Vps35-Dependent Recycling of Trem2 Regulates Microglial Function

Received: 18 November 2015 Revised and accepted: 21 September 2016 Uncorrected manuscript published: 26 September 2016 Published on: 1 November 2016 DOI 10.1111/tra.12451

ORIGINAL ARTICLE

Vps35-dependent recycling of Trem2 regulates microglial function

1State Key Laboratory of Brain and Cognitive Sciences, Institute of Biophysics, Chinese Triggering receptor expressed on myeloid cells 2 (Trem2), an immune-modulatory receptor, is Academy of Sciences, Beijing, China preferentially expressed in microglia of central nervous system. Trem2 might be involved in the 2Sino-Danish College, University of Chinese development of Alzheimer’s disease (AD) through regulating the inflammatory responses and Academy of Sciences, Beijing, China phagocytosis of microglia. However, the intracellular trafficking of Trem2 remains unclear. In 3 Qingdao Mental Health Center, Qingdao, this study, we showed that Trem2 in the plasma membrane underwent endocytosis and recy- China cling. Trem2 is internalized in a clathrin-dependent manner and then recycled back to the 4Center of Alzheimer’s Disease, Beijing Institute for Brain Disorders, Beijing, China plasma membrane through vacuolar protein sorting 35 (Vps35), the key component of cargo Corresponding Author: Siqi Zhao, State Key recognition core of retromer complex, but not Rab11. When Vps35 is knocked down, Trem2 Laboratory of Brain and Cognitive Sciences, accumulated in the lysosomes but was not degraded. More importantly, Vps35 deficiency leads Institute of Biophysics, Chinese Academy of to excessive lipopolysaccharide (LPS)-induced inducible nitric oxide synthase (iNOS) expression Sciences, Beijing 100101, China and IL-6 production, which can be abolished by Trem2 overexpression. Furthermore, R47H ([email protected]). Trem2, an AD-associated mutant, failed to interact with Vps35 and became unstable compared Funding information National Science Foundation of China,Grant/ with wild-type Trem2. Our study suggests that Vps35/retromer is responsible for recycling of Award number: 81125010, 81030025 and Trem2 in the regulation of microglial function such as proinflammatory responses, whereas 81600997; National Basic Research Program R47H mutation impairs Trem2 trafficking, which might contribute to AD. of China,Grant/Award number: 973- 2012CB910701 and 2013DFA31990; Cross- disciplinary Collaborative Teams Program for KEYWORDS Science, Technology and Innovation (2014- Alzheimer’s disease, microglia, receptor recycling, retromer, Trem2, Vps35 2016); Chinese Academy of Sciences.

1 | INTRODUCTION Homozygous mutations in Trem2 or Dap12 appears in Nasu-Hakola disease (NHD), which is characterized by bone cysts and fractures and Triggering receptor expressed on myeloid cells 2 (Trem2), a homolog presenile dementia associated with demyelination and cerebral atrophy.4 of Trem1, is a transmembrane glycoprotein that belongs to the immu- Consistent with the clinical symptoms, Trem2−/− mice exhibits reduced noglobulin variable domain receptor family. Trem2 consists of a lead- microglial expanse during aging and impaired myelin debris clearance in ing signal peptide, a single type V extracellular region containing Cuprizone-induced nonautoimmune demyelination model.5 Genome- 3 potential N-glycosylation sites, a transmembrane domain and a wide association study (GWAS) has identified R47H mutation of Trem2 short cytoplasmic tail lacking signaling motifs.1 Owing to its short increases the risk of Alzheimer’s disease (AD) with a high odds ratio (3.5), cytoplasmic tail, Trem2 needed to transfer its signaling by Dap12, an which is similar to that of ApoEε4.6,7 A recent study reported that defi- adaptor protein,2 which recruits the protein tyrosine kinase Syk, lead- ciency of Trem2 augmented hippocampal amyloid β accumulation and ing to the subsequent activation of various downstream molecules of loss of layer V cortical neurons in AD mouse model, which directly links the innate immune system.3 AD with Trem2 mutation.8 The R47H mutation has also been identified

ABBREVIATIONS: ALS, amyotrophic lateral sclerosis; CHX, cycloheximide; EEA1, early endosome antigen 1; ERC, endocytic recycling compartment; ERC, endocytic recycling compartment; FTD, frontotemporal dementia; GC, Golgi complex; GST, glutathione S-transferase; iNOS, inducible nitric oxide synthase; LPS, lipopolysaccharide; NHD, Nasu-Hakola disease; PD, Parkinson’s disease; shRNA, small hairpin RNA; TGN, trans-Golgi network; Trem2, triggering receptor expressed on myeloid cells 2; Vps35, vacuolar protein sorting 35 †These authors contributed equally to this work.

FIGURE 1 Triggering receptor expressed on myeloid cells 2 (Trem2) is constitutively endocytosed from the plasma membrane via a clathrin-dependent manner. A and B, N9 cells (A) and primary mouse microglial cells (B) were incubated (pulsed) with anti- Trem2 antibody (10 μg/mL) for 40 minutes at 4C, then washed and incubated (chased) for 1 hour at 37C before fixation, permeabilization and treatment with the secondary antibody. Scale bar is 25 μm. C- E, Effect of RNA interference (RNAi)- mediated clathrin knockdown on Trem2 endocytosis. C, N9 cells were transfected with either small interfering RNA (siRNA) of clathrin or non-targeting siRNA. Relative mRNA levels of Trem2 were determined by real-time-polymerase chain reaction (PCR). GAPGH was used as an internal control. ***P < .001. D, N9 cells treated with siRNA targeting clathrin and non-targeting siRNA were used for endocytosis assay. Scale bar, 25 μm. E, Quantification shows the mean fluorescent area per cell. **P < .01. For each group, 6 visual fields containing approximately 150 cells in total were randomly chosen to be photographed, each image was analyzed by Image-Pro Plus to generate a measurement of mean fluorescent area per cell. as a risk factor for other multiple neurodegenerative diseases including Trem2 in the regulation of microglial function and R47H mutation amyotrophic lateral sclerosis (ALS),9 Parkinson’sdisease(PD)andfronto- disrupts the interaction between Trem2 and Vps35 thus impairs temporal dementia (FTD).10 However, a recent study found that R47H Trem2 trafficking and protein stability, which might contribute to AD. mutation is highly associated with the risk of AD, but not the others.11 To date, it is still elusive whether R47H serves as a common risk factor 2 | RESULTS for all the neurodegenerative diseases or just specifically associates with AD. Moreover, how R47H mutation alters normal function of Trem2 2.1 | Clathrin-dependent endocytosis is necessary needs to be further investigated. for Trem2 internalization As an innate immune receptor, Trem2 is expressed on a subset of myeloid cells including osteoclasts, dendritic cells, macrophages and Trem2 has been reported to undergo constitutive endocytosis in the microglial cells.12 The expression of Trem2 has also been detected in a immortalized N9 microglial cells.17 In our experiments, N9 and primary fraction of neurons such as granule cells in dentate gyrus,13-15 but these mouse microglial cells were exposed (pulsed) to anti-Trem2 antibody observations still need to be further confirmed.16 Trem2 is abundant in for 40 minutes at 4 C, and then incubated (chased) at 37 C for up to human and murine microglia in both brain tissues and cultured cell lines, 1 hour before fixation and treatment with the secondary antibody. We in which Trem2 distributes to intracellular membrane-bound structures observed that Trem2 internalized in N9 or primary microglia such as the trans-Golgi network (TGN), while a small fraction locates at (Figure 1A,B). To investigate whether Trem2 endocytosis is through the plasma membrane.15 Trem2 in an intracellular pool could be translo- the typical clathrin-mediated pathway, which plays a major role in most cated and recycled from the cell surface, which demonstrated that the selective receptor internalization in higher eukaryotes,20 we used a surface density and presumably the activation of Trem2 is continuously small interfering RNA (siRNA) specifically targeting clathrin heavy chain, adapted.17 NHD-associated mutations, such as Q33X, Y38C and T66M, which reduced about 70% of clathrin expression (Figure 1C) and found impaired the glycosylation of Trem2 in the Golgi apparatus, as well that internalization of Trem2 is significantly decreased in clathrin- as trafficking of Trem2 to the plasma membrane and shedding by deficient N9 cells (Figure 1D,E). Our data indicates that Trem2 endocy- γ-secretase.18,19 These studies suggest that normal trafficking of tosis may be clathrin-dependent in microglial cells. Trem2 is important for the biological function of Trem2 and aberrant 2.2 | Endocytosed Trem2 directly interacts with traffic may contribute to the development of neurodegenerative dis- Vps35 eases. However, the molecular mechanism underlying the recycling process of Trem2 remains largely unknown. Here, we show that vacuo- It has been shown that internalized Trem2 colocalizes with EEA1 lar protein sorting 35 (Vps35)/retromer is responsible for recycling of (Early Endosome Antigen 1), a marker of early endosomes, from 1288 YIN ET AL.

FIGURE 2 The interaction between triggering receptor expressed on myeloid cells 2 (Trem2) and vacuolar protein sorting 35 (Vps35) in vivo. A, Trem2 colocalized with Vps35 in primary microglial cells. Scale bar, 7.5 μm. B, N9 cells were lysed in IP buffer and lysates were immunoprecipitated with anti-Vps35 antibody or control anti-IgG antibody. Trem2 was detected in immune complexes of Vps35. C, N9 cells were incubated with anti-Trem2 antibody (10 μg/mL) for 40 minutes at 4C before ﬁxation, permeabilization and treatment with anti- Vps35 antibody. Vps35 and endocytic Trem2 were double immunolabled by Alexa Fluor 594 and Alexa Fluor 488 individually. Scale bar, 7.5 μm.

where Trem2 will be either recycled to the plasma membrane or Vps35 regulates Trem2 recycling in post-endocytosis level. In addition sorted to the lysosome for degradation.17 Recent studies have also to retromer-dependent recycling, Rab11 functions act as an important shown that retromer complex plays an important role in 2 known alternative transporter in the cargo recycling from the endocytic recy- transportation routes out of endosomes: 1 is the retrograde pathway, cling compartment (ERC) back to the plasma membrane.26,27 To rule through which cargo is retrieved from endosome to TGN, and the out the possibility that the ERC pathway is involved in Trem2 recy- other is the recycling pathway, in which cargo is delivered from endo- cling, Rab11 was knocked down in N9 cells (Figure 3E) and we found some back to the cell surface.21,22 Here, we hypothesized that retro- that Rab11 deletion failed to affect Trem2 recycling (Figure 3F,G). mer might be involved in intracellular traffic of Trem2. To test Here, we argue that post-endocytic trafficking of Trem2 is regulated whether Trem2 could interact with Vps35, the key component of by the retromer-dependent pathway but not through ERC. retromer,23 mouse primary microglial cells were used and we observed that there is a significant colocalization of Trem2 and 2.4 | Trem2 accumulated in lysosomes and Vps35 (Figure 2A). Furthermore, co-immunoprecipitation analysis in N9 cells showed that Trem2 and Vps35 endogenously interact with degraded when retromer-dependent recycling is each other (Figure 2B). Consistently, internalized Trem2 could also impaired colocalize with Vps35 (Figure 2C). Taken together, Trem2 could inter- It has been reported that blockage of the retromer-dependent act with Vps35, implying that Vps35 may be responsible for post- recycling often leads to the lysosomal degradation of missorted fi endocytic traf cking of Trem2. receptors.22,28 In order to further understand the role of retromer on post-endocytic Trem2, we then defined the fate of Trem2 when retromer-dependent recycling is disrupted. Accordingly, we found 2.3 | Trem2 recycling is dependent on Vps35 that there is a significant increase of immunofluorescence-labeled Beclin1 has been demonstrated to regulate CD36 and Trem2 recycling Trem2 colocalized with Lamp1, a putative lysosomal marker, in N9 through recruiting retromer complex.24 However, there is no straight- cells when Vps35 was knocked down (Figure 4A-C). In addition, we forward evidence of the direct interaction between Trem2 and Vps35. isolated lysosome fractions by density gradient centrifugation and we Our data clearly showed that Vps35 interacts with Trem2. To further found Trem2 accumulated in lysosome fractions in Vps35-deficient investigate the involvement of Vps35 in regulating Trem2 recycling, N9 cells (Figure 4D). Furthermore, we observed that Trem2 indeed we first established an assay according to Mitchell et al25 as described degraded faster in N9 cells when Vps35 was knocked down compar- in Figure 3A. Then we knocked down Vps35 by using siRNA in N9 ing with the control group in cycloheximide (CHX)-chase assays cells (Figure 3B) and Vps35-deficiency remarkably decreased Trem2 (Figure 4E,F, Figure S1A,B, Supporting Information). To further deter- recycling (Figure 3C,D). However, Vps35 knockdown did not affect mine whether the accelerated degradation caused by Vps35 Trem2 endocytosis (data not shown). Together, our data indicates that knockdown is lysosome-dependent, we treated cells with chloroquine YIN ET AL. 1289

FIGURE 3 Effect of Rab11 or vacuolar protein sorting 35 (Vps35) knockdown on triggering receptor expressed on myeloid cells 2 (Trem2) recycling in N9 cells. A, Diagram of Trem2 recycling assay. (1) Antibody binds to the extracellular domain of Trem2 at 4C. (2) More antibodies recognize the receptor, resulting in antibody internalization. (3) Acid wash at 4C to remove surface antibodies. (4) Internalized antibodies traffic back to plasma membrane. (5) Receptors bound with primary antibody were labeled by fluorescent secondary antibody and continue to be internalized at 37C. (6) Surface antibodies were removed by acid wash. B-D, Effect of RNA interference (RNAi)-mediated Vps35 knockdown on Trem2 recycling in N9 cells. B, N9 cells were transfected with either Vps35 small interfering RNA (siRNA) or non-targeting siRNA. Expression levels of Vps35 were determined using western blotting using anti-Vps35 antibodies. C, N9 cells treated with siRNA targeting Vps35 and non- targeting siRNA were subjected to Trem2 recycling assay. Scale bar, 25 μm. D, Quantification shows the mean fluorescent area per cell. **P < .01. For each group, 6 visual fields containing approximately 150 cells in total were randomly chosen to be photographed, each image was analyzed by Image-Pro Plus to generate a measurement of mean fluorescent area per cell. E-G, Effect of RNAi-mediated Rab11 knockdown on Trem2 recycling in N9 cells was investigated as described as above. F, Scale bar, 25 μm. G, ns. not significant.

(CQ), a lysosomal degradation inhibitor) and found that Vps35 the expression of iNOS and production of nitric oxidate (NO) knockdown-induced Trem2 degradation is significantly rescued, sug- (Figure S2A,B) as well as the mRNA level of TNF-α (Figure S2C) in gesting that Vps35 deficiency-induced Trem2 degradation might be LPS-treated BV2 cells. Interestingly, Vps35 knockdown significantly through the lysosomal pathway (Figure 4E,F). Interestingly, the CQ enhanced iNOS protein levels (Figure 5A), NO production (Figure 5B) treatment-mediated rescue effect is not overt in control cells, which and the mRNA levels of IL-6 and TNF-α (Figure 5C,D) in the presence argues that the lysosomal degradation pathway is not the route for of LPS. Furthermore, we observed that Vps35 knockdown-induced Trem2 degradation under normal circumstances, unless Trem2 is mis- iNOS expression and IL-6 production were abolished by Trem2 over- localized to lysosomes. However, the degradation pathway of Trem2 expression (Figure 5E,F). Therefore, our data indicated that Trem2 under normal conditions needs to be further investigated. and Vps35 might interact with and function together in the regulation of microglial activation.

2.5 | Vps35 is involved in Trem2-mediated inhibition of microglial activation 2.6 | R47H Trem2 disrupts the binding of Trem2 to Vps35 and promotes its degradation As we found Vps35 played an important role in Trem2 recycling (Figure 4), we then sought to investigate whether Vps35/retromer Among the mutations in Trem2, the R47H variant shows the strongest affects Trem2 function in microglial activation. Previous studies have associationwithAD13 and increases the risk of AD with a high odds demonstrated that knockdown of Trem2 increased the expression of ratio (3.5), which is similar to that of APOEε4 mutation.7 Previous tumor necrosis factor-α (TNF-α) and inducible nitric oxide synthase reports have found that the R47H mutation affects bead uptake on (iNOS) in primary cultured microglia29 and the mRNA level of IL-6 in Trem2-Dap12 ﬂip-in 293T cells.18 Accordingly, we found the R47H microglial BV2 cells in the presence of lipopolysaccharide (LPS).30 mutation of Trem2 impairs both phagocytosis ability and inﬂammatory Consistently, we observed that knockdown of Trem2 increased responses on BV2 cells (Figure S3A-E). However, how the R47H 1290 YIN ET AL.

FIGURE 4 Triggering receptor expressed on myeloid cells 2 (Trem2) is mislocalized to lysosome for degradation in vacuolar protein sorting 35 (Vps35)deficient N9 cells. A and B, N9 cells were transfected with not-targeting small interfering RNA (siRNA) (A) or siRNA targeting Vps35 (B). Cells were double immunostained with Trem2 and Lamp1 after transfection for 72 hours. Scale bar, 10 μm. C, Mander’s overlap coefficients for colocalization of Trem2 with Lamp1. **P < .01. For each group, 6 visual fields containing approximately 60 cells were randomly chosen to be photographed and analyzed by Image-Pro Plus to calculate the colocalization coefficiency. D, N9 cells were cultured in 15 cm petri dishes and transfected with control siRNA or siRNA targeting Vps35. 72 hours after transfection, 108 cells were harvested and lysosome fraction were purified by density gradient equilibrium centrifugation. Cytoplasm and lysosome fraction were analyzed using western blotting. E, Control N9 cells and RNA interference (RNAi)- mediated Vps35 knockdown N9 cells were incubated with vehicle or 50 μMCQ 3 hours before treatment with cycloheximide (50 μg/mL) for the indicated time period. Cells were harvested and the lysates were analyzed using western blotting. F, The quantification of Trem2 protein levels. **P < .01, *P < .05 compared with siVps35 + CQ group (ANOVA followed by Tukey post hoc test). The experiment has been repeated for 3 times. mutation effects on the normal function of Trem2 remains elusive. In 3 | DISCUSSION this study, we found R47H Trem2 disrupted its interaction with Vps35 in cells (Figure 6D). Because the R47H mutation of Trem2 perturbs its In this study, we found Vps35 regulates phagocytic receptor Trem2’s binding with Vps35, we then sought to examine whether the R47H function in microglia through mediation of recycling and degradation mutant Trem2 shall go to lysosomal degradation due to failure in Vps35- of Trem2. Loss of function of Vps35 impairs Trem2 recycling mediated recycling of Trem2. We transfected GFP-Trem2 (WT or and accelerates its degradation in lysosome. Furthermore, the Trem2 R47H) and Cherry-Lamp1 (lysosome marker) together in HeLa cells and p.R47H mutation, an AD-associated risk, also decreases the interac- we found that the R47H mutation of Trem2 significantly increased its tion between Vps35 and Trem2 then degrades in lysosome. colocalization with Lamp1 (Figure 6A-C). Consist with this result, the It has been known that clathrin-coated pits are widely involved R47H mutant Trem2 was significantly increased in lysosome fractions in the process of receptor-mediated endocytosis31 and caveolin1- compared with WT Trem2 (Figure 6E). Furthermore, R47H Trem2 coated-pits also interact with the classical clathrin-dependent degraded much faster than WT Trem2 in CHX-chase assay, which could pathway.32 Here, we found that Trem2 is internalized through a be rescued by CQ treatment (Figure 6F,G). Taken together, these data clathrin-dependent manner and recycled back to the plasma mem- suggest that the R47H mutation of Trem2 impairs the binding with brane by Vps35/retromer. We found that Trem2 endocytosis is not Vps35, thus leading to its mislocalization and lysosomal degradation, completely abolished by clathrin knockdown, which might due to which might contribute to the disrupted microglial function during the incomplete depletion of clathrin, but we could not rule out the possi- development of neurodegenerative diseases including AD. bility that other endocytic pathways are involved. YIN ET AL. 1291

FIGURE 5 Knockdown of vacuolar protein sorting 35 (Vps35) exacerbates lipopolysaccharide (LPS)-induced proinflammatory responses. A and B, N9 cells treated with non-targeting small interfering RNA (siRNA) or Vps35-specific siRNA were incubated with 10 ng/mL LPS or vehicle control for 24 hours. Inducible nitric oxide synthase (iNOS) expression and nitric oxidate (NO) production were detected as depicted. C and D, N9 cells treated with non-targeting siRNA or Vps35-specific siRNA were incubated with 10 ng/mL LPS for 6 hours. RNA was extracted and the relative mRNA levels of IL-6 and tumor necrosis factor-α (TNF-α) were determined by quantitative real-time- PCR. GAPDH was used as an internal control. E and F, BV2 cells stably expressing lentiviral Trem2 and control cells were treated with non-targeting siRNA or Vps35-specific siRNA. Cells were incubated with 10 ng/mL LPS for 24 hours. iNOS was detected using western blot and IL-6 in culture medium was measured by enzyme-linked immunosorbent assay (ELISA). All values are mean SEM; mean differences were compared by unpaired Student’s t test (B, D-F) or one-way ANOVA with a Tukey’s post test (H). *P < .05, **P < .01, ***P < .001.

The classical function of the retromer complex is to transport cargo factors could be reversed by Trem2 overexpression, arguing that from early endosome to the TGN; however, recent studies showed that Vps35 not only regulates the recycling of Trem2 but also disrupts its the retromer complex also is involved in endosome-to-plasma mem- function in over-activated microglial cells. Microglia-mediated inflam- brane trafficking of receptors.22,33 Moreover, it has recently been mation is believed to play an important role in the pathology of neu- reported that impaired phagocytic receptor recycling caused by beclin-1 rodegenerative disease, and our finding suggests that the crosstalk of knockdown is associated with the reduced expression of Vps35.24 In Trem2 and Vps35 is involved in this process through modulating this study, we found strong evidence that Vps35 directly interacts with microglial proinflammatory responses. the extracellular domain of Trem2 and this interaction can be disrupted One of the characteristics of the AD brain is the progressive by the R47H mutation. It has been reported that Trem2 is largely dis- accumulation of amyloid-beta (Aβ) peptides and toxic plaque lesions. tributed in the intracellular membrane-bound structures such as TGN Trem2 expression is upregulated in microglia associated with amyloid and exocytic vesicles.15,17 Our data clearly shows that Vps35 interacts plaque in AD animal models including both CRND8Tg mice and with intracellular Trem2 (Figure 2A) and internalized Trem2 (Figure 2C). APP23Tg mice.34,35 Increased Trem2 could enhance the ability of We hypothesized that the extracellular domain of Trem2 becomes microglia to clear amyloid plaques in vitro and in APP23Tg mice16,34 exposed to Vps35 after endocytosis and interacts with Vps35. Prada while deficiency of Trem2 augmented Hippocampal amyloid β accu- et al reported that the majority of intracellular Trem2 is distributed in mulation.8 Thus, Trem2 could be a particularly important sensor for GC/TGN, a fraction of the exocytosed vesicles which are transported Aβ42 clearance. This hypothesis was further supported by the finding to, and recycled from the plasma membrane and are positive for that ApoE is a novel ligand of Trem2 and promotes phagocytosis of TGN38, implying a TGN origin.17 Base on this finding and according to apoptotic neurons together with Trem2.36,37 It has been shown that our result that Trem2 recycling is not dependent on Rab11, which is ApoE could form a stable complex with Aβ and modulate its clear- responsible for endosome-to-cell surface trafficking, we hypothesize ance. After ApoE/Aβ complex is endocytosed, ApoE either disassoci- that Trem2 might be transported by retromer from endosomes to TGN ates from Aβ in early endosome or is trafficked to lysosomes where thus preventing its degradation in lysosomes. Aβ is typically transported for degradation.38,39 Therefore, Trem2 in It has shown that Trem2 deficiency increased LPS-induced IL-6 microglia might serve as a receptor for ApoE/Aβ complex or ApoE- and IL-1β mRNA levels in microglia,30 indicating Trem2 functions to bound apoptotic neurons and promotes its clearance. Furthermore, it restrain microglial activation. Consistently, Trem2 knockdown allevi- has been reported that Vps35 is reduced in the AD brain.40 In this ates TNF-α and IL-6 expression in our study. More importantly, work, we argue that Vps35 may play an important role in this process Vps35 knockdown-induced the expression of proinflammatory through preventing Trem2 from lysosomal degradation and 1292 YIN ET AL.

FIGURE 6 R47H mutation of triggering receptor expressed on myeloid cells 2(Trem2) disrupts its binding with vacuolar protein sorting 35 (Vps35) and promotes its degradation. A and B, HeLa cells were transfected with GFP-Trem2 (WT or R47H) and Cherry-Lamp1. C, Mander’s overlap coefficients for colocalization of Trem2 with Lamp1. For each group, 20 cells double positive for GFP and Cherry were randomly chosen to be analyzed. **P < .01. D, 293T cells were transfected with Myc-Vps35 and Flag-Trem2 (WT or R47H). Cells were harvested 48 hours after transfection and lysates were immunoprecipitated with anti-Vps35 antibody. Flag-Trem2 was detected by anti-Trem2 antibody. E, 293T cells were planted in 15 cm cell culture dishes, transfected with Flag-Trem2-WT or Flag- Trem2-R47H plasmid. After 72 hours of transfection, 108 cells were harvested and lysosome fraction were purified by density gradient equilibrium centrifugation. Cytoplasm and lysosome fraction were analyzed using western blotting. F, 293T cells transfected with Flag-Trem2-WT or Flag-Trem2-R47H were incubated with vehicle or 50 μM chloroquine 3 hours before treatment with cycloheximide (50 μg/mL) for indicated time period. Cells were harvested and the lysates were analyzed using western blotting. G, Gray value of Flag-Trem2 band in each lane were calculated and normalized to relative GAPDH band by using Image J. For each time point, Trem2 remains was expressed as the ratio of gray value in the specific lane to gray value in the first lane. ***P < .001 compared with R47H + CQ group (ANOVA followed by Tukey post hoc test). The experiment has been repeated for 3 times. promoting its recycling and function. However, the relationship In summary, we demonstrate that Vps35 is involved in Trem2- between Vps35 and ApoE/Aβ needs to be further investigated. mediated inhibition of proinflammatory responses in microglia through Many mutations of Trem2 have been involved in several neuro- regulating Trem2 recycling. Also, a possible mechanism underlying why degenerative diseases.6,10,13,41,42 Recently, 2 independent groups R47H Trem2 impairs microglial function have been demonstrated. In investigated how Trem2 missense mutations affected Trem2 func- addition to restraining inflammation, retromer-mediated recycling of a tions and they found that the R47H mutation behaves differently phagocytic receptor, such as CD3624 and Trem2, may play an impor- from NHD-associated mutations, such as Q33X, Y38C and tant role in the clearance of disease relevant substrates such as amy- T66M,18,19 indicating that there might be another mechanism under- loid peptides and debris of apoptotic neurons, thus exhibiting a lying the pathophysiological role of R47H Trem2. In our present work, positive effect on neurodegenerative diseases. the R47H mutation of Trem2 disturbs its interaction with Vps35, which leads to lysosomal degradation of Trem2. We speculate that the R47H mutation changes the conformation of the Trem2 protein 4 | MATERIALS AND METHODS and the change is propagated through the transmembrane domain and eventually affects the interaction with Vps35. This is likely to be 4.1 | Reagents and antibodies the mechanism underlying the fact that the R47H mutation impairs microglial function including both inflammation and phagocytic capa- Protein synthesis inhibitor CHX and endosomal acidification inhibitor bility, which might contribute to the development of AD. CQ were purchased from Beyotime Institute of Biotechnology. LPS YIN ET AL. 1293 was purchased from Sigma. Primers for molecular cloning and real- centrifugation, suspended and cultured with DMEM F12 medium time-PCR were synthesized by Life Technologies. T4 DNA Ligase containing 10% FBS and 100 U/mL penicillin/streptomycin in 25 cm2 were purchased from Thermo Scientific and restriction enzymes from cell culture flasks, which were pre-coated with 0.1 mg/mL poly-L- New England Biolabs. SYBR Green for quantitative real-time-PCR lysine. After 14 day’s culturing, 0.25% trypsin diluted in DMEM at a was purchased from TransGen Biotech. The following antibodies dilution ratio of 1:4 were used to dissociate astrocytes for 30 minutes. were used: anti-Trem2 polyclonal sheep IgG (used for ICC, 1:25 dilu- After removal of astrocytes, microglia were planted in culture plates tion) (R&D Systems); anti-Trem2 monoclonal rat IgG (used for WB, for use. The purity of the cells obtained was >95% as verified by 1:500 dilution) (R&D Systems); anti-Vps35 polyclonal goat IgG (for immunocytochemistry using monoclonal antibodies against Iba-1 WB, 1:5000 dilution; for ICC, 1:500 dilution); anti-Rab11 polyclonal (Wako) (data not shown). rabbit IgG (for WB, 1:1000 dilution) (ABclonal); anti-LAMP1 polyclonal rabbit IgG (for ICC, 1:100 dilution) (ABclonal); anti-FLAG M2 monoclonal mouse IgG (for WB, 1:8000 dilution) (Sigma); anti-c-Myc 4.5 | Lentivirus packaging and stable BV2 cell lines monoclonal mouse IgG (for WB, 1:2000 dilution) (CWBiotech); anti- establishment GST monoclonal mouse IgG (for WB, 1:800 dilution) (Santa Cruz); anti-His-HRP monoclonal mouse antibody (for WB, 1:1000 dilution) pLKO-shTrem2 plasmids were co-transfected with pVSVG and (Invitrogen). pCMV-dR8.12 plasmids into 293T cells. pCDH-EF1-Trem2 plasmids were co-transfected with pLnV and pVSVG plasmids into 293FT cells. The supernatant was harvested at 36 and 72 hours after transfection, 4.2 | Plasmids then was subjected to ultracentrifugation to enrich virus. BV2 cells The following plasmids were used in this study: Flag-Trem2-WT, were infected with enriched viral particles and maintained in medium Flag-Trem2-R47H, GFP-Trem2-WT, GFP-Trem2-R47H, generated by containing 5 μg/mL puromycin 24 hour after infection. Control cells ligating Trem2 cDNA into pCMV10-3xFlag vector or pLVX-AcGFP1- were infected with virus produced from the pLKO.1 or pCDH empty N1 vector. Myc-Vps35 was constructed by ligating Vps35 cDNA into vector. pCMV-Myc vector. For overexpressing Trem2 in BV2 cells, Trem2 was cloned into pCDH-EF1-Puro. Small hairpin RNA (shRNA) targeting Trem2 was inserted into the pLKO.1 vector. The sequence of 0 0 4.6 | RNA interference shTrem2 is 5 -GAAGCGGAATGGGAGCACA-3 . In order to knock down Clathrin, Rab11 and Vps35 gene expression in N9 cells, siRNA targeting specific gene were synthesized by 4.3 | Cell lines, cell culture and transfection GenePharma. The sequences of siRNA were as followed: siClathrin: HEK293T cells, HeLa cells, mouse microglial cell line BV2 cells were 50-AACAUUGGCUUCAGUACCUUGTT-30; siRab11: 50-GUGCAGUG- purchased from the Cell Resource Center, Institute of Basic Medical CUGUCAGAACA-30; siVps35: 50-GCCUUCAGAGGAUGUUGUA Science, Peking Union Medical University and cultured in high- UCUUUA-30. RNA interference was performed following the manual glucose DMEM containing 10% FBS and 100 U/mL penicillin/strep- provided by GenePharma. Briefly, N9 cells were planted in 24-well or tomycin. Mouse microglial cell line N9 was kindly provided by Prof. 6-well plates and were transfected with siRNA at a concentration of J.M. Wang (Laboratory of Molecular Immunoregulation, Center for 200 nM using Lipofectamin 2000. Scrambled siRNA was included as Cancer Research, NCI, National Institutes of Health) and was cultured negative. Knockdown efficiency was detected by quantitative RT- in Iscove’s Modified Dulbecco’s Medium (Iscove’s modified Dulbec- PCR or using western blot 72 hours after transfection. co’s medium [IMDM]; Gibco) containing 5% FBS, 0.1 M Mercap- toethanol (Sigma) and 100 U/mL penicillin/streptomycin. All cells were growth in a humidified 5% CO2 incubator at 37 C. DNA and 4.7 | Immunofluorescence staining small interference RNA transfection were performed by using Lipo- fectamin 2000 according to the manufacturer’s recommendation. Primary microglial cells, N9 cells and HeLa cells transfected with indicated plasmids were grown on glass coverslips and used for staining 48 hours after transfection. Unless indicated otherwise, cells were 4.4 | Primary microglial culture fixed with 4% paraformaldehyde for 15 minutes at 4C, permeabilized Postnatal 0-1 C57BL/6 mice were used to prepare primary microglia. with 0.4% saponin or 0.3% triton for 30 minutes at 37C, blocked in Brain cortices were isolated and the meninges were removed in 3% BSA for 1 hour at room temperature, treated with primary antibo- 0.1 M PBS containing 100 U/mL penicillin/streptomycin. The cortices dies overnight at 4C then incubated in secondary antibodies for were cut into small pieces and chemically dissociated with 0.25% 1 hour an 37C. All solutions were made in PBS. After staining, cover- trypsin (Gibco) for 7 minutes at 37C. Equal volume of Dulbecco’s slips were mounted on microslides with anti-fade reagent and ana- modified Eagle’s medium/F-12 nutrient mixture (DMEM-F12, Gibco) lyzed with the use of Leica SP5 confocal microscope. Digital images containing 10% FBS was added to stop the reaction. Then cells were were transferred to Adobe Photoshop to make overlay images. Man- mechanically dissociated and the suspension was filtrated through a der’s overlap coefficients for colocalization was calculated by using filter of 200 mesh to remove the tissue debris. Cells were pelleted via Image Pro Plus. 1294 YIN ET AL.

4.8 | Endocytosis assay and recycling assay 1 μg RNA was reverse-transcribed into cDNA using the one-step gDNA removal and cDNA synthesis kit (Transgen). SYBR Green qPCR Trem2 endocytosis was assayed by pulse-chase experiment. In brief, Master mix (Transgen) was used to perform quantitative RT-PCR. The N9 cells or primary microglial cells were seeded on poly-L-lysine- melting curve and amplification curve were analyzed in Agilent coated glass coverslips in 24-well plates for 48 hours ready for use. Mx3005P qRT-PCR system. The relative mRNA levels were normal- Then cells were incubated in IMDM containing rat anti-Trem2 antibo- ized to of GAPDH based on the Ct values. The primer sequences for dies at 4C for 1 hour then washed twice in cold IMDM to remove Trem2, Clathrin, TNF-α, IL-6 and GAPDH were as followed: Trem2-For- unbound antibodies. Subsequently, cells were reincubated in IMDM ward: ATGGGACCTCTCTCCACCAGTTTC; Trem2-Reverse: GAATTCT containing 5% FBS at 37C in cell incubator for 1 hour. To remove CTCACGTACCTCCG; Clathrin-Forward: TGAGTCTAAGGTTCGAGAA cell surface-bound antibodies, the cells were washed twice for several GCA; Clathrin-Reverse: CCGGGACCAAAGCATGTTCA; TNF-α-For- seconds in IMDM adjusted to pH 2.0. Cells were then fixed with 4% ward: CAGGCGGTGCCTATGTCTC; TNF-α-Reverse: CGATCACCCC paraformaldehyde for 10 minutes at 4C, permeabilized with 0.4% GAAGTTCAGTAG; IL-6-Forward: TCTATACCACTTCACAAGTCGGA; saponin for 30 minutes at 37C, stained with donkey anti-rat second- IL-6-Reverse: GAATTGCCATTGCACAACTCTTT; GAPDH-Forward: ary antibodies coupled to Alexa Fluor 488 for 1 hour at 37C. Finally, AGGTCGGTGTGAACGGATTTG; GAPDH-Reverse: GGGGTCGTTGAT the coverslips were mounted on microslides with anti-fade reagent GGCAACA. for imaging. Trem2 recycling assay were performed according to a modifica- tion of an established assay procedure.25 N9 cells were seeded on 4.11 | Enzyme-linked immunosorbent assay (ELISA) poly-L-lysine-coated glass coverslips in 24-well plates for 48 hours To determine the IL-6 concentration in the supernatants, enzyme- before staining. Antibodies against Trem2 were added to the cells in linked immunosorbent assays (ELISAs) were performed using IL-6 IMEM for 40 minutes at 4C then 1 hour at 37C in cell culture incu- specific ELISA kit (BioLegend) according to the manufacturer’s proto- bator. Cells were washed with cold IMDM at pH 2.0 on ice then cul- col. In brief, 96-well plates provided by BioLegend were coated with tured in IMDM containing 5% FBS for 1 hour at 37C in cell culture capture antibody for 12 hours at 4C. Plates were washed 6 times incubator and then provided with secondary antibodies coupled to with washing buffer and incubated with diluted samples and IL-6 Alexa Fluor 488 in IMDM for 1 hour at 37C in cell incubator. Cells standards for 2 hours at room temperature. After washed, IL-6 was were again acid washed with cold IMDM at pH 2.0 then with cold detected using biotinylated-detective antibody and SULFO-TAG PBS. Finally, cells were fixed, washed and mounted for imaging. Fluo- streptavidin. The light emission at 620 nm after electrochemical stim- rescent signal from vesicles containing endocytosed or recycled ulation was measured using the TECAN infinite M200 microplate Trem2 was imaged by Leica SP5 confocal microscope. The amount of reader. IL-6 concentrations of samples were calculated based on the recycled Trem2 was determined by the area of the fluorescent standard curve drawn with IL-6 standards. puncta which computed by using Image Pro Plus. The measurement of mean fluorescent area per cell was generated by the total area of fluorescent vesicles divided by the cell number in the field of vision. 4.12 | Lysosome isolation For each group, at least 6 fields of view were imaged and analyzed. Lysosome fraction was extracted using Lysosome Isolation Kit (Genmed Scientifics, Inc.) according to the manufacturer’s protocol. In 4.9 | Drug treatment brief, 108 cells were collected and washed, broken in Dounce homog-

In LPS stimulation experiments, BV2 or N9 cells were planted in cul- enizer following breakage evaluation by observation under light ture plate for 12 hours before LPS treatment. After the culture media microscope. Cell lysate was subjected to serial centrifugation at was changed into FBS free media, LPS (Sigma) was added into the 3000, 10 000 and 20 000g. The supernatant was collected as cyto- culture media at a concentration of 10 ng/mL. To detect TNF-α and plasm fraction. A total of 20 000g pellet was collected and placed on IL-6 mRNA level, cells were harvested with TRIZOL reagent 6 hours an Optiprep step gradient and centrifuge at 145 000g. Lysosome after LPS treatment. For detection of iNOS protein expression, cells fractions were collected from the top layer. Cytoplasm fraction and were harvested with RIPA buffer 24 hours after LPS treatment. To lysosome fraction were analyzed using western blotting. measure NO and IL-6 concentration, culture media was collected 48 hours after LPS stimulation. In protein degradation experiments, 4.13 | Measurement of NO concentration 293T cells or N9 cells were plated in 6-well plates. CHX (Beyotime Biotechnology) was add into culture media at a concentration of To determine the amount of NO production, the concentration of 50 μg/mL, cells were harvested at a serial of time points. If needed, NO in the culture media was measured by Gress Reagent (Boyotime). CQ was added 3 hours before CHX treatment. The working concen- BV2 or N9 cells were planted in 96-well plate for 12 hours. Each μ tration of CQ was 50 μM. group has 6 replicates. A total of 50 L culture media was mixed with 50 μL Gress reagent I and 50 μL Gress reagent II. The light absorb- ance at 540 nm was measured using the TECAN inﬁnite M200 micro- 4.10 | Quantitative RT-PCR plate reader. NO concentrations of samples were calculated based on

Cells were harvested in TRIZOL reagent (Invitrogen) and total RNAs the standard curve drawn with NaNO2 standards dissolved were extracted according to the manufacturer’s protocol. A total of in DMEM. YIN ET AL. 1295

4.14 | Western blotting used for multiple comparisons. All statistical analyses were computed using GraphPad Prism 5. All data were presented as mean SEM. A total of 293T cells and N9 cells were harvested in RIPA (Radio *P < .05, **P < .01, ***P < .001 or NS (no significant difference) Immunoprecipitation Assay) buffer (Beyotime). Protease inhibitors denote the significance thresholds. cocktail was added to prevent protein degradation. Nuclei and cell debris were removed by centrifugation at 15 000 rpm (25155 g) for 10 minutes at 4C. Total protein concentrations were quantified by ACKNOWLEDGMENTS using BCA Assay Kit (Beyotime). The lysates were boiled in SDS loading buffer. Equal amounts of protein was loaded on 8%-12% SDS- This work was supported by the National Science Foundation of polyacrylamide gels for electrophoresis and then transferred to PVDF China (Grant No. 81125010, 81030025 and 81600997), the National (Polyvinylidene Fluoride) membrane (Whatman). PVDF membranes Basic Research Program of China (973-2012CB910701 and were maintained in blocking buffer containing 0.1% Tween-20 and 2013DFA31990), and Cross-disciplinary Collaborative Teams Pro- 5% skimmed milk powder for 1 hour at room temperature, then incu- gram for Science, Technology and Innovation (2014-2016) from Chi- bated in antigen-specific primary antibodies overnight at 4C and nese Academy of Sciences. detected in species-specific horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 hour at room temperature. Chemilumines- Conflict of interest cence signal were developed with the use of enhanced chemilumines- cence (ECL) (Thermo Pierce) and visualized with autoradiography film The authors declare no potential conflict of interests. (Kodak).

REFERENCES 4.15 | Co-immunoprecipitation 1. Bouchon A, Dietrich J, Colonna M. Cutting edge: inflammatory responses can be triggered by TREM-1, a novel receptor expressed The 293T cells were planted in 6-well plates and cotransfected with on neutrophils and monocytes. J Immunol. 2000;164:4991-4995. pCMV-Myc-Vps35 and pCMV-Flag-Trem2-WT or pCMV-Flag-Trem2- 2. Lanier LL, Corliss B, Wu J, Phillips JH. Association of DAP12 with R47H plasmids. After 48 hours of transfection, cells were harvested in activating CD94/NKG2C NK cell receptors. Immunity. 1998;8:693-701. IP buffer containing protease inhibitors. Lysates were immunoprecipi- 3. Ford JW, McVicar DW. TREM and TREM-like receptors in inflamma- fi tated with Red ANTI-FLAG M2 Af nity Gel (Sigma-Aldrich) containing tion and disease. Curr Opin Cell Biol. 2009;21:38-46. anti-FLAG momoclonal antibody covalently attached to crosslinked 4. Paloneva J, Kestilä M, Wu J, et al. Loss-of-function mutations in TYR- 4% agarose beads for 3 hours at 4C on a rotor. To determine the OBP (DAP12) result in a presenile dementia with bone cysts. Nat Genet. 2000;25:357-361. endogenous protein interaction between Trem2 and Vps35, N9 cells 5. Poliani PL, Wang Y, Fontana E, et al. TREM2 sustains microglial were lysed as described above. Anti-Vps35 antibody or anti-IgG anti- expansion during aging and response to demyelination. J Clin Invest. body was added to lysates for incubation overnight at 4C. Then 2015;125(5):2161-2170. 6. Jonsson T, Stefansson H, Steinberg S, et al. Variant of TREM2 associ- lysates were immunoprecipitated with protein G-Agarose beads for ated with the risk of Alzheimer’s disease. N Engl J Med. 4 hours at 4 C. Finally, the beads were washed with IP buffer and 2013;368:107-116. boiled in 1× SDS loading buffer. Immunocomplexes were subjected to 7. Murcia JDG, Schmutz C, Munger C, et al. Assessment of TREM2 rs75932628 association with Alzheimer’s disease in a population- western blot using specific antibodies as depicted above. based sample: the Cache County Study. Neurobiol Aging. 2013;34: e2811-e2889. e2813. 8. Wang Y, Cella M, Mallinson K, et al. TREM2 lipid sensing sustains the 4.16 | Phagocytosis assay microglial response in an Alzheimer’s disease model. Cell. Phagocytosis assay was performed as previously described.24 Briefly, 2015;160:1061-1071. 9. Cady J, Koval ED, Benitez BA, et al. TREM2 variant p. R47H as a risk BV2 cells were planted in 24-well plates at a density of 20 000 cells per factor for sporadic amyotrophic lateral sclerosis. JAMA Neurol. well for 24 hours. Culture medium was replaced with DMEM alone. 2014;71:449-453. Latex beads (6 μm, internally dyed with the fluorophore Flash Red; 10. Rayaprolu S, Mullen B, Baker M, et al. TREM2 in neurodegeneration: evidence for association of the p. R47H variant with frontotemporal Polysciences, Inc.) were pre-suspended in 50% FBS and Hanks’ bal- dementia and Parkinson’s disease. Mol Neurodegener. 2013;8:1-5. anced salt solution (HBSS) and then added into culture medium at a 11. Lill CM, Rengmark A, Pihlstrøm L, et al. The role of TREM2 R47H as a concentration of 10 beads per cell for 1 hour. Cells were harvested in risk factor for Alzheimer’s disease, frontotemporal lobar degeneration, amyotrophic lateral sclerosis, and Parkinson’s disease. Alzheimers cold fluorescence-activated cell sorter (FACS) buffer (1% FBS and Dement. 2015;11:1407-1416. 0.02% sodium azide in PBS), and analyzed using flow cytometry using 12. Colonna M. TREMs in the immune system and beyond. Nat Rev LSR-II FACS machine (BD Biosciences). In order to rule out detection of Immunol. 2003;3:445-453. ’ free latex beads, events were thresholded for size. Phagocytosis ability 13. Guerreiro R, Wojtas A, Bras J, et al. TREM2 variants in Alzheimer s disease. N Engl J Med. 2013;368:117-127. fl was represented by the proportion of cell containing uorescent beads. 14. Kiialainen A, Hovanes K, Paloneva J, Kopra O, Peltonen L. Dap12 and Trem2, molecules involved in innate immunity and neurodegeneration, are co-expressed in the CNS. Neurobiol Dis. 2005;18:314-322. 4.17 | Statistical analysis 15. Sessa G, Podini P, Mariani M, et al. Distribution and signaling of TREM2/DAP12, the receptor system mutated in human polycystic Difference between 2 treatment conditions was determined by Stu- lipomembraneous osteodysplasia with sclerosing leukoencephalopa- dent’s t-test. One-way ANOVA followed by Tukey post hoc test was thy dementia. Eur J Neurosci. 2004;20:2617-2628. 1296 YIN ET AL.

16. Jiang T, Tan L, Zhu X-C, et al. Upregulation of TREM2 ameliorates neu- 32. Sharma DK, Choudhury A, Singh RD, Wheatley CL, Marks DL, ropathology and rescues spatial cognitive impairment in a transgenic Pagano RE. Glycosphingolipids internalized via caveolar-related endo- mouse model of Alzheimer’s disease. Neuropsychopharmacology. cytosis rapidly merge with the clathrin pathway in early endosomes 2014;39:2949-2962. and form microdomains for recycling. J Biol Chem. 2003;278:7564- 17. Prada I, Ongania GN, Buonsanti C, Panina-Bordignon P, Meldolesi J. 7572. Triggering receptor expressed in myeloid cells 2 (TREM2) trafficking in 33. McGough IJ, Steinberg F, Gallon M, et al. Identification of molecular microglial cells: continuous shuttling to and from the plasma membrane heterogeneity in SNX27-retromer-mediated endosome-to-plasma- regulated by cell stimulation. Neuroscience. 2006;140:1139-1148. membrane recycling. J Cell Sci. 2014;127:4940-4953. 18. Kleinberger G, Yamanishi Y, Suárez-Calvet M, et al. TREM2 mutations 34. Melchior B, Garcia AE, Hsiung B-K, et al. Dual induction of TREM2 implicated in neurodegeneration impair cell surface transport and and tolerance-related transcript, Tmem176b, in amyloid transgenic phagocytosis. Sci Transl Med. 2014;6:243ra286-243ra286. mice: implications for vaccine-based therapies for Alzheimer’s disease. 19. Park JS, Ji IJ, An HJ, et al. Disease-associated mutations of TREM2 ASN Neuro. 2010;2:AN20100010. alter the processing of N-linked oligosaccharides in the Golgi appa- 35. Frank S, Burbach GJ, Bonin M, et al. TREM2 is upregulated in amyloid ratus. Traffic. 2015;16:510-518. plaque-associated microglia in aged APP23 transgenic mice. Glia. 20. Ungewickell EJ, Hinrichsen L. Endocytosis: clathrin-mediated mem- 2008;56:1438-1447. brane budding. Curr Opin Cell Biol. 2007;19:417-425. 36. Atagi Y, Liu CC, Painter MM, et al. Apolipoprotein E is a ligand for 21. Small SA, Petsko GA. Retromer in Alzheimer disease. Nat Rev Neurosci: triggering receptor expressed on myeloid cells 2 (TREM2). J Biol Parkinson disease and other neurological disorders; 2015. Chem. 2015;290:26043-26050. 22. Temkin P, Lauffer B, Jäger S, Cimermancic P, Krogan NJ, von 37. Bailey CC, DeVaux LB, Farzan M. The triggering receptor expressed Zastrow M. SNX27 mediates retromer tubule entry and endosome- on myeloid cells 2 binds apolipoprotein E. J Biol Chem. to-plasma membrane trafficking of signalling receptors. Nat Cell Biol. 2015;290:26033-26042. 2011;13:715-721. 38. Kanekiyo T, Xu H, Bu G. ApoE and Abeta in Alzheimer’s disease: acci- 23. Hierro A, Rojas AL, Rojas R, et al. Functional architecture of the retro- dental encounters or partners? Neuron. 2014;81:740-754. mer cargo-recognition complex. Nature. 2007;449:1063-1067. 39. Verghese PB, Castellano JM, Garai K, et al. ApoE influences amyloid- 24. Lucin KM, O’Brien CE, Bieri G, et al. Microglial beclin 1 regulates ret- beta (Abeta) clearance despite minimal apoE/Abeta association in romer trafficking and phagocytosis and is impaired in Alzheimer’s dis- physiological conditions. Proc Natl Acad Sci USA. 2013;110:E1807- ease. Neuron. 2013;79:873-886. E1816. 25. Mitchell H, Choudhury A, Pagano RE, Leof EB. Ligand-dependent 40. Small SA, Kent K, Pierce A, et al. Model-guided microarray implicates and-independent transforming growth factor-β receptor recycling the retromer complex in Alzheimer’s disease. Ann Neurol. regulated by clathrin-mediated endocytosis and Rab11. Mol Biol Cell. 2005;58:909-919. 2004;15:4166-4178. 41. Guerreiro R, Bilgic B, Guven G, et al. A novel compound heterozygous 26. Chen W, Feng Y, Chen D, Wandinger-Ness A. Rab11 is required for mutation in TREM2 found in a Turkish frontotemporal dementia-like trans-golgi network-to-plasma membrane transport and a preferential family. Neurobiol Aging. 2013;34:e2891-e2890. e2895. target for GDP dissociation inhibitor. Mol Biol Cell. 1998;9:3241- 42. Guerreiro RJ, Lohmann E, Brás JM, et al. USing exome sequencing to 3257. reveal mutations in trem2 presenting as a frontotemporal dementia- 27. Ren M, Xu G, Zeng J, De Lemos-Chiarandini C, Adesnik M, like syndrome without bone involvement. JAMA Neurol. Sabatini DD. Hydrolysis of GTP on rab11 is required for the direct 2013;70:78-84. delivery of transferrin from the pericentriolar recycling compartment to the cell surface but not from sorting endosomes. Proc Natl Acad Sci USA. 1998;95:6187-6192. 28. Gokool S, Tattersall D, Seaman MN. EHD1 interacts with retromer to SUPPORTING INFORMATION stabilize SNX1 tubules and facilitate endosome-to-Golgi retrieval. fi Traf c. 2007;8:1873-1886. Additional Supporting Information may be found online in the sup- 29. Takahashi K, Prinz M, Stagi M, Chechneva O, Neumann H. TREM2- transduced myeloid precursors mediate nervous tissue debris clear- porting information tab for this article. ance and facilitate recovery in an animal model of multiple sclerosis. PLoS Med. 2007;4:675. 30. Zhong L, Chen X-F, Zhang Z-L, et al. DAP12 stabilizes the C-terminal How to cite this article: Yin J, Liu X, He Q, Zhou L, Yuan Z fragment of the triggering receptor expressed on myeloid cells-2 and Zhao S. Vps35-dependent recycling of Trem2 regulates (TREM2) and protects against LPS-induced pro-inflammatory microglial function, Traffic. 2016;17(12):1286–1296. response. J Biol Chem. 2015;290(25):15866-15877. 31. Mukherjee S, Ghosh RN, Maxfield FR. Endocytosis. Physiol Rev. 1997;77:759-803.