Superactivation of Integrin Αvβ3 by Low Antagonist Concentrations
Total Page：16
File Type：pdf, Size：1020Kb
Erschienen in: Journal of cell science ; 114 (2001), 8. - S. 1545-1553 RESEARCH ARTICLE 1545 Superactivation of integrin αvβ3 by low antagonist concentrations Daniel F. Legler1,*, Guido Wiedle2,*, F. Patrick Ross3 and Beat A. Imhof2,‡ 1Institute of Biochemistry, University of Lausanne, CH-1066 Epalinges, Switzerland 2Department of Pathology, Centre Médical Universitaire, 1 rue Michel-Servet, CH-1211 Geneva 4, Switzerland 3Department of Pathology, Jewish Hospital at Washington University Medical Centre, St Louis, MO 63110, USA *Both authors contributed equally to this work ‡Author for correspondence (e-mail: [email protected]) Accepted 24 January 2001 Journal of Cell Science 114, 1545-1553 © The Company of Biologists Ltd SUMMARY Integrins are implicated in cell adhesion, migration and phase at high concentrations, and an agonistic phase at homeostasis. An important feature is their ability to adopt low concentrations. This integrin superactivation by low different affinity states that can be regulated by a variety antagonist concentrations is shown in binding of srαvβ3 to of intra- and extracellular factors. To study affinity immobilized ligands by ELISA, and in adhesion of cells modulation of the integrin ectodomain by extracellular that express the chimaeric integrin ligand KISS31 to factors, we produced a soluble recombinant form of mouse immobilized rsαvβ3 and native purified αvβ3. Our results integrin αvβ3 in a mammalian expression system and indicate that low concentrations of the ligand mimetic isolated it to purity. We show that the two transmembrane cyclo-RGD can result in superactivation of the truncated integrin subunits stably associate to form a extracellular domain of integrin αvβ3 to a comparable level functional receptor, soluble recombinant αvβ3. The affinity as activation by manganese. of this receptor for its ligands vitronectin, fibronectin and fibrinogen can be modulated by the divalent cations magnesium, calcium and manganese. Most importantly, we Key words: Integrin αvβ3, Vitronectin receptor, Affinity modulation, found that a cyclic RGD-peptide has a biphasic effect on Integrin activation, Soluble recombinant cell adhesion molecule, rsαvβ3 and native purified αvβ3, with an antagonistic Cyclo-RGD INTRODUCTION platelets. Integrins involved in such marked affinity changes are of the β1-, β2-, β3 and β7-family, with the most extensively Integrins are a family of αβ-heterodimeric cell adhesion studied being α4β1, α4β7, αLβ2, αIIbβ3 and αvβ3. Cell molecules consisting of two type I transmembrane adhesion can also be regulated without changing integrin glycoprotein subunits. Eight integrin β-chains pair with a affinity from within the cell: the cytoskeleton controls lateral restricted number of 16 α-chains, giving rise to 22 different diffusion and clustering of integrin receptors in the membrane, integrins with distinct expression patterns and ligand binding thereby modulating avidity and plasticity of the adhesive profiles. The ligands are either large, modular extracellular interaction, an important mechanism for cell spreading and matrix molecules such as collagens, fibronectin, vitronectin, migration (Bazzoni and Hemler, 1998; Hughes and Pfaff, 1998; laminins, osteopontin, vWF and fibrinogen, or they are Peter and O’Toole, 1995; Yamada and Miyamoto, 1995; Yauch members of the immunoglobulin superfamily of adhesion et al., 1997). molecules, like VCAM-1, ICAM-1, -2, -3, L1, and MAdCAM- In addition to cytoplasmic regulation, integrin affinity is 1 (Bazzoni and Hemler, 1998; Humphries and Newham, 1998). strongly influenced by extracellular concentrations of calcium, The most prominent and unique feature of integrins is their magnesium and manganese, which can be bound by at least ability to undergo rapid changes in ligand binding affinity in three types of coordination sites in both integrin subunits. response to intracellular signals that can be propagated from Some alpha subunits contain three or four EF-handlike calcium the cytoplasmic domain to the extracellular ligand binding binding motifs, and a subset has an additional magnesium domain, possibly by conformational changes. This so-called coordination site in the so-called I-domain, a structure inside-out signalling allows cells to undergo a fast transition homologous to the vWF A-domain. Beta subunits bind divalent from a non-adherent to an adherent state (Diamond and cations with a N-terminal structure that is related to the Springer, 1994; Hughes et al., 1996; Hughes and Pfaff, 1998). I-domains of the integrin subunits alphaM and alphaL Accordingly, this mechanism is a critical regulation step for (Bergelson and Hemler, 1995). Interestingly, these ions are leukocytes and platelets that circulate in the blood as non- qualitatively different: whereas magnesium promotes affinity adhesive cells, but rapidly become adherent upon stimulation, of all integrins in a monophasic fashion, calcium can act on thus allowing transendothelial migration of leukocytes at some integrins in a biphasic manner. For example, in αIIbβ3 defined sites, or fibrinogen binding and thrombus formation by calcium occupies the high affinity coordination sites and thus Konstanzer Online-Publikations-System (KOPS) URL: http://nbn-resolving.de/urn:nbn:de:bsz:352-0-366259 1546 JOURNAL OF CELL SCIENCE 114 (8) promotes ligand binding at low concentrations. However, at ACTACAAGGACGACGATGACAAGTAAGGCC) and antisense higher concentrations, calcium can bind to low affinity sites (5′TTACTTGTCATCGTCGTCCTTGTAGTCGGGCC) cDNA were and act as allosteric inhibitor, presumably by increasing the annealed and cloned into the ApaI-site of pcDNA3, thereby dissociation rate of the ligand. Manganese has the most reconstituting only the ApaI site 5′ of the inserted FLAG-cDNA. dramatic effect on integrin affinity, since its binding to cation cDNAs to be expressed as FLAG-tagged soluble molecules were then coordination sites activates integrins to maximal affinity. cloned into the multiple cloning site of pcDNA3/FLAG in frame with However, it is still unclear whether manganese can reach the FLAG-tag cDNA. concentrations above its dissociation constant for integrins in Soluble recombinant mouse integrin αvβ3 vivo, and thus whether manganese has any biological role in The cDNA encoding the ectodomain for mouse integrin αv was integrin affinity modulation in vivo (Bazzoni et al., 1995; amplified by PCR from mouse placenta cDNA using Pfu polymerase D’Souza et al., 1994; Hu et al., 1996; Smith et al., 1994). (Stratagene, La Jolla, CA) and the following oligonucleotides: Finally, several integrins have been shown to associate and forward primer 5′ATTATGGATCCACCATGGCTGCTCCCGGGCG- interact in a cis manner with an increasing number of CCTGCT, reverse primer 5′ATATTAGGGCCCCTGAATGCCCCAG- transmembrane molecules such as CD47 (IAP), insulin- and GTGATGTTAG. The PCR product was digested with BamHI and PDGFβ-receptor, VEGFR-2, and the transmembrane 4 ApaI (internal primer sites are underlined), cloned into the superfamily members CD9, CD63, CD81, CD82, and CD151. corresponding site of pcDNA3/FLAG (see above) in frame with the These regulatory interactions can result in modulation of the FLAG-tag cDNA, and sequenced. Full length cDNA for mouse associated molecule by the integrin (e.g. VEGFR-2) as well as integrin β3 was cloned into the BamHI/XhoI site of pcDNA3, the in modulation of integrin function by the associated molecule cDNA encoding the transmembrane and cytoplasmic region excised (e.g. CD47) (Fitter et al., 1999; Frazier et al., 1999; Mannion with EcoRV/XhoI, and the open XhoI site blunted with mung bean nuclease. Re-ligation of the vector resulted in a cDNA encoding the et al., 1996; Schneller et al., 1997; Soldi et al., 1999). β In terms of promiscuity and affinity modulation, αvβ3 is ectodomain of the 3-chain, followed by three more amino acids (Ala- Cys-Ile) and a stop codon. probably the most versatile integrin, because it can be regulated by all of the above mentioned interactions and mechanisms. SKI-7 On some lymphoid cell lines and on platelets, it is expressed The cDNA for the disintegrin kistrin, generated by annealing of in an inactive, low affinity form that requires cellular activation overlapping oligonucleotides (Wiedle et al., 1999), was cloned into in order to mediate cell adhesion (Bennett et al., 1997; Byzova pcDNA3/FLAG to create a fusion molecule of kistrin with a C- and Plow, 1998; Sadhu et al., 1998; Stupack et al., 1992). In terminal FLAG-tag. An additional tag, the first Ig-homology domain contrast, on most cell lines and all adherent cells αvβ3 is of mouse CD31, was then added to 5′end of this cDNA. Finally, the maximally active, and its affinity cannot be further increased cDNA for the mouse CD8α hinge region was inserted between the by intracellular signals. It therefore has been suggested that the CD31 and kistrin sequence. The resulting protein soluble kistrin 7, default state of αvβ3 be active (Mehta et al., 1998; Pelletier et SKI-7, consists thus of the following components: N-(CD31- al., 1996). However, intracellular interaction of αvβ3 with the domain1)-(CD8α-hinge)-(kistrin)-(FLAG)-C. cytoskeleton is crucial for its localization to focal adhesion KISS31 plaques during cell spreading and migration, and this interaction can be regulated by calpain, a calcium-dependent Cloning and expression of KISS31 has been previously described β (Wiedle et al., 1999). Briefly, the chimaeric cell adhesion molecule protease with specificity for the 3-subunit cytoplasmic KISS31 consists of CD31/PECAM-1