Heterologous Expression of Human Mpr Alpha, Mpr Beta and Mpr

Total Page:16

File Type:pdf, Size:1020Kb

Heterologous Expression of Human Mpr Alpha, Mpr Beta and Mpr steroids 73 (2008) 1160–1173 available at www.sciencedirect.com journal homepage: www.elsevier.com/locate/steroids Heterologous expression of human mPR␣, mPR␤ and mPR␥ in yeast confirms their ability to function as membrane progesterone receptors Jessica L. Smith, Brian R. Kupchak, Ibon Garitaonandia 1, L. Kim Hoang, Andrew S. Maina, Lisa M. Regalla 2, Thomas J. Lyons ∗ Department of Chemistry, University of Florida, P.O. Box 117200, Gainesville, FL 32611, United States article info abstract Article history: The nuclear progesterone receptor (nPR) mediates many of the physiological effects of Received 1 April 2008 progesterone by regulating the expression of genes, however, progesterone also exerts Received in revised form 6 May 2008 non-transcriptional (non-genomic) effects that have been proposed to rely on a receptor Accepted 8 May 2008 that is distinct from nPR. Several members of the progestin and AdipoQ-Receptor (PAQR) Published on line 18 May 2008 family were recently identified as potential mediators of these non-genomic effects. Mem- branes from cells expressing these proteins, called mPR␣, mPR␤ and mPR␥, were shown to Keywords: specifically bind progesterone and have G-protein coupled receptor (GPCR) characteristics, Membrane progestin receptors although other studies dispute these findings. To clarify the role of these mPRs in non- Progesterone genomic progesterone signaling, we established an assay for PAQR functional evaluation Yeast using heterologous expression in Saccharomyces cerevisiae. Using this assay, we demonstrate ␣ ␤ ␥ Adiponectin unequivocally that mPR , mPR and mPR can sense and respond to progesterone with EC50 Osmotin values that are physiologically relevant. Agonist profiles also show that mPR␣, mPR␤ and mPR␥ are activated by ligands, such as 17␣-hydroxyprogesterone, that are known to activate non-genomic pathways but not nPR. These results strongly suggest that these receptors may indeed function as the long-sought-after membrane progesterone receptors. Additionally, we show that two uncharacterized PAQRs, PAQR6 and PAQR9, are also capable of respond- ing to progesterone. These mPR-like PAQRs have been renamed as mPR␦ (PAQR6) and mPR␧ (PAQR9). Additional characterization of mPR␥ and mPR␣ indicates that their progesterone- dependent signaling in yeast does not require heterotrimeric G-proteins, thus calling into question the characterization of the mPRs as a novel class of G-protein coupled receptor. © 2008 Elsevier Inc. All rights reserved. 1. Introduction This type of signal transduction is often referred to as genomic signaling because this receptor, also called the nuclear proges- The classic paradigm for progesterone-mediated signal trans- terone receptor (nPR), doubles as a DNA binding transcription duction involves diffusion of the steroid hormone into cells factor and, as such, modulates gene transcription in response and binding to soluble intracellular progesterone receptors [1]. to progesterone. It has long been recognized, however, that ∗ Corresponding author. Tel.: +1 352 846 3392; fax: +1 352 846 2095. E-mail address: [email protected]fl.edu (T.J. Lyons). 1 Current address: Department of Neurobiology, SBR-14, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037, United States. 2 Current address: Boston Museum of Science, Science Park, Boston, MA 02114, United States. 0039-128X/$ – see front matter © 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.steroids.2008.05.003 steroids 73 (2008) 1160–1173 1161 many of the physiological effects of progesterone occur far too attribute progesterone-dependent effects solely to one pro- rapidly to require gene transcription and often occur in cells tein. This line of research is beyond the scope of this study that are transcriptionally silent, such as sperm [2]. Moreover, and, ultimately, the discovery of the true physiological roles the receptor(s) responsible for mediating the non-genomic of mPR␣,mPR␤ and mPR␥ may require the development of effects of progesterone have a markedly different agonist pro- mouse knockout strains. files from nPR [3], suggesting that it is a distinct receptor. Herein, we address another important aspect of character- These facts have led researchers to propose the existence of izing mPR␣,mPR␤ and mPR␥—their biochemistry. To date, the an integral membrane progesterone receptor (mPR) that binds biochemical characterization of mPR␣,mPR␤ and mPR␥ has progesterone at the cell surface and rapidly generates intracel- involved their expression in either vertebrate cell culture or lular second messengers [4]. This mechanism for progesterone E. coli [19,10,11]. Expression in vertebrate cell culture has been response has been called non-genomic signaling because it fruitful, however, conflicting results were obtained by differ- does not absolutely require transcription to proceed, although ent groups [17,19]. Moreover, this approach is limited by the there is no reason to suspect that non-genomic mechanisms aforementioned overabundance of progesterone-binding pro- do not also regulate transcription [5]. The existence of mPR is teins in vertebrate cells that make data interpretation difficult. a matter of intense debate. Indeed, it has been argued that On the other hand, E. coli do not contain known progesterone there is no need to invoke the existence of a distinct mPR receptors and heterologous expression in this organism has because the nPR itself is capable of mediating rapid non- been successfully used to confirm progesterone binding to genomic effects by binding to and regulating the activity of isolated mPRs embedded in intact E. coli membranes [10,11]. other signaling proteins [6–9]. Nevertheless, several candidate However, while expression in E. coli is certainly useful for mPRs have emerged and, while it is clear that some of these studying progesterone binding to these receptors, it cannot candidates bind progesterone, it is not clear how, or even if, yet be used to investigate functionality, since E. coli it is not they function as receptors to mediate the non-genomic effects known if PAQR receptors function the same in this organism of progesterone. as they do in eukaryotes. Recently, a series of seminal papers were published iden- Thus, a resolution to the debate about whether mPR␣, tifying three integral membrane proteins from fish that not mPR␤ and mPR␥ can sense and respond to progesterone only bind progesterone, but also seem to mediate many of requires a system with two fundamental properties. First, its rapid non-genomic effects [10,11]. These three proteins, such a system must be devoid of known progesterone- renamed mPR␣,mPR␤ and mPR␥, are conserved in vertebrates binding/sensing proteins so that the mPRs can be studied in and belong to a newly characterized family of proteins that isolation. Second, this system must have an intact signaling includes the yeast osmotin receptor (Izh2p) [12] and human apparatus that allows for monitoring signal transduction in adiponectin receptors (AdipoR) [13]. This family is known as response to progesterone. Herein we report the development the progestin- and AdipoQ-Receptor (PAQR) family [14]. of such a system that entails the heterologous expression of A series of follow-up studies produced compelling evidence mPR␣,mPR␤ and mPR␥ in the yeast Saccharomyces cerevisiae. that mPR␣,mPR␤ and mPR␥ function as membrane proges- This choice of model systems is advantageous for several rea- terone receptors. However, as a recent review in this journal sons. First, yeast is a eukaryotic system for which simple yet demonstrates [15], the field remains embroiled in controversy. powerful genetic tools exist. Second, yeast possesses receptors The primary reason for this is the fact that a recent study was in the PAQR family suggesting that the machinery required to unable to reproduce the original results [16,17]. Another signif- read second messengers produced by these proteins is present icant source of contention is the assertion that these receptors [27]. Third, S. cerevisiae neither makes nor uses progesterone. function as a new class of G-protein-coupled receptor (GPCR) In fact, a recent publication showed that massive doses of [18,19,10,11] despite the fact that no other class of PAQR seems progesterone (1 mM) did little more than weakly induce the to couple to G-proteins and that members of the PAQR family general stress–response [28]. The low background biological of receptors bear only superficial similarity to GPCRs. activity of progesterone in this system makes it an ideal model Further investigation is needed before mPR␣,mPR␤ and for the study of individual progesterone receptors in a living mPR␥ can be universally accepted as membrane progesterone cell. Indeed, S. cerevisiae has already been successfully adapted receptors. One side of this equation involves the study of the for the biochemical characterization of nuclear progesterone physiological roles of these proteins in vivo. To date, no stud- receptors [29]. ies have demonstrated an unequivocal role for these proteins We recently published a study showing that the yeast in the physiology of progesterone. Part of the reason for this osmotin receptor (Izh2p) controls a signaling pathway in S. is the overabundance of progesterone-binding proteins and cerevisiae that negatively regulates the expression of a gene putative progesterone receptors in vertebrates that can poten- called FET3 [30]. The physiological importance of this reg- tially confound data analysis. Not only do vertebrate cells ulation
Recommended publications
  • Peripheral Nervous System……………………………………………….9
    PhD School in Integrative Biomedical Research Department of Pharmacological and Biomolecular Sciences Curriculum: Neuroscience Molecular basis for the development of innovative therapies for peripheral neuropathies treatment: role and cross-regulation of the GABAergic system and neuroactive steroids SDD BIO/09 - Physiology Luca Franco Castelnovo Badge number R10402 PhD Tutor: Prof. Valerio Magnaghi PhD School Coordinator: Prof. Chiarella Sforza Academic year 2015/2016 INDEX Abstract…………………………………………………………………...page 1 Abbreviations list…………………………………………………………….....5 Introduction………………………………………………………………….....8 Peripheral nervous system……………………………………………….9 General concepts……………...……….……………………………........……..9 Sensory system and nociceptive fibers.………………..………….…………..12 Schwann cells and myelination……….……..………………...………………15 Peripheral neuropathies…….…………………………………………...26 General concepts……………………………………………………...……….26 Neuropathic pain……………………………………...……………………….27 Nerve regeneration…………………………………………………………….28 The GABAergic system………….……………………………………...32 GABA……………….…………………………………………………..……..32 GABA-A receptors…………………………………………………………….33 GABA-B receptors…………………………………………………………….42 GABAergic system in the peripheral nervous system…………………………47 Protein kinase C – type ε……………………….………………………..51 General concepts…………………………………………………….…………51 Cross-talk with allopregnanolone and GABA-A………………………………54 Neuroactive steroids…………......………………………………………57 General concepts…………………………………….…………………………57 Mechanism of action…………………………….……………………………..59 Progesterone derivatives………………………………….……………………60
    [Show full text]
  • Nicotinic Signalling and Neurosteroid Modulation in Principal Neurons of the Hippocampal Formation and Prefrontal Cortex
    Nicotinic Signalling and Neurosteroid Modulation in Principal Neurons of the Hippocampal Formation and Prefrontal Cortex by Beryl Yik Ting Chung A Thesis presented to The University of Guelph In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Sciences and Neuroscience Guelph, Ontario, Canada © Beryl Yik Ting Chung, April, 2018 ABSTRACT NICOTINIC SIGNALLING AND NEUROSTEROID MODULATION IN PRINCIPAL NEURONS OF THE HIPPOCAMPAL FORMATION AND PREFRONTAL CORTEX Beryl Yik Ting Chung Advisor: University of Guelph, 2018 Dr. Craig D.C. Bailey Nicotinic signalling plays an important role in coordinating the response of neuronal networks in many brain regions. During pre- and postnatal circuit formation, neurotransmission mediated by nicotinic acetylcholine receptors (nAChRs) influences neuronal survival and regulates neuronal excitability, synaptic transmission, and synaptic plasticity. Nicotinic signalling is also necessary for the proper function of the hippocampal formation (HF) and prefrontal cortex (PFC), which are anatomically and functionally connected and facilitate higher-order cognitive functions. The decline or dysfunction in nicotinic signalling and nAChR function has been observed in various neurological disorders, and the disruption or alteration of nicotinic signalling in the HF and/or PFC can impair learning and memory. While the location and functional role of the α4β2* nAChR isoform has been well characterized in the medial portion of the PFC, this is not well-established in the HF. What is the role of α4β2* nAChRs in excitatory principal neurons of the HF during early development? Growing evidence suggests that the progesterone metabolite allopregnanolone (ALLO) plays a role in mediating the proper function of the HF and the PFC, and that it may also inhibit nAChR function.
    [Show full text]
  • Progesterone Receptor Membrane Component 1 Promotes Survival of Human Breast Cancer Cells and the Growth of Xenograft Tumors
    Cancer Biology & Therapy ISSN: 1538-4047 (Print) 1555-8576 (Online) Journal homepage: http://www.tandfonline.com/loi/kcbt20 Progesterone receptor membrane component 1 promotes survival of human breast cancer cells and the growth of xenograft tumors Nicole C. Clark, Anne M. Friel, Cindy A. Pru, Ling Zhang, Toshi Shioda, Bo R. Rueda, John J. Peluso & James K. Pru To cite this article: Nicole C. Clark, Anne M. Friel, Cindy A. Pru, Ling Zhang, Toshi Shioda, Bo R. Rueda, John J. Peluso & James K. Pru (2016) Progesterone receptor membrane component 1 promotes survival of human breast cancer cells and the growth of xenograft tumors, Cancer Biology & Therapy, 17:3, 262-271, DOI: 10.1080/15384047.2016.1139240 To link to this article: http://dx.doi.org/10.1080/15384047.2016.1139240 Accepted author version posted online: 19 Jan 2016. Published online: 19 Jan 2016. Submit your article to this journal Article views: 49 View related articles View Crossmark data Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=kcbt20 Download by: [University of Connecticut] Date: 26 May 2016, At: 11:28 CANCER BIOLOGY & THERAPY 2016, VOL. 17, NO. 3, 262–271 http://dx.doi.org/10.1080/15384047.2016.1139240 RESEARCH PAPER Progesterone receptor membrane component 1 promotes survival of human breast cancer cells and the growth of xenograft tumors Nicole C. Clarka,*, Anne M. Frielb,*, Cindy A. Prua, Ling Zhangb, Toshi Shiodac, Bo R. Ruedab, John J. Pelusod, and James K. Prua aDepartment of Animal Sciences,
    [Show full text]
  • PAQR6 Antibody (C-Term) Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP13667B
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 PAQR6 Antibody (C-term) Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP13667B Specification PAQR6 Antibody (C-term) - Product Information Application WB,E Primary Accession Q6TCH4 Other Accession NP_940798.1, NP_079173.2 Reactivity Human Host Rabbit Clonality Polyclonal Isotype Rabbit Ig Calculated MW 37989 Antigen Region 283-312 PAQR6 Antibody (C-term) - Additional Information PAQR6 Antibody (C-term) (Cat. #AP13667b) Gene ID 79957 western blot analysis in Jurkat cell line lysates (35ug/lane).This demonstrates the PAQR6 Other Names antibody detected the PAQR6 protein (arrow). Progestin and adipoQ receptor family member 6, Progestin and adipoQ receptor family member VI, PAQR6 PAQR6 Antibody (C-term) - Background Target/Specificity The function of this protein remains unknown. This PAQR6 antibody is generated from rabbits immunized with a KLH conjugated PAQR6 Antibody (C-term) - References synthetic peptide between 283-312 amino acids from the C-terminal region of human PAQR6. Kamatani, Y., et al. Nat. Genet. 42(3):210-215(2010) Dilution Smith, J.L., et al. Steroids WB~~1:1000 73(11):1160-1173(2008) Tang, Y.T., et al. J. Mol. Evol. Format 61(3):372-380(2005) Purified polyclonal antibody supplied in PBS with 0.09% (W/V) sodium azide. This antibody is purified through a protein A column, followed by peptide affinity purification. Storage Maintain refrigerated at 2-8°C for up to 2 weeks. For long term storage store at -20°C in small aliquots to prevent freeze-thaw cycles. Precautions PAQR6 Antibody (C-term) is for research Page 1/3 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 use only and not for use in diagnostic or therapeutic procedures.
    [Show full text]
  • PAQR6 (NM 001272108) Human Tagged ORF Clone – RG236776
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG236776 PAQR6 (NM_001272108) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: PAQR6 (NM_001272108) Human Tagged ORF Clone Tag: TurboGFP Symbol: PAQR6 Synonyms: PRdelta Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG236776 representing NM_001272108. Sequence: Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTCAGTCTCAAGCTGCCCCAACTTCTTCAAGTCCACCAGGTCCCCCGGGTGTTCTGGGAAGATGGC ATCATGTCTGGCTACCGCCGCCCCACCAGCTCGGCTTTGGACTGTGTCCTCAGCTCCTTCCAGATGACC AACGAGACGGTCAACATCTGGACTCACTTCCTGCCCACCTGTTTCCTGGAGCTGGAAAGCCCTGGGCTC AGTAAGGTCCTCCGCACAGGAGCCTTCGCCTATCCATTCCTGTTCGACAACCTCCCACTCTTTTATCGG CTCGGGCTGTGCTGGGGCAGGGGCCACGGCTGTGGGCAGGAGGCCCTGAGCACCAGCCATGGCTACCAT CTCTTCTGCGCGCTGCTCACTGGCTTCCTCTTCGCCTCCCACCTGCCTGAAAGGCTGGCACCAGGACGC TTTGATTACATCGGCCACAGCCACCAGTTATTCCACATCTGTGCAGTGCTGGGCACCCACTTCCAGCTG GAGGCAGTGCTGGCTGATATGGGATCACGCAGAGCCTGGCTGGCCACACAGGAACCTGCCCTGGGCCTG GCAGGCACAGTGGCCACACTGGTCTTGGCTGCAGCTGGGAACCTACTCATTATTGCTGCTTTCACAGCC ACCCTGCTTCGGGCCCCCAGTACATGCCCTCTGCTGCAGGGTGGCCCACTGGAGGGGGGTACCCAGGCC AAACAACAG ACGCGTACGCGGCCGCTCGAG - GFP Tag - GTTTAAAC This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View
    [Show full text]
  • Expression of Progesterone Receptor Membrane Component 1 (PGRMC1
    Hindawi Publishing Corporation BioMed Research International Volume 2016, Article ID 8065830, 12 pages http://dx.doi.org/10.1155/2016/8065830 Research Article Expression of Progesterone Receptor Membrane Component 1 (PGRMC1), Progestin and AdipoQ Receptor 7 (PAQPR7), and Plasminogen Activator Inhibitor 1 RNA-Binding Protein (PAIRBP1) in Glioma Spheroids In Vitro Juraj Hlavaty,1 Reinhard Ertl,2 Ingrid Miller,3 and Cordula Gabriel1 1 Institute of Anatomy, Histology and Embryology, University of Veterinary Medicine, 1210 Vienna, Austria 2VetCORE, Facility for Research, University of Veterinary Medicine, 1210 Vienna, Austria 3Institute of Medical Biochemistry, University of Veterinary Medicine, 1210 Vienna, Austria Correspondence should be addressed to Cordula Gabriel; [email protected] Received 27 January 2016; Revised 14 April 2016; Accepted 27 April 2016 Academic Editor: Emeline Tabouret Copyright © 2016 Juraj Hlavaty et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Objective. Some effects of progesterone on glioma cells can be explained through the slow, genomic mediated response via nuclear receptors; the other effects suggest potential role of a fast, nongenomic action mediated by membrane-associated progesterone receptors. Methods. The effects of progesterone treatment on the expression levels of progesterone receptor membrane component 1 (PGRMC1), plasminogen activator inhibitor 1 RNA-binding protein (PAIRBP1), and progestin and adipoQ receptor 7 (PAQR7) on both mRNA and protein levels were investigated in spheroids derived from human glioma cell lines U-87 MG and LN-229. Results. The only significant alteration at the transcript level was the decrease in PGRMC1 mRNA observed in LN-229 spheroids treated with 30 ng/mL of progesterone.
    [Show full text]
  • PRODUCT SPECIFICATION Anti-PAQR9 Product
    Anti-PAQR9 Product Datasheet Polyclonal Antibody PRODUCT SPECIFICATION Product Name Anti-PAQR9 Product Number HPA052798 Gene Description progestin and adipoQ receptor family member IX Clonality Polyclonal Isotype IgG Host Rabbit Antigen Sequence Recombinant Protein Epitope Signature Tag (PrEST) antigen sequence: IMLESWLFDLRGENPTLFVHF Purification Method Affinity purified using the PrEST antigen as affinity ligand Verified Species Human Reactivity Recommended IHC (Immunohistochemistry) Applications - Antibody dilution: 1:20 - 1:50 - Retrieval method: HIER pH6 Characterization Data Available at atlasantibodies.com/products/HPA052798 Buffer 40% glycerol and PBS (pH 7.2). 0.02% sodium azide is added as preservative. Concentration Lot dependent Storage Store at +4°C for short term storage. Long time storage is recommended at -20°C. Notes Gently mix before use. Optimal concentrations and conditions for each application should be determined by the user. For protocols, additional product information, such as images and references, see atlasantibodies.com. Product of Sweden. For research use only. Not intended for pharmaceutical development, diagnostic, therapeutic or any in vivo use. No products from Atlas Antibodies may be resold, modified for resale or used to manufacture commercial products without prior written approval from Atlas Antibodies AB. Warranty: The products supplied by Atlas Antibodies are warranted to meet stated product specifications and to conform to label descriptions when used and stored properly. Unless otherwise stated, this warranty is limited to one year from date of sales for products used, handled and stored according to Atlas Antibodies AB's instructions. Atlas Antibodies AB's sole liability is limited to replacement of the product or refund of the purchase price.
    [Show full text]
  • Neuroprotection in Perimenopause New Insights for Hormone Therapy
    ISSN: 2573-9565 Review Article Journal of Clinical Review & Case Reports Neuroprotection in Perimenopause New Insights for Hormone Therapy Manuela Cristina Russu MD, Ph.D *Corresponding author Manuela Cristina Russu: “Dr I Cantacuzino” Clinic of Obstetrics and Gynecology; “Carol Davila” University of Medicine and Pharmacy, Bucharest, 5-7 Ion Movilă Professor of Obstetrics and Gynecology Street, District 2, zip code 020745. Romania Submitted: 18 Mar 2020; Accepted: 25 Mar 2020; Published: 03 Apr 2020 Abbreviations a demented status to progress from early stages of endocrine aging FMP: Final Menstrual Period process [1]. HPOA: Hypothalamic-Pituitary-Ovarian Axis MT: Menopausal Transition Update on the importance of Hormone Therapy in perimenopause VMS: Vasomotor Symptoms The menopausal transition (MT) or perimenopause– 4 to 6 years MHT: Menopausal Hormone Therapy duration [2]. with reproductive and dynamic critical changes in ERT: Estrogen Replacement Therapy hypothalamic-pituitary-ovarian axis (HPOA), and entire women’s PCC: Posterior Cingulate Cortex body, biology and psychology, starts with menstrual irregularities MCI: Mild Cognitive Impairment from the stage -3b/-3a in the late reproductive ages, with ethnic AD: Alzheimer ’s disease differences in symptoms, hormones and their receptors and actions PD: Parkinson’s Disease [3, 4]. Aβ: Beta Amyloid CVD: Cerebrovascular Disease CAA: Cerebral Amyloid Angiopathy HS: Hippocampal Sclerosis 17ß-E2: 17ß-Estradiol CEE: Conjugated Equine Estrogens ERs: Estrogen Receptors Pg: Progesterone PRs:
    [Show full text]
  • Human Chorionic Gonadotropin Increases Serum Progesterone, Number of Corpora Lutea and Angiogenic Factors in Pregnant Sheep
    REPRODUCTIONRESEARCH Human chorionic gonadotropin increases serum progesterone, number of corpora lutea and angiogenic factors in pregnant sheep Megan P T Coleson*, Nicole S Sanchez*, Amanda K Ashley, Timothy T Ross and Ryan L Ashley Department of Animal and Range Sciences, New Mexico State University, PO Box 30003, MSC 3I, Las Cruces, New Mexico 88003, USA Correspondence should be addressed to R L Ashley; Email: [email protected] *(M P T Coleson and N S Sanchez contributed equally to this work) Abstract Early gestation is a critical period when implantation and placental vascularization are established, processes influenced by progesterone (P4). Although human chorionic gonadotropin (hCG) is not endogenously synthesized by livestock, it binds the LH receptor, stimulating P4 synthesis. We hypothesized treating pregnant ewes with hCG would increase serum P4, number of corpora lutea (CLs) and concepti, augment steroidogenic enzymes, and increase membrane P4 receptors (PAQRs) and angiogenic factors in reproductive tissues. The objective was to determine molecular alterations induced by hCG in pregnant sheep that may promote pregnancy. Ewes received either 600 IU of hCG or saline i.m. on day 4 post mating. Blood samples were collected daily from day 0 until tissue collection for serum P4 analysis. Reproductive tissues were collected on either day 13 or 25 of gestation and analyzed for PAQRs, CXCR4, proangiogenic factors and steroidogenic enzymes. Ewes receiving hCG had more CL and greater serum P4, which remained elevated. On day 25, StAR protein production decreased in CL from hCG-treated ewes while HSD3B1 was unchanged; further, expression of CXCR4 significantly increased and KDR tended to increase.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Sex Steroids Regulate Skin Pigmentation Through Nonclassical
    RESEARCH ARTICLE Sex steroids regulate skin pigmentation through nonclassical membrane-bound receptors Christopher A Natale1, Elizabeth K Duperret1, Junqian Zhang1, Rochelle Sadeghi1, Ankit Dahal1, Kevin Tyler O’Brien2, Rosa Cookson2, Jeffrey D Winkler2, Todd W Ridky1* 1Department of Dermatology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, United States; 2Department of Chemistry, University of Pennsylvania, Philadelphia, United States Abstract The association between pregnancy and altered cutaneous pigmentation has been documented for over two millennia, suggesting that sex hormones play a role in regulating epidermal melanocyte (MC) homeostasis. Here we show that physiologic estrogen (17b-estradiol) and progesterone reciprocally regulate melanin synthesis. This is intriguing given that we also show that normal primary human MCs lack classical estrogen or progesterone receptors (ER or PR). Utilizing both genetic and pharmacologic approaches, we establish that sex steroid effects on human pigment synthesis are mediated by the membrane-bound, steroid hormone receptors G protein-coupled estrogen receptor (GPER), and progestin and adipoQ receptor 7 (PAQR7). Activity of these receptors was activated or inhibited by synthetic estrogen or progesterone analogs that do not bind to ER or PR. As safe and effective treatment options for skin pigmentation disorders are limited, these specific GPER and PAQR7 ligands may represent a novel class of therapeutics. DOI: 10.7554/eLife.15104.001 *For correspondence: ridky@mail.
    [Show full text]
  • WO 2013/184908 A2 12 December 2013 (12.12.2013) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2013/184908 A2 12 December 2013 (12.12.2013) P O P C T (51) International Patent Classification: Jr.; One Procter & Gamble Plaza, Cincinnati, Ohio 45202 G06F 19/00 (201 1.01) (US). HOWARD, Brian, Wilson; One Procter & Gamble Plaza, Cincinnati, Ohio 45202 (US). (21) International Application Number: PCT/US20 13/044497 (74) Agents: GUFFEY, Timothy, B. et al; c/o The Procter & Gamble Company, Global Patent Services, 299 East 6th (22) Date: International Filing Street, Sycamore Building, 4th Floor, Cincinnati, Ohio 6 June 2013 (06.06.2013) 45202 (US). (25) Filing Language: English (81) Designated States (unless otherwise indicated, for every (26) Publication Language: English kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, (30) Priority Data: BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, 61/656,218 6 June 2012 (06.06.2012) US DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, (71) Applicant: THE PROCTER & GAMBLE COMPANY HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KN, KP, KR, [US/US]; One Procter & Gamble Plaza, Cincinnati, Ohio KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, 45202 (US). MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, (72) Inventors: XU, Jun; One Procter & Gamble Plaza, Cincin SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, nati, Ohio 45202 (US).
    [Show full text]