Hyaluronic Acid Synthase-1 Expression Regulates Bladder

Research Article

Hyaluronic Acid Synthase-1 Expression Regulates Bladder Cancer Growth, Invasion, and Angiogenesis through CD44 Roozbeh Golshani,1 Luis Lopez,2 Veronica Estrella,2 Mario Kramer,2 Naoko Iida,2 and Vinata B.Lokeshwar 1,2,3

Departments of 1Cell Biology and Anatomy and 2Urology and 3Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, Florida

Abstract and HAase levels correlate with levels in tissues (14). We have also shown that tumor-derived HAase, HYAL1, either alone or together Hyaluronic acid (HA) promotes tumor metastasis and is an with HA, serves as an independent prognostic indicator for pros- accurate diagnostic marker for bladder cancer. HA is syn- tate cancer progression (15, 16). thesized by HA synthases HAS1, HAS2, or HAS3. We have HA regulates cell adhesion, migration, and proliferation by previously shown that HAS1 expression in tumor tissues is a interacting with receptors such as CD44 and RHAMM (17–19). predictor of bladder cancer recurrence and treatment failure. It has been shown that pericellular HA produced by tumor cells In this study, we stably transfected HT1376 bladder cancer binds CD44 and induces a lipid raft-associated, signaling complex cells with HAS1-sense (HAS1-S), HAS1-antisense (HAS1-AS), containing phosphorylated ErbB2 (p-ErbB2), CD44, ezrin, phospho- or vector cDNA constructs. Whereas HAS1-S transfectants inositide 3-kinase, and chaperone molecules Hsp90 and cdc37. This produced f1.7-fold more HA than vector transfectants, HA complex is apparently necessary for promoting survival activities production was reduced by f70% in HAS1-AS transfectants. of tumor cells (20, 21). Moreover, endogenous HA produced by HAS1-AS transfectants grew 5-fold slower and were f60% less breast cancer cells induces a complex between CD44 and RHAMM, invasive than vector and HAS1-S transfectants. HAS1-AS trans- which then recruits extracellular signal-regulated kinase 1/2 in the fectants were blocked in G -M phase of the cell cycle due to 2 complex and stimulates its kinase activity (22). HA may also aid down-regulation of cyclin B1, cdc25c, and cyclin-dependent tumor cells in overcoming the contact inhibition of growth and kinase 1 levels. These transfectants were also 5- to 10-fold avoiding immune surveillance (23, 24). more apoptotic due to the activation of the Fas-Fas ligand– In tumor tissues, elevated HA levels are contributed by both mediated extrinsic pathway. HAS1-AS transfectants showed the tumor-associated stroma and tumor cells (3–16). HA synthesis a f4-fold decrease in ErbB2 phosphorylation and down- occurs at the plasma membrane by a transmembrane HA synthase regulation of CD44 variant isoforms (CD44-v3, CD44-v6, (HAS). There are three HAS isoforms, HAS1, HAS2, and HAS3, and CD44-E) both at the protein and mRNA levels. However, which synthesize HA at different catalytic rates, resulting in dif- no decrease in RHAMM levels was observed. The decrease in ferent size polymers (25–27). For example, HAS3 is catalytically CD44-v mRNA levels was not due to increased mRNA degra- more active and synthesizes smaller HA polymers (1 Â 105 to dation. Whereas CD44 small interfering RNA (siRNA) trans- 1 Â 106 Da) than HAS1 and HAS2 (2 Â 105 to 2 Â 106 Da). fection decreased cell growth and induced apoptosis in It has been shown that HAS1 and HAS2 expression increases HT1376 cells, HA addition modestly increased CD44 expres- after the malignant transformation of a rat fibroblast line, by viral sion and cell growth in HAS1-AS transfectants, which could be oncogenes, and is involved in promoting tumor growth (25). blocked by CD44 siRNA. In xenograft studies, HAS1-AS tumors Silencing of HAS2 expression decreases cell growth due to cell cycle grew 3- to 5-fold slower and had f4-fold lower microvessel arrest and inhibits cell migration (28). Coexpression of HAS2 with density. These results show that HAS1 regulates bladder HYAL1 significantly increases tumor growth than either enzyme cancer growth and progression by modulating HA synthesis alone (29). In xenograft models, HAS2 and HAS3 overexpression and HA receptor levels. [Cancer Res 2008;68(2):483–91] has been shown to increase tumor growth and invasion (28, 30–32). At the present time, not much information is available on HAS1 Introduction function in tumor cell growth, invasion, and angiogenesis either Hyaluronic acid (HA) and its degrading enzyme, hyaluronidase in vitro or in vivo. Nonetheless, when compared with HAS2 and (HAase), are intricately involved in tumor growth and metastasis. HAS3, HAS1 expression is elevated in multiple myeloma patients HA is a nonsulfated glycosaminoglycan made up of repeating (33, 34). The expression of a HAS1 splice variant (HAS1-vb) has been disaccharide units D-glucuronic acid and N-acetyl-D-glucosamine shown to correlate with survival in multiple myeloma patients (35). (1). HAase is an endoglycosidase that breaks HA into fragments, HAS1 expression in tumor tissues also serves as a prognostic indi- some of which are angiogenic (2). HA levels are elevated in many cator in many carcinomas (6, 34–37). We have shown that, in bladder tumors (3–10). We have shown that HA levels are elevated in the cancer, HAS1 mRNA and protein expression is elevated in bladder urine of bladder cancer patients and, together with urinary HAase tumor cells and tissues and correlates with a positive inference on levels, serve as an accurate diagnostic marker (11–13). Urinary HA the HA urine test. More importantly, HAS1 expression correlated with bladder tumor recurrence and response to treatment (38). We recently showed that HYAL1 expression is a molecular Requests for reprints: Vinata B. Lokeshwar, Department of Urology (M-800), determinant of bladder and prostate cancer growth, invasion, and Miller School of Medicine, University of Miami, P. O. Box 016960, Miami, FL 33101. angiogenesis (39, 40) and that the HA-HAase system seems to Phone: 305-243-6321; Fax: 305-243-6893; E-mail: [email protected]. I2008 American Association for Cancer Research. promote tumor growth and progression. Therefore, in this study, doi:10.1158/0008-5472.CAN-07-2140 we investigated HAS1 functions in bladder cancer. www.aacrjournals.org 483 Cancer Res 2008; 68: (2). January 15, 2008

Materials and Methods assay involving formaldehyde-fixed human erythrocytes as described before (40). Results were expressed as % cells with pericellular matrix F SD. Generation of HAS1 transfectants. HAS1-sense (HAS1-S), HAS1- Differences among transfectants with respect to pericellular matrix were antisense (HAS1-AS), and the vector transfectants were generated by determined using Tukey-Kramer multiple comparison test. transfecting HT1376 bladder cancer cell line with HAS1-S, HAS1-AS, and CD44 and RHAMM cell surface localization by flow cytometry. Cell vector cDNA constructs as described previously (38). The transfectants were surface labeling of HT1376 and 253J-Lung cells for CD44 (all isoforms) and selected and maintained in growth medium (RPMI 1640 + 10% fetal bovine RHAMM was carried out using mouse anti-pan-CD44 and mouse anti- serum + gentamicin) containing 3.5 Ag/mL blasticidin. 253J-Lung bladder CD168 (i.e., RHAMM) antibodies as described before (42). cancer cell line was kindly provided by Dr. Colin Dinney (The University Tumor xenografts. Transfectants (2 Â 106 cells) were s.c. implanted on of Texas M. D. Anderson Cancer Center, Houston, TX). the dorsal flank of 5-week-old mice (five animals per clone). Time for the Analysis of HA, HAase activity, and HAS1 expression. HA and HAase tumors to become palpable was noted. Tumor size was measured twice levels present in the serum-free conditioned medium (RPMI 1640 + insulin, weekly and tumor volume was calculated by approximating the tumor to an transferrin and selenium supplement + gentamicin) of transfectants were ellipsoid (39–41). At necropsy, tumors were weighed and Tukey-Kramer measured by the HA and HAase ELISA-like assays (13) and normalized to multiple comparison test was used to compare the differences in tumor cell number. Cell lysates of HT1376 transfectants were subjected to growth rate and tumor weight. immunoblot analysis using a rabbit polyclonal anti-HAS1 IgG or an anti-v5 Localization of HYAL1-v1 and microvessel density determination. monoclonal antibody (Invitrogen) as described previously (38, 41). HAS1, HA, and microvessels were localized in tumor specimens by Cell proliferation, cell cycle, and apoptosis assays. In cell prolifer- immunohistochemistry using HAS1 IgG (1:1,000 dilution), HA (1 Ag/mL), ation assay, transfectants plated on 24-well plates in growth medium + and a rat anti-mouse CD34 IgG (3.1 Ag/mL) as described previously blasticidin were counted every 24 h for 96 h. In actively growing cultures, (39–41). Microvessel density (MVD) was determined as described previously cell cycle phase distribution was estimated by propidium iodide staining (39–41). of DNA followed by flow cytometry (39–41). For the apoptosis assay, 96-h cultures of transfectants were analyzed using the Cell Death ELISA Plus kit (Roche Diagnostics). In some cell growth and apoptosis experi- Results ments, human umbilical cord HA (0–50 Ag/mL; MBL) was added. Matrigel invasion assay. Transfectants (3 Â 105 cells) were plated in the Analysis of HAS1 and HA expression in HT1376 trans- upper chamber of a Matrigel-coated Transwell (12-Am pore) plate in serum- fectants. We chose HT1376 cells as a model to test HAS1 functions free medium. The bottom chamber contained the growth medium. After because real-time RT-PCR showed that in HT1376 cells HAS1 48 h, invasion of cells in the bottom chamber was evaluated using the 3-(4,5- expression was the highest (normalized HAS1 mRNA levels: dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay (39–41). 5.4 F 0.8) followed by HAS3 (1.59 F 0.31) and HAS2 (0.81 F 0.32). Â 4 Immunoblot analysis. Cell lysates (4 10 cells) were immunoblotted We analyzed 25 to 30 stable clones of each transfectant type using anti–cyclin B1, anti–cyclin-dependent kinase 1 (cdk1), anti-cdc25c, (i.e., vector, HAS1-S, and HAS1-AS) for HA production and HAS1 anti-chk1, anti-wee1, anti–active caspase-3, anti–cleaved poly(ADP-ribose) 5 F polymerase (PARP; Asp214), anti–active caspase-9, anti-Fas, anti–Fas ligand expression. The mean HA levels (ng/10 cells) in vector (103 15.6) F (Fas-L), anti–Fas-associated death domain (FADD), anti–caspase-8, and and HAS1-S (156 20) clones were three to five times higher anti-BID antibodies as described previously (41). Cell lysates were also than in HAS1-AS (38.7 F 14.3) clones. The data on two (vector and immunoblotted using anti-RHAMM (Novocastra), pan-CD44 (Santa Cruz HAS1-S) or three (HAS1-AS) representative clones are shown here. Biotechnology), CD44 variant CD44-v3 (Alexis Biochemicals), CD44-v6, and As shown in Fig. 1A-a, HAS1-S transfectants produce 1.6-fold more CD44-v10 (Chemicon), and c-ErbB2 and p-ErbB2 (Lab Vision) mouse HA than vector transfectants and there is 70% reduction in the monoclonal antibodies. amount of HA produced by HAS1-AS transfectants. HAS1 immu- Semiquantitative reverse transcription-PCR and cloning. CD44 noblotting reveals that HAS1 expression in HAS1-S and HAS1-AS variant isoforms expressed in HT1376 transfectants were detected by transfectants mirrors HA production by these cells (Fig. 1A-b). The reverse transcription-PCR(RT-PCR)and TOPO-TA cloning (Invitrogen) as described previously (42, 43) using the primers that map in exon 5 (forward presence of v5 epitope-tagged protein only in HAS1-S transfectants primer) and exon 15 (reverse complementary primer): CD44, GCACTTCAG- confirms that the increased HAS1 expression in HAS1-S trans- GAGGTTACATC (forward) and ATCCATGAGTGGTATGGGAC (reverse). fectants is due to the expression of recombinant HAS1-v5 fusion Real-time RT-PCR. Real-time RT-PCR to measure HAS2 and HAS3 protein. mRNA levels was carried out as described previously (38) using the follow- In a breast cancer cell model, silencing of HAS2 expression led to ing primers: HAS2, 5-TGAACAAAACAGTTGCCCTTT-3 (forward), 5-TTCC- increased expression of HAS1 and HYAL1 (28). However, real-time CATCTATGACCATGACAA-3 (reverse), and FAM 5-ATCGCTGCCTATCAA- RT-PCR analyses showed that HAS2 and HAS3 expression was not GAAGATCCAGAC-3 BHQ1 (probe); HAS3, 5-CTCTACTCCCTCCTCTATAT- significantly different (P > 0.05) among vector (0.41 F 0.19; 2.2 F GTC-3 (forward), 5-AACTGCCACCCAGATGGA-3 (reverse), and FAM 5-AA- 0.26), HAS1-S (0.37 F 0.18; 1.2 F 0.21), and HAS1-AS (0.62 F 0.33; TGAGGCCAATGAAGTTCACCACAAT-3 BHQ1 (probe). For the measure- F ment of CD44 standard and CD44 variant mRNA levels, real-time PCR was 1.1 0.3) transfectants. HYAL1 expression and HAase activity were performed using the iQ SYBRGreen Supermix (Bio-Rad)and the following also not significantly different among various HAS1 transfectants primers: CD44 variant–specific primers, 5-CAGGTGGAAGAAGAGACCCAA- (data not shown). 3 (forward) and 5-GCTGAGGTCACTGGGATGAA-3 (reverse); CD44 stan- Effect of HAS1 expression on cell proliferation, cell cycle, dard–specific primers, 5-CTGTACACCCCATCCCAGAC-3 (forward) and and apoptosis. The growth rate of vector and HAS1-S trans- 5-TGTGTCTTGGTCTCTGGTAGC-3 (reverse). For normalization, h-actin fectants is comparable (doubling time, f26–28 h; Fig. 1B-a). real-time PCRwas carried out on the same samples (38). Normalized mRNA However, the HAS1-AS transfectants grow 4- to 5-fold slower DCt Â levels for each transcript were calculated as (1/2 1,000), where than vector clones (doubling time, f120 h). Similar growth DC C À C h t value = t (test mRNA) t( -actin mRNA). kinetics were obtained for the f25 clones examined in each Small interfering RNA transfection. Small interfering RNA (siRNA) transfection using the ON-TARGETplus SMARTpool siRNA against HAS1, category, and this measurement was done in conjunction with CD44, or Fas and ON-TARGETplus siCONTROL Nontargeting siRNA was HA level measurement (data not shown). To confirm that the carried out as described previously (41). observed decrease in cell proliferation among HAS1-AS trans- Pericellular matrix (coat) assay. HA-dependent pericellular matrices fectants was due to decreased HA production, we examined whe- (coats) around HAS1 transfectants were visualized using a particle exclusion ther the addition of exogenous HA could rescue HAS1-AS

Cancer Res 2008; 68: (2). January 15, 2008 484 www.aacrjournals.org

Figure 1. Examination of HA production, HAS1 expression, and growth characteristics of HAS1 transfectants. A-a, measurement of HA levels by HA ELISA-like assay. Columns, mean of three separate experiments; bars, SE. A-b, analysis of HAS1 expression. Cell lysates from the transfectants were subjected to anti-HAS, anti-v5, or anti-actin immunoblotting. GFP, green fluorescent protein. B-a, determination of the proliferation rate of HT1376 transfectants. Points, mean; bars, SD. B-b, effect of HA on the proliferation of HAS1-AS transfectant. Columns, mean; bars, SD. B-c, cell cycle analysis of HT1376 transfectants. The bar graphs (i–iii) show the percentage of cells in G0-G1, S, and G2-M phases of the cell cycle. Columns, mean; bars, SD. C-a, apoptotic activity measured using the Cell Death ELISA Plus assay. Columns, mean; bars, SD. C-b, effect of HA on the apoptosis of HAS1-AS cells. D-a, immunoblot analysis of HAS1 in 253J-Lung cells transfected with control or CD44 siRNA. D-b, analysis of cell growth and apoptosis in 253J-Lung cells following control and CD44 siRNA transfection. Columns, mean; bars, SD. transfectants. As shown in Fig. 1B-b, addition of HA modestly As shown in Fig. 1C-a, HAS1-AS transfectants are 5- to 10-fold increases the growth of HAS1-AS transfectant (clone 2) in a dose- more apoptotic when compared with vector and HAS1-S clones dependent manner. (P < 0.001, Tukey test). Addition of exogenous HA caused a dose- Cell cycle analysis shows that the decreased growth rate of dependent but modest decrease in the apoptotic activity of HAS1-AS transfectants is at least partially due to cell cycle arrest HAS1-AS cells (maximum decrease, f45%; P < 0.05; Fig. 1C-b). in the G2-M phase. As shown in Fig. 1B-c, when compared with We also down-regulated HAS1 expression in 253J-Lung bladder vector and HAS1-S transfectants, there is a f300% increase in the cancer cells by transiently transfecting them with HAS1 siRNA. number of HAS1-AS transfectants in the G2-M phase of the cell siRNA transfection down-regulated HAS1 expression by >80% cycle, with a corresponding decrease in the S phase (P < 0.001, (Fig. 1D-a). Down-regulation of HAS1 expression caused a 3.5-fold Tukey test). Because HA is involved in cell adhesion, we deter- decrease in cell growth and a 3-fold increase in apoptosis (Fig. 1D-b). mined whether a decrease in HA production causes HAS1-AS Therefore, the effect of HAS1 depletion on cell growth and apoptosis cells to undergo apoptosis due to perturbation in cell adhesion. is not a peculiarity of the HT1376 cell line. www.aacrjournals.org 485 Cancer Res 2008; 68: (2). January 15, 2008

C Next, we examined the expression of G2-M regulators (i.e., shown in Fig. 2 , transient transfection of Fas siRNA decreases cdc25c, cdk1, cyclin B1, chk1, and wee1) in various transfectants by apoptosis in HAS1-AS transfectants by f2-fold. Immunoblot immunoblotting. As shown in Fig. 2A, there is >2-fold decrease in analysis was used to confirm that Fas siRNA decreased Fas cyclin B1, cdk1, and cdc25c expression in HAS1 transfectants when expression in these HAS1-AS clones (data not shown). These results compared with the vector and HAS1-S transfectants. However, show that blocking HAS1 expression most likely induces apoptosis no change in the expression of negative regulators of the G2-M via the extrinsic pathway. phase (i.e., wee1 and chk1) was observed in any transfectants. Effect of HAS1 expression on HA-dependent pericellular These results show that HAS1-AS transfectants are arrested in the matrix formation. We tested the presence of pericellular matrices cell cycle due to a down-regulation of some of the positive around HAS1 transfectants using the particle exclusion assay regulators of the G2-M phase. (40, 44). As shown in Fig. 3A, vector and HAS1-AS clones do not Because HAS1-AS transfectants were highly apoptotic, we exhibit pericellular matrices, as the erythrocytes closely abut the examined PARP cleavage and caspase-3 and caspase-9 activation. surface of each cell and in some cases cover the cells. Figure 3B As shown in Fig. 2B, cleaved PARP and activated caspase-3 and shows that the percent of cells with pericellular membrane in caspase-9 are detected in HAS1-AS transfectants but not in vector vector and HAS1-AS transfectants is similar. The lack of pericellular and HAS1-S transfectants. Because HA production is severely HA matrix around vector clones is likely because HT1376 cells reduced in HAS1-AS transfectants, we reasoned that the cells may express high levels of HYAL1 (40). Contrarily, HAS1-S cells exhibit be undergoing apoptosis due to loss of adhesion and may involve a pericellular matrix, as the erythrocytes do not abut the cell mem- the receptor-mediated (Fas/Fas-L) or the extrinsic pathway. This brane. Figure 3B shows that there is a 5-fold increase in the number pathway involves the formation of the death-inducing signaling of cells with pericellular matrix in HAS1-S cells (P < 0.001). complex and FADD-mediated activation of caspase-8, which in However, not all HAS1-S cells have the pericellular coat. This is turn causes BID cleavage and caspase-3 activation, leading to the because HAS1-S transfectants also express HYAL1 at levels similar abnormal cleavage of PARP (44). to those produced by vector and HAS1-AS transfectants, and this As shown in Fig. 2B, caspase-8 activation (i.e., cleaved should result in pericellular HA degradation. caspase-8), BID cleavage, up-regulation of FADD levels, and Fas Effect of HAS1 expression on invasion. The invasive activity of expression are observed in all HAS1-AS clones when compared vector transfectant clones (31.2 F 3.4%) was normalized as 100%. As with vector and HAS1-S clones. There is also a small increase in shown in Fig. 3C, HAS1-AS transfectants are 50% to 90% less Fas-L expression of HAS1-AS transfectants. invasive than the vector transfectants. Contrarily, HAS1-S trans- We next examined whether blocking Fas expression by Fas fectants are 33% to 40% more invasive than vector transfectants. siRNA will reduce apoptosis in HAS1-AS transfectants (41). As Incorporation of HA in Matrigel did not influence the invasive

Figure 2. Analyses of G2-M checkpoint regulator and apoptotic pathway proteins. Cell lysates of HT1376 transfectants were analyzed by immunoblotting using cyclin B1, cdc25c, cdk1, chk1, wee1, or actin antibodies (A) or using IgGs against cleaved PARP, active caspase-3, cleaved caspase-9, caspase-8, Fas, Fas-L, FADD, BID, and actin (B). Positive control for FADD: Jurkat cell lysates. C, apoptotic activity in HAS1-AS transfectants transiently transfected with Fas or control siRNA. Columns, mean; bars, SD.

Cancer Res 2008; 68: (2). January 15, 2008 486 www.aacrjournals.org

Figure 3. Examination of pericellular coat and invasion activity. A, pericellular matrices surrounding vector, HAS1-S#1, and HAS1-AS#1. B, quantification of the % cells with pericellular matrices. Columns, mean; bars, SD.C, analysis of invasive activity. Columns, mean of triplicate determinations in two independent experiments; bars, SD. properties of various HT1376 transfectants. Therefore, blocking intracellular (45). Flow cytometry analyses show low cell surface HAS1 expression, and thereby blocking HA production, significantly expression of RHAMM but high CD44 expression in HT1376 cells reduces the invasive activity of bladder cancer cells. (median peak: anti-RHAMM, 2.22; anti-CD44, 76.8; control IgG, Effect of HAS1 on HA receptor expression. It has been 0.511; Fig. 4B-a). In 253J-Lung cells, there is little RHAMM expres- reported that, in Hs5787 breast cancer cells, blocking HAS2 sion on the cell surface (median peak: anti-RHAMM, 1.03; anti- expression causes a slight decrease in CD44 protein levels (28). CD44, 111.5; control IgG, 0.515; Fig. 4B-b). We therefore examined the expression of HA receptors CD44 Next, we down-regulated CD44 expression in HT1376 cells by and RHAMM in HAS1 transfectants. As shown in Fig. 4A-a, anti- siRNA (Fig. 4C-a). Unlike the effect of HAS1 on CD44 expression, pan-CD44 immunoblotting reveals high expression of three high CD44 down-regulation does not have any effect on HAS1 expression molecular mass (f150–220 kDa) proteins and somewhat lower (Fig. 4C-a). However, it results in a f2-fold decrease in cell growth expression of f90-kDa CD44 standard protein in vector and and a f1.7-fold increase in apoptosis, suggesting that CD44 is HAS1-S transfectants. However, very little CD44-related expression necessary for growth and inhibition of apoptosis (Fig. 4C-b). is observed in HAS1-AS transfectants. Immunoblotting using CD44 Because HA addition modestly rescued the HAS1-AS phenotype, variant–specific antibodies shows that the three high molecular we determined whether HA addition to HAS1-AS transfectants mass CD44-related proteins are variant isoforms, CD44-v3, increases CD44 levels. As shown in Fig. 4D-a, exposure of HAS1-AS CD44-v6, and CD44E (contains variant exons 8–10), respectively, cells to HA increases CD44 levels. To determine whether the and the expression of each of these isoforms was significantly increased CD44 levels due to HA addition are responsible for the reduced in HAS1-AS transfectants (Fig. 4A-b). In contrast, RHAMM partial rescue of the HAS1-AS phenotype, we down-regulated CD44 expression is not decreased in HAS1-AS transfectants (Fig. 4A-c). in HAS1-AS cells (by siRNA) in the presence or absence of HA (Fig. CD44 but not RHAMM down-regulation was also observed in HAS1 4D-b). As shown in Fig. 4D-c, blocking of CD44 expression further siRNA-treated 253J-Lung cells (data not shown). decreases the growth of HAS1-AS transfectants (compare Fig. 1B-a It has been shown that the cell surface HA-CD44 interaction and Fig. 4D-c). Furthermore, although HA addition modestly induces a complex formation between CD44 and ErbB2, leading to increases the growth of HAS1-AS cells, it fails to increase the growth ErbB2 activation (20, 21). We therefore examined the levels of of HAS1-AS transfectants blocked in CD44 expression (Fig. 4D-c). p-ErbB2 and total ErbB2 in HAS1 transfectants. As shown in Because in these experiments cell growth was severely inhibited, Fig. 4A-d, there is over 4-fold decrease in p-ErbB2 levels in HAS1-AS apoptosis experiments could not be performed. transfectants when compared with vector and HAS1-S trans- Mechanism of CD44 down-regulation. Semiquantitative RT- fectants, with no change in total ErbB2 levels. PCRto amplify CD44 standard and CD44 variant transcripts in In contrast to CD44, RHAMM lacks a transmembrane domain, various transfectants followed by DNA sequencing shows that and therefore, its expression could be intracellular and extracel- CD44 v3-v10 (CD44-v3), CD44 v6-v10 (CD44-v6), and CD44 v8-v10 lular. In bladder tumor tissues, RHAMM expression seems to be (CD44-E) variants and CD44 standard transcripts are expressed in www.aacrjournals.org 487 Cancer Res 2008; 68: (2). January 15, 2008

Figure 4. Examination of CD44, RHAMM, ErbB2, and p-ErbB2 expression. A, cell lysates of HT1376 transfectants were analyzed by immunoblotting using anti-pan-CD44 (a), CD44 variant–specific (b), RHAMM (c), and ErbB2 and p-ErbB2 (d) or actin antibodies. mAb, monoclonal antibody. B, cell surface labeling with anti-CD44, anti-RHAMM, or control IgG followed by flow cytometry. C, CD44 siRNA transfection. a, immunoblot analyses using anti-CD44 and anti-HAS1 antibodies; b, analysis of cell growth and apoptosis. Columns, mean; bars, SD. D-a, immunoblot analysis of CD44 in HAS1-AS transfectants following HA addition. D-b and D-c, CD44 siRNA transfection of HAS1-AS transfectant. D-b, immunoblot analysis of CD44. D-c, analysis of cell growth. Columns, mean; bars, SD. vector and HAS1-S transfectants (Fig. 5A). However, a weak expres- and HAS1-S clones (palpable tumors: 7–10 days; P < 0.001). The sion of only CD44-E and CD44 standard isoforms is detected in 3- to 7-fold decrease in the weight of HAS1-AS tumors when HAS1-AS (clones 1 and 2) transfectants. Real-time RT-PCR analysis compared with vector and HAS1-S tumors is also statistically shows that CD44 variant mRNA levels are 4- to 8-fold higher in significant (P < 0.001, Tukey-Kramer test; Fig. 6A-b). These results vector and HAS1-S transfectants than in HAS1-AS transfectants show that blocking HAS1 expression in HT1376 bladder cancer (Fig. 5B-a). There are no significant differences among HAS1-AS, cells decreases tumor growth. HAS1-S, and vector transfectants with respect to CD44 standard Immunohistochemistry was performed to determine whether mRNA levels, which are 30- to 80-fold lower than the CD44 variant tumor cells in vector, HAS1-S, and HAS1-AS tumors retain their phe- mRNA levels (Fig. 5B-b). notype with respect to HAS1 and HA expression. As shown in Fig. 6B, The decreased CD44 variant mRNA levels in HAS1-AS transfec- there is high HAS1 and HA expression in tumor cells in the vector tants are not due to increased rate of mRNA degradation because and HAS1-S specimen. MVD is higher in vector and HAS1-S tumor the rate of CD44 variant mRNA degradation in vector, HAS1-S, and specimens when compared with HAS1-AS specimens (Fig. 6B). HAS1-AS transfectants, determined in the presence of actinomycin Quantification of microvessels in various specimens shows that the D, is very similar (Fig. 5B-c). HAS1 expression did not affect MVD in vector and HAS1-S specimens is 2- to 6-fold higher than that RHAMM expression, as the real-time RT-PCR showed that RHAMM in HAS1-AS specimens (Fig. 6C). These results show that, by regu- mRNA levels are similar in vector (2.81 F 0.95), HAS1-S (3.33 F lating HA expression, HAS1 affects tumor growth and angiogenesis. 0.83), and HAS1-AS (3.1 F 0.14) transfectants. Effect of HAS1 expression on tumor xenografts. As shown in Fig. 6A-a, there was a 3- to 4-fold delay in the generation of pal- Discussion pable s.c. tumors in the animals injected with HAS1-AS trans- In this study, we show that, consistent with the role of HA in fectants when compared with the animals injected with the vector regulating cell adhesion, migration, and proliferation, modulation

Cancer Res 2008; 68: (2). January 15, 2008 488 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2008 American Association for Cancer Research. HAS1 Functions in Bladder Cancer of HAS1 expression significantly affects bladder tumor cell growth reduction in HA synthesis induce Fas and FADD expression, lead- and invasion. Unlike HAS2, where increased HAS1 and HYAL1 ing to the activation of the extrinsic pathway. It has been shown expression compensates for the loss of HAS2 expression (28), HAS1 that stimulation of CD44 decreases Fas expression and CD44 iso- expression did not result in a compensatory increase in other HAS forms interfere with Fas signaling (47, 48). Our study shows that or HYAL1 genes. This suggests that regulation of the expression of decreasing HA production by blocking HAS1 expression down- one HAS gene by other HASs may be restricted to HAS2 and/or it is regulates the expression of CD44 variant isoforms. Therefore, cell type specific. The slow growth rate of HAS1-AS transfectants is down-regulation of CD44 variant isoforms may very likely be partially due to cell cycle arrest in the G2-M phase and can be responsible for Fas up-regulation and Fas-mediated apoptosis. modestly rescued by HA addition. It is noteworthy that blocking Our study is the first to report that silencing of a HAS gene (i.e., the expression of HYAL1 in bladder and prostate tumor cells also HAS1) significantly down-regulates CD44 variant isoforms at the causes a G2-M arrest, which can be partially rescued by the addi- mRNA and protein levels. At present, it remains unclear whether tion of angiogenic HA fragments (42). This suggests that the tumor HAS1 similarly regulates CD44 standard transcript levels because, cell–associated HA-HAase system is involved in cell cycle prog- in HT1376 cells, CD44 standard transcript levels are 30- to 80-fold ression at the G2-M phase. less than that of the CD44 variant transcripts. Because HAS1 down- The high apoptotic activity in HAS1-AS transfectants can be regulation does not affect RHAMM expression, it suggests that reversed only partially by the addition of exogenous HA. This the effect of HAS1 on CD44 expression is not common for all HA indicates that many functions of tumor cell–associated HA cannot receptors. be replaced by the addition of soluble HA in the medium. Our The down-regulation of CD44 due to decreased HA synthesis results are consistent with the results of Li et al. (28), who also seems to be involved in the decreased growth and increased reported that addition of HA in HAS2 siRNA-treated cells partially apoptosis observed in HAS1-AS transfectants. Because CD44 down- restored cyclin B expression but did not increase cell proliferation regulation alone decreases cell growth and HA addition to HAS1- or migration. The slower growth of HAS2/HAS3 antisense trans- AS cultures, blocked in CD44 expression, fails to increase the cell fectants of PC3LN4 prostate cancer cells is also not restored when growth, these suggest that CD44-HA interaction is important for they are mixed with HA. However, when these cells are mixed with bladder cancer cell growth and attenuation of apoptosis. It remains HA and implanted in mice, the tumor growth rate was restored to to be determined whether the interaction between all or specific that of the wild-type PC3LN4 cells (46). It is possible that the CD44 variants and HA is important for bladder tumor cell growth architecture of HA matrix surrounding the tumor cells is critical for and inhibition of apoptosis. how HA affects growth, invasion, and migration. Our data show that HAS1 is involved in promoting tumor HA is necessary for cell adhesion, and therefore, reduction in HA growth, invasion, and angiogenesis. HT1376 cells express both production by tumor cells may very likely induce anoikis. Our HYAL1 and HA, and in these cells, HYAL1 expression is necessary results support this notion, as the down-regulation of HAS1 and for tumor growth and progression (39–41). Simpson (29) reported

Figure 5. Analysis of CD44 transcript expression. A, semiquantitative RT-PCR analysis of mRNA from HAS1 transfectants for CD44 standard (CD44-S) and CD44 variant expression. B-a and B-b, real-time RT-PCR analyses for CD44 variant (CD44-v) and CD44 standard (CD44-std) expression. Columns, mean; bars, SE. C, analysis of CD44 variant transcript following actinomycin D treatment.

www.aacrjournals.org 489 Cancer Res 2008; 68: (2). January 15, 2008

Figure 6. Characterization of the HAS1 transfectant tumors. A, vector and HAS1 transfectants were injected s.c. in athymic mice and tumor volume was measured twice weekly once the tumor became palpable. a, tumor volume. Points, mean; bars, SD. b, tumor weight at 35 d. Columns, mean tumor weight (g); bars, SD. B, localization of HAS1, HA, and microvessels by immunohistochemistry. a, d, and e, vector clone 1; b, e, and h, HAS1-S clone 1; c, f, and j, HAS1-AS clone 1. Magnification, Â400. C, microvessels were counted in 10 random high-power fields representing the highest MVD per tumor specimen. Columns, mean; bars, SD. that concurrent expression of HAS2 and HYAL1 has higher may be an accurate diagnostic and prognostic tumor marker and a tumorigenic potential than either molecule alone. Overexpression possible therapeutic target. of HAS3 slows the growth of 22Rv1 prostate cancer cells. Furthermore, HAS3-overexpressing tumors are less angiogenic Acknowledgments and the growth-inhibitory effects of HAS3 overexpression can be Received 6/8/2007; revised 8/18/2007; accepted 9/13/2007. reversed by stable expression of HYAL1 (49). Taken together, these Grant support: NIH/National Cancer Institute grants R01 CA 72821-09 and R01 CA findings show that the tumor-associated HA-HYAL1 system is 123063-01 (V.B. Lokeshwar). The costs of publication of this article were defrayed in part by the payment of page important in tumor growth and progression. HAS1 expression charges. This article must therefore be hereby marked advertisement in accordance correlates with invasion, disease progression, tumor recurrence, with 18 U.S.C. Section 1734 solely to indicate this fact. and poor survival in a variety of carcinomas, including bladder We thank Dr. Bal Lokeshwar (Department of Urology) for his help in cell cycle analyses and cell surface localization of CD44 and RHAMM and Dr. Awtar Krishan (6, 35–38). The results presented in this study show that HAS1 is a Ganju (Department of Radiology and Microbiology and Immunology) for his advice on positive regulator of tumor growth progression, and therefore, it pericellular matrix detection experiments.

References sulfate, tenascin, and hyaluronan, and their association increased stromal expression indicates unfavorable with disease outcome in node-negative breast cancer. outcome in patients with adenocarcinoma. Int J Cancer 1. Toole BP, Zoltan-Jones A, Misra S, Ghatak S. Hyaluronan: Clin Cancer Res 2004;10:2491–8. 2001;95:12–7. a critical component of epithelial-mesenchymal and 6. Yabushita H, Kishida T, Fusano K, et al. Role of 10. Aaltomaa S, Lipponen P, Tammi R, et al. Strong stro- epithelial-carcinoma transitions. Cells Tissues Organs hyaluronan and hyaluronan synthase in endometrial mal hyaluronan expression is associated with PSA recur- 2005;179:66–72. cancer. Oncol Rep 2005;13:1101–5. rence in local prostate cancer. Urol Int 2002;69:266–72. 2. Stern R. Hyaluronan metabolism: a major paradox in 7. Seta¨la¨LP, Tammi MI, Tammi RH, et al. Hyaluronan 11. Schroeder GL, Lorenzo-Gomez MF, Hautmann SH, et cancer biology. Pathol Biol (Paris) 2005;53:372–82. expression in gastric cancer cells is associated with local al. A side by side comparison of cytology and biomarkers 3. Adamia S, Maxwell CA, Pilarski LM. Hyaluronan and and nodal spread and reduced survival rate. Br J Cancer for bladder cancer detection. J Urol 2004;172:1123–6. hyaluronan synthases: potential therapeutic targets in 1999;79:1133–8. 12. Lokeshwar VB, Schroeder GL, Selzer MG, et al. cancer. Curr Drug Targets Cardiovasc Haematol Disord 8. Mukaratirwa S, van Ederen AM, Gruys E, Nederbragt Bladder tumor markers for monitoring recurrence and 2005;5:3–14. H. Versican and hyaluronan expression in canine screening comparison of hyaluronic acid-hyaluronidase 4. Gotte M, Yip GW. Heparanase, hyaluronan, and CD44 colonic adenomas and carcinomas: relation to malig- and BTA-Stat tests. Cancer 2002;95:61–72. in cancers: a breast carcinoma perspective. Cancer Res nancy and depth of tumour invasion. J Comp Pathol 13. Lokeshwar VB, Obek C, Pham HT, et al. Urinary 2006;66:10233–7. 2004;131:259–70. hyaluronic acid and hyaluronidase: markers for bladder 5. Suwiwat S, Ricciardelli C, Tammi R, et al. Expression of 9. Pirinen R, Tammi R, Tammi M, et al. Prognostic value cancer detection and evaluation of grade. J Urol 2000; extracellular matrix components versican, chondroitin of hyaluronan expression in non-small-cell lung cancer: 163:348–56.

Cancer Res 2008; 68: (2). January 15, 2008 490 www.aacrjournals.org

14. Posey JT, Soloway MS, Ekici S, et al. Evaluation of the 27. Itano N, Sawai T, Yoshida M, et al. Three isoforms of 38. Golshani R, Hautmann SH, Estrella V, et al. HAS1 prognostic potential of hyaluronic acid and hyaluroni- mammalian hyaluronan synthases have distinct enzy- expression in bladder cancer and its relation to urinary dase (HYAL1) for prostate cancer. Cancer Res 2003;63: matic properties. J Biol Chem 1999;274:25085–92. HA test. Int J Cancer 2007;120:1712–20. 2638–44. 28. Li Y, Li L, Brown TJ, Heldin P. Silencing of hyaluronan 39. Lokeshwar VB, Cerwinka WH, Isoyama T, Lokeshwar 15. Ekici S, Cerwinka WH, Duncan R, et al. Comparison synthase 2 suppresses the malignant phenotype of invasive BL. HYAL1 hyaluronidase in prostate cancer: a tumor of the prognostic potential of hyaluronic acid, hyal- breast cancer cells. Int J Cancer 2007;120:2557–67. promoter and suppressor. Cancer Res 2005;65:7782–9. uronidase (HYAL1), CD44v6 and microvessel density for 29. Simpson MA. Concurrent expression of hyaluronan 40. Lokeshwar VB, Cerwinka WH, Lokeshwar BL. prostate cancer. Int J Cancer 2004;112:121–9. biosynthetic and processing enzymes promotes growth HYAL1 hyaluronidase: a molecular determinant of 16. Hautmann SH, Lokeshwar VB, Schroeder GL, et al. and vascularization of prostate tumors in mice. Am J bladder tumor growth and invasion. Cancer Res 2005; Elevated tissue expression of hyaluronic acid and Pathol 2006;169:247–57. 65:2243–50. hyaluronidase validates the HA-HAase urine test for 30. Liu N, Gao F, Han Z, Xu X, Underhill CB, Zhang L. 41. Lokeshwar VB, Estrella V, Lopez L, et al. HYAL1-v1, bladder cancer. J Urol 2001;165:2068–74. Hyaluronan synthase 3 overexpression promotes the an alternatively spliced variant of HYAL1 hyaluronidase: 17. Turley EA, Noble PW, Bourguignon LY. Signaling growth of TSU prostate cancer cells. Cancer Res 2001;61: a negative regulator of bladder cancer. Cancer Res 2006; properties of hyaluronan receptors. J Biol Chem 2002; 5207–14. 66:11219–27. 277:4589–92. 31. Udabage L, Brownlee GR, Waltham M, et al. 42. Lokeshwar BL, Lokeshwar VB, Block NL. Expression 18. Knudson CB, Knudson W. Hyaluronan and CD44: Antisense-mediated suppression of hyaluronan synthase of CD44 in prostate cancer cells: association with cell modulators of chondrocyte metabolism. Clin Orthop 2 inhibits the tumorigenesis and progression of breast proliferation and invasive potential. Anticancer Res Relat Res 2004;(427 Suppl):S152–62. cancer. Cancer Res 2005;65:6139–50. 1995;15:1191–8. 19. Toole BP. Hyaluronan: from extracellular glue to 32. Jacobson A, Rahmanian M, Rubin K, Heldin P. 43. Lokeshwar VB, Schroeder GL, Carey RI, Soloway MS, pericellular cue. Nat Rev Cancer 2004;4:528–39. Expression of hyaluronan synthase 2 or hyaluronidase Iida N. Regulation of hyaluronidase activity by alterna- 20. Ghatak S, Misra S, Toole BP. Hyaluronan constitu- 1 differentially affect the growth rate of transplantable tive mRNA splicing. J Biol Chem 2002;277:33654–63. tively regulates ErbB2 phosphorylation and signaling colon carcinoma cell tumors. Int J Cancer 2002;102: 44. Garrison JB, Kyprianou N. Doxazosin induces apop- complex formation in carcinoma cells. J Biol Chem 2005; 212–9. tosis of benign and malignant prostate cells via a 280:8875–83. 33. Calabro A, Oken MM, Hascall VC, Masellis AM. death receptor-mediated pathway. Cancer Res 2006;66: 21. Misra S, Toole BP, Ghatak S. Hyaluronan constitu- Characterization of hyaluronan synthase expression and 464–72. tively regulates activation of multiple receptor tyrosine hyaluronan synthesis in bone marrow mesenchymal 45. Kong QY, Liu J, Chen XY, Wang XW, Sun Y, Li H. kinases in epithelial and carcinoma cells. J Biol Chem progenitor cells: predominant expression of HAS1 Differential expression patterns of hyaluronan receptors 2006;281:34936–41. mRNA and up-regulated hyaluronan synthesis in bone CD44 and RHAMM in transitional cell carcinomas of 22. Hamilton SR, Fard SF, Paiwand FF, et al. The marrow cells derived from multiple myeloma patients. urinary bladder. Oncol Rep 2003;10:51–5. hyaluronan receptors CD44 and RHAMM (CD168) form Blood 2002;100:2578–85. 46. Simpson MA, Wilson CM, McCarthy JB. Inhibition of complexes with ERK1,2 that sustain high basal motility 34. Kanomata N, Yokose T, Kamijo T, et al. Hyaluronan prostate tumor cell hyaluronan synthesis impairs in breast cancer cells. J Biol Chem 2007;282:16667–80. synthase expression in pleural malignant mesothelio- subcutaneous growth and vascularization in immuno- 23. Hobarth K, Maier U, Marberger M. Topical chemopro- mas. Virchows Arch 2005;446:246–50. compromised mice. Am J Pathol 2002;161:849–57. phylaxis of superficial bladder cancer with mitomycin C 35. Adamia S, Reiman T, Crainie M, Mant MJ, Belch 47. Yasuda M, Tanaka Y, Fujii K, Yasumoto K. CD44 and adjuvant hyaluronidase. Eur Urol 1992;21:206–10. AR, Pilarski LM. Intronic splicing of hyaluronan stimulation down-regulates Fas expression and Fas- 24. Itano N, Atsumi F, Sawai T, et al. Abnormal synthase 1 (HAS1): a biologically relevant indicator mediated apoptosis of lung cancer cells. Int Immunol accumulation of hyaluronan matrix diminishes contact of poor outcome in multiple myeloma. Blood 2005; 2001;13:1309–19. inhibition of cell growth and promotes cell migration. 105:4836–44. 48. Mielgo A, van Driel M, Bloem A, Landmann L, Proc Natl Acad Sci U S A 2002;99:3609–14. 36. Yamada Y, Itano N, Narimatsu H, et al. Elevated Gunthert U. A novel antiapoptotic mechanism based on 25. Itano N, Sawai T, Atsumi F, et al. Selective expression transcript level of hyaluronan synthase1 gene correlates interference of Fas signaling by CD44 variant isoforms. and functional characteristics of three mammalian with poor prognosis of human colon cancer. Clin Exp Cell Death Differ 2006;13:465–77. hyaluronan synthases in oncogenic malignant transfor- Metastasis 2004;21:57–63. 49. Bharadwaj AG, Rector K, Simpson MA. Inducible mation. J Biol Chem 2004;279:18679–87. 37. Yabushita H, Noguchi M, Kishida T, et al. Hyaluronan hyaluronan production reveals differential effects on 26. Itano N, Kimata K. Mammalian hyaluronan syn- synthase expression in ovarian cancer. Oncol Rep 2004; prostate tumor cell growth and tumor angiogenesis. thases. IUBMB Life 2002;54:195–9. 12:739–43. J Biol Chem 2007;282:20561–72.

www.aacrjournals.org 491 Cancer Res 2008; 68: (2). January 15, 2008

Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2008 American Association for Cancer Research. Hyaluronic Acid Synthase-1 Expression Regulates Bladder Cancer Growth, Invasion, and Angiogenesis through CD44

Roozbeh Golshani, Luis Lopez, Veronica Estrella, et al.

Cancer Res 2008;68:483-491.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/68/2/483

Cited articles This article cites 48 articles, 20 of which you can access for free at: http://cancerres.aacrjournals.org/content/68/2/483.full#ref-list-1

Citing articles This article has been cited by 10 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/68/2/483.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/68/2/483. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.