sign in sign up
<<
Home , Oxytocin, Secretin, Vasopressin

as a neurohypophysial factor regulating

Jessica Y. S. Chua, Leo T. O. Leea,C.H.Laib, H. Vaudryc, Y. S. Chanb, W. H. Yungd, and Billy K. C. Chowa,1

aSchool of Biological Sciences and bDepartment of and Research Centre of , , and Healthy Aging, University of Hong Kong, Hong Kong, China; cInstitut National de la Sante´et de la Recherche Me´dicale Unite´413, Laboratory of Cellular and Molecular , University of Rouen, 76821 Mont-Saint-Aignan, France; and dDepartment of Physiology, Chinese University of Hong Kong, Hong Kong, China

Edited by Roger Guillemin, The Salk Institute for Biological Studies, La Jolla, CA, and approved July 30, 2009 (received for review April 5, 2009) Hypothalamic magnocellular express either one of the neu- ng/g of in the rat pituitary. Consistent with previous rohypophysial , or , along with differ- findings that showed a high concentration of SCT in the neu- ent or neuromodulators. Axonal terminals of these rointermediate lobe of pituitary (7), the current study revealed neurons are generally accepted to release solely the two hormones intense IR signals for both SCT and its (SCTR) almost but not others into the circulation. Here, we show that secretin, exclusively in the posterior lobe (Fig. 1A), where they were originally isolated from upper intestinal mucosal extract, is present distributed evenly throughout the neuronal fibers with SCT-IR throughout the hypothalamo–neurohypophysial axis and that it is enriched in and axonal terminals but not in released from the under plasma hyperosmolality pituicytes. In the , abundant SCT and SCTR were conditions. In the hypothalamus, it stimulates vasopressin expression detected primarily in the PVN and SON by both in situ hybrid- and release. Considering these findings together with our previous ization and immunohistochemical staining (Fig. 1B). These findings that show a direct effect of secretin on renal water reab- findings are in agreement with previous studies showing distinct sorption, we propose here that secretin works at multiple levels in the localization of SCT-IR to the PVN and SON and intercalated hypothalamus, pituitary, and to regulate water homeostasis. hypothalamic nuclei (8) and binding of 125I-SCT to hypothalamic Findings presented here challenge previous understanding regarding homogenate (9). Additionally, SCT-IR was found throughout the neurohypophysis and could provide new concepts in treating the hypothalamo–neurohypophysial tracts. Within SON, SCT disorders related to . and SCTR were found to be present in the magnocellular PHYSIOLOGY neurons (Ͼ20 ␮m) and in the varicose or beaded fibers located hypothalamic–pituitary axis ͉ osmoregulation ͉ vasopressin in the ventral position of the nucleus, whereas within the PVN high proportions of large (Ͼ20 ␮m) and small (Ͻ20 ␮m) neurons he pituitary is essential for life. It consists of adenohypoph- were shown to express SCT and SCTR. The latter findings Tysis and neurohypophysis and is responsible for the release indicated that SCT and SCTR are expressed in both parvocel- of hormones that regulate all major body functions, including lular and magnocellular subdivisions of the PVN. water homeostasis, , growth, development, and To investigate the potential activity of SCT within the hypo- . Currently, only two nonapeptide hormones, va- , the expression of the immediate early Fos protein, sopressin (Vp) and oxytocin (Oxt), are widely accepted to be which is a well-established marker to identify activated neurons released from the neurohypophysis. The two differ by in the autonomous and central nervous system after chemical, a single substitution and are synthesized within the mechanical, or sensory stimuli, was examined1hafterintrace- magnocellular neurosecretory cells in the paraventricular nu- rebroventricular (ICV) injection of SCT. Fig. 2A shows the cleus (PVN) and (SON). Oxytocin is best effects of SCT on activating Fos-IR in the rat hypothalamus known for its role in parturition and , whereas Vp is compared with that of the saline control. In control rats treated with isotonic saline, in agreement with Pirnik et al. (10), Chang critical to water conservation in the renal collecting ducts via et al. (11), and Kobelt et al. (12), no Fos signal was found in translocation and expression of -2 (AQP2). In addition neither the PVN nor the SON. In SCT-injected rats, however, to Vp, many studies have indicated the presence of Vp- Fos-IR was detected over the whole areas of the PVN and SON. independent mechanisms in the kidney. In isolated collecting The Fos signals were found only in the nuclei of certain duct segments, Jeon et al. (1) found that the highest plasma magnocellular neurons in the PVN and SON, thereby suggesting concentration of Vp (10 pM) under severe dehydration could a regulated and differential response to SCT among individual increase osmotic water permeability to only 44% of the maximal magnocellular cells. value. Our group has shown recently that secretin (SCT), a hormone that modulates water and transport in SCT Induces Vp Expression and Its from the Hypo- pancreatic (2), (3, 4), and thalamo–Pituitary Axis. To identify the downstream mechanism of epididymal epithelial cells (5), is part of the Vp-independent SCT, double-immunofluorescent labeling of Fos with either Vp mechanisms in regulating renal water (6). Because or Oxt was performed (Fig. 2B). Up-regulation of Fos was we observed changes in plasma SCT levels during chronic observed in the cytoplasm of both Vp- and Oxt-expressing hyperosmolality and the presence of intense SCT-immunoreac- neurons, whereas Fos protein was detected only within the nuclei tivity (IR) signals in the posterior pituitary, the present study of vasopressinergic neurons but not in the nuclei of oxytocinergic intended to investigate a putative role of SCT as a pituitary neurons. Expression of this immediate early gene in magnocel- hormone in the hypothalamo–neurohypophysial system, a cen- lular cells has been shown already to link various physiological tral integrative structure that regulates coordinated responses to perturbations in water balance and osmotic stability. Author contributions: J.Y.S.C., L.T.O.L., H.V., Y.S.C., W.H.Y., and B.K.C.C. designed research; Results and Discussion J.Y.S.C. performed research; L.T.O.L., C.H.L., Y.S.C., W.H.Y., and B.K.C.C. contributed new Secretin Induces Expression of the Immediate Early Gene c-fos in the reagents/analytic tools; J.Y.S.C. analyzed data; and J.Y.S.C. and B.K.C.C. wrote the paper. Vasopressinergic Neurons of the Hypothalamic PVN and SON. The The authors declare no conflict of interest. concentrations of SCT and Vp were 122 Ϯ 6 and 142 Ϯ 35 ng/g This article is a PNAS Direct Submission. of protein in the rat hypothalamus and 799 Ϯ 87 and 4,684 Ϯ 426 1To whom correspondence should be addressed. E-mail: [email protected].

www.pnas.org͞cgi͞doi͞10.1073͞pnas.0903695106 PNAS Early Edition ͉ 1of6 Downloaded by guest on October 1, 2021 Fig. 1. Cellular distribution of secretin (SCT) and SCT receptor (SCTR) in the hypothalamus and pituitary. (Ai) SCT and SCTR immunoreactivity (IR) in a panoramic view of the pituitary. Both SCT and SCTR were shown to localize almost exclusively in the pars nervosa but not in the pars distalis and pars intermedia of the adenohypophysis. Negative controls (SCT-1 and SCT-2) were performed using primary SCT antiserum preabsorbed with 0.1 mM SCT and pituitary andenylate cyclase-activating polypeptide (PACAP), respectively. SCTR-1, primary SCTR antiserum preabsorbed with 0.1 mM immunizing ; SCTR-2, prebleed rabbit serum as primary antiserum; PN, pars nervosa; PI, pars intermedia; PD, pars distalis. (Aii) Bright-field photomicrograph of a rat pituitary section labeled with anti-SCT antiserum. SCT-IR is shown in brown against a blue background of hematoxylin staining. Note that intensely stained structures of various sizes (arrows) are present in the neurohypophysis, representing dilations of the formally known as Herring bodies. Negative controls as in A1 were not shown. (B1 and B2) Localization of SCT and SCTR in the paraventricular nucleus (PVN) and supraoptic nucleus (SON). (Bi) SCTR-IR was observed in the soma of magnocellular neurons, whereas SCT-IR was found in both the soma and the axonal projections (arrow) of the parvocellular and magnocellular neurons. (Bii) In situ hybridization showing the presence of SCT and SCTR transcripts within the PVN and SON. The riboprobes for SCT and SCTR were made reverse and complementary to sequences corresponding to base pairs 34–488 of the rat SCT (GenBank accession no. NM࿝022670) and 211–639 that encode the N-terminal extracellular region of the rat SCTR (GenBank accession no. NM࿝031115) cDNAs, respectively. (Biii) Localization of SCT in the hypothalamo–neurohypophysial tracts. The SCT-containing were shown to project laterally from the PVN and run inferiorly above and below the fornix toward the SON. Processes from the SON then cross ventrally to these axonal tracts from the PVN and continue medially along the basal of hypothalamus to the .

stimulations to Vp (13–15). Thus, we hypothe- right jugular vein (Fig. 2Dii). The plasma Vp levels in SCT- sized that SCT could stimulate Vp expression via the cAMP/ treated rats reached 3.78-fold within 30 min compared with (PKA)/Fos pathway. To test this hypothesis, those at time 0 or before peptide injection. Note also that Vp ICV injection of SCT coupled to laser capture microdissection levels of control animals remained relatively constant through- and real-time PCR (Fig. 2C) was performed. The ICV-SCT out the sampling period, indicating that the observed changes in markedly up-regulated Vp transcript levels in the PVN and SON Vp levels were not due to acute hypovolemia nor the experi- (64.1 Ϯ 13.5-fold in PVN and 51.9 Ϯ 17.6-fold in SON) and to mental procedure. Because SCT could not induce Vp release a lesser extent Oxt expression (5.9 Ϯ 1.9-fold in PVN and 1.7 Ϯ from isolated pituitary (Fig. 2Diii), SCT therefore should stim- 0.5-fold in SON). Neurons residing in the PVN were found to be ulate Vp release into the circulation via direct modulation of the more responsive than those in the SON to SCT . We activity of vasopressinergic neurons at the hypothalamus rather next tested whether SCT could modulate locally the release of than at their axonal terminals in the neurohypophysis. Thus, the Vp from and within the hypothalamo–neurohypophysial axis stimulatory effect of SCT on Vp release appears to require the (Fig. 2D). Our in vitro data indicated that Vp is spontaneously integrity of the hypothalamo–neurohypophysial structure. released from hypothalamic and pituitary explants (0.031 Ϯ 0.0005 and 0.967 Ϯ 0.041 ng/mL from hypothalamic and pituitary SCT Is a Neurosecretory Hormone Released from the Posterior Pitu- explants, respectively), and 100 nM SCT could increase markedly itary into the Systemic Circulation in Response to Hyperosmolality. To Vp release from the hypothalamic explants, reaching 0.131 Ϯ extend our previous study showing the function of SCT in 0.02 ng/mL after 5 min of incubation (Fig. 2Di). This effect was regulating water reabsorption in kidney tubules (6), we moni- SCT-specific and PKA-dependent, because coincubation of the tored changes in the expression of SCT and SCTR in response antagonist secretin (5–27) (1 ␮M) or PKA inhibitor H89 (5 ␮M) to an increase in by dehydration (Fig. 3A). The could reduce significantly the SCT-evoked Vp release. In in vivo basal hypothalamic SCT and Vp mRNA levels in ad libitum studies, ICV administration of SCT (0.45 ␮g) was able to animals were 1.42 Ϯ 0.13 and 8.34 Ϯ 0.27 fmol/hypothalamus, increase Vp concentrations in blood samples collected from the respectively. After 3 days of water deprivation, which should

2of6 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0903695106 Chu et al. Downloaded by guest on October 1, 2021 cause chronic hypovolemia (16, 17), SCT and SCTR expression levels were elevated significantly in the hypothalamus and pitu- itary (SCT, 1.58 Ϯ 0.11-fold in hypothalamus and 3.74 Ϯ 1.05-fold in pituitary; SCTR, 1.95 Ϯ 0.20-fold in hypothalamus and 3.10 Ϯ 0.55-fold in pituitary). These data, together with SCT’s effects in augmenting Vp synthesis and release (Fig. 2 C and D), implicated the importance of SCT in contributing to a sustained elevation of Vp levels during extended periods of hyperosmolality or during dehydration. Because we also observed changes in plasma SCT levels in mice under water deprivation (6), the effects of chronic hyper- osmolality on plasma SCT levels in rats therefore were moni- tored. This was accomplished by subjecting rats to 4 days of restricted water access or 5 days of 0.9% saline consumption, both of which are well-established dehydration paradigms to promote persistent secretion of Vp (16). In our study, the basal levels of SCT and Vp in plasma were 0.074 Ϯ 0.004 and 0.116 Ϯ 0.008 ng/mL, respectively. During chronic hyperosmolality, plasma SCT concentrations also were elevated, reaching 0.554 Ϯ 0.092 ng/mL on the fourth day of water restriction and 0.733 Ϯ 0.056 ng/mL on the fifth day of saline consumption (Fig. 3B). Although our data do not exclude that changes in plasma SCT levels could be caused by inherent in the dehydration paradigms, we showed here that SCT is released from its source into the circulation in chronic hyperosmotic conditions. All of the data presented in this work support the notion that SCT could be released from the neurohypophysis into peripheral circulation under various physiological conditions. We therefore PHYSIOLOGY used Kϩ (80 mM) as a depolarizing and measured in vitro release of SCT from pituitary explants. Similar to Vp, SCT also is released spontaneously from the pituitary explants, albeit its basal level is approximately one order of magnitude lower than that of Vp (Vp, 0.967 Ϯ 0.041 ng/mL; SCT, 0.142 Ϯ 0.011 ng/mL). Exposure of pituitary explants to 80 mM Kϩ signifi- cantly evoked SCT release (Fig. 3 Ci and Cii; 0.468 Ϯ 0.043 ng/mL; Ϸ3.29-fold vs. basal release), which was abolished in the presence of the channel blocker TTX (0.76 Ϯ 0.03-fold vs. basal release), indicating that it is action-potential-dependent (Fig. 3Cii). The release of SCT is also high-voltage-gated (HVA) -channel-dependent since only cadmium (Cd2ϩ, 1.28 Ϯ 0.11-fold vs. basal) but not nickel (Ni2ϩ, 3.33 Ϯ 0.34-fold vs. basal) was able to block it. To characterize further the Ca2ϩ channel subtypes (L-, N-, P-, or Q-type) that are involved in this process, specific HVA blockers were used (Fig. 3C2). Applica- tion of R-type SNX-482 (30 nM) had no Fig. 2. Hypothalamic neuronal activation after secretin (SCT) treatment. Ϯ (A) Fos-IR in the rat paraventricular nucleus (PVN) and supraoptic nucleus effect (3.29 0.1-fold vs. basal), showing that SCT release from (SON) 1 h after intracerebroventricular administration of vehicle (C) or SCT. the pituitary does not depend on the R-type HVA channel. Low levels of Fos-IR were observed in the PVN and SON after saline injection However, significant inhibitions were observed in the presence (C). Injection of 0.45 ␮g of SCT, however, induced Fos expression in mag- of the P-type channel blocker ␻-Agatoxin IVA (1.56 Ϯ 0.18-fold nocellular neurons of both the PVN and the SON. 3V, third ventricle. (B) vs. basal, a 52.6% blockage, P Ͻ 0.01), the L-type channel Localization of SCT-induced Fos (F) in Vp- and Oxt-containing magnocel- blocker nicardipine (1.77 Ϯ 0.21-fold vs. basal, a 46.2% blockage, lular neurons. Fos-IR was observed in the nuclei of Vp-expressing cells P Ͻ 0.01), and the N-type channel blocker ␻-conotoxin GVIA (arrows). M, merged image. (C) Secretin-induced changes in Vp and Oxt (2.08 Ϯ 0.21-fold vs. basal, 36.8% blockage, P Ͻ 0.05). In gene expression in the rat hypothalamic PVN and SON. Values are shown as summary, L-, N-, and P-type HVA channels are involved in the means Ϯ SEM fold changes compared with expression levels of Vp or Oxt in ϩ control animals (PBS-infused control group, n ϭ 3; SCT-infused group, n ϭ K -evoked secretin release from the rat pituitary. 4). (D) Effects of SCT on the release of Vp in vitro and in vivo. (Di) SCT After in vitro studies, we next sought to establish in vivo stimulates Vp release from rat hypothalamic explants. This effect is specific release of SCT from the pituitary by electrical stimulation of to SCT and is mediated via a PKA-dependent pathway, because it was PVN followed by monitoring SCT concentrations from plasma abrogated in the presence of the SCT antagonist secretin-(5–27) or the PKA samples collected from the jugular vein. As illustrated in Fig. 3D, inhibitor H89. After a 40-min preequilibrium period and two 5-min incu- we found that direct stimulation of the PVN with either a single bations (10 and 5 min) in normal artificial cerebrospinal fluid (ACSF) (Fig. 3Dii; 0.1-ms pulses at 50 Hz for a duration of 10 s, 200 ␮A) medium to determine basal release, the explants in treatment group were or repeated monopolar pulses (Fig. 3Di; 100–500 ␮A, 0.1-ms stimulated with 100 nM SCT (5 and 10 min). For the control, explants were pulses at 50 Hz, 10 s on, 10 s off, for 2 min) could evoke release incubated in ACSF solution at all time points. (Dii) Centrally injected SCT triggers Vp release into peripheral circulation by sampling blood from the of SCT into systemic circulation, when compared with control right jugular vein. The Vp levels after SCT injection were compared with the animals with no electrical stimulation. This release of SCT was baseline level at time 0, *, P Ͻ 0.01. (Diii) SCT is not able to trigger Vp release observed only when the PVN area was stimulated but not in from rat pituitary explants. Experimental conditions were the same as other positions (data not shown). Positions of the probe and the those in Di. site of stimulation were confirmed by a marked increase in blood

Chu et al. PNAS Early Edition ͉ 3of6 Downloaded by guest on October 1, 2021 Fig. 3. Up-regulation and release of SCT in or from the hypothalamo–neurohypophysial axis during plasma hyperosmolality. (A) Up-regulation of SCT and SCTR expression in the hypothalamus and pituitary after water deprivation. Data are presented as means Ϯ SEM. Asterisks indicate statistically significant differences (P Ͻ 0.05) when the water-deprived animals were compared with control animals. (B) Effects of chronic hyperosmolality on daily plasma SCT levels. Tap water was available ad libitum to the control group, whereas restricted water access or 0.9% saline was given to the treatment group. Blood was withdrawn daily from the tail to prepare plasma for the measurement of SCT using a rat SCT immunoassay kit (n ϭ 6–9). *, P Ͻ 0.05 and **, P Ͻ 0.01 vs. basal value. (C) Release of SCT from rat pituitaries in response to depolarization with 80 mM Kϩ.(Ci) Neuronal depolarization triggers SCT release from pituitary explants. After a 40-min preequilibrium period and two 5-min incubations (10 and 5 min) in normal artificial cerebrospinal fluid (ACSF) medium to determine basal release, the explants in the treatment group were stimulated for 5 min with 80 mM Kϩ. Control experiments were performed without Kϩ treatment. Basal release was found to be relatively constant over time. (Cii) Action-potential- and Ca2ϩ-mediated release of SCT from the pituitary. Outflow of SCT from pituitary explants was evoked ϩ by 80 mM K alone or in the presence of toxin or channel blocker. The toxins used were 1 ␮M TTX, 100 ␮M high-voltage-activated calcium channel blocker CdCl2 2ϩ 2ϩ (Cd ), 100 ␮M low-voltage-activated calcium channel blocker NiCl2 (Ni ), 90 nM ␻-agatoxin IVA (␻-Aga), 5 ␮M nicardipine, 300 nM Q-type calcium channel blocker ␻-conotoxin MVIIC (MVIIC), 100 nM ␻-conotoxin GVIA (GVIA), and 30 nM SNX-482. Results are presented in mean fold changes Ϯ SEM of three to five determinations each in triplicate. Comparison of treated groups and controls was based on ANOVA for multiple comparisons followed by the Student–Newman– ϩ Keuls test. *, P Ͻ 0.05 and **, P Ͻ 0.01 vs. basal SCT outflow; *, P Ͻ 0.05 and **, P Ͻ 0.01 vs. K -evoked SCT outflow. (D) Secretin levels in circulation upon stimulation of the PVN. (Di) Blood samples (150 ␮L) were collected for a duration of 5 min from the jugular vein through an indwelling catheter after 2 min of repeated monopolar pulse stimulation at various current intensities (0.1-ms pulses at 50 Hz, 10 s on, 10 s off, 100–500 ␮A). (Dii) Blood samples (150 ␮L) were collected every 4 min from the jugular vein from 12 min before to 44 min (4-min interval) after a 200-␮A monopolar pulse stimulation (indicated with an arrow; 0.1-ms pulses at 50 Hz, 10 s) of the PVN. *, P Ͻ 0.05; **, P Ͻ 0.01.

pressure upon stimulation (18) and by histological examination after water deprivation. Plasma SCT levels were found to be after the experiments. In summary, our data indicated that unaltered in hypophysectomized rats under such conditions chronic hyperosmolality could lead to the release of SCT from (0.073 Ϯ 0.002 and 0.083 Ϯ 0.024 ng/mL before and after 18 h the posterior pituitary into systemic circulation by activating water deprivation, respectively; P Ͼ 0.5; n ϭ 20), again indicating magnocellular neurons in the PVN of the hypothalamus. that the source of elevated SCT during chronic hyperosmolaltity To confirm that SCT is a neurosecretory factor, plasma SCT was the pituitary. Taken together, these observations not just levels were monitored in hypophysectomized rats before and confirm the potential of secretin as a posterior pituitary hor- mone but also provide explanations to abnormalities underlying type D syndrome of inappropriate antidiuresis (SIADH). In Table 1. Oligonucleotides used in this study these patients, Vp release and response are normal, although abnormal renal expression, translocation of AQP2, or both were Name Sequence (5Ј 3 3Ј) found (19). Secretin as a neurosecretory hormone from the rGAPDH-F ATGACTCTACCCACGGCAAG posterior pituitary, therefore, could be the long-sought Vp- rGAPDH-R CTGGAAGATGGTGATGGGTT independent mechanism to solve the riddle that has puzzled rSCT-F GCCCGTCCCAAGCCATTAG clinicians and physiologists for decades. Finally, as a neurose- rSCT-R ATGGTCGACAGCAGGCCTTGGT cretory hormone released from the posterior pituitary, future rSCTR-F CAGAACGCAAAGGGGAGCAACAGTG studies of SCT should provide a new target for prevention or rSCTR-R TGAGTTTCAGCAGGTACGCATGCCG therapeutic intervention for disorders, particularly SIADH, of rVP-F GCAAGAGGGCCACATCCGACAT body water homeostasis. rVP-R TCGGCCACGCAGCTCTCATC rOXT-F AAGAGGGCTGCGCTAGACCT Materials and Methods rOXT-R CTCGGAGAAGGCAGACTCAG ICV Cannulation and Drug Administration. A 30-gauge stainless steel guide cannula was placed into the lateral ventricle as described in refs. 20 and 21.

4of6 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0903695106 Chu et al. Downloaded by guest on October 1, 2021 Animals were allowed to recover for 4 days before peptide injection. Rat SCT buffer (except that salmon DNA concentration was reduced to 60 peptide was purchased from Bachem. ␮g/mL) supplemented with 10 mM DTT, 10% dextran sulfate, and 600 pg of heat-denatured RNA riboprobes. Posthybridization treatment and incubation Electrical Stimulation of the PVN. The femoral artery and the jugular vein were with anti-digoxigenin antibody conjugated to alkaline phosphatase (Roche cannulated for systolic blood pressure measurement and blood sampling, Diagnostics) were conducted as described in ref. 25. respectively, before the placement of a double-barreled micropipette [one barrel of which was filled with Woods metal connected to a constant-current Immunohistochemical Staining. Immunohistochemical staining was performed Ј stimulator driven by a stimulus generator (World Precision Instruments); the as described earlier in ref. 6 and visualized by immunoperoxidase–3,3 - other barrel was filled with Pontamine sky blue] into the PVN [1.5–1.8 mm diaminobenzidine staining using the SuperPicTure polymer detection kit posterior to bregma, 0.4–0.7 mm lateral to the midline, 7.5–8.0 mm from the (Zymed Laboratories, Invitrogen Life Technologies). Fluorescence signals were surface of the brain (22)]. In control experiments, the stimulating electrode captured using the Leica Quantimet 570 computerized image analysis system. The antibodies used were rabbit anti-Fos (1:280 dilution; Santa Cruz Biotech- was positioned at a site lateral to the PVN. Positioning of the probe at the PVN nology), rabbit anti-SCT (1:250 dilution; Phoenix Pharmaceuticals), rabbit (18) was established initially by an observed increase in systolic blood pressure anti-SCTR [1:200 dilution (5, 6)], goat antiserum against Oxt or Vp (1:250 and upon electrical stimulation (0.1-ms pulses at 50 Hz for a duration of 10 s, 200 1:400 dilution, respectively; Santa Cruz Biotechnology), Alexa Fluor 594 don- ␮A). The indifferent electrode was an alligator clip attached to occipital key anti-goat IgG (1:500 dilution; Molecular Probes, Invitrogen), and Alexa muscle. The animal was allowed to rest for 45 min before repeated monopolar Fluor 488 chicken anti-rabbit IgG (1:500 dilution; Molecular Probes). ␮ pulses with different intensities (100–500 A) were applied (0.1-ms pulses at To assess whether the Fos antibody is specifically reactive to Fos protein 50 Hz, 10 s on, 10 s off) for 2 min. Blood samples (5 min in duration) were expressed in rat PVN, an ECL Western blot analysis system (Amersham) was collected immediately before and after electrical stimulation through the used. A single band was obtained at Ϸ55 kDa. attached polyethylene tubing (PE-50, 0.58 mm i.d. ϫ 0.965 mm o.d., Becton Dickinson). For the continual blood sampling study, a current intensity of 200 Laser Capture Microdissection. Eight-micrometer sections of frozen brain ␮ A was selected for single monopolar pulse stimulation (0.1-ms pulses at 50 tissues were fixed in ice-cold methanol and then prestained with hematoxylin ␮ Hz, 10 s). Blood samples (150 L of each) were collected from a time of 12 min under RNase-free conditions for histological identification of the specific Ϸ at 4-min intervals for 1 h. The maximum duration for blood sampling of each hypothalamic nucleus of interest. After complete dehydration, sections were experimental animal was adjusted according to their total permissible sample microdissected using a Pixcell IIe laser capture microdissection system with an volume based on the equation developed by the National Institute— infrared diode laser (Arcturus) and high-sensitivity caps (CapSure LCM Caps). Frederick Animal Care and Use Committee [volume (mL) ϭ 0.0091 ϫ animal’s Ͻ body weight (g)], which is 13% of the circulating . At the end RNA Extraction, First-Strand cDNA Synthesis, and Real-Time PCR. RNA extrac- of the experiment, the stimulation site was verified histologically. tion and first-strand cDNA synthesis were performed as described earlier in

ref. 5, whereas the expression levels of various were measured by PHYSIOLOGY Hypophysectomy. The anterior and posterior lobes of the pituitary were real-time PCR using the SYBR Green PCR kit (Applied Biosystems) as described removed by suction using a parapharyngeal approach (23). The aspirated in ref. 6. anterior and posterior pituitaries were examined to confirm the completeness of hypophysectomy. For sham hypophysectomy, the same procedure was Drugs. The porcine SCT antagonist secretin-(5–27) was purchased from performed, except that the pituitary was not aspirated. The incision was Bachem. The PKA inhibitor H89, sodium channel blocker TTX, Q-type calcium closed with a suture, and analgesia was provided as needed based on clinical channel blocker ␻-conotoxin MVIIC, and R-type calcium channel blocker SNX- observations of pain or distress. 482 were purchased from Alomone Labs. The polypeptide toxin for the N-type calcium channel, ␻-conotoxin GVIA, was purchased from Tocris. The P-type ␻ Peptide Release Experiments. Immediately after decapitation, the hypothal- calcium channel blocker -agatoxin IVA from Agelenopsis aperta used in this amus and pituitary were dissected out quickly. Peptide release experiments study was the synthetic version purchased from Calbiochem. All other chem- were performed as described in ref. 24. The concentration of the target icals and the L-type calcium channel blocker nicardipine used in the peptide peptide was measured using rat SCT and Vp enzyme immunoassay kits (Phoe- release experiment were purchased from Sigma. nix Pharmaceuticals). Statistical Analysis. For quantitative real-time PCR analysis, data are shown as the means Ϯ SEM from at least three independent experiments, each in In Situ Hybridization. Sense and antisense riboprobes for rat SCT and SCTR were triplicate. All data were analyzed by one-way ANOVA and followed by a generated from their respective partial cDNA clone containing pBlueScript Dunnett’s test using the computer software PRISM (version 3.0; GraphPad). KSϩ using a digoxigenin RNA labeling Kit (Roche Diagnostics). Coronal brain sections were rehydrated, treated with proteinase K, and then acetylated ACKNOWLEDGMENTS. We are grateful to Simon S. M. Chan for his excellent before incubation at 50 °C for 1 h with prehybridization buffer (pH 7.5) technical assistance in the in vivo stimulation experiments. This work was ⅐ ϫ containing 50% formamide, 0.6 M NaCl, 10 mM Tris HCl, 1.3 Denhardt’s supported by Hong Kong government Research Grants Council Grants solution, 1 mM EDTA, 550 ␮g/mL denatured salmon sperm DNA, and 50 ␮g/mL HKU7501/05M, HKU7384/04M, and GRF763809 (to B.K.C.C.), GRF768608 (to yeast tRNA. Hybridization was conducted overnight at 50 °C in the same L.T.O.L.), and F-HK31/07T (to H.V. and B.K.C.C.).

1. Jeon US, et al. (2003) Oxytocin induces apical and basolateral redistribution of aqua- 10. Pirnik Z, Mravec B, Kiss A (2004) Fos protein expression in mouse hypothalamic porin-2 in rat kidney. Exp Nephrol 93:e36–e45. paraventricular (PVN) and supraoptic (SON) nuclei upon osmotic stimulus: Colocal- ϩ Ϫ 2. Villanger O, Veel T, Raeder MG (1995) Secretin causes H /HCO3 secretion from ization with vasopressin, oxytocin, and hydroxylase. Neurochem Int pancreatic ductules by vacuolar-type Hϩ- triphosphatase. Gastroenterology 45:597–607. 108:850–859. 11. Chang GQ, et al. (2004) Circulating triglycerides impact on orexigenic peptides and 3. Marinelli RA, Pham L, Agre P, LaRusso NF (1997) Secretin promotes osmotic water neuronal activity in hypothalamus. 145:3904–3912. transport in rat cholangiocytes by increasing aquaporin-1 water channels in plasma 12. Kobelt P, et al. (2004) Two immunocytochemical protocols for immunofluorescent membrane. Evidence for a secretin-induced vesicular translocation of aquaporin-1. detection of c-Fos positive neurons in the rat brain. Brain Res Brain Res Protoc J Biol Chem 272:12984–12988. 13:45–52. 4. Tietz PS, et al. (2003) -induced coordinated trafficking of functionally 13. Da Costa AP, De La Riva C, Guevara-Guzman R, Kendrick KM (1999) C-fos and c-jun related transport for water and ions in cholangiocytes. J Biol Chem in the paraventricular nucleus play a role in regulating peptide gene expression, 278:20413–20419. oxytocin and glutamate release, and maternal behaviour. Eur J Neurosci 11:2199– 5. Chow BK, et al. (2004) Secretin controls anion secretion in the rat in an 2210. autocrine/paracrine fashion. Biol Reprod 70:1594–1599. 14. Wong LF, Harding T, Uney J, Murphy D (2003) cAMP-dependent protein kinase A 6. Chu JY, et al. (2007) Phenotypes developed in -null mice indicated mediation of vasopressin gene expression in the hypothalamus of the osmotically a role of secretin in regulating renal water reabsorption. Mol Cell Biol 27:2499– challenged rat. Mol Cell Neurosci 24:82–90. 2511. 15. Penny ML, et al. (2005) The effects of osmotic stimulation and water availability on 7. Charlton CG, et al. (1982) Secretin in the rat hypothalamo-pituitary system: Localiza- c-Fos and FosB staining in the supraoptic and paraventricular nuclei of the hypothal- tion, identification and characterization. Peptides 3:565–567. amus. Exp Neurol 194:191–202. 8. Welch MG, et al. (2004) Secretin: Hypothalamic distribution and hypothesized neuro- 16. Kondo N, et al. (2004) Osmoregulation of vasopressin release and gene transcription regulatory role in . Cell Mol Neurobiol 24:219–241. under acute and chronic hypovolemia in rats. Am J Physiol 286:E337–E346. 9. Fremeau RT, Jr, et al. (1983) Secretin: Specific binding to rat brain membranes. 17. Klemfuss H, Seiden LS (1985) Water deprivation increases anterior hypothalamic J Neurosci 3:1620–1625. metabolism in the rat. Brain Res 341:222–227.

Chu et al. PNAS Early Edition ͉ 5of6 Downloaded by guest on October 1, 2021 18. Landgraf R, et al. (1990) Release of vasopressin and oxytocin by paraventricular 22. Paxinos G, Watson C (1986) The Rat Brain in Stereotaxic Coordinates (Academic, stimulation in rats. Am J Physiol 258:R155–R159. Sydney). 19. Multz AS (2007) Vasopressin dysregulation and in hospitalized patients. 23. Thorngren KG, Hansson LI, Menander-Sellman K, Stenstrom A (1973) Effect of J Intensive Care Med 22:216–223. hypophysectomy on longitudinal bone growth in the rat. Calcif Res 11:281– 20. Turner CA, et al. (2008) -like effects of intracerebroventricular FGF2 in 300. rats. Brain Res 1224:63–68. 24. Chu JY, Yung WH, Chow BK (2006) Endogenous release of secretin from the hypothal- 21. Jing W, et al. (2009) vasopressin prevents amyloid beta protein-induced amus. Ann N Y Acad Sci 1070:196–200. impairment of long-term potentiation in rat hippocampus in vivo. Neurosci Lett 25. Siu FK, Sham MH, Chow BK (2006) The prenatal expression of secretin receptor. Ann N 450:306–310. Y Acad Sci 1070:561–565.

6of6 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0903695106 Chu et al. Downloaded by guest on October 1, 2021