Of Microorganisms Related To Ethylene Production From Lipids Of Dead Grape Leaf. Acta Hortic. 768, 293-299

Otto M (August 2010). "Staphylococcus epidermidis - the "accidental" pathogen". Nature Reviews Microbiology. 7 (8): 555–567.

Pan J, Huang Q, Zhang Y (2004). Gene cloning and expression of an alkaline serine protease with dehairing function from Bacillus pumilus. Current microbiology;49(3):165-9.

Panda, Amrita & Bisht, Satpal & De Mandal, Surajit & Senthil Kumar, N & Gurusubramanian, Guruswami & Kumar Panigrahi, Ashok. (2014). Brevibacillus as a biological tool: A short review. Antonie van Leeuwenhoek. 105. 10.1007/s10482-013-0099-7.

Payel Majumder and Debnath Palit (2017), Isolation, Identification and Characterization of Bacteria of Coal Mine Soil at Sonepur Bazari of Raniganj Coalfield, West Bengal, International Journal of Applied Environmental Sciences ISSN 0973-6077 Volume 12, Number 6, pp. 1131- 1140

Pinchuk, I. V., Bressollier, P., Sorokulova, I. B., Verneuil, B., and Urdaci, M. C. (2002). Amicoumacin antibiotic production and genetic diversity of Bacillus subtilis strains isolated from different habitats. Res. Microbiol. 153:269-276.

82 Pourbabaee A. A., Bahmani E., Alikhani H. A., Emami S. (2016). Promotion of wheat growth under salt stress by halotolerant bacteria containing ACC deaminase. J. Agric. Sci. Technol. 18, 855–864

Priyadarshini, Subhashree & Gopinath, Dr. V. & Meera Priyadharsshini, N & MubarakAli, Davoodbasha & Velusamy, Palaniyandi. (2012). Synthesis of anisotropic silver nanoparticles using novel strain, Bacillus flexus and its biomedical application. Colloids and surfaces. B, Biointerfaces. 102C. 232-237. 10.1016/j.colsurfb.2012.08.018.

Radhakrishnan R., Lee I. J. (2013). Regulation of salicylic acid, jasmonic acid and fatty acids in cucumber (Cucumis sativus L.) by spermidine promotes plant growth against salt stress. Acta Physiol. Plant. 35, 3315–3322.

Radhakrishnan R., Lee I. J. (2016). Gibberellins producing Bacillus methylotrophicus KE2 supports plant growth and enhances nutritional metabolites and food values of lettuce. Plant Physiol. Biochem. 109, 181–189.

Rahman, A., Nahar, N., Nawani, N. N., Jass, J., Desale, P., Kapadnis, B. P., Mandal, A. (2014). Isolation and characterization of aLysinibacillusstrain B1-CDA showing potential for bioremediation of arsenics from contaminated water. Journal of Environmental Science and Health, Part A, 49(12), 1349–1360.doi:10.1080/10934529.2014.928247

Ramalingam Radhakrishnan, Abeer Hashem and Elsayed F. Abd_Allah (2017), “Bacillus: A Biological Tool for Crop Improvement through Bio-Molecular Changes in Adverse Environments”, Front Physiol.

S Sathish, K Swaminathan (2009), “Genetic diversity among toxigenic clostridia isolated from soil, water, meat and associated polluted sites in south india” Indian Journal of Medical Microbiology.

Salyers, Abigail A. & Whitt, Dixie D. (2002). Bacterial Pathogenesis: A Molecular Approach, 2nd ed. Washington, D.C.: ASM Press. ISBN 978-1-55581-171-6.

Saman, S., Saman, S., and Slattery, P (2010). "Isolation of a potential new member of the Bacillus cereus group from snow covered soil." Life Sciences and Medicine Research, Vol.:LSMR-18

Sang-Mo Kang, Ramalingam Radhakrishnan, Young-Hyun You, Gil-Jae Joo, In-Jung Lee, Ko-Eun Lee, andJin-Ho Kim (2014), “Phosphate Solubilizing Bacillus megaterium mj1212 Regulates Endogenous Plant Carbohydrates and Amino Acids Contents to Promote Mustard Plant Growth”, Springer.

Sari, E., Etebarian, R., and Aminian H (2007). “The effects of Bacillus pumilus, isolated from wheat rhizosphere, on resistance in wheat seedling roots agains the Take-all fungus, Gaeumannomyces graminis var. tritici”. Journal of Phytopathology. Volume 155. p. 720-727.

83 Shin KS, M., Hong SB, Ph., , Son BR, M. (2006) . A Case of Catheter-Related Bacteremia by Arthrobacter woluwensis. Korean J Lab Med;26:103-106.

Singh, Ram S.; Rupinder P. Singh; Mukesh Yadav (2013). "Molecular and biochemical characterization of a new endoinulinase producing bacterial strain of Bacillus safensis AS- 08*". Biologia. 68 (6): 1028–1033.

Stabb, E. V., Jacobson, L. M., and Handelsman, J. (1994). Zwittermicin Aproducing strains of Bacillus cereus from diverse soils. Appl. Environ. Microbiol. 60:4404-4412

Sueharu Horinouchi (2010), Tsukasa Ikeda, in Comprehensive Natural Products II.

Sungwan Kanso, Anthony C. Greene and Bharat K. C. Patel (2002), “Bacillus subterraneus sp. nov., an iron- and manganese-reducing bacterium from a deep subsurface Australian thermal aquifer”, International Journal of Systematic and Evolutionary Microbiology.

Tai S-K, Lin H-P, Kuo J, and Liu J-K (2004), Extremophiles, 8, 345– 349.

Takarada H, Sekine M, Kosugi H, et al. (2008) Complete genome sequence of the soil actinomycete Kocuria rhizophila. J Bacteriol.;190(12):4139–4146. doi:10.1128/JB.01853-07

Thomas, P (2004). “Isolation of Bacillus pumilus from in vitro grapes as a long-term alcohol surviving and rhizogenesis inducing covert endophyte”. Journal of Applied Microbiology.. Volume 97. p. 114-123.

Trivedi, N., Gupta, V., Kumar, M., Kumari, P., Reddy, C. R. K., & Jha, B. (2011). Solvent tolerant marine bacterium Bacillus aquimaris secreting organic solvent stable alkaline cellulase. Chemosphere, 83(5), 706–712.

Tsubakishita S, Baba K K-A T, and Hiramatsu K (2010) Staphylococcal cassette chromosome mec-Like element in Macrococcus caseolyticus. Antimicrob. Agents Chemother. 54 (4) 1469- 1475

Vasudevan Dinakaran, Manoharan Shankar, Sathyanarayanan Jayashree, Andiappan Rathinavel, Paramasamy Gunasekaran, and Jeyaprakash Rajendhran (2012), “Genome Sequence of Staphylococcus arlettae Strain CVD059, Isolated from the Blood of a Cardiovascular Disease Patient”, journal of bacteriology.

Vincent and Denis (2008) “ Bacillus thuringiensis, applications in agriculture and insect resistance management . A review” Springer.

Vincenzo Savini, Chiara Catavitello, Azaira Bianco, Andrea Balbinot, Domenico D'Antonio (2009), “Epidemiology, Pathogenicity and Emerging Resistances in Staphylococcus pasteuri: From Mammals and Lampreys, to Man, Recent Patents on Anti-Infective Drug Discovery.

X.Y. Han, A.S. Pham, J.J. Tarrand, K.V. Rolston, L.O. Helsel, P.N. Levett (2003), Bacteriologic characterization of 36 strains of Roseomonas species and proposal of Roseomonas mucosa sp nov and Roseomonas gilardii subsp rosea subsp nov Am J Clin Pathol, 120, pp. 256-264

84 Xie S., Wu H. J., Zang H., Wu L., Zhu Q., Gao X. (2014). Plant growth promotion by spermidine-producing Bacillus subtilis OKB105. Mol. Plant Microbe Interact. 27, 655–663.

Xu M., Sheng J., Chen L., Men Y., Gan L., Guo S., et al. . (2014). Bacterial community compositions of tomato (Lycopersicum esculentum Mill.) seeds and plant growth promoting activity of ACC deaminase producing Bacillus subtilis (HYT-12-1) on tomato seedlings. World J. Microbiol. Biotechnol. 30:835–845

Yeon-Gyeong Park, Bong-Gyu Mun ,Sang-Mo Kang,Adil Hussain,Raheem Shahzad,Chang- Woo Seo, Ah-Yeong Kim and Byung-Wook Yun 2017 , “Bacillus aryabhattai SRB02 tolerates oxidative and nitrosative stress and promotes the growth of soybean by modulating the production of phytohormones”, plos- one.

Yoon JH, Kang SJ, Lee MH, Oh TK (2007). Description of Sulfitobacter donghicola sp. nov., isolated from seawater of the east sea in Korea, transfer of staleya guttiformis Labrenz et al. 2000 to the genus Sulfitobacter as Sulfitobacter guttiformis comb. nov. and emended description of the genus Sulfitobacter . International Journal of Systematic & Evolutionary Microbiolog ;57(8):1788–1792.

Yoon, J.-H., Kim, I.-G., Kang, K.H., Oh, T.-K., and Park, Y.-H (2003). "Bacillus marisflavi sp. nov. and Bacillus aquimaris sp. nov., isolated from seawater of a tidal flat of the Yellow Sea in Korea." Int. J. Syst. Evol. Microbiol. 53:1297-1303.

Zhao S, Ye L, Liu C, Abagana AY, Zheng W, Sun P, Li J, Xiang W and Wang X (2016), “Streptomyces gamaensis sp. nov., a novel actinomycete with antifungal activity isolated from soil in Gama, Chad”, pubmed.

Zhao, Jian; Lan, Xiaojun; Su, Jun; Sun, Lei; Rahman, Erkin (2008). "Isolation and identification of an alkaliphilic Bacillus flexus XJU-3 and analysis of its alkaline amylase". Wei Sheng Wu Xue Bao = Acta Microbiologica Sinica. 48 (6): 750– 756. ISSN 0001-6209. PMID 18720839.

Zhou Y, et al, (2018) international journal for systematic evolutionary microbiology, 2012.Characterization of the Genus Sinomonas, New and future developments in microbial biotechnology and bioengineering, pp 179-190.

First and Foremost, We thank the Almighty for being the unfailing source, support, comfort, strength and for His blessings throughout our project work.

We acknowledge our sincere indebtedness and profound sense of gratitude to Kerala State Biodiversity Board, Thiruvananthapuram for giving an opportunity to conduct this project and for the financial support during the project period.

Sincerely express our thanks to Dr. T M Joseph, Principal, Nirmala College, Muvattupuzha for giving permission to carry out this project work at the college and also for providing necessary facilities.

With great respect and love we convey our profound thanks to Dr. (Sr.) Tessy Joseph, Former Head, Department of Botany for the suggestions, moral support and providing necessary facilities.

We express our sincere gratitude to Mrs. Sindu Rachel Joy, Head, Department of Botany for providing facilities and the support.

We are thankful to all the teaching and non-teaching staff of Department of Botany for their valuable support and co-operation.

We acknowledge all the teaching and non-teaching staff of Nirmala College, Muvattupuzha for their co-operation.

It is our immense delight to express whole hearty thanks to all team members for their encouragement, love and support.

Fig.4 Subcultured microbial isolates of all soil samples (NB01-NB55) obtained from serial dilution and spread plating methods

93 Table 7 The colony characteristics of all isolates obtained from soil sample (NB01-NB55) of Udumbanchola Taluk of Idukki District by spread plate method

ion Number Isolates Colony characteristics (CFU/g)

Locat Sample

-4

S12 Pin Point Small, Round, Mucoid, Translucent, Entire 800X10 S13 Small Round, Raised, Moist, Opaque, Entire 800X10-4 NB01 S14 Pin Point Small, Round, Mucoid, Transparent, Entire 800X10-4 S1 Round, Small, Orange Yellow, Raised, Moist, Opaque 9X10-5 Round, Small, Pale Yellow, Raised, Convex, Moist S2 5X10-5 Translucent

S3 Irregular, Opaque, White, Flat, Dry, Large 4X10-5 S4 Round, White, Opaque, Moist, Moist, Convex, Medium 6X10-5

SAMPLE 1 SAMPLE S5 Small, Round, White, Convex, Raised, Opaque, 6X10-5

NB02 S6 Round, Small, Yellow, Raised, Moist, Opaque 7X10-5 S8 Small Round, White, Center Concave And Pointed 2X10-5 S9 Pin Point, Raised, Transparent, No Pigment, Entire 712X10-4 S10 Small, Irregular, Transparent, Flat, Moist 50X10-4 S11 Small Round, Entire, White, Flat, Dry 126X10-4 S19 Very Small, Round, Entire, Raise, White Dry, Opaque 1250X10-5

S20 Moderate, Irregular, Undulate, Moist, Spreaded, Translucent, 1250X10-5

Moderate, Round, Entire, Opaque, Mucoid, Raised, Milky -4

NB05 S21 3X10

White S22 Large, Irregular, Flat, Opaque, Dry, Undulate 3X10-4 S15 Round, Moderate, White, Opaque, Dry Flat Entire 200X10-4

SAMPLE 2 SAMPLE

Pin Point Small Round Raised Translucent Entire (Similar To S16 600X10-4 S12)

NB04 S17 Small Round Raised Moist Opaque Entire (Similar To S13) 600X10-4 S18 Round Moderate Translucent Pale Yellow Round Entire 2X10-5 S23 Large, Irregular, Undulate, Opaque, Dry, Flat 4X10-4 S24 Moderate, Round, Entire, Opaque, Dry, Flat 1X10-4 -4 S25 Small, Round, Entire, Opaque, Dry, Flat 4X10

S26 Large, Round, Entire, Opaque, Dry, Flat 2X10-4

NB06 Large, Round, Entire, Opaque, Dry, Flat, Light, Yellow- -4 SAMPLE 4 SAMPLE S27 1X10 Orange Pigment S28 Large, Round, Entire, Opaque, Moist, Flat 5X10-4 S29 Small, Round, Entire, Opaque, Moist Raised 1X10-4

94 Moderate, Round, Entire, Opaque, Moist, Flat, Brownish- S30 108X10-4 Gold Pigment S33 Large, Irregular, Undulate, Fat, Dry, Opaque 1X10-4 S34 Moderate, Round, Entire, Flat, Dry, Opaque, Light Yellow 2X10-4 Moderate, Round, Entire, Raised, Moist, Opaque (Clear Zone S35 1X10-4 Around Colony-Am) S37 Moderate, Round, Entire, Opaque, Moist, Raised 6X10-4 Large, Round, Entire, Raised, Moist, Opaque, Orange S38 3X10-6 Pigment S39 Moderate, Round, Raised, Dry, Opaque, Yellow, Entire 1X10-3 S46 Round, Large, Entire, Flat, Mucoid, Opaque 1X10-4 S47 Large, Raised, Entire, Flat, Center Moist, Side Dry, Opaque 3X10-5 S48 Large, Round, Entire, Flat, Dry, Opaque 3X10-5 Moderate, Irregular, Undulate, Flat, Dry, Opaque (Clear Zone S49 15X10-4 Around The Colony-AM) S50 Large, Round, Entire, Raised, Dry, Opaque 1X10-5 S40 Large, Irregular, Flat, Moist, Translucent 1X10-4 S41 Large, Irregular, Flat, Dry, Opaque, Undulate 7X10-4 S42 Large, Irregular, Undulate, Flat, Dry, Opaque 1X10-4 S43 Small, Round, Entire, Raised, Moist, Translucent 27X10-4 Round, Moderate, Entire, Flat, Dry, Brown (Extracellular S45 2X10-4 Pigment) Opaque S51 Large, Round, Entire, Flat, Dry, Opaque, Red Pigment 1X10-4 S52 Large, Round, Entire, Moist, Flat, Opaque 8X10-4 Moderate, Round ,Entire, Mucoid, Raised, Opaque, Light S53 4X10-4 Yellow Pigmented S54 Very, Small Round, Entire, Raised, Moist, Translucent 70X10-4 S55 Small, Raised, Entire, Mucoid, Translucent, Pale Yellow 1X10-5 -5

NB07 S56 Pin Pointed, Very Small, Round, Entire, Raised, Dry, Opaque 5X10 S57 Small, Round, Entire, Raised, Moist, Translucent 3X10-5 S58 Large, Irregular, Lobate, Flat, Dry, Opaque, Light Pink 1X10-5 S59 Large, Round, Entire, Flat, Moist, Opaque 2X10-5 S60 Small, Round, Entire, Flat, Moist, Opaque, Light Yellow 8X10-5 S61 Large, Round, Entire, Flat, Dry, Opaque 2X10-5 S63 Small, Round, Entire, Flat, Dry, Opaque 3X10-5 S64 Moderate, Round, Entire, Raised, Mucoid, Opaque, White 9X10-5 S65 Small, Round, Entire, Raised, Moist, Light Yellow, Opaque 2X10-5 S66 Moderate, Round, Entire, Flat, Moist, Opaque, Pale Yellow 3X10-5 S67 Large, Irregular, Lobate, Opaque, Moist, White 1X10-5

95 S68 Small, Round, Entire, Flat, Moist, Translucent, White 2X10-5 S69 Very Small, Round, Entire, Flat, Moist, Translucent, Flat 6X10-5 S70 Small, Round, Entire, Raised, Dry, Opaque 3X10-5 S71 Moderate, Round, Entire, Flat, Moist, Opaque 3X10-5 S72 Small, Round, Entire, Flat, Moist, Opaque 2X10-5 S73 Small, Round, Entire, Flat, Moist, Translucent 2X10-5 S74 Large, Round, Entire, Flat, Moist, Opaque 5X10-5 S75 Small, Round, Entire, Flat, Opaque, Dry 3X10-5 S76 Small, Round, Entire, Flat, Dry, Opaque 2X10-5 S77 Large, Round, Entire, Raised, Mucoid, Opaque, Yellow 18X10-4 S78 Small, Oval Shape, Flat, Dry, Opaque 9X10-6 Moderate, Round, Entire, Raised, Mucoid, Cream Colour S79 3X10-6 Opaque Moderate, Round, Entire, Flat, Opaque, Dry, Brown Pigment S80 1X10-5 ECP S82 Large, Irregular, Undulate, Flat, Dry, Opaque 1X10-5 S83 Moderate, Entire, Round, Flat, Dry, Opaque 1X10-6 S84 Moderate, Irregular, Dry, Flat, Opaque, Undulate 2X10-6 S85 Large, Raised, Entire, Mucoid, Opaque, Flat 20X10-4 S86 Small, Round, Entire, Raised, Moist, Opaque 1X10-4 S87 Moderate, Round, Entire, Raised, Mucoid, Translucent 4X10-4 S88 Moderate, Round, Entire, Raised, Mucoid ,Opaque 2X10-5 S89 Large, Raised, Entire, Raised, Mucoid, Opaque, Red-Brown 1X10-6 Small, Round, Entire, Raised, Dry, Opaque, Light Yellow S90 1X10-4 ECP S91 Moderate, Round, Entire, Flat, Moist, Opaque 2X10-4

-4 S92 Large, Irregular, Undulate, Flat, Moist, Opaque 1X10

NB08 S93 Very, Large, Irregular, Undulate, Flat, Dry, Opaque 1X10-4 S94 Small, Round, Entire, Raised, Moist, Translucent 4X10-5

SAMPLE 5 SAMPLE S95 Large, Round, Entire, Flat, Dry, Translucent 1X10-4 S97 Filamentous, Transparent, Moist 2X10-5 S98 Small, Round, Entire, Raised, Moist, Opaque, Yellow 1X10-5 S99 Moderate, Flat, Round, Entire, Moist, Opaque 5X10-5 S100 Large, Irregular, Lobate, Dry, Flat, Opaque 1X10-6 J01 Small, Round, Entire, Flat, Moist, Opaque (Clear Zone AM) 1X10-4 J02 Large, Irregular, Undulate, Flat, Dry, Opaque 5X10-4 -4

NB09 J03 Large, Irregular, Undulate, Flat, Dry, Opaque, Center Raised 2X10

96 J04 Large, Irregular, Undulate, Flat, Moist, Translucent 1X10-4 J05 Moderate, Round, Raised, Entire, Mucoid, Opaque 2X10-4 J06 Large, Round, Entire, Flat, Mucoid, Opaque 1X10-4 J07 Moderate, Round, Entire, Raised, Yellow, Opaque 3X10-5 J08 Large, Round, Entire, Raised, Mucoid, Opaque 1X10-5 J09 Small, Round, Entire, Raised, Dry, Opaque 2X10-5 J10 Small, Round, Entire, Flat, Moist, Opaque 5X10-4 J11 Moderate, Round, Entire, Mucoid, Raised ,Opaque 17X10-4 Small, Round, Entire, Raised, Mucoid, Opaque, Orange J12 4X10-4 Pigment J13 Moderate, Irregular, Undulate, Flat, Moist, Opaque 1X10-6 J14 Small, Round, Entire, Raised, Moist, Opaque, Red 1X10-6 J15 Large, Irregular, Undulate, Flat, Dry, Opaque 2X10-6 J16 Small, Round, Entire, Raised, Dry, Opaque 1X10-5 Small, Round, Entire, Flat, Dry, Opaque, Brown Pigment J17 9X10-4 ECP J18 Large, Irregular, Undulate, Raised, Moist, Opaque 4X10-4 J19 Large, Irregular, Undulate, Flat, Moist, Opaque 2X10-5 J20 Moderate, Round, Entire, Flat, Translucent, Dry 1X10-5 J21 Small, Round, Entire, Raised, Dry, Opaque 4X10-5 J42 Medium, Round, Irregular, Flat, Moist, Translucent 100X10-4 J43 Large, Round, Undulate, Flat, Moist, Opaque, Pale Yellow 2X10-6 Small, Round, Entire, Flat, Dry, Opaque, Mannitol J44 7X10-6 Fermenting Small, Round, Entire, Flat, Dry, Opaque, Mannitol Non J45 3X10-6 Fermenting J46 Moderate, Irregular, Undulate, Flat, Dry, Opaque 2X10-6 -6

J47 Moderate, Raised, Undulate, Flat, Moist, Opaque 1X10

J48 Medium, Round, Undulate, Flat, Moist, Opaque 1X10-6 NB11 J49 Medium, Round, Raised, Entire, Moist, Opaque 90X10-6 -6 SAMPLE 6 SAMPLE J50 Small Round Undulate Flat Dry Opaque 1X10 J51 Small, Round, Raised, Entire, Moist, Opaque 1X10-6 J52 Small, Round, Raised, Entire, Moist, Opaque 1X10-6 J53 Medium, Round, Raised, Entire, Moist, Opaque, Pale Yellow 1X10-6 J54 Large, Round, Undulate, Flat, Dry, Opaque 1X10-6 J55 Pinpoint, Round, Entire, Raised, Mount, Opaque 1X10-6 J22 Medium, Round, Entire, Flat, Dry, Opaque, Light Yellow 1X10-6 -6

NB10 J23 Small, Round, Entire, Raised, Moist, Yellow, Opaque 1X10

97 Very Small, Round, Entire, Raised, Moist, Pale Yellow J24 23X10-4 Opaque J25 Small, Round, Entire, Flat, Dry, Pale Yellow, Opaque 3X10-4 J27 Small, Round, Entire, Raised, Mucoid, Orange Pigment 1X10-4 J28 Small, Round, Entire, Flat, Dry, Opaque 1X10-6 J29 Medium, Round, Entire, Flat, Dry, Opaque 1X10-6 J30 Large, Irregular, Undulate, Flat, Dry, Opaque 1X10-5 J31 Medium, Round, Entire, Flat, Moist, Translucent 1X10-5 J32 Medium, Round, Entire, Flat, Moist, Opaque 1X10-5 J36 Pin Point, Round, Entire, Raised, Moist, Opaque, Orange 1X10-6 J37 Small, Round, Entire, Raised, Moist, Translucent 4X10-4 J38 Medium, Round, Entire, Raised, Dry, Opaque 1X10-4 J39 Medium, Round, Entire, Raised, White, Opaque, Dry 25X10-4 J40 Medium, Round, Entire, Flat, Dry, Opaque, White 5X10-4 J41 Large, Round, Entire, Flat, Dry, Opaque, Pale Yellow 3X10-4 J56 Moderate round entire flat opaque dry brown 1X10-3 J57 Large round entire flat moist opaque 2X10-3 J58 Large round entire moist raised opaque 1X10-3 J59 Moderate irregular raised moist opaque 1X10-3 J60 Moderate round entire raised dry opaque 2X10-3 J61 Small round entire raised dry opaque 7X10-3 J62 Large round entire flat moist translucent 1X10-3 J63 Large round entire flat dry opaque yellow 1X10-3 J64 Small round entire flat moist opaque 2X10-3

-3

J65 Small round entire flat dry opaque 1X10 J66 Small round entire flat moist opaque 1X10-3

NB12 -6 SAMPLE 7 SAMPLE J67 Very small round entire raised opaque red pigment 1X10 J68 small round entire raised dry opaque 7X10-3 J69 Large round entire flat opaque dry red pigment 1X10-3 J70 Large round entire flat opaque moist 15X10-3 J71 Small round entire raised dry opaque 2X10-4 J72 Moderate round entire dry opaque 2X10-4 J73 Very Large irregular undulate opaque flat white 5X10-3 J74 Very small entire round raised dry opaque 1X10-3 J75 Very Large undulate flat dry opaque white 1X10-3 J76 Round entire Large opaque flat moist white 1X10-3

98 J77 Round opaque flat dry white moderate 1X10-3 J78 Round opaque flat dry moderate light brown 2X10-3 J79 Opaque dry wrinkled Large white flat 1X10-3 J80 Small round entire raised moist opaque 14X10-3 J81 Large flat dry opaque irregular light brown 4X10-3 J82 Small round entire opaque raised dry 2X10-3 J83 Round entire opaque flat dry cream colour 1X10-3 J84 Small round entire raised dry brown ECP 2X10-3 J85 Small round entire raised dry white 6X10-3 J86 Moderate flat dry undulate translucent 1X10-3 J87 Opaque dry small entire white flat 1X10-3 J88 Moderate round entire moist raised opaque 1X10-3 J89 very Large round entire flat moist opaque 1X10-3 J91 Small round entire white opaque flat dry 10X10-3 J92 Small round entire red opaque flat dry 1X10-3 J93 Small round entire raised opaque white 14X10-3 J94 Moderate round opaque brown ECP dry raised 1X10-3 J95 Flat dry moderate opaque dry cream 1X10-3 -3

NB13 J96 Raised dry round entire opaque light yellow 4X10 J97 Small round entire opaque raised moist 1X10-3 J98 Small round entire opaque raised moist 3X10-3 J99 Very small round entire opaque raised dry 20X10-3 J100 Round moderate raised moist light brown pigment entire 10X10-3 B01 Large round entire flat dry cream colour 2X10-3 B02 Large round entire flat dry white colour 20X10-3 B03 Large round entire flat dry light yellow pigment 25X10-3 B04 Small round entire flat dry red pigment 1X10-3 B05 Small round entire flat dry 2X10-3 B06 Moderate undulate flat dry opaque 12X10-3 -3

NB14 B07 Moderate irregular flat dry opaque 1X10 B08 Translucent small round flat 1X10-4 B09 Small round entire dry opaque light brown pigment 1X10-4 B10 Small irregular translucent flat moist 2X10-4 B11 Moderate round translucent flat moist 1X10-4 B12 Small round entire opaque flat dry 2X10-4

-3

SA B9515 Very small round entire raised dry opaque 1X10

LE 8 LE

99 B96 Moderate round entire raised moist opaque 1X10-3 B97 Moderate round entire flat moist translucent 1X10-3 B98 Moderate round entire flat dry translucent 4X10-4 B99 Moderate round entire raised dry opaque 1X10-3 B100 Moderate round entire flat dry brown pigment 1X10-3 C1 Large irregular undulate moist flat opaque 4X10-4 C2 Large irregular undulate raised dry opaque brown ECP 1X10-3 C3 Large round entire raised moist opaque 5X10-4 C4 Moderate irregular undulate raised dry opaque 1X10-3 C5 Very Large round entire flat moist opaque 1X10-3 C6 Small round entire raised mucoid opaque 3X10-4 C7 Large round entire center raised moist 4X10-4 C8 Very Large round entire mucoid moist opaque 1X10-5 C9 Large round entire raised dry opaque 1X10-5 C10 Moderate round entire flat dry opaque 1X10-3 C11 Large round entire raised mucoid opaque 1X10-3 C12 Small round entire flat moist translucent 1X10-3 C13 Large round entire flat dry opaque 1X10-3 C14 Moderate round entire flat dry opaque 1X10-3 -3

C15 Large round entire flat dry opaque 1X10 C16 Small round entire raised moist opaque 1X10-4 NB16 C17 Large round entire raised moist opaque 1X10-4 C18 Large round entire raised moist opaque 1X10-4 C20 Large irregular undulate raised mucoid opaque yellow 1X10-4 C21 Large round entire flat dry opaque 2X10-3 C22 Large round entire flat dry opaque brown ECP 1X10-3 C23 Small round entire raised dry opaque brown ECP 4X10-3 C24 Small round entire raised dry opaque 1X10-3 C25 Moderate round entire dry opaque yellow pigment 1X10-3 C26 Very Large round entire mucoid opaque 5X10-4 C27 Very Large irregular undulate flat moist opaque 2X10-4 -4

C29 Small round entire raised mucoid opaque 1X10 C30 Small round raised moist opaque 5X10-4 NB17 C31 Large irregular undulate moist opaque 2X10-4 C32 Large round entire raised mucoid opaque 76X10-3 C33 Large round entire raised mucoid opaque 1X10-3

100 C34 Small round entire dry flat opaque 1X10-3 C35 moderate round entire flat moist opaque 58X10-3 C36 Moderate round entire flat moist opaque 10X10-3 C37 Large round entire raised mucoid opaque 1X10-3 C38 Small round entire raised dry opaque 1X10-3 C39 Small round entire raised mucoid opaque 1X10-3 C40 Very small round entire raise moist opaque red 1X10-3 C41 Small round entire flat dry opaque 1X10-3 C42 Moderate round entire flat moist opaque 6X10-3 C43 Very Large round entire raised mucoid translucent 1X10-3 C44 Moderate round entire flat moist opaque 1X10-3 C45 Small round entire flat moist opaque 1X10-3 B57 Very Large filamentous irregular lobate dry opaque white 1X10-3 B58 Moderate round entire raised dry opaque 1X10-3 B59 Small round entire raised moist 7X10-3 B60 Very Large irregular undulate dry flat opaque 1X10-3 B61 Moderate round entire raised moist opaque 1X10-3 B62 Large irregular lobate center raised flat opaque 1X10-3 B63 Very Large irregular entire flat moist opaque 1X10-3 B64 Large round entire flat moist translucent 1X10-3 B65 Very Large irregular lobate moist opaque 1X10-3 -3

B66 Very Large irregular lobate moist opaque 3X10 B67 Small round entre flat moist translucent 1X10-3

NB19 B68 Large round entire flat dry opaque 4X10-3 B69 Small round entire raised mucoid opaque 1X10-3

SAMPLE 9 SAMPLE B70 Small round entire raised dry opaque 4X10-3 B71 Moderate round entire mucoid opaque 1X10-3 B72 Moderate round entire mucoid translucent 1X10-3 B73 Vary Large round entire flat dry opaque 1X10-3 B74 Moderate round entire flat dry opaque 4X10-3 B75 Small round entire moist flat translucent 2X10-3 B76 Small round entire raised dry opaque brown ECP 2X10-3 B77 Large round entire flat dry opaque red colour at center 1X10-3 -3

B50 small round entire raised dry opaque 2X10 B51 Moderate round entire flat dry opaque 3X10-3 NB20 B52 Moderate round entire flat dry opaque 4X10-3

101 B53 Moderate round entire flat dry opaque wrinkled 1X10-3 B54 Moderate round entire flat dry light yellow wrinkled 2X10-5 B55 Small round entire raised moist mucoid opaque 2X10-3 B56 Moderate round entire raised moist opaque 6X10-3 B94 Small irregular flat dry opaque 1X10-3 B78 Small round entire raised moist translucent 3X10-3 B79 Small round entire moist translucent 7X10-3 B80 Moderate irregular undulate flat dry opaque 1X10-3 B81 Very small round entire flat dry translucent 9X10-4 B82 Large irregular lobate flat dry opaque 1X10-5 -5

B83 Small irregular undulate flat dry opaque 1X10 B84 Small round entire raised mucoid opaque 2X10-5 NB21 B85 Small round entire raised moist translucent 1X10-5 B86 Large irregular lobate flat opaque dry 1X10-3 B87 Small round entire raised moist opaque yellow 1X10-3 B88 Small round entire raised mucoid opaque 33X10-3 B89 Small round entire flat dry opaque 9X10-3 B90 Small round entire flat dry translucent 20X10-5 Small round entire translucent raised moist light brown B13 5X10-5 pigment B14 Large round entire flat dry opaque white 1X10-5 B15 Large round entire flat dry opaque white 9X10-5 B16 Small round entire raised dry white 1X10-5 B17 Moderate entire round translucent brown pigment flat moist 1X10-5 B18 Large round entire opaque cream flat dry 1X10-5 B19 Large round entire opaque cream flat dry 15X10-5

B20 Large round entire translucent flat dry light yellow 4X10-5 B21 Small round entire translucent flat moist 3X10-5

NB18 B22 Small round entire raised dry opaque 10X10-5 B23 Moderate round entire raised moist opaque 7X10-5 B24 Moderate round entire translucent raised moist 2X10-5 B25 Moderate round entire white opaque 28X10-3 B26 Small round entire opaque raised moist 7X10-3 B27 Small round entire raised moist opaque light rose pigment 8X10-3 B28 Small round opaque entire raised moist yellow pigment 26X10-3 B29 Small round entire opaque raised moist 15X10-3

102 B30 Small round entire translucent flat moist 1X10-3 B31 Small round entire white raised dry 6X10-3 B32 Small round entire flat dry opaque 6X10-3 B33 Small round entire flat dry opaque 10X10-3 B34 Small round entire flat dry light brown pigment 2X10-3 B35 Large round entire flat dry light yellow opaque 3X10-3 B36 Small Large round entire flat dry 4X10-3 B37 Large round entire flat moist opaque light yellow 2X10-3 B38 Large irregular flat dry opaque 13X10-3 B39 Small irregular flat dry opaque 2X10-3 B40 Small entre raised moist opaque white 3X10-3 B41 Very small round entre raised moist opaque 30X10-3 B42 Large round entire flat dry yellow pigment opaque 1X10-3 B43 Small round entire opaque flat dry 5X10-3 B44 Small round entire translucent flat dry 4X10-3 B45 Small round entire flat moist translucent 4X10-3 B46 Large undulate flat dry opaque 5X10-3 B47 Small round entire flat dry opaque 4X10-3 B48 Small round entire raised moist opaque 2X10-3 B49 Small round entire raised brown pigment 5X10-3 B91 Small round entire flat dry opaque cream colour 8X10-3 B92 Large round irregular flat dry opaque 3X10-3 C19 Small round entire raised mucoid opaque 1X10-6 C28 Moderate round entire raised mucoid opaque 7X10-4 C46 Very Large irregular undulate flat moist opaque 3X10-3 C47 Large round entire flat moist translucent 1X10-3 C48 Very small round entire opaque 10X10-3 -3 C49 Moderate round entire rise opaque 56X10 C50 small round entire flat moist opaque 1X10-3 -4

NB22 C51 Very Large round entire flat dry opaque 3X10 SAMPLE 10 SAMPLE C52 Very Large round entire flat dry opaque 2X10-4 C53 Large irregular undulate moist opaque 1X10-4 C54 Small round entire dry flat round opaque 1X10-4 C55 Small round entire dry flat raised opaque 2X10-4 C56 Large irregular undulate dry transparent 1X10-4 C57 Small round entire raised moist opaque light yellow 8X10-4

103 C58 Large round entire raised mucoid flat opaque 1X10-6 C59 Moderate round entire raised mucoid light peach 1X10-4 C60 Large round entire flat mucoid translucent 1X10-4 C61 Small round entire raised moist opaque 4X10-3 C62 Moderate round entire dry raised opaque 7X10-3 C63 Large round entire raised moist opaque 4X10-3 C64 Small round entire raised dry opaque yellow pigment 1X10-3 C65 Moderate irregular undulate raised mucoid translucent 1X10-4 C66 Small round entire raised moist opaque 2X10-4 C67 Large irregular undulate raised opaque 3X10-4 C68 Large round entre flat moist opaque 7X10-4 C69 Large round entire flat moist opaque 1X10-5 C70 Very sale entire raised dry opaque 1X10-5 C71 Small round entire flat moist opaque 1X10-5 C72 Large irregular undulate moist opaque 1X10-5 C73 Moderate round entire raised dry 3X10-5 C74 Large round entire raised moist opaque yellow pigment 11X10-5 C75 Moderate round entire raised dry opaque 1X10-5 C76 Large irregular undulate flat opaque 33X10-5 C77 Moderate round raised mucoid translucent 1X10-5 C78 Moderate round raised entire mucoid opaque 29X10-3 C79 Small round entire mucoid opaque 111X10-3 C80 Small round entire raised dry opaque 1X10-4 C81 Large entire raised flat moist opaque 16X10-5 C82 Very Large round entire flat dry opaque 1X10-4 C83 Very Large round flat moist opaque 1X10-4 C85 Very Large irregular undulate flat dry opaque 1X10-5 C86 Large round entire raised opaque 1X10-5 C87 Very Large round entire flat moist opaque 1X10-5 C88 Small round entire raised mucoid opaque 1X10-5 C89 Small round entire flat dry opaque 6X10-3 -3

NB23 C90 Large round entire flat dry opaque 1X10 C91 Very small round entire raised dry opaque 1X10-3 C92 Very Large irregular undulate flat dry opaque 1X10-3 C93 Moderate round entire raised mucoid opaque 2X10-3 C94 Small round entire flat moist opaque 15X10-3

104 C95 Small round entire flat dry opaque 3X10-3 C96 Moderate round entire dry flat opaque 4X10-3 C97 Large irregular undulate flat dry opaque 2X10-3 C98 Small round entire flat mucoid translucent 5X10-3 C99 Very Large entire raised mucoid opaque 1X10-3 C100 Moderate irregular undulate dry opaque 17X10-3 F1 Large round undulate moist translucent 2X10-3 F2 Large irregular undulate dry flat opaque 7X10-3 F3 Large round entire flat moist opaque 9X10-3 F4 Moderate round entire raised mucoid opaque 12X10-3 F5 Larger round entire flat dry opaque 5X10-3 F6 Moderate irregular translucent undulate flat dry 3X10-3 F7 Small round entire raised dry opaque yellow ECP 1X10-3 F8 Moderate round entire raised mucoid translucent 3X10-3 F9 Moderate round entire flat moist transparent 3X10-3 F10 Small round entire flat moist opaque 38X10-3 F11 Large round entire flat moist opaque 2X10-3 F12 Very Large round entire flat moist opaque 1X10-3 F13 Very Large round entire raised mucoid opaque red pigment 2X10-6 F14 Very Large irregular undulate flat dry translucent 1X10-4 F15 Very Large round entire flat moist opaque brown pigment 1X10-4 F16 Small round entire flat moist opaque 2X10-4 F17 Small round entire flat moist opaque 5X10-4 F18 Large round entire dry flat opaque 1X10-4 F19 Large round entire flat moist translucent 1X10-4 F20 Moderate round entire raised dry opaque yellow pigment 2X10-4 F21 Large irregular undulate flat dry opaque 1X10-4 F22 Small round entire raised mucoid opaque 19X10-3 F23 Small round entire flat dry translucent 3X10-3 F24 Small round entire raised mucoid opaque 2X10-3 F25 Moderate round entire raised mucoid opaque 1X10-3 F26 Small round entire fat mucoid translucent 2X10-3 F27 Small round entire flat dry opaque 1X10-3 F28 Small round entire raised mucoid opaque 2X10-3 F29 Large irregular undulate flat moist opaque 5X10-3 F30 moderate round entire flat dry opaque 1X10-3

105 F31 Small round entire flat mist opaque 9X10-3 F32 Small round entire raised mucoid opaque 12X10-4 F33 Moderate round entire flat moist translucent 2X10-4 F34 Large round entire raised dry opaque 1X10-4 F35 Small round entire raised moist opaque 2X10-4 Large round entire raised dry opaque red center white F36 2X10-4 periphery F37 Very Large irregular undulate flat moist opaque 2X10-4 F38 Large round entire flat moist translucent 1X10-4 F39 Small round entire raised mucoid opaque 11X10-4 F40 Large irregular undulate flat moist opaque 1X10-3 F41 Very Large irregular undulate flat dry opaque 1X10-3 F42 Large round entire flat moist opaque 1X10-3 F43 Large round entire raised moist opaque 2X10-3 F44 Large round entire raised mucoid opaque 1X10-3 F45 Large round entire flat dry opaque 1X10-3 F46 Large round entire raised mucoid opaque 1X10-3 F47 Large round entire raised mucoid translucent 4X10-3 F48 small round entire raised mucoid opaque 7X10-3 F49 Very Large irregular undulate flat moist translucent 1X10-3 F50 Large round entire flat dry opaque 1X10-3 F51 Very Large irregular undulate flat moist opaque 1X10-3 F52 Small round entire flat dry opaque 1X10-5 F53 Large irregular undulate flat moist translucent 1X10-5 F54 Very Large irregular undulate flat moist opaque 1X10-5 F55 Very Large round entire fat dry opaque 1X10-5 F56 Small round entire flat dry opaque 1X10-5 F57 Small round entire flat dry opaque 1X10-5 F58 Small round entire raised mucoid opaque 11X10-4 F59 Very Large irregular undulate flat moist opaque 3X10-5 F60 Very Large round entire flat moist opaque 1X10-5 F61 Large round entire flat moist translucent 2X10-5 F62 Very Large irregular undulate flat moist opaque 5X10-5 F63 Large irregular undulate flat dry opaque 4X10-5 F64 Very large round entire flat dry opaque 1X10-4 F65 Moderate round entire raised moist opaque 1X10-4

106 Very small round entire raised mucoid opaque yellow F66 3X10-4 pigment F67 Moderate round entire flat moist opaque 2X10-4 F68 Small round entire raised mucoid opaque 2X10-4 F69 Small round entire flat dry opaque brown pigment 1X10-4 F70 Moderate round entire flat dry opaque 1X10-4 F71 Large round entire flat moist opaque 1X10-4 F72 Very Large irregular undulate flat moist opaque 1X10-4 F73 Moderate round entire raised mucoid opaque 1X10-4 F74 Moderate irregular undulate flat dry opaque 1X10-4 F75 Moderate round entire flat dry opaque orange pigment 1X10-5 F76 Large irregular undulate flat mist opaque 1X10-5 F77 Small round entire flat dry opaque 2X10-5 F78 Large irregular lobate flat moist opaque 2X10-5 F79 Pin point round entire raised dry opaque 4X10-5 F80 Moderate round entire raised mucoid opaque 1X10-5 F81 Small round entire raised mucoid opaque 1X10-5 F82 Small round entire raised mucoid opaque 2X10-5 F83 Large round entire raised dry opaque 1X10-5 F84 Large irregular undulate flat moist translucent 1X10-5 F85 Moderate round entire raised mucoid opaque pink pigment 1X10-5 F86 Moderate round entire flat mist opaque yellow pigment 1X10-5 F88 Small round entire raised dry opaque yellow pigment 24 X10-3 -3

NB24 F89 Large irregular undulate flat dry opaque 20 X10 F91 Small round entire flat moist opaque 823 X10-5 F92 Small round entire raised moist opaque 3 X10-5 F93 Large round entire flat dry transparent 11 X10-5 F94 Small round entire flat dry transparent 2 X10-5 F95 Small round entire raised moist transparent 2 X10-5 F96 Large round entire flat dry translucent 2 X10-5 F97 Small round entire flat dry transparent 3 X10-5 F98 Small round entire flat dry transparent 6 X10-5 F99 Small round entire flat dry opaque 2 X10-4 F100 Large irregular undulate flat dry translucent 5 X10-4 G1 Small round entire flat moist yellow pigment 2 X10-6 G2 Very small round entire flat moist transparent 14 X10-4

107 G3 Small round entire flat dry opaque 4 X10-4 G4 Large irregular undulate flat dry opaque 28 X10-4 G5 Small irregular undulate flat dry translucent 3 X10-4 G6 Small round entire flat dry translucent light yellow pigment 3 X10-6 G7 Small round entire flat dry opaque red pigment 1 X10-4 G8 Large irregular undulate flat dry translucent yellow pigment 1 X10-4 G9 Large round entire flat dry opaque 4 X10-3 G10 Small round entire raised moist opaque 731 X10-3 G11 Moderate round entire flat dry opaque 8 X10-3 G12 Small round entire flat dry opaque yellow pigment 2 X10-3 G13 Small round entire raised dry opaque brown pigment 1 X10-3 G14 Moderate irregular undulate flat dry opaque 24 X10-5 G15 Moderate round entire flat dry translucent 25 X10-5 G16 Moderate round entire flat moist opaque 7 X10-4 G17 Small round entire raised dry opaque 4 X10-4 G18 Small round entire flat dry opaque red pigment 1 X10-4 G19 Very small round entire flat dry opaque 64 X10-4 G20 Small round entire raised moist opaque 5 X10-4 G21 Small round entire flat dry opaque center brown 4 X10-4 G22 Moderate round entire flat dry opaque 4 X10-4 G23 Small round entire flat dry opaque light yellow pigment 2 X10-4 G24 Small round entire raised dry opaque 12 X10-4 G25 Small round entire raised mucoid transparent 2 X10-4 G26 Moderate round entire flat dry opaque brown pigment 2 X10-4 G27 Small round entire flat dry opaque 8 X10-4 G28 Small round entire flat dry opaque brown pigment 28 X10-4 G29 Small round entire raised opaque 24 X10-4 G30 Small round entire raised moist red pigment 1 X10-4 G31 Small round entire raised opaque moist brown pigment 3 X10-4 G32 Small round entire raised dry opaque 637 X10-4 G33 Small round entire raised dry opaque yellow pigment 236 X10-4 G71 Small round entire raised moist opaque 271 X10-4 -4

G72 Small round entire raised dry opaque yellow pigment 234 X10 G73 Moderate round entire raised moist opaque 1 X10-4

NB27 -3

SAMPLE 11 SAMPLE G74 Small round entire flat dry opaque brown pigment 1 X10 G75 Small round entire flat dry opaque brown pigment 1 X10-3

108 G76 Small round entire raised moist opaque yellow pigment 1 X10-3 G77 Moderate irregular lobate flat moist opaque 23 X10-3 G78 Moderate irregular undulate flat dry opaque 5 X10-3 G79 Moderate irregular undulate flat moist translucent 1 X10-3 G80 Small round entire flat dry opaque brown pigment 1 X10-3 G81 Small round entire round dry opaque 1 X10-3 G82 Small round entire raised moist opaque 1 X10-3 G83 Small round entire flat dry opaque 1 X10-3 G84 Small irregular undulate flat dry transparent yellow pigment 1 X10-3 G85 Moderate irregular undulate raised moist opaque wrinkled 1 X10-4 G86 Moderate round irregular flat moist translucent 10 X10-5 G87 Large irregular lobate flat moist opaque 1 X10-5 G88 Small round entire raised moist opaque 1 X10-5 G89 Very small, round , entire , raised, dry , opaque red pigment 1 X10-5 G90 Very small round entire raised moist opaque 1 X10-5 G91 Moderate round entire flat dry opaque 1 X10-5 G92 Very small round entire raised moist opaque 1 X10-5 G93 Very small round entire flat dry translucent 206 X10-4 G94 Very Large irregular undulate flat moist opaque 2 X10-5 G95 Very Large irregular undulate flat moist opaque 9 X10-5 G96 Moderate round entire flat dry opaque 8 X10-5 G97 Small round entire raised moist opaque 44 X10-3 G98 Small round entire raised moist opaque yellow pigment 262 X10-3 G99 Moderate round entire opaque flat translucent 638 X10-3 G100 Moderate round entire flat dry opaque 18 X10-3 H1 Small round entire raised dry opaque inner white 1 X10-3 H2 Small round entire raised moist opaque yellow pigment 1 X10-3 H3 Very Large entire raised moist opaque 1 X10-3 H4 Moderate round entire raised moist opaque brown pigment 1 X10-3 H5 Small round entire flat dry brown pigment 1 X10-3 H6 Small undulate raised dry opaque 4 X10-3 H7 Moderate round entire flat dry opaque light yellow pigment 1 X10-3 H8 Moderate undulate flat dry opaque 5 X10-3 H9 Very small round entire flat moist opaque 15 X10-3 H10 Moderate round entire flat dry opaque 1 X10-3 H11 Small round entire raised dry opaque 1 X10-3

109 G34 Small round entire raised dry opaque 1 X10-4 G35 Moderate round entire flat moist opaque light yellow pigment 1 X10-4 G36 Moderate filamentous lobate flat moist transparent 2 X10-4 G37 Large irregular undulate flat moist opaque 1 X10-4 G38 Small round entire raised moist opaque yellow pigment 8 X10-4 G39 Small round entire raised moist translucent 1 X10-4 G40 Small round entire raised moist translucent 2 X10-4 G41 Large irregular lobate flat dry opaque 1 X10-5 G42 Moderate round entire raised moist opaque 1 X10-5 G43 Large irregular undulate flat dry opaque 4X10-5 G44 Moderate round entire flat dry opaque wrinkled 3 X10-4 G45 Small round entire raised dry opaque yellow pigment 4 X10-4 G46 Small round entire flat moist opaque 4 X10-4 G47 Small irregular undulate raised dry opaque 4 X10-4 G48 Small round entire raised dry opaque centre yellow pigment 43 X10-4 G49 Moderate irregular undulate flat moist opaque 34 X10-4 G50 Small irregular undulate flat moist translucent 1 X10-4

G51 Small irregular undulate flat dry opaque 902 X10-4 -4

NB25 G52 Very small round entire raised moist translucent 22 X10 G53 Small round entire raised moist opaque 1 X10-4 G54 Small round entire flat dry opaque 18 X10-4 G55 Moderate round entire raised moist opaque brown pigment 32 X10-5 G56 Moderate irregular flat moist translucent 25 X10-3 G57 Moderate round entire flat moist transparent 1 X10-3 G58 Small round entire raised moist opaque light brown pigment 42 X10-3 G59 Small round entire flat moist translucent 134 X10-3 1372 X10- G60 Very small round entire raised moist translucent 3 G61 Moderate irregular flat dry opaque wrinkled 5 X10-3 G62 Small irregular undulate flat dry opaque 1 X10-3 G63 Small round entire raised dry opaque mannitol fermenting 2 X10-3 G64 Moderate irregular undulate flat dry opaque 2 X10-3 G65 Small round entire raised dry opaque 3 X10-3 G66 Moderate irregular undulate flat dry opaque 1 X10-3 Moderate irregular undulate flat dry opaque light yellow G67 4 X10-3 pigment G68 Small round entire raised dry opaque red pigment 1 X10-3

110 G69 Moderate irregular undulate flat dry opaque 1 X10-3 G70 Small round entire flat moist opaque 1 X10-3 H13 Small round entire flat moist opaque 14 X10-4 H14 Large irregular flat dry opaque 8 X10-4 H15 Large irregular flat moist translucent yellow pigment 1 X10-4 H17 Large round entire flat dry transparent 18 X10-4 H18 Small round entire flat dry brown pigment 2 X10-4 H19 Small round entire raised moist opaque 23 X10-4 H20 Small round entire raised moist opaque 8 X10-4 H21 Moderate round undulate flat moist opaque 4 X10-4 H22 Moderate round undulate flat moist opaque 4 X10-4 H23 Moderate round entire flat dry opaque 8 X10-4 H24 Small round entire flat moist translucent 14 X10-4 H25 Small irregular undulate flat moist opaque 17 X10-4 H27 Moderate round entire flat moist opaque 12 X10-4 H28 Large irregular undulate flat moist opaque 13 X10-4 H29 Small round entire flat dry opaque light brown pigment 1 X10-5 H30 Large round entire flat dry translucent 1 X10-5

H31 Small round entire flat dry transparent 4 X10-5

NB26 H32 Small round entire raised moist opaque yellow pigment 4 X10-3 Moderate round entire flat moist opaque light brown H33 367 X10-3 pigment H34 Moderate round entire flat dry opaque 2 X10-4 H35 Small round entire flat dry opaque light brown pigment 1 X10-4 H36 Large round entire flat dry opaque 1 X10-4 H38 Small round entire flat moist transparent 1 X10-4 H39 Large irregular lobate flat dry opaque 4 X10-5 H40 Large irregular undulate flat dry opaque 2 X10-5 H41 Moderate round entire raised moist opaque yellow pigment 53 X10-5 H42 Small round entire flat dry opaque 8 X10-5 H43 Moderate round entire flat moist translucent 2 X10-5 H44 Small round entire raised dry opaque light brown pigment 5 X10-5 H45 Small round entire raised dry translucent 1 X10-5 H46 Large round entire flat moist opaque 2 X10-5 H47 Large round entire flat moist opaque 1 X10-5 H48 Large irregular undulate flat dry opaque 1 X10-5

111 H49 Small round entire flat moist opaque 4 X10-5 H50 Large irregular undulate flat dry opaque light pink pigment 1 X10-5 H51 Small round entire raised moist opaque 4 X10-5 H52 Small round entire flat dry opaque light yellow pigment 1 X10-5 H53 Small round entire flat dry translucent 4 X10-5 H54 Small irregular undulate flat dry opaque 2 X10-5 H55 Small round entire raised mucoid opaque 1 X10-5 H56 Very small round entire flat dry opaque red pigment 1 X10-4 H57 Large irregular undulate flat dry opaque 1 X10-4 H58 Small round entire flat dry opaque 1 X10-4 H59 Small round entire raised moist opaque yellow pigment 243 X10-5 H60 Large irregular undulate flat moist opaque 14 X10-5 H61 Small round entire raised moist opaque 12 X10-5 H62 Small round entire flat moist opaque 1 X10-5 H63 Small round entire flat moist opaque 8 X10-5 H64 Large irregular undulate flat dry opaque 5 X10-5 H65 Very Large irregular undulate flat moist opaque 2 X10-3 H66 Small irregular undulate raised dry opaque 8 X10-3 H67 Small irregular undulate raised dry opaque light red pigment 1 X10-3 K30 Small round entire flat opaque 1 X10-5 K31 Small round entire flat dry opaque 1 X10-3 K32 Small irregular undulate flat dry translucent 1 X10-3 K33 Small round entire raised moist opaque 1 X10-3 K34 Moderate round entire raised dry opaque 1 X10-3 K35 Small irregular undulate raised dry translucent 2 X10-3 K36 Moderate round entire flat dry opaque 1 X10-3

K37 Small round entire raised moist opaque 1 X10-3 K38 Very Large irregular lobate flat moist opaque 1 X10-3

NB29

SAMPLE 12 SAMPLE K39 Small round entire raised mucoid opaque 2 X10-5 Small round entire raised mucoid opaque light brown K40 1 X10-4 pigment K41 Large irregular lobate flat dry opaque 1 X10-4 K42 Small round entire raised moist opaque 1 X10-4 K43 Small round entire raised dry opaque light brown pigment 2 X10-4 K44 Small round entire raised dry opaque light yellow pigment 1 X10-4 K45 Small round entire mucoid opaque light yellow pigment 1 X10-5

112 K46 Small round entire dry opaque brown pigment 4 X10-5 K47 Small round entire raised dry opaque yellow pigment 2 X10-5 K48 Moderate irregular undulate flat dry opaque 1 X10-4 K49 Small round entire raised moist opaque 4 X10-3 K50 Small round entire raised dry opaque brown ECP 1 X10-3 K51 Small round entire flat dry translucent 1 X10-3 K52 Large round entire flat dry opaque 1 X10-3 K53 Small round entire flat moist translucent 5 X10-3 K54 Small round entire raised moist opaque 1 X10-3 H68 Medium irregular undulate raised dry opaque yellow pigment 1 X10-4 H69 Medium irregular undulate raised dry opaque light yellow 1 X10-4 H70 Medium round entire raised dry opaque light yellow 1 X10-4 H71 Medium round entire flat dry transparent 1 X10-4 H72 Small round entire raised dry opaque orange pigment 1 X10-4 H73 Small round entire flat dry opaque 3 X10-3 H74 Small round entire flat dry opaque 4 X10-3 H75 Small round entire flat dry opaque 3 X10-3 H76 Small round entire flat dry opaque 2 X10-3 H77 Small round entire flat dry opaque 2 X10-3 H78 Small round entire flat dry opaque light yellow pigment 2 X10-3 H79 Small round entire flat dry opaque red pigment 2 X10-3

H80 Small round entire raised mucoid translucent K1 Moderate round entire round moist opaque 1 X10-3

NB28 K2 Small round entire flat dry opaque 2 X10-3 K3 Small round entire flat dry translucent 4 X10-3 Moderate round entire raised dry opaque light orange K4 2 X10-3 pigment K5 Small round entire raised dry opaque 3 X10-5 K6 Small round entire raised dry opaque brown pigment center 1 X10-3 K7 Moderate round entire flat dry opaque 1 X10-3 K8 Small round entire flat dry opaque 2 X10-3 K9 Large irregular undulate flat moist opaque 1 X10-3 K10 Small round entire raise moist opaque light yellow pigment 8 X10-3 K11 Small round entire raise dry opaque 2 X10-3 K12 Small round entire raised moist opaque 4 X10-3 K13 Small round entire raises moist opaque 1 X10-3

113 K14 Small round entire raised dry opaque 2 X10-3 K15 Small round entire raised dry transparent 1 X10-3 K16 Large irregular undulate flat dry opaque 1 X10-3 K17 Small irregular undulate flat dry opaque 2 X10-5 K18 Small round entire raised dry opaque brown ECP 2 X10-3 K19 Small round entire raised dry opaque white pigment 1 X10-3 Large irregular undulate flat dry opaque wrinkled light K20 1 X10-3 yellow pigment K21 Small round entire raised moist opaque 1 X10-3 K23 Small irregular undulate raise dry opaque 2 X10-3 K24 Small round entire flat mist translucent 2 X10-3 K25 Large irregular undulate flat mist opaque 1 X10-3 K26 Small round entire raised dry opaque 1 X10-3 K27 Large round entire raised moist opaque 1 X10-3 K28 Small round entire flat dry opaque 1 X10-3 K29 Small round entire raised dry opaque yellow pigment 2 X10-5 K55 Small round entire raised mucoid opaque yellow pigment 1 X10-5 K56 Pin point, round entire flat dry opaque 2 X10-5 K57 Moderate round entire flat mist opaque 1 X10-5 Small irregular undulate flat dry translucent light yellow K58 13 X10-3 pigment K59 Small round entire flat dry transparent 8 X10-3 K60 Small round entire raised dry opaque yellow pigment 16 X10-3 K61 Small round entire raised dry opaque 2 X10-3 K62 Small round entire raised dry opaque 2 X10-4 -4

K63 Small round entire flat dry opaque 1 X10 K64 Large irregular lobate flat dry opaque 1 X10-4

NB30 -4

SAMPLE 13 SAMPLE K65 Small round entire moist opaque yellow pigment 2 X10 K66 Small round entire raised dry translucent 1 X10-3 Moderate round entire raised mucoid opaque light orange K67 123 X10-3 pigment K68 Small round entire raised dry translucent 1 X10-3 K69 Small round entire raised dry opaque brown ECP 3 X10-4 K70 Small round entire raised dry opaque 89 X10-4 K71 Small round entire raised dry opaque 2 X10-3 K72 Small round entire raised mucoid opaque 23 X10-3 K73 Small round entire moist raised opaque 4 X10-3

114 K74 Small round entire raised dry opaque brown ECP 2 X10-3 K80 Small round entire round mucoid translucent 1 X10-4 K75 Small entire round raised moist translucent 4 X10-3 K76 Small round entire raised moist opaque pale yellow pigment 2 X10-3 K77 Moderate irregular undulate flat dry opaque wrinkled 1 X10-3 K78 Small round entire raised dry opaque 1 X10-4 K79 Small round entire raised moist opaque 14 X10-4 K81 Moderate irregular undulate flat moist opaque 8 X10-5 K82 Small round entire flat dry opaque red pigment 1 X10-5 K83 Small round entire raised dry opaque wrinkled 1 X10-5 -5

NB31 K84 Small round entire raised mucoid transparent 2 X10 K85 Small round entire flat dry opaque 62 X10-5 K86 Moderate irregular lobate flat dry opaque 1 X10-4 K87 Small round entire flat dry opaque brown pigment 1 X10-4 K88 Small round entire raised dry opaque yellow pigment 2 X10-3 K89 Small round entire raised dry opaque 7 X10-5 K90 Small round entire raised moist opaque 4 X10-3 K91 Moderate round entire flat dry opaque 1 X10-3 M57 Moderate irregular undulate flat moist opaque 5 X10-4 M58 Very Large irregular undulate flat moist opaque 4 X10-4 M59 Moderate irregular undulate flat dry opaque 3 X10-4 M60 Very Large irregular undulate flat dry opaque 3 X10-4 M61 Very large irregular undulate fat moist opaque 2 X10-4 M62 Small irregular undulate raised dry opaque 1 X10-4 M63 Moderate round entire flat moist opaque 1 X10-3 M64 Very Large irregular undulate dry flat opaque 1 X10-3 M65 Moderate round entire raised dry opaque 2 X10-3 -3

NB32 M66 Very Large irregular undulate flat dry opaque 1 X10 M67 Very Large irregular undulate flat dry opaque 1 X10-3 M68 Moderate irregular undulate flat dry opaque 1 X10-3 M69 Very Large irregular undulate flat moist opaque 1 X10-3 M70 Large irregular undulate flat dry opaque 1 X10-3 M71 Small round entire raised mucoid opaque orange pigment 1 X10-3 M72 Very Large irregular undulate flat moist opaque 1 X10-3 M73 Small round entire raised moist opaque yellow pigment 1 X10-3 M74 Moderate round entire flat dry opaque 1 X10-4

115 M75 Very Large irregular undulate flat moist opaque 6 X10-4 M76 Moderate irregular undulate raised dry opaque 2 X10-4 Moderate round undulate raised moist opaque center orange M77 5 X10-4 pigment M78 Very Large irregular undulate flat dry opaque 2 X10-4 M79 Small round entire raised moist opaque 1 X10-4 M80 Very Large irregular undulate flat moist opaque 3 X10-4 M81 Very Large irregular undulate dry raised opaque 4 X10-3 M82 Very Large irregular undulate flat moist translucent 5 X10-3 M83 Moderate round entire flat moist translucent 2 X10-3 M84 Very small round entire raised dry opaque 2 X10-3 M85 Moderate round entire raised moist opaque 2 X10-3 M86 Small round entire flat dry opaque 1 X10-3 M87 Moderate round entire raised moist opaque orange pigment 1 X10-3 M88 Moderate irregular undulate flat moist translucent 5 X10-3 M89 Very Large irregular undulate flat dry opaque 2 X10-3 M90 Very Large irregular undulate flat moist opaque 4 X10-3 M91 Moderate irregular undulate flat moist opaque 5 X10-3 M92 Moderate round entire raised moist opaque 4 X10-3 M93 very Large round entire flat moist opaque 4 X10-3 M94 Moderate irregular lobate raised dry opaque 1 X10-5 M95 Small irregular undulate raised most opaque 1 X10-5 M96 Large irregular undulate flat dry opaque 1 X10-5 M97 Small irregular undulate flat moist opaque 1 X10-5 M98 Large irregular undulate flat moist opaque yellow pigment 1 X10-5 M99 Moderate irregular undulate flat moist opaque 1 X10-5 M100 Very Large irregular undulate flat dray opaque 1 X10-5 N1 Large round entire flat dry translucent 1 X10-5 N2 Very Large irregular undulate flat dry opaque 1 X10-5 N3 Moderate round entire flat moist opaque 1 X10-5 N4 Very Large irregular lobate flat dry opaque 1 X10-5 N5 Moderate irregular undulate flat dry opaque 1 X10-5 N6 Small round entire flat dry opaque 1 X10-5 N7 Moderate round entire flat dry opaque 1 X10-5 N8 Small round entire flat dry opaque 1 X10-5 N9 Very Large irregular lobate flat dry opaque 1 X10-5

116 N10 Moderate irregular undulate raised dry opaque 1 X10-5 N11 Moderate entire round flat dry opaque black pigment 10 X10-5 N12 Small round entire flat dry opaque 3X10-3 N13 Small round entire raised moist transparent 5X10-3 N14 Moderate round entire raised mucoid transparent 1 X10-5 N15 Small round entire raised mucoid translucent 13 X10-5 N16 Moderate round entire flat dry opaque 1 X10-5 N17 Moderate round entire flat dry opaque 1 X10-5 N18 Moderate round entire flat dry opaque 21 X10-5 N19 Very Large irregular undulate flat dry opaque 1 X10-5 N20 Moderate round entire flat dry translucent 1 X10-5 N21 Moderate round entire flat dry opaque 5 X10-5 N22 Very Large irregular undulate flat dry opaque 5 X10-5 N23 very mall round entire raised dry opaque 8 X10-5 N24 Very Large irregular undulate flat dry opaque 8 X10-3 N25 Large irregular undulate flat moist opaque black pigment 1X10-3 N26 Small round entire flat dry opaque mannitol fermenting 24X10-3 Small round entire flat dry opaque orange pigment mannitol N27 28X10-3 fermenting N28 Small Round Entire raised moist opaque 120X10-3 -3

N29 Small round entire raised dry opaque 75X10 N30 Small round entire raised moist translucent 15X10-3 NB33 N31 Small round entire raised moist translucent 17X10-3 N32 Very Large irregular undulate flat dry opaque 1X10-3 Very Large round entire flat moist opaque light orange N33 2X10-4 pigment N34 Small round entire raised dry opaque 2X10-4

SAMPLE 14 SAMPLE N35 Large irregular undulate raised dry opaque 1X10-3 N36 Small Round Entire round raised moist opaque 22X10-3 N51 Moderate round entire raised moist opaque yellow pigment 2 X10-3 N52 Small round entire flat dry opaque 2 X10-3 N53 Large irregular undulate flat dry opaque 2 X10-3 N54 Very Large irregular lobate flat dry opaque 1 X10-3 -3

NB35 N55 Moderate round entire flat dry opaque 2 X10 N56 Small round entire flat moist opaque 13 X10-3 N57 Moderate round entire flat moist opaque 1 X10-3 N58 Small round entire raised dry translucent 14 X10-3

117 N59 Moderate irregular undulate round dry opaque 2 X10-3 N60 Small round entire raised dry opaque 13 X10-3 N61 Moderate round entire flat dry opaque 4 X10-3 N62 Small round entire raised dry opaque 2 X10-3 N63 Moderate round entire raised dry opaque 2 X10-3 N64 Small round entire raised moist translucent 44 X10-3 N65 Small round entire flat dry opaque 5 X10-3 N66 Small round entire raised moist opaque 4 X10-3 N67 Small round entire raised moist opaque 2 X10-3 N68 Small round entire flat dry opaque 1 X10-3 N69 small round entire raised mucoid transparent 2 X10-5 N70 Small round entire flat dry opaque 4 X10-3 N71 Small round entire flat dry opaque 1 X10-3 N72 Moderate round entire flat moist opaque 1 X10-3 Small round entire flat moist translucent pale yellow N73 3 X10-5 pigmentation N74 Small round entire raised mucoid opaque red pigment 5 X10-3 N75 Large irregular lobate flat moist translucent 44 X10-4 N76 Moderate irregular flat moist undulate opaque 1 X10-3 N77 Small round entire raised moist opaque 43 X10-3 N78 Pin point, round entire raised dry opaque 8 X10-5 N79 Small round entire flat dry opaque 12 X10-5 N80 Small round entire flat dry opaque 12 X10-3 N81 Moderate irregular undulate flat dry opaque 1 X10-4 N82 Small irregular undulate round moist opaque 5 X10-4 N83 Moderate irregular undulate flat dry opaque 3 X10-5 H81 Small round entire raised dry opaque orange pigment 9X10-5 N37 Moderate irregular undulate flat moist opaque 1 X10-5 N38 Moderate irregular lobate flat dry opaque 1 X10-4 N39 Small irregular undulate raised dry opaque yellow pigment 7 X10-5 N40 Small round entire flat dry opaque 2 X10-5 -4

NB34 N41 Small round entire raised dry opaque 1 X10 N42 Small round entire raised dry opaque 10 X10-4 N43 Small round entire raised dry opaque 1 X10-4 N44 Small round entire raised moist opaque 1 X10-4 N45 Small round entire raised dry opaque yellow pigment 18 X10-4

118 N46 Moderate round entire flat dry opaque 1 X10-4 N47 Small round entire raised dry opaque 1 X10-4 N48 Moderate round entire flat dry opaque 1 X10-4 N49 Moderate irregular undulate raised dry opaque 1 X10-4 N50 Small round entire raised moist translucent 9 X10-5 N84 Small round entire raised dry opaque yellow pigment 2 X10-3 N85 Small round entire flat dry opaque 1 X10-3 N86 Small round entire raised wrinkled opaque 2 X10-3 N87 Large irregular undulate flat dry translucent 3 X10-3 N88 Moderate irregular undulate flat dry opaque 3 X10-3 N89 Very Large irregular undulate flat dry opaque 2 X10-3 N90 Small round entire raised dry opaque yellow pigment 1 X10-3 N91 Very Large round entire raised dry opaque 1 X10-3 N92 Small round entire raised dry opaque brown ECP 3 X10-4 N93 Small round entire flat dry translucent 1 X10-4 N94 Moderate round entire flat dry opaque wrinkled 1 X10-4 N95 Small round entire raised moist opaque 2 X10-4 N96 Small round entire raised dry opaque 1 X10-4 N97 Small round entire raised dry opaque 2 X10-4 -4

N98 Small round entire raised dry opaque yellow pigment 1 X10 N99 Small round entire raised dry opaque 55 X10-5

NB36 -5

SAMPLE 15 SAMPLE N100 Small round entire raised dry opaque 2 X10 P1 Moderate irregular undulate flat dry opaque wrinkled 2 X10-5 P2 Small round entire flat moist transparent 1 X10-5 P3 Very Large irregular lobate flat dry opaque 1 X10-5 P4 Small round entire raised dry opaque yellow pigment 2 X10-5 P5 Small round entire raised moist opaque 1 X10-4 P6 Small round entire raised moist opaque 1 X10-4 P7 Moderate irregular undulate flat dry opaque 1 X10-4 P8 Moderate irregular undulate flat dry opaque 1 X10-4 P9 Small round entire raised dry opaque 1 X10-4 P10 Small round entire raised moist opaque 1 X10-5 P11 Small round entire flat moist opaque 4 X10-3 P12 Small irregular undulate flat most opaque 8 X10-3 P13 Small round entire raised moist translucent 2 X10-3 P14 Small round entire flat dry opaque 1 X10-3

119 P15 Small round entire flat dry opaque 2 X10-3 P16 Small round raised flat dry opaque 4 X10-3 P17 Moderate irregular undulate flat dry translucent 1 X10-3 P18 Moderate round entire flat dry opaque 1 X10-3 P19 Small round entire flat dry opaque 4 X10-3 P20 Small round entire raised moist opaque 2 X10-3 P21 Small round entire raised moist opaque light yellow pigment 1 X10-3 P22 Small round entire flat dry opaque 1 X10-3 P23 Small round entire flat dry opaque 1 X10-3 P24 Small round entire raised moist opaque 2 X10-3 P25 Small round entire flat dry opaque 1 X10-3 P26 Pin point round entire raised moist transparent 2 X10-3 P27 Small irregular undulate flat dry translucent 1 X10-3 P28 Small raised entire round dry opaque Orange pigment 1 X10-5 P30 Small round entire flat moist translucent pale yellow pigment 1 X10-5 P31 Moderate irregular undulate raised dry opaque 39 X10-5 P32 Small round entire raised moist opaque 28 X10-5 P33 Small round entire raised moist opaque 2 X10-5 P34 Small round entire raised dry opaque yellow pigment 9 X10-5 K92 Small, Moderate entire flat Dry opaque 1X10-3 K93 Very Large irregular undulate flat dry opaque 8X10-3 K94 Moderate irregular undulate flat moist translucent 1X10-3 K95 Large round entire flat dry opaque 1X10-3 K96 Large irregular undulate flat moist translucent 1X10-3 K97 Moderate irregular undulate flat moist opaque 4X10-3 K98 Very Large irregular undulate flat dry opaque 2X10-3 -3

K99 Very small round entire raised dry opaque 5X10 K100 Small round entire flat dry opaque 3X10-3 NB37 M1 Small round entire flat dry opaque 2X10-3 M2 Moderate round entire raised dry translucent 95X10-3 M3 Very Large irregular undulate dry translucent 3X10-3 M4 Very small round entire raised dry opaque 11X10-3 M5 Small round undulate raise moist opaque 9X10-3 M6 Moderate round entire raised moist opaque 3X10-4 M7 Small round entire raised dry opaque 3X10-4 M8 Large round entire raised mucoid opaque 1X10-4

120 M9 Very Large irregular undulate raised mucoid transparent 1X10-4 M10 Moderate irregular undulate raised dry opaque 1X10-4 M11 Moderate round entire raised dry opaque 1X10-4 M12 Small round entire raised mucoid opaque 3X10-4 M13 Moderate irregular undulate raised dry opaque 1X10-4 M14 Moderate round entire raised mucoid opaque 1X10-4 M15 Moderate round entire flat moist opaque yellow pigmentation 1X10-5 M16 Small round entire flat dry opaque 6X10-5 Moderate irregular undulate raised dry opaque orange M17 54X10-5 pigmentation M18 Very Large regular entire flat moist opaque 3X10-5 M19 Large irregular undulate flat moist opaque 1X10-5 Very Large regular entire flat moist opaque peach M20 18X10-5 pigmentation Very Large round entire flat dry opaque brown pigment M21 1X10-5 center M22 Moderate round entire raised dry opaque 18X10-5 M23 Very Large irregular undulate flat moist opaque 1X10-5 Small round entire raised mucoid opaque orange M24 1X10-5 pigmentation M25 Moderate round entire raised mucoid opaque yellow pigment 4X10-5 M26 Small round entre raised mucoid opaque 3X10-5 M27 Large round entire raised moist opaque 3X10-5 M28 Small round entire raised dry opaque 18X10-5 Small round entire raised mucoid opaque light yellow M29 24X10-5 pigment Moderate round entire raised mucoid opaque light yellow M30 2X10-5 pigment M31 Small round entire raised mucoid translucent 1X10-5 Very Large entire round flat moist opaque light yellow M32 1X10-5 pigment M33 Small round entire raised dry opaque red pigment 1X10-3 M34 Small round entire raised mucoid opaque 5X10-3 M35 Small round entire raised dry opaque orange pigment 7X10-3 M36 Small round entire raised dry opaque 1X10-3 M37 Large round entire flat dry opaque 3X10-3 M38 Small round entire flat dry opaque 3X10-3 M39 Very large irregular undulate flat moist opaque 4X10-3 M40 Very Large irregular undulate flat moist opaque 4X10-3 M41 Moderate round entire raised dry opaque 5X10-3

121 M42 Small round entire raised mucoid opaque 1X10-3 M43 Small round entire raised mucoid opaque 7X10-3 M44 Moderate round entire flat moist translucent 7X10-4 M45 Very Large entire round fat dry opaque 7X10-4 M46 Very Large irregular undulate flat dry opaque 7X10-4 M47 Moderate round entire flat dry opaque yellow pigment 7X10-4 M48 Small round entire raised mucoid opaque yellow pigment 7X10-4 M49 Moderate round entire flat dry opaque 7X10-4 M50 Large round entire raised mucoid opaque 7X10-4 M51 Small round entire flat dry opaque brown ECP 7X10-4 M52 Large irregular undulate flat moist opaque 7X10-4 M53 Small round entire flat moist opaque red pigment 7X10-4 M54 Small irregular undulate dry raised opaque 7X10-5 M55 Small round entire raised moist translucent orange pigment 10 X10-5 M56 Small round entire raised moist opaque 1 X10-5 P36 Small Round Entire Flat Dry Opaque 3 X10-4 P37 Medium Round Entire Raised Moist Opaque 2 X10-4 P38 Small Round Entire Flat Dry Transparent 1 X10-4 P39 Medium Round Entire Flat Dry Opaque 3 X10-4 P40 Small Round Entire Raised Moist Opaque 6 X10-4 P41 Medium Round Entire Flat Dry Opaque 2 X10-4 P42 Small Round Entire Flat Dry Opaque powdery 5 X10-4 P43 Small Round Entire Flat Dry Transparent 1 X10-4 P44 Small Round Entire Flat Dry Opaque 4 X10-4

P45 Small Round Entire Raised Mucoid Transparent 1 X10-4 P46 Medium Round Entire Flat Dry Translucent 2 X10-4

NB38

SAMPLE 16 SAMPLE P47 Small Round Entire Flat Dry Opaque 4 X10-4 P48 Medium Irregular Undulate Flat Moist Opaque 2 X10-4 P49 Small Irregular Undulate Flat Opaque Dry 1 X10-4 P50 Large Irregular Undulate Flat Dry Opaque 1 X10-4 P51 Medium Irregular Lobate Flat Dry Opaque 3 X10-4 P52 Small Round Entire Flat Dry Opaque 5 X10-4 P53 Very Small Round Entire Flat Dry Opaque 7 X10-4 Medium Irregular Lobate Flat Dry Opaque pale yellow P54 1 X10-4 Pigment P55 Small Round Entire Flat Dry Transparent 1 X10-4

122 P56 Large Irregular Undulate Flat Dry Opaque 59 X10-3 P57 Large Irregular Undulate Flat Moist Opaque 498 X10-3 P58 Small Round Entire Flat Dry Opaque 6 X10-3 P59 Small Round Entire Flat Dry Opaque pale yellow Pigment 5 X10-3 P60 Small Round Entire Flat Dry Transparent 71X10-3 P61 Small Irregular Lobate Flat Dry Transparent 22 X10-3 P62 Medium Irregular Undulate Flat Dry Opaque 1 X10-4 P63 Medium Round Entire Raised Moist Opaque 3 X10-4 P64 Small Irregular Undulate Flat Dry Opaque 1 X10-4 Medium Irregular Lobate Raised Moist Opaque light pink P65 3 X10-3 Pigment P66 Large Irregular Undulate Flat Dry Opaque 2 X10-4 P67 Small Round Entire Raised Moist Opaque 1 X10-4 Medium Round Entire Flat Moist Transparent yellow P68 1 X10-4 Pigment P69 Large Irregular Lobate Flat Moist Transparent 171 X10-3 P70 Small Round Entire Flat Dry Opaque 2 X10-3 P71 Medium Round Entire Flat Dry Opaque 4 X10-4 P72 Medium Round Entire Flat Dry Translucent 3 X10-4 P73 Small Round Entire Raised Moist Opaque 3 X10-4 P74 Small Round Entire Flat Dry Opaque 1 X10-4 P75 Rhizoid growth Lobate Irregular Large Flat Dry Opaque 1 X10-3 P76 Medium Round Entire Flat Dry Opaque 2 X10-3 P77 Medium Round Entire Flat Moist Opaque 5 X10-3 P78 Small Round Entire Flat Dry Opaque 3 X10-3 P79 Medium Round Entire Raised Moist Opaque 1 X10-3 -3

NB39 P80 Rhizoid growth Lobate Irregular Large Flat Dry Opaque 2 X10 P81 Small Round Entire Flat Moist Transparent 3 X10-3 P82 Large Irregular Undulate Flat Dry Opaque 162 X10-3 P83 Medium Irregular Undulate Flat Dry Translucent 2 X10-3 P84 Small Round Entire Flat Dry Opaque 4 X10-3 P85 Small Round Entire Raised Moist Opaque 4 X10-3 P86 Large Irregular Undulate Flat Dry Translucent 2 X10-3 P90 Medium Round Entire Flat Moist Opaque 1 X10-3 P91 Small Round Entire Flat Dry Opaque 3 X10-4 P92 Large Irregular Lobate Flat Dry Opaque 15 X10-4 P93 Medium Round Entire Raised Moist Opaque 18 X10-4

123 P94 Large Round Entire Flat Dry Opaque wrinkled 2 X10-4 P87 Small Round Entire Flat Dry Opaque 2 X10-3 P88 Very Small Round Entire Flat Dry Opaque 14 X10-3 P95 Medium Round Entire Flat Dry Opaque 2 X10-3 P96 Medium Round Entire Flat Dry Opaque 1 X10-3 P97 Medium Round Entire Flat Dry Transparent 1 X10-3 P98 Small Round Entire Flat Dry Opaque wrinkled 3 X10-3 P99 Medium Irregular Undulate Flat Dry Opaque 5 X10-5 Small Round Entire Raised Opaque wrinkled pale yellow P100 1 X10-3 Pigment Q1 Small Round Entire Flat Dry Opaque 1 X10-3 Q2 Large Irregular Lobate Flat Dry Opaque light pink Pigment 1 X10-3 Q3 Small Irregular Lobate Flat Dry Transparent 1 X10-5 Q4 Small Round Entire Flat Dry Transparent 1 X10-5 Q5 Small Round Entire Raised Moist Opaque 2 X10-5 Q6 Large Irregular Lobate Flat Dry Opaque 2 X10-3 Q7 Large Irregular Lobate Flat Dry Translucent 1 X10-3 -3

NB40 Q8 Medium Round Entire Raised Moist Opaque 1 X10 Q9 Small Round Entire Raised Dry Opaque yellow Pigment 2 X10-3 Q10 Large Round Entire Flat Dry Opaque 1 X10-3 SAMPLE 17 SAMPLE Q11 Small Round Entire Raised Dry Opaque 1 X10-3 Q12 Medium Round Entire Raised Dry Opaque 1 X10-3 Q13 Medium Round Entire Flat Moist Translucent 1 X10-3 Q14 Small Irregular Lobate Flat Dry Opaque 1 X10-5 Q15 Large Irregular Lobate Dry Flat Opaque 5 X10-5 Q16 Small Round Entire Flat Moist Opaque 2 X10-5 Q17 Small Round Entire Flat Dry Opaque 1 X10-4 Q18 Large Irregular Flat Dry Opaque 1 X10-4 Q19 Rhizoid growth Large Irregular Lobate Flat Dry Opaque 1 X10-4 Q20 Large Irregular Lobate Raised Dry Opaque wrinkled 2 X10-4 Small Round Entire Raised Mucoid Opaque light orange Q21 51 X10-4 Pigment Q22 Small Round Entire Raised Mucoid Opaque 52 X10-4 Q23 Small Round Entire Raised Dry Opaque 1 X10-4 Q24 Small Irregular Large Raised Moist Opaque 1 X10-5 -4

NB41 Q25 Small Round Entire Raised Dry Opaque 2 X10 Q26 Small Round Entire Raised Moist Opaque 2 X10-4

124 Small Round Entire Raised Moist Opaque light orange Q27 1 X10-4 Pigment Q28 Small Round Entire Flat Dry Opaque 2 X10-4 Very Small Round Entire Raised Moist Transparent yellow Q29 124 X10-4 Pigment Q30 Small Round Entire Raised Moist Translucent 145 X10-4 Q31 Small Round Entire Raised Moist Opaque yellow Pigment 128 X10-4 Q32 Small Round Entire Raised Mucoid Opaque 131 X10-4 Q33 Small Round Entire Dry Flat Opaque 54 X10-4 Q34 Small Round Entire Flat Dry Opaque 45 X10-4 Q35 Large Irregular Lobate Flat Dry Opaque 1 X10-5 Q36 Small Round Entire Flat Dry Opaque 1 X10-5 Q37 Large Round Entire Flat Dry Opaque 1 X10-3 Q38 Large Irregular Lobate Flat Dry Opaque 2 X10-3 Q39 Small Round Entire Raised Moist Translucent 28 X10-3 2145 X10- Q40 Small Round Entire Flat Dry Opaque 3 Q41 Small Round Entire Raised Moist Opaque yellow Pigment 5 X10-4 Q42 Small Round Entire Raised Moist Opaque yellow Pigment 95 X10-4 Q43 Large Irregular Lobate Raised Dry Opaque 3 X10-4 Q44 Large Round Entire Flat Dry Opaque 1 X10-3 Q45 Small Round Entire Flat Dry Transparent 4 X10-3 Q46 Very Small Round Entire Raised Moist Opaque 5 X10-3 Q47 Large Round Entire Flat Dry Opaque 2 X10-3 Q48 Small Round Entire Raised Dry Opaque 1 X10-3 -3

Q49 Medium Irregular Undulate Flat Dry Transparent 3 X10 Q50 Medium Irregular Lobate Flat Dry Transparent 1 X10-3

NB42 -3

SAMPLE 18 SAMPLE Q51 Small Round Entire Raised Dry Opaque 1 X10 Q52 Small Round Entire Flat Dry Opaque 1 X10-3 1325 X10- Q53 Small Round Entire Raised Medium Opaque 3 Q54 Small Irregular Undulate Flat Dry Opaque 1 X10-3 Q55 Small Round Entire Raised Dry Opaque orange Pigment 1 X10-3 Q56 Medium Round Entire Raised Moist Opaque 3 X10-3 Q57 Medium Round Entire Raised Moist Opaque 1 X10-5 Q58 Medium Round Entire Flat Moist Opaque 8 X10-5 Q59 Large Irregular Lobate Flat Moist Opaque 1 X10-5 Q60 Small Irregular Undulate Flat Dry Opaque 1 X10-5

125 Q61 Small Round Entire Flat Dry Opaque 1 X10-5 Q62 Small Round Entire Raised Moist Opaque red Pigment 1 X10-5 Q63 Medium Round Entire Flat Moist Opaque 1 X10-3 Q64 Medium Round Entire Raised Moist Opaque 1 X10-3 Q65 Small Round Entire Raised Moist Opaque 23 X10-3 Q66 Medium Round Entire Flat Dry Opaque wrinkled 1 X10-4 Q67 Medium Round Entire Flat Dry Opaque 1 X10-4 Q68 Small Irregular Undulate Flat Dry Opaque 4 X10-3 -3

NB43 Q69 Small Round Entire Raised Moist Opaque 8 X10 Q70 Small Round Entire Flat Moist Opaque 7 X10-4 Q71 Medium Irregular Undulate Flat Moist Opaque 215 X10-3 Q72 Small Round Entire Raised Moist Opaque 204 X10-3 Q73 Medium Irregular Undulate Flat Moist Opaque 1 X10-4 Q74 Very Small Round Entire Raised Moist Opaque 1 X10-4 Q75 Medium Round Entire Flat Moist Transparent 3 X10-3 Small Round Entire Raised Moist Opaque light orange Q76 3 X10-3 Pigment Q77 Large Irregular Undulate Flat Dry Opaque 2 X10-3 Q78 Small Round Entire Flat Dry Opaque 3 X10-3 Q79 Small Round Entire Flat Moist Transparent 4 X10-3 Q80 Large Round Entire Raised Mucoid Opaque 2 X10-3 Q81 Small Round Entire Round moist Opaque Orange pigment 2 X10-4 Q82 Small round entire flat moist translucent 1 X10-4 Q83 Small round entire raised moist opaque 1 X10-4

Q84 Small round entire flat dry opaque 4 X10-4 Q85 Small round entire flat moist transparent 2 X10-4

NB44 -4 SAMPLE 19 SAMPLE Q86 Small irregular undulate flat dry transparent 1 X10 Q87 Small round entire raised dry opaque 3 X10-4 Q88 Small round entire flat dry opaque 15 X10-4 Q89 Small round entire raised moist opaque 4 X10-3 Q90 Small irregular undulate flat dry opaque 2 X10-3 Q91 Small irregular undulate flat dry opaque 3 X10-3 Q92 Small round entire flat dry translucent 2 X10-3 Q93 Small round entire raised moist opaque 1 X10-3 Q95 Small irregular undulate flat dry opaque 114 X10-4 Q96 Small irregular undulate flat dry transparent 21 X10-4

126 Q97 Small round entire flat dry opaque 8 X10-4 Q100 Small round entire raised moist translucent 2 X10-3 R1 Small round entire flat dry opaque 6 X10-3 R2 Small round entire raised dry opaque 10 X10-3 R3 Small round entire raised dry opaque 2 X10-3 R4 Small round entire raised moist opaque 13 X10-4 R5 Small round entire raised moist opaque yellow pigment 1 X10-3 R6 Small round entire raised dry opaque 1 X10-3 R7 Very small round entire raised moist opaque 2 X10-3 R8 Small round entire flat moist opaque 4 X10-3 R9 Moderate round entire raised mucoid translucent 134 X10-3 R10 Very small round entire raised moist opaque 12 X10-3 R11 Very small round entire dry raised opaque 12 X10-3 R12 Small round entire raised mucoid transparent 1 X10-3 R12 Small, Round, Entire, Raised, Mucoid, Transparent 1 X10-3 R13 Small, Round, Entire, Raised, Dry, Opaque 5 X10-4 R14 Small, Round, Entire, Raised, Moist, Transparent 6 X10-4 R15 Small, Round, Entire, Flat, Dry, Opaque 1 X10-4 R16 Small, Round, Entire, Raised, Moist, Opaque 1 X10-4 R17 Small, Irregular, Undulate, Flat, Dry, Transparent 4 X10-3 R18 Small, Round, Entire, Raised, Moist, Transparent 16 X10-3 Small, Round, Entire, Raised, Moist, Opaque, Orange R19 4 X10-3 pigment R20 Small, Round, Entire, Raised, Mucoid, Opaque 3 X10-3 R21 Small, Round, Entire, Flat, Dry, Opaque 16 X10-5

R22 Small, Round, Entire, Raised, Mucoid, Opaque 6 X10-4

NB45 R23 Small, Irregular, Undulate, Flat, Dry, Opaque 4 X10-4 R24 Small, Round, Entire, Flat, Moist, Translucent 12 X10-4 R25 Small, Round, Entire, Raised, Mucoid, Translucent 22 X10-5 R26 Moderate, Irregular, Undulate, Flat, Moist, Transparent 2 X10-4 R27 Small, Round, Entire, Flat, Dry, Opaque 1 X10-4 R28 Large, Irregular, Lobate, Flat , Dry, Opaque 1 X10-4 R29 Very small, Round, Entire, Flat, Dry, Opaque 8 X10-4 R30 Small, Round, Entire, Flat, Dry, Opaque 1 X10-4 R31 Small, Round, Entire, Raised, Moist, Translucent 1 X10-4 R32 Small, Round, Entire, Raised, Moist, Opaque 8 X10-4

127 R33 Large, Irregular, Lobate, Flat, Dry, Opaque 1 X10-4 Moderate, Round, Entire, Raised, Moist, Opaque, Orange R34 1 X10-4 pigment R35 Moderate, Irregular, Undulate, Flat, Moist, Transparent 1 X10-4 R36 Moderate, Irregular, Undulate, Flat, Moist, Transparent 1 X10-4 R37 Moderate, Irregular, Undulate, Flat, Moist, Transparent 1 X10-4 R38 Moderate, Irregular, Undulate, Flat, Dry, Transparent 1 X10-4 Moderate, Irregular, Undulate, Flat, Dry, Opaque, Yellow R39 1 X10-4 pigment R40 Moderate, Round, Entire, Raised, Moist, Opaque 1 X10-4 R41 Small, Round, Entire, Flat, Moist, Opaque 1 X10-4 R45 Moderate, Irregular, Undulate, Flat, Dry, Opaque 1 X10-5 R46 Large, Irregular, Lobate, Flat, Dry, Opaque 3 X10-3 R47 Small, Round, Entire, Raised, Moist, Opaque 22 X10-5 Moderate, Round, Entire, Flat, Moist, Opaque, Yellow R48 3 X10-3 pigment Moderate, Round, Entire, Flat, Moist, Translucent, Yellow R49 2 X10-3 pigment R50 Small, Round, Entire, Raised, Dry, Opaque 2 X10-3 R51 Large, Irregular, Lobate, Flat, Dry, Transparent 4 X10-3 Moderate, Irregular, Undulate, Flat, Dry, Opaque, Orange R52 1 X10-3 pigment R54 Moderate, Irregular, Undulate, Flat, Dry, Transparent 12 X10-3 R55 Large, Irregular, Undulate, Flat, Dry, Transparent 18 X10-3 R56 Large, Round, Entire, Flat, Moist, Opaque 1 X10-5 R57 Small, Round, Entire, Raised, Dry, Opaque, Yellow pigment 1 X10-5 R58 Moderate, Round, Entire, Flat, Moist, Opaque 1 X10-5 R59 Moderate, Round, Entire, Flat, Dry, Opaque 3 X10-5 R60 Small, Round, Entire, Raised, Dry, Opaque, Brown ECP 1 X10-5 R61 Moderate, Irregular, Undulate, Raised, Dry, Opaque 200 X10-4 R62 Large, Round, Entire, Flat, Dry, Opaque 15 X10-4 R63 Moderate, Round, Entire, Flat, Dry, Opaque 1 X10-4

NB46 R64 Small, Round, Entire, Flat, Moist, Opaque 2 X10-3 Small, Irregular, Undulate, Flat, Moist, Opaque, Brown R65 2 X10-3 pigment R66 Large, Irregular, Lobate, Flat, Dry, Opaque 300 X10-4 R67 Small, Round, Entire, Raised, Dry, Opaque 300 X10-4 R68 Very small, Round, Entire, Raised, Moist, Transparent 120 X10-3 R69 Small, Round, Entire, Flat, Dry, Opaque, Brown pigment 2 X10-3

128 R70 Small, Round, Entire, Flat, Dry, Opaque 2 X10-4 R71 Small, Irregular, Undulate, Raised, Moist, Opaque 300 X10-4 R72 Small, Round, Entire, Raised, Mucoid, Opaque 100 X10-4 R73 Small, Round, Entire, Raised, Dry, Opaque, Orange pigment 1 X10-4 R74 Small, Round, Entire, Flat, Dry, Opaque, Yellow pigment 1 X10-5 R75 Large, Round, Entire, Flat, Dry, Opaque 1 X10-5 Very small, Round, Entire, Flat, Dry, Opaque, Pale yellow R76 1 X10-5 pigment Very small, Round, Entire, Raised, Dry, Opaque, Orange R77 12 X10-4 pigment R78 Small, Round, Entire, Raised, Dry, Opaque, Red pigment 2 X10-4 R79 Rhizoid growth 4 X10-4 R80 Large, Round, Entire, Flat, Moist, Opaque, Orange pigment 1 X10-5 Moderate, Round, Entire, Raised, Mucoid, Opaque, Yellow R81 1 X10-5 pigment R82 Very Large, Irregular, Lobate, Flat, Dry, Opaque 2 X10-4 R83 Small, Round, Entire, Raised, Dry, Opaque, Yellow pigment 5 X10-4 R84 Small, Round, Entire, Raised, Dry, Opaque 2 X10-5 R85 Large, Irregular, Lobate, Flat, Moist, Translucent 3 X10-5 R86 Moderate, Irregular, Undulate, Flat, Dry, Opaque 80 X10-5 R87 Moderate, Round, Entire, Flat, Dry, Opaque 1 X10-3 R88 Large, Irregular, Undulate, Flat, Dry, Opaque 8 X10-3 R89 Small, Round, Entire, Raised, Moist, Translucent 50 X10-4 R90 Small, Round, Entire, Raised, Moist, Opaque 10 X10-4 -5 R91 Small, Irregular, Undulate, Flat, Dry, Opaque 80 X10

R92 Small, Round, Entire, Flat, Dry, Opaque 500 X10-3 -3

NB47 R93 Small, Round, Entire, Raised, Moist, Translucent 20 X10 SAMPLE 20 SAMPLE R94 Small, Round, Entire, Raised, Moist, Opaque 20 X10-3 R95 Small, Round, Entire, Flat, Dry, Translucent 500 X10-3 Small, Round, Entire, Raised, Moist, Opaque, Pale yellow R96 1 X10-3 pigment R97 Moderate, Round, Entire, Flat, Dry, Opaque 1 X10-3 R98 Moderate, Round, Entire, Flat, Dry, Opaque 1 X10-5 R99 Moderate, Irregular, Undulate, Flat, Dry, Opaque 1 X10-5 R100 Moderate, Irregular, Lobate, Flat, Dry, Translucent 1 X10-3 Small, Round, Entire, Raised, Moist, Opaque, Orange T1 2 X10-3 pigment T2 Small, Round, Entire, Raised, Moist, Opaque 100 X10-3

129 T3 Moderate, Round, Entire, Raised, Mucoid, Opaque 5 X10-3 T5 Small, Round, Entire, Raised, Moist, Opaque 2 X10-3 T6 Very small, Round, Entire, Raised, Dry, Opaque 1 X10-3 T7 Small, Round, Entire, Raised, Moist, Opaque 2 X10-3 T8 Moderate, Round, Entire, Raised, Dry, Opaque 1 X10-3 Small, Round, Entire, Raised, Moist, Opaque, Light red T9 1 X10-3 pigment T4 Small, Irregular, Undulate, Raised, Moist, Opaque 50 X10-3 Small, Round, Entire, Raised, Dry, Opaque, Pale yellow T10 3 X10-3 pigment T11 Small, Round, Entire, Raised, Dry, Opaque, Orange pigment 1 X10-3 T12 Moderate, Round, Entire, Flat, Dry, Opaque 1 X10-3 -3 T13 Moderate, Irregular, Undulate, Flat, Dry, Translucent 3 X10 Small, Round, Entire, Raised, Mucoid, Opaque, Light red T14 1 X10-3 NB48 pigment T15 Moderate, Round, Entire, Flat, Dry, Opaque 1 X10-3 T16 Small, Round, Entire, Raised, Moist, Opaque 10 X10-3 T17 Very small, Round, Entire, Raised, Moist, Opaque 10 X10-3 T18 Small, Round, Entire, Raised, Dry, Opaque, Orange pigment 1 X10-5 T19 Small, Round, Entire, Raised, Dry, Opaque 1 X10-5 T20 Small, Irregular, Undulate, Flat, Dry, Opaque 1 X10-5 T21 Small, Irregular, Undulate, Raised, Moist, Opaque 5 X10-5 T22 Moderate, Round, Entire, Flat, Moist, Opaque 1 X10-5 T23 Moderate, Irregular, Lobate, Flat, Moist, Opaque 1 X10-5 T24 Small, Round, Entire, Flat, Dry, Opaque 3 X10-5 T25 Small, Round, Entire, Flat, Dry, opaque 1 X10-5 T26 Small, Round, Entire, Raised, Dry, Opaque 200 X10-4 -4 T27 Small, Round, Entire, Flat, Dry, Transparent 2 X10 T28 Small, Round, Entire, Flat, Dry, Translucent 3 X10-4

NB49 -4

SAMPLE 21 SAMPLE T29 Small, Irregular, Lobate, Flat, Dry, Opaque 1 X10 T30 Moderate, Irregular, Undulate, Flat, Dry, Opaque 1 X10-4 T31 Small, Round, Entire, Raised, Dry, Opaque, Orange pigment 2 X10-3 T32 Rhizoid growth 3 X10-3 T33 Small, Round, Entire, Raised, Moist, Opaque 5 X10-3 T34 Small, Irregular, Undulate, Flat, Moist, Opaque 4 X10-3 T35 Small, Round, Entire, Flat, Dry, Translucent 1 X10-3 T36 Moderate, Irregular, Undulate, Flat, Dry, Opaque 300 X10-3

130 Moderate, Round, Entire, Raised, Moist, Opaque, Pink T37 1 X10-3 pigment T38 Moderate, Round, Entire, Flat, Dry, Translucent 1 X10-3 T39 Small, Irregular, Undulate, Flat, Dry, Transparent 1 X10-3 T40 Rhizoid growth 1 X10-3 T41 Small, Round, Entire, Flat, Dry, Transparent 3 X10-3 T42 Small, Round, Entire, Raised, Moist, Translucent 20 X10-3 T43 Large, Irregular, Undulate, Flat, Moist, Opaque 300 X10-3 T45 Small, Round, Entire, Raised, Dry, Opaque 4 X10-5 T47 Small, Round, Entire, Raised, Moist, Opaque 2 X10-5 T48 Small, Round, Entire, Flat, Dry, Opaque, Brown ECP 1 X10-5 T49 Small, Round, Entire, Raised, Mucoid, Opaque 1 X10-5 T50 Small, Round, Entire, Flat, Dry, Opaque 1 X10-5 T51 Small, Round, Entire, Raised, Moist, Opaque 4 X10-4 T52 Very small, Irregular, Lobate, Flat, Dry, Opaque 20 X10-4

NB50 T53 Moderate, Irregular, Undulate, Flat, Dry, Opaque, 1 X10-4 T54 Small, Round, Entire, Flat, Dry, Opaque 5 X10-4 T55 Small, Irregular, Undulate, Raised, Mucoid, Opaque 10 X10-4 T56 Small, Round, Entire, Raised, Dry, Opaque, Yellow pigment 10 X10-4 T57 Moderate, Round, Entire, Raised, Mucoid, Opaque 1 X10-4 Small, Irregular, Undulate, Flat, Dry, Opaque, Light orange T58 1 X10-4 pigment T59 Small, Round, Entire, Raised, Moist, Transparent 1 X10-4 T60 Small, Irregular, Undulate, Flat, Dry, Opaque 500 X10-3 T61 Small, Irregular, Lobate, Flat, Dry, Transparent 100 X10-3 Moderate, Round, Entire, Raised, Mucoid, Opaque, Pink T62 1 X10-3 pigment T63 Small, Round, Entire, Flat, Dry, Opaque 1 X10-3 T64 Moderate, Round, Entire, Raised, Dry, Opaque 1 X10-5 T65 Moderate, Round, Entire, Flat, Dry, Translucent 1 X10-5 -5 T66 Small, Round, Entire, Raised, Dry, Opaque 1 X10 Small, Round, Entire, Raised, Moist, Opaque, Light yellow T67 200 X10-5 NB51 pigment SAMPLE 22 SAMPLE T68 Large, Round, Entire, Flat, Mucoid, Opaque 5 X10-3 T69 Small, Round, Entire, Raised, Moist, Opaque 5 X10-3 T70 Small, Round, Entire, Raised, Dry, Opaque 1 X10-3 T71 Small, Round, Entire, Raised, Dry, Opaque 11 X10-3 T72 Small, Round, Entire, Raised, Dry, Opaque 3 X10-3

131 T73 Small, Round, Entire, Raised, Dry, Opaque, Yellow pigment 1 X10-3 T74 Small, Round, Entire, Raised, Dry, Opaque, Orange pigment 6 X10-3 T75 Small, Round, Entire, Raised, Moist, Opaque 3 X10-3 T78 Small, Round, Entire, Raised, Moist, Opaque 105 X10-3 T77 Large, Irregular, Undulate, Flat, Dry, Opaque 104 X10-3 T79 Moderate, Irregular, Undulate, Raised, Moist, Opaque 257 X10-3 T80 Small, Round, Entire, Flat, Dry, Opaque, Brown pigment 22 X10-3 T81 Small, Round, Entire, Raised, Moist, Opaque 28 X10-3 T82 Small, Round, Entire, Flat, Moist, Opaque 286 X10-3 Small, Round, Entire, Raised, Moist, Opaque, Pink coloured T83 1 X10-3 pigment T84 Small, Round, Entire, Flat, Moist, Opaque 56 X10-3 T85 Small, Round, Entire, Flat, Dry, Opaque 1 X10-4 T86 Moderate, Round, Entire, Flat, Moist, Opaque 13 X10-4

T87 Small, Round, Entire, Flat, Dry, Opaque 5 X10-4 T88 Small, Irregular, Undulate, Flat, Dry, Opaque 20 X10-4 NB52 Small, Round, Entire, Raised, Moist, Opaque, Light yellow T90 16 X10-4 pigment Small, Round, Entire, Raised, Dry, Opaque, Light yellow T91 1 X10-4 pigment T92 Small, Round, Entire, Raised, Moist, Opaque 217 X10-3 Small, Round, Entire, Raised, Moist, Opaque, Orange T93 3 X10-3 pigment T94 Large, Irregular, Undulate, Flat, Dry, Opaque 1 X10-3 T95 Moderate, Round, Entire, Raised, Moist, Opaque 2 X10-5 T96 Small, Round, Entire, Raised, Dry, Opaque 1 X10-5 T97 Rhizoid growth 53 X10-3 T98 Small, Round, Entire, Flat, Dry, Opaque, Orange pigment 2 X10-5 T99 Small, Irregular, Undulate, Flat, Dry, Opaque 1 X10-3 T100 Small, Round, Entire, Flat, Dry, Opaque 28 X10-4 U1 Small, Round, Entire, Flat, Dry, Transparent 29 X10-4 -4 U2 Small, Irregular, Undulate, Raised, Moist, Opaque 54 X10 U3 Very small, Round, Entire, Raised, Moist, Transparent 18 X10-4

NB53 -4

SAMPLE 23 SAMPLE U4 Small, Round, Entire, Raised, Dry, Opaque 1 X10 U5 Small, Round, Entire, Raised, Dry, Opaque 19 X10-4 U6 Large, Round, Entire, Flat, Dry, Opaque 1 X10-5 U7 Small, Irregular, Undulate, Flat, Dry, Translucent 1 X10-5 U8 Moderate, Round, Entire, Raised, Dry, Opaque 1 X10-5

132 U9 Rhizoid growth 1 X10-4 U10 Small, Round, Entire, Raised, Moist, Transparent 1 X10-4 U11 Small, Irregular, Undulate, Raised, Dry, Opaque 4 X10-4 U12 Moderate, Round, Entire, Flat, Dry, Opaque 5 X10-4 U13 Small, Irregular, Undulate, Flat, Dry Opaque 1 X10-4 U14 Small, Round, Entire, Raised, Moist, Opaque 2 X10-4 U15 Small, Irregular, Undulate, Flat, Dry Opaque 5 X10-5 U16 Moderate, Irregular, Undulate, Flat, Moist, Opaque 1 X10-4 Small, Round, Entire, Raised, Moist, Opaque, Light yellow U17 1 X10-4 pigment Moderate, Round, Entire, Raised, Dry, Opaque, yellow U18 1 X10-5 pigment U19 Small, Round, Entire, Flat, Moist, Opaque 1 X10-5 U20 Small, Irregular, Undulate, Raised, Dry, Opaque 1 X10-5 -5 U21 Small, Round, Entire, Raised, Moist, Opaque 1 X10 U22 Small, Irregular, Undulate, Flat, Moist, Opaque 6 X10-5 NB54 U23 Small, Round, Entire, Raised, Mucoid, Opaque, Pink pigment 1 X10-5 U24 Small, Irregular, Undulate, Raised, Dry, Opaque 1 X10-4 U25 Small, Round, Entire, Raised, Dry, Opaque 1 X10-5 U26 Moderate, Irregular, Undulate, Flat, Dry, Opaque 1 X10-5 U27 Small, Round, Entire, Raised, Dry, Opaque 1 X10-5 U28 Small, Round, Entire, Raised, Dry, Opaque, Brown ECP 1 X10-5 U29 Small, Round, Entire, Flat, Dry, Opaque, Light red pigment 1 X10-5 U30 Large, Irregular, Lobate, Flat, Dry, Opaque 1 X10-5 U31 Small, Round, Entire, Raised, Dry, Opaque 1 X10-5 U32 Small, Irregular, Undulate, Raised, Dry, Opaque 57 X10-4 U33 Large, Irregular, Undulate, Flat, Dry, Opaque 1 X10-3 U34 Rhizoid growth 5 X10-3 U35 Small, Round, Entire, Raised, Dry, Opaque, Yellow pigment 1 X10-3 U36 Rhizoid growth 1 X10-3 U37 Very small, Round, Entire, Raised, Dry, Opaque 1 X10-3 U38 Small, Irregular, Undulate, Flat, Moist, Translucent 1 X10-3 -3 U39 Small, Round, Entire, Flat, Moist, Opaque 2 X10 U40 Small, Irregular, Undulate, Raised, Dry, Opaque, Wrinkled 1 X10-3 NB55 U41 Small, Round, Entire, Raised, Dry, Opaque 1 X10-3 U42 Small, Round, Entire, Raised, Dry, Opaque 28 X10-4 U43 Very small, Round, Entire, Flat, Dry, Opaque 17 X10-4

133 U44 Small, Round, Entire, Raised, Moist, Opaque 9 X10-3 U45 Very small, Round, Entire, Raised, Dry, Opaque 19 X10-4 U46 Small, Round, Entire, Flat, Dry, Translucent, Yellow pigment 1 X10-3 U47 Small, Irregular, Undulate, Raised, Dry, Opaque 1 X10-3 U48 Small, Round, Entire, Raised, Dry, Opaque 1 X10-3 U49 Small, Round, Entire, Flat, Dry, Opaque, Yellow pigment 1 X10-3

134 Nutrient agar Final pH ( at 25°C) 7.2 Peptone 5.0g (autoclaving at 15 lbs for 15 minutes) NaCl 5.0g Beef extract 1.5g Starkey's Sulphate Reducing Agar Base Yeast extract 1.5g Tryptone 15.0g Agar 15g Soya peptone 5.0g Distilled water 1000ml NaCl 5.0g pH 7.4+0.2 Magnesium sulphate, (autoclaving at 15 lbs for 15 minutes) heptahydrate 2.0g Ferrous ammonium sulfate, Ashbys Mannitol Agar hexahydrate 2.0g Mannitol 20.0 g Agar 20.0g Dipotassium phosphate 0.2 g Final pH ( at 25°C) 7.3 Magnesium sulphate 0.2g Distilled water 1000ml NaCl 0.2g In 1000ml distilled water add 4 ml of 60% sodium lactate. Heat to boiling to dissolve Potassium sulphate 0.2g the medium completely. Sterilize by Calcium carbonate 5.0g autoclaving at 15lbs pressure (121°C) for 15 Agar 15.0g minutes. Final pH ( at 25°C) 7.4 Crystal violet Distilled water 1000ml (autoclaving at 15 lbs for 15 minutes) Solution A Crystal violet 3g Pikovskayas Agar Ethanol (90%) 20 ml Yeast extract 0.5g Solution B Dextrose 10.0g Ammonium oxalate 0.9g Distilled water 80 ml Calcium phosphate 5.0g (A and B prepared desperately and mix them Ammonium sulphate 0.5g and keep in brown colour stoppered bottle) Potassium chloride 0.2g

Magnesium sulphate 0.1g Safranin Manganese sulphate 0.0001g Safranin 1.0g Ferrous sulphate 0.0001g Ethyl alcohol 40ml Agar 15.0g Distilled water 300ml Distilled water 1000ml (autoclaving at 15 lbs for 15 minutes) Methyl red indicator Aleksandrow Agar Methyl red 0.1g Magnesium sulphate 0.5g Ethanol 300ml Calcium carbonate 0.1g Distilled water 200ml Potassium alumino silicate 2.0g Glucose 5.0g 3% KOH Ferric chloride 0.005g KOH crystals 0.3g Calcium phosphate 2.0g Distilled water 10 ml Agar 20.0g TE buffer

135 Tris-HCl (pH8.0) 10µm Na2EDTA.2H2O (pH8.0) 1µm

1X TBE 10X TBE 50ml Distilled water 450ml

10X TBE Tris buffer 10.8g Boric acid 5.5g EDTA 0.75g Distilled water 100ml (autoclaving at 15 lbs for 15 minutes)

Agarose gel Agarose 0.45g 1X TBE 30ml (Mixture boiled) Safe blue 7µl 1.5% agarose used visualize the amplification after PCR

Gel loading dye (bromocresol purple) Stock (0.5%) BPB 0.5% BPB 500gm distilled water 100ml autoclave and store at 4°C BPB dye Stock (0.5%) BPB 100µl 1X TBE 700µl Glycero/ ficoll 200µl mix well and store at 4°C

TE buffer 1M Tris Hcl 500µl 0.5M EDTA 100µl Make up to 50µl

136

137