Methylation of the 5' Cpg Island of the FHIT Gene Is Closely Associated with Transcriptional Inactivation in Esophageal Squamous Cell Carcinomas1

[CANCER RESEARCH 58, 3429-3434. August I, 1998] Methylation of the 5' CpG Island of the FHIT Gene Is Closely Associated with Transcriptional Inactivation in Esophageal Squamous Cell Carcinomas1

Hisashi Tanaka,2 Yutaka Shimada, Hideki Harada, Masayuki Shinoda, Syunzo Hatooka, Masayuki Imamura, and Kanji Ishizaki3

Laboratory of Experimental Radiology, Aichi Cancer Center Research Institute, Nagoya 464-8681, Japan [H. T., H. H., K. I.Â¡;Department of Thoracic Surgery, Aichi Cancer Center Hospital, h'agova 464-8681, Japan [M. S., 5. H.J: and Department of Surgery and Surgical Basic Science, Kvoto University Graduate School of Medicine, Kyoto 606- 8507, Japan [H. T. Y. S.. H. H., M. I.)

ABSTRACT tumor suppressor. In ESC, Ohta et al. (4) reported that aberrant transcripts lacking exons 5 or 8 were detected in 50% of the tumors by Previous studies suggested that the I III i (fragile histidine triad) gene the nested RT-PCR. In contrast, Zou et al. (18) reported that deletions on 3pl4.2 might be involved in the development of esophageal squamous of the specific exons were rare by genomic PCR and direct sequencing cell carcinomas, but the mechanisms for inactivating the gene have not analysis of exons 5-9, although loss of mRNA was frequent in ESC been fully revealed. In the present study, we examined aberrations of the I III! gene in 23 esophageal squamous cell carcinoma cell lines and 35 cell lines. In this study, we examined structural alterations and ex primary tumors. We detected aberrant expression in seven cell lines pression of the FHIT gene in ESC and confirmed frequent loss of (30%), including a shorter transcript in two cell lines and loss of apparent FHIT mRNA in ESC cell lines. These findings suggested that the transcript in five cell lines. Genomic PCR or cDNA sequencing analysis FHIT gene might be involved in the development of ESC. but the revealed a single exon deletion in two cell lines with a shorter transcript mechanism inactivating it remains to be determined. and one cell line without expression, but no structural alterations were Aberrant cytosine methylation at CpG dinucleotide of the 5' CpG found in the other 20 cell lines, including transcriptionally repressed four cell lines. Next we examined methylation of the 5' CpG island of the /â€¢///'/' island was associated with transcriptional repression of tumor sup gene by bisulfite genomic sequencing. Hypermethylation of the 5' CpG pressor genes such as the retinoblastoma gene in retinoblastoma (19), the von Hippel-Lindau gene in renal tumor (20), and the pI6INK4a and island of the I III! gene was observed in three of four structurally pÂ¡Â¡iNK4hgenesÂ¡navariety of human cancers (21, 22), suggesting that unaltered but transcriptionally repressed cell lines. The remaining cell line harbored a point mutation upstream of exon 1. All methylated cell lines it is an important and common mechanism for inactivation of the exhibit re-expression of the /â€¢//// gene and demethylation in the CpG tumor suppressor genes (23, 24). In ESCs, hypermethylation of the 5' island after treatment with demethylating agent 5-aza-2'-deoxycytidine. CpG island in p!6INK4" gene is also associated with loss of expression Hypermethylation was also found in 5 of 35 (14%) primary tumors, (25, 26). Here we examined methylation of the 5' CpG island of the whereas corresponding normal tissue shows no methylation. These find FHIT gene in structurally unaltered ESC cell lines and tumors. We ings suggest that methylation of the 5' CpG island of the /-'//// gene is found transcriptional inactivation of the FHIT gene by hypermethy closely associated with transcriptional inactivation and might be involved lation of the 5' CpG island around exon 1, which was reversible by the in tumor development of the esophagus. treatment with Aza-dC. Hypermethylation was also frequent in pri mary tumors, but not in matched normal tissues. INTRODUCTION Frequent allelic loss was observed on chromosome 3p in ESC4 and MATERIALS AND METHODS its premalignant lesions (1-3), indicating that inactivation of putative Cell Lines and Resected Specimens. Twenty-three cell lines were estab tumor suppressor genes on 3p may be involved in early steps of lished from pathologically confirmed independent primary ESCs and main esophageal carcinogenesis. Ohta et al. (4) identified the FHIT gene on tained in Ham's F12/RPMI 1640 with 2% PCS as described previously (27). 3pl4.2, spanning the FRA3B common fragile site and the t(3;8) break Tumor tissues were obtained from 35 Japanese patients with ESC who under point associated with hereditary renal cell carcinomas. Fhit protein has went surgery at Kyoto University Hospital or Aichi Cancer Center Hospital and stored at -80Â°C. Genomic DNA was extracted from the cell lines and been characterized as an AP3A hydrolase, which cleaves the AP4A substrate, a molecule that might be involved in the control of DNA frozen tumor tissues by using the DNA Extraction Kit (Stratagene). Total RNA replication and cell cycle (5). Introduction of the wild-type FHIT gene was extracted from the cell lines by the RNeasy Total RNA kit and QIA into cancer cells lacking endogenous Fhit protein suppressed tumor- shredder (Qiagen, Inc.). RT-PCR Amplification and Sequencing of the FHIT Gene Transcripts. igenicity in nude mice (6). Highly frequent abnormal transcripts were Three Â¿tgof total RNA from each cell line was reverse transcribed by SUPER found in a variety of human cancers including digestive tract, lung, SCRIPTâ„¢ preamplification system for first strand cDNA synthesis (Life breast, and head and neck cancers (4, 7-13). Point mutations were also Technologies, Inc.). Using this cDNA as a template, a PCR amplification was seen in lung, gastric, and breast cancers (7, 14, 15). Moreover, performed with two pairs of primers, 5U1 (located in exon 3J/3D1 (in exon 10) absence of Fhit protein was frequently observed in lung and cervical or 5RT-F (in exon 5)/3D2 (exon 10; Ref. 4, Table 1), in a Perkin-Elmer Corp. cancers (16, 17). These results indicate a role for the FHIT gene as a 2400 thermal cycler for 40 cycles of 95Â°Cfor 30 s, 58Â°Cfor 30 s, and 72Â°C for 30 s. The PCR product was run on 2% agarose gel and visualized by

Received 3/2/98; accepted 6/3/98. ethidium bromide staining. The integrity of RNA was evaluated by amplifi The costs of publication of this article were defrayed in part by the payment of page cation of human GAPDH mRNA. charges. This article must therefore be hereby marked advertisement in accordance with The PCR products flanked with 5U1 and 3D1 were purified through agarose 18 U.S.C. Section 1734 solely to indicate this fact. 1Supported by Bristol-Myers Squibb Biomedicai Research Grants Program. gel electrophoresis and a QIAEX II gel extraction kit (Qiagen). Using these 2 Present address: Division of Basic Sciences, Fred Hutchinson Cancer Research purified PCR products as a template, the cycle PCR sequencing was performed Center. 1124 Columbia Street. Seattle, WA 98I04-2092. with the Sequencing Pro kit (Toyobo). Primers (5U1, 5RT-F, and 8RT-F) were 3 To whom requests for reprints should be addressed, at the Laboratory of Experimen end-labeled with y 32P-ATP for the cycle sequencing (Table 1). tal Radiology. Aichi Cancer Center Research Institute. I-I. Kanokoden. Chikusa-ku. Exon Deletion Analysis. Deletions Â¡ngenomic sequence were analyzed by Nagoya 464-8681. Japan. Phone: 81-52-762-6111; Fax: 81-52-763-5233. "*The abbreviations used are: ESC, esophageal squamous cell carcinoma: FHIT, fragile Southern hybridization and exon-specific genomic PCR. After digestion with histidine triad; Aza-dC. 5-aza-2'-deoxycytidine; SSCP, single-strand conformational BamH I, Hind III, Xba I, or EcoR V, genomic DNA samples (5 /i g) were size polymorphism. fractionated by 0.7% agarose gel electrophoresis and transferred onto Hy- 3429

Table 1 Primers

Annealing Expression analysis 5U1/3D1 ; TCCGTAGTOCTATCTACAT/CATGCTGATTCAGTTCCTCTTGG 58 Â°C 5RT-F/3D2;GCTCTTGTGAATAGGAAACC/TCACTGGTTGAAGAATACAGG 58 Â°C cDNA sequencing analysis 5U1; TCCGTAGTGCTATCTACAT 5RT-F: GCTCTTGTGAATAGGAAACC 8RT-F; CACGTCCATGTTCTTCCCAGG Bisulfite genomic sequencing analysis Region 1 First U-F/D-R; GAAAAAGTTAAAGATTGTGCGA/AAACGACGCCGACCCCACTAAA 55 'C Nested U-F2/U-R2; AGTTGTGTTTTGTGGTTAGTGTTTTT/AAACTTACCTCCCCGCCCCTAC 65 Â°C Sequencing U-SQ; TAGGGTTATTGTTATTATGGT 62 Â°C Region 2 First D-F/D-R;TTTCGGGTTTTTTAGGCGGTTATTTAGTGGG/ATCCCACCCTAAAACCTCGTAAAAC 60 "C Nested D-F2/D-R;TAGTGGGTATATTTTTAGGCGGCGTT/ATCCCACCCTAAAACCTCGTAAAAC 60 Â°C Sequencing D-SQ; GAAGGTAGGGG(C/T)GGGGAGGTAAGTT 68 "C

bond-N+ nylon membranes (Amersham). A full-length FHIT cDNA probe, RESULTS which was kindly provided by Dr. Kay Huebner (Kimmel Cancer Center, Jefferson Med. Coll., Philadelphia, PA), was labeled with a "P-dCTP by a Aberrant Expression and Exon Deletion of the FHIT Gene in random prime DNA labeling mix (Life Technologies, Inc.). The membranes ESC Cell Lines. Although Ohta et al. (4) reported that aberrant were hybridized with the labeled probe in the rapid hybridization buffer transcripts lacking exons 5 or 8 were frequent in ESC tumors by the (Amersham) and washed under stringent conditions (0.2 x SSC) at 65Â°C.The nested RT-PCR, variant transcripts were also detected by single-stage primer sets for amplifying the genomic sequence of exons 3-8 were as PCR amplification in head and neck cancer and lung cancer (11, 12). described previously (28). PCR amplifications were carried out for 30 cycles To avoid possible overrepresentation of shorter transcripts, we used of 94Â°Cfor 30 s, 55Â°Cfor 30 s, 72Â°Cfor 30 s, and the products were analyzed single stage amplification. RT-PCR amplification revealed a shorter by agarose gel electrophoresis. PCR-SSCP in Low pH Buffer. We screened point mutations of the transcript in two cell lines (KYSE 70 and KYSE 350) and loss of transcript in five cell lines (KYSE 30, KYSE 150, KYSE 170, KYSE genomic sequence of the FHIT gene in 35 tumors and in four cell lines, which exhibited no apparent transcript by using PCR-SSCP in low pH buffer as 273, and KYSE 410; Table 2, Fig. 1A). The other 16 cell lines described previously (29). Briefly. PCR amplification of exons 3-8 was exhibited transcripts identical to the normal mRNA. Of the two cell performed by using o 32P-dCTP as described previously (28). The labeled PCR lines exhibiting a shorter transcript, KYSE 70 showed deletion of product was diluted with formamide dye and heat denatured for 5 min at 95Â°C exon 4 by exon-specific PCR (Fig. In), Southern blotting (Fig. 1C), followed by electrophoresis at 40 W, 25Â°Cfor 2 h in the TME buffer pH 6.8 and sequencing analysis. KYSE 350 exhibited normal transcript in (30 min Tris, 35 mM MES, and 1 mM Na2EDTA). A 5% neutral polyacrylamide addition to a shorter band by RT-PCR using primer sets 5RT-F/3D2, gel was also contained TME buffer. Samples with shifted bands were further and sequencing analysis of a shorter transcript revealed loss of exon analyzed by direct sequencing. 8 (data not shown). However, no deletion or point mutation at the Bisulfite Genomic Sequencing. Conversion of nonmethylated cytosine splice acceptor site of intron 7 was detected by genomic analysis. residues to uracils in genomic DNA by treating with bisulfite was performed as described previously (30). Briefly, 5 /xg of genomic DNA was digested with Therefore, regarding the FHIT gene, there might be some subpopu restriction enzyme Hind III in 90 fil of reaction mixture, and then denatured lations in this cell line as reported previously by fluorescence in situ with 10 fi\ of 3 M NaOH at 37Â°Cfor 15 min, followed by incubating with 1040 hybridization analysis of head and neck cancer cell lines (10). /xi of freshly prepared 3.6 M sodium bisulfite, pH 5.0 (Wako Pure Chemicals, In five cell lines without apparent FHIT transcript, exon-specific Inc., Osaka. Japan), and 50 (xl of freshly prepared 10 mM Hydroquinon (Wako PCR analysis (Fig. IÃŸ)andBamH I or Hind III cleaved Southern blots Pure Chemicals, Inc.) for 16 h at 50Â°Cunder mineral oil. After bisulfite (data not shown) revealed a deletion of exon 5 in KYSE 410. How treatment, DNA was desalted with a QIAEX II gel extraction kit (Qiagen, ever, in the other four cell lines, deletion of exons 3-8 was not Inc.), denatured with 22 /xl of 3 M NaOH at 37Â°Cfor 15 min, precipitated with detected by genomic PCR (Fig. 15), and no gross rearrangement was 140 /xl of 5 M NH4Oac pH 7 and 900 /il of ethanol, and resuspended in 100 /j.1 found by Southern blot analysis (Fig. 1C). Genomic and cDNA of 10 mM Tris-HCI pH 8.5. For sequencing analysis, we divided the 5' CpG island, including exon 1, sequencing revealed only T to C transition at codon 98, which has into two parts; the sequence including 5' of exon 1 and exon 1 (region 1), and been reported as a normal polymorphism before (11). the sequence in intron 1 (region 2; Fig. 2). Primer sets were designed according In summary, the deletion of a single exon was detected in two cell to Clark et al. (30) to contain a minimal number of CpG dinucleotides (Table lines exhibiting a shorter transcript and one cell line without expres 1). Two jitl of bisulfite treated DNA was amplified with the primer sets of sion. However, no genomic alteration was found in four cell lines with U-F/U-R for region 1 and D-F/D-R for region 2. To obtain products for loss of expression. sequencing, a second round PCR was performed with nested primers U-F2/ U-R2 for region 1 and D-F2/D-R for region 2. PCR conditions were as follows: 95Â°Cfor 5 min, followed by 30 cycles of 95Â°Cfor 30 s, 55Â°C-65Â°Cfor 30 s, Table 2 Structure and expression of the FHIT gene in ESC cell lines" 72Â°Cfor 30 s, and finally 72Â°Cfor 7 min in a Perkin-Elmer Corp. 2400 thermal cycler (Table 1). A PCR product was purified with SUPREC-2 (Takara), and structureWild region 1 was cycle-sequenced with U-SQ primer at an annealing temperature KYSE30KYSE typeDeletion of 62Â°C, whereas region 2 was cycle-sequenced with D-SQ primer at an 70KYSE transcriplNoneNoneNoneWild 4Wild of exon annealing temperature of 68Â°C using Sequencing Pro (Toyobo). Bisulfite 150KYSE typeWild 170KYSE typeWild sequencing was done at least twice in each cell line and tumor. 273KYSE typeWild Aza-dC Treatment. Cells (5 X IO5) were plated into 10-cm dish and 350KYSE transcriptNoneGenomictype and shorter exonDeletiontype and deletion of exposed to Aza-dC (Sigma Chemical Co.) at a final concentration of 1-2 JIM 410ExpressionNoneShorter of exon 58 for 3 days. "The other 16 cell lines exhibit wild type transcripts. 3430

CpG index of 0.7. Both CpG density and CpG index exceeded 6% and o o 0.6, respectively, which were previously reported as definitions of O O O T- CO O O Â§1 CpG island (31, 32). This sequence contained three Spl binding sites S LULUUJUJUJUJUJUJUJLiJ LU LU LU LU LU that are necessary to keep the CpG island methylation free (33). These PPPPPPPPPP Â« W W W CO Â»Â§ data defined this region of the FHIT gene as a CpG island. We analyzed this CpG island for cytosine methylation by bisul fite genomic sequencing (30). Bisulfite is known to change non- FHIT methylated cytosines into uracils while leaving methylated cytosines unchanged. We found methylation of cytosine residues at CpG dinucleotides in three of four structurally unaltered, transcrip G3PDH tionally repressed cell lines. Two cell lines (KYSE 150 and KYSE 170) exhibited methylated cytosine residues at CpG dinucleotides B in both regions 1 and 2, whereas one cell line (KYSE 30) showed methylation exclusively at 8 cytosine residues of CpG dinucleo -= tides in region 1 (Fig. 2 and Fig. 3A). A thymine band was also luuiuiujuiujiuuiuiuiiJiiJ Â£ seen with cytosines at some CpG sites in KYSE 150 and KYSE PPPPPPPPPPPP>>â€¢>â€¢>->->â€¢>->â€¢>â€¢>>->â€¢oE kkkkkkkkkkkkz 170, but cytosines were exclusively observed in most of the CpG sites. In the remaining cell line, KYSE 273, bisulfite genomic sequencing didn't detect hypermethylation but happened to reveal T to G transversion at the 71st bp upstream of exon 1. However, we have not yet evaluated the effect of this single base change, and the relationship to loss of expression remains unclear. We next inves tigated aberrant methylation in 10 cell lines, in which wild-type mRNA were detected. All cytosines at CpG sites were converted to thymines in these cell lines, indicating that they were not methy lated in the CpG island of the FHIT gene (Fig. 3A). We also examined hypermethylation with structurally altered cell lines (KYSE 350 and KYSE 410), and methylation was not detected in them. To determine whether the observed methylation of the CpG island actually blocked expression of the FHIT gene, we treated three meth ylated cell lines with 1-2 Â¿AMofAza-dC for 3 days. RT-PCR showed that, after Aza-dC treatment, all these cell lines re-expressed mRNA of the FHIT gene, the size of which was equal to that of normal transcript (Fig. 3ÃŸ).Bisulfite genomic sequencing revealed that ---Â«t Aza-dC led to demethylation of all of the cytosines at CpG sites (Fig. 9.4k_ 3C). We also performed Aza-dC treatment with KYSE 410 which showed a deletion of exon 5 and loss of expression, but re-expression 6.5k_ was not observed (data not shown). These data suggest that, in ESC cell lines without any structural alteration, hypermethylation at CpG sites is the important mechanism for transcriptional inactivation of the FHIT gene. 4.3k_ 5' CpG Island Methylation in Primary ESC. We also deter mined whether aberrant methylation was present in primary ESC Fig. 1. Alleration of the FHIT gtne in ESC cell lines, /l. RT-PCR analysis of the FHIT tumors. PCR-SSCP and Southern analysis revealed no genomic alter transcript in ESC cell lines using primer sets of 5U1/3D1. Wild type transcript exhibits a 707 bp fragment. A shorter transcript is found in KYSE 70 and KYSE 350. An apparent ations in these tumors. Five of 35 tumors showed hypermethylation in band is not observed in KYSE 30. KYSE 150, KYSE 170. KYSE 273, or KYSE 410. B, region 2 of the CpG island by bisulfite genomic sequencing (14%; exon-specific genomic PCR of the FHIT gene. Respective deletions of exon 4 in KYSE Fig. 4). In these tumors, thymine residues were seen with cytosines at 70 and exon 5 in KYSE 410 are shown. Deletion is not found in KYSE 30, KYSE 150, KYSE 170, or KYSE 273, all of which are transcriptionally repressed. C. Southern CpG sites, which might be derived from DNA of contaminating blotting analysis of the Xba I digested DNA of ESC cell lines. KYSE 70 shows loss of normal tissues. In contrast, bisulfite treated DNA obtained from 14kb fragment, which was reported to contain exon 4 (281. In KYSE410 loss of fragment is not seen because each fragment containing exon 5 or 8 exhibits the same length (28). corresponding normal esophageal tissues of these five tumors did not In the other cell lines, apparent changes are not found in Xba I cleavage. exhibit any methylation. Since RNA samples with good quality were not obtained from these tumors, we could not know whether they exhibited aberrant expression of the FHIT gene or not. Transcriptional Block of the ///// Gene by 5' CpG Island

Methylation in ESC Cell Lines. To examine hypermethylationof DISCUSSION the CpG island of the FHIT gene in the four cell lines that were structurally unaltered but transcriptionally repressed, we searched for Recent analysis revealed frequent absence of Fhit protein in immu- the presence of the 5' CpG island in the previously reported genomic nohistochemistry and concordant aberrant mRNA transcript in lung sequence around the first exon of the FHIT gene (GenBank accession and cervical cancers (16, 17). An aberrant mRNA transcript correlates number, U76263 and U76262; Fig. 2). The genomic sequence from with a deletion of some coding exons in a variety of human cancers -95 to +365 bases relative to the transcription start site exhibited GC (11, 12, 28). These data suggest that genomic deletions may give rise content of 66.5%, CpG density of 7.8%, and an observed/expected to aberrant mRNA, resulting in loss of Fhit protein in tumor cells. 3431

K26 K25 K23 III IC12 KYSE170 * * â€¢¿ * KYSE150 â€¢¿ â€¢¿â€¢¿ . KYSE 30 â€¢¿ â€¢¿â€¢¿ io7ggcccggcataggcgcatgctctgcgcgtattggcctccgctcctgtcccc K25 K23 K18 113 no â€¢¿ Â« â€¢¿ 150 * Â« 30 -56agacaagcggccatcttgggtcccgcccctaccgtggggtgttgtgggaat K26 K2S K23 K18 K12 170 â€¢¿ â€¢¿ 150 â€¢¿ â€¢¿ 30 5 tgcagTCCCCGCTCTGCTCTGTCCGGTCACAGGACTTTTTGCCCTCTGTTC K26 as K23 K18 K12 170 â€¢¿ ... 150 â€¢¿ ... 30 ... Â«7CCGGGTCCCTCAGGCGGCCACCCAGTGGGCACACTCCCAGGCGGCGCTCCG K26 FC2S K23 K18 IU2 170 * * 150 * â€¢¿ 30 â€¢¿â€¢¿ 98 GCCCCGCGCTCCCTCCCTCTGCCTTTCATTCCCAGCTGTCAACATCCTGGA K26 IC25 Â« â€¢¿ K23 K18 K12 .. 170 .. 150 . Â« 30 AGgtaggggcggggaggcaagcccaagtggaatactgtttctggggcgcgg K26 K25 K23 K18 K12 170 150 30 gtntgggtttccacgcgcgtcaggtcatcaccccggagcccagtggggccg K26 K25 K23 â€¢¿ K18 * K12 170 â€¢¿ 150 â€¢¿ 30 251gcgccgctcacggggcg-gtgggcttctgtcccgagtatcttccgcccc

Fig. 2. 5 ' CpG island of the FHIT gene. Capital letters represent sequence of exon 1. Italicized letters indicate a putative Sp 1 binding site. Distribution of methylated cytosines at CpG sites in each cell line and tumor is shown by asterisks (*). CpG dinucleotide without underline is not evaluated. A thymine residue double-underlined is changed to a guanine in KYSE 273.

Although Fhit protein expression has not yet been studied thus far in region 2 and methylation at each CpG site was not complete partly ESC, deletion of some exons of the FHIT gene was reported in ESC because of contamination of normal cells. Further study on FHIT cell lines (18). In the present study, we found deletion of exon 4 in mRNA and protein in primary tumors is required to demonstrate that KYSE 70 and deletion of exon 5 in KYSE 410, both of which showed the methylation is actually involved in repression of the FHIT gene an aberrant transcript. Therefore, aberrant expression caused by de and plays a roll in a carcinogenic pathway of ESC. letion of some exons seems to be a common mechanism impairing the The distribution of methylated cytosines within each cell line and FHIT gene in ESC. In addition, we present here that hypermethylation tumor was heterogeneous. Of the three cell lines, KYSE 150 and of the 5' CpG island was shown in structurally unaltered, transcrip- KYSE 170 harbored methylated cytosine at CpG sites throughout the tionally repressed cell lines, and these transcriptional blocks were CpG island, whereas KYSE 30 showed it only at eight CpG sites. reversible by treatment with Aza-dC. These data suggest that 5' CpG Furthermore, in KYSE 150 and KYSE 170, thymine bands, which island methylation represents an alternative pathway for silencing of represented unmethylated cytosine, were seen with cytosines at some the FHIT gene in ESCs with a structurally unaltered FHIT gene. The CpG sites, indicating that methylation occurred partially at such CpG fact that methylated cytosines at CpG dinucleotides were observed in sites. However, the re-expression of by 5-deoxyazacytidine treatment primary tumors, but not in corresponding normal tissues, indicates in all three cells might mean that a transcriptional block was acquired that this specific form of methylation is actually involved in neoplastic by methylation at restricted CpG sites. In support of this, Bird and transformation. However, methylation in primary tumors was only in colleagues (34, 35) have identified a repressor MeCP2 that binds to 3432

Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 1998 American Association for Cancer Research. HYPERMETHYLATION OF FH1T IN ESC only a single methyl CpG and represses transcription. They also K12 K23 K25 showed that repression was invariably strong when the density of Tumor Normal Tumor Normal Tumor Normal methyl CpGs was more than 2/100 bp. From this point of view, only GATC GATC GATC GATC GATC GATC the eight methyl CpGs seen in KYSE 30 and the heterogeneous Â£ I.

KYSE 30 KYSE 150 KYSE 170 KYSE 180 KYSE 201 KYSE 273 KYSE 520 L: â€¢¿;.L:i: GATC GATC GATC GATC GATC GATC GATC :â€¢ iÂ« * -\ ÃŽ-ÃŽ'iâ€¢¿-â€¢ !â€¢*Â¿*,*'-'â€¢i*â€¢¿'4-! U- -i- i li ;* .! V: C V :: C V :Â¿ m â€ž¿ .1:T U5 'l^ i I ^"l :i.Â« i l 'l ,1 '-f 'f Â»'l â€¢¿:'.1 1 1 * '-! 'j '.' U- ÃŽ-! -r 4 Â» I

Fig. 4. Hypermethylation of the region 2 in the 5' CpG island in primary tumors. Cytosine residues are found exclusively in tumors (arrowheads) in bisulfite genomic sequencing, from 185 (bottom) to 270.

FHIT distribution of methyl CpGs detected in primary tumors would sug gest that some sites are independently involved in the transcriptional block of the FHIT gene. In the four cell lines harboring structurally unaltered, transcriptionally repressed FHIT gene, three exhibited 5' CpG island methylation. The remaining cell line, KYSE 273, did not show hypermethylation, but harbored a single base change in the 5' region of exon 1. This KYSE 30 KYSE 150 KYSE 170 Aza(-) Aza(+) Aza(-) Aza(+) Aza(-) Aza(+) point mutation in the promoter region may be associated with tran scriptional block as previously reported in the RB gene (36). However, GATC GATC GATC GATC GATC GATC additional studies are needed to clarify whether this point mutation actually gave rise to a transcriptional block and to determine whether point mutations of the 5' of exon 1 occur in a variety of human cancers. In conclusion, we found that methylation of the 5' CpG island is also an important mechanism for the inactivation of the FHIT gene in ESC. However, the possible role of this mechanism in other types of .ft. - human cancer remains to be determined in future studies.

ACKNOWLEDGMENTS

We thank Dr. Kay Huebner for providing a FHITcDNA probe. We are also Fig. 3. Methylation of the CpG island of the FHIT gene in ESC. A, bisulfite genomic indebted to Dr. Nobuhiro Uchhida for assistance in the Aza-dC treatment, to sequencing of the region I in the 5' CpG island of the FHIT gene, in which nonmethylated Sakiko Shimada for establishing and maintaining cell lines, and to Yukiyo cytosines are changed to thymines and methylated cytosines exhibit bands in C lanes. Sequences corresponding to that from â€”¿86(bottom)to â€”¿14inFig. 2 are shown. Arrowheads Mimaki for useful information on bisulfite genomic sequencing. indicate methylated cytosine residues. KYSE 30, KYSE 150, and KYSE 170, all of which are transcriptionally repressed but structurally unaltered, exhibit methylated cytosine residues. KYSE 273, which is also deficient of apparent transcript, shows point mutation (*). B, REFERENCES re-expression of the FHIT mRNA by the treatment of Aza-dC in hypermethylated ESC cell lines. All three cell lines show recovery of transcription after treatment ( + ). C, Partial 1. Shibagaki, I., Shimada. Y., Wagata. T.. Ikenaga, M., Imamura. M.. and Ishizaki, K. demethylation of the 5' CpG island after Aza-dC treatment. Representative regions are shown. Allelotype analysis of esophageal squamous cell carcinoma. Cancer Res., 54: 2996- Sequences presented are from -92 (bottom) to -55 in KYSE 30, from 191 (bottom) to 226 3000, 1994. in KYSE 150, and from 203 (bottom) to 244 in KYSE 170. Thymine residues appeared in 2. Mori, T., Yanagisawa, A., Kato, Y., Miura, K., Nishihira, T., Mori, S., and Nakamura, addition to cytosines after Aza-dC treatment (arrowheads). Other methylated CpG sites which Y. Accumulation of genetic alterations during esophageal carcinogenesis. Hum. Mol. are not shown here also exhibited partial demethylation after Aza-dC treatment. Genet., 3: 1969-1971, 1994. 3433

3. Ogasawara. S., Maesawa. C.. Tamura. G., and Satodate, R. Frequent microsalellite 19. Sakai, T.. Toguchida, J.. Ohtani. N.. Yandell. D. W.. Rapaport. J. M.. and Dryja, T. P. alterations on chromosome 3p in esophageal squamous cell carcinoma. Cancer Res., Allele-specific hypermethylation of the retinoblastoma tumor-suppressor gene. Am. J. 55: 891-894, 1995. Hum. Genet., 48: 880-888, 1991. 4. Ohta. M., [noue. H., Cotticelli, M. G.. Kastury, K.. Baffa, R., Palazzo. J., Siprashvili, 20. Herman. J. G.. Latif. F., Weng. Y.. Lerman. M. I., Zbar. B., Liu. S.. Samid. D.. Duan, Z., Mori, M., McCue, P., Druck, T.. Croce, M., and Huebner, K. The FHIT gene, D. S., Gnarra. J. R., Linehan, W. M., and Baylin. S. B. Silencing of the VHL spanning the chromosome 3pl4.2 fragile site and renal carcinoma-associated t(3;8) tumor-suppressor gene by DNA methylation in renal carcinoma. Proc. Nati. Acad. breakpoint, is abnormal in digestive tract cancers. Cell, 84: 587-597, 1996. Sci. USA. 91: 9700-9704, 1994. 5. Barnes. L. D., Garrison, P. N.. Siprashvili, Z.. Guranowski, A., Robinson, A. K., 21. Merlo, A., Herman. J. G.. Mao, L., Lee, D. J., Gabrielson, E., Burger, P. C., Baylin. Ingram. S. W., Croce. C. M., Ohta. M., and Huebner. K. Fhit, a putative tumor S. B., and Sidransky, D. 5' CpG island methylation is associated with Iranscriptional suppressor in humans, is a dinucleotide 5',5'"-Pl, P3-triphosphate hydrolase. Bio silencing of the tumour suppressor pl6/CDKN2/MTSl in human cancers. Nat. Med.. chemistry, 35: 11529-11535, 1996. /: 686-692. 1995. 6. Siprashvili, Z., Sozzi, G., Barnes, L. D.. McCue. P., Robinson. A. K., Eryomin, V.. 22. Herman, J. G., Merlo, A., Mao. L.. Lapidus, R. G., Issa. J. P., Davidson, N. E., Sard, L.. Tagliabue, E., Greco, A., Fusetti, L., Schwartz, G., Pierotti, M. A., Croce, C. M., and Huebner. K. Replacement of Fhit in cancer cells suppresses tumorigenic- Sidransky, D., and Baylin. S. B. Inactivation of the CDKN2/pl6/MTSl gene is ity. Proc. Nati. Acad. Sci. USA, 94: 13771-13776, 1997. frequently associated with aberrant DNA methylation in all common human cancers. Cancer Res.. 55: 4525-4530, 1995. 7. Sozzi. G., Veronese, M. L., Negrini, M., Baffa, R., Cotticelli, M. G., Inoue, H., 23. Jones P. A. DNA methylation errors and cancer. Cancer Res.. 56: 2643-2647, 1996. Tornielli. S.. Piloni, S., De Gregorio, L., Pastorino. U., Pierotti, M. A., Ohta. M., 24. Bender. C. M.. Pao. M., and Jones, P. A. Inhibition of DNA methylation by Huebner. K., and Croce, C. M. The FHIT gene 3pl4.2 is abnormal in lung cancer. 5-aza-2'-deoxycytidine suppresses the growth of human tumor cell lines. Cancer Res.. Cell, 85: 17-26, 1996. 58: 95-101, 1997. 8. Sozzi. G.. Alder, H.. Tornielli. S., Corletto. V.. Baffa, R., Veronese. M. L., Negrini, M.. Piloni. S.. Pierotti. M. A., Huebner, K., and Croce, C. M. Aberrant FHIT 25. Maesawa, C.. Tamura, G.. Nishizuka. S., Ogasawara, S., Ishida, K.. Terashima, M., transcripts in Merkel cell carcinoma. Cancer Res., 56: 2472-2474, 1996. Sakata. K., Sato, N., Saito. K.. and Satodate. R. Inactivation of the CDKN2 gene by 9. Negrini. M., Monaco, C., Vorechovsky, I., Ohta. M., Druck. T.. Baffa, R.. Huebner. homozygous deletion and de novo methylation is associated with advanced stage K., and Croce, C. M. The FHIT gene at 3pl4.2 is abnormal in breast carcinomas. esophageal squamous cell carcinoma. Cancer Res., 56: 3875-3878. 1996. Cancer Res., 56: 3173-3179. 1996. 26. Tanaka. H., Shimada. Y.. Imamura, M., Shibagaki. I., and Ishizaki, K. Multiple types 10. Virgilio. L., Shuster. M.. Gollin. S. M., Veronese, M. L., Ohta, M., Huebner, K.. and of aberrations in the pl6 (INK4a) and the pl5(INK4b) genes in 30 esophageal Croce. C. M. FHIT gene alterations in head and neck squamous cell carcinomas. Proc. squamous-cell-carcinoma cell lines. Int. J. Cancer. 70: 437-442, 1997. Nati. Acad. Sci. USA, 9.?: 9770-9775, 1996. 27. Shimada. Y.. Imamura, M., Wagata, T.. Yamaguchi. N., and Tobe, T. Characteriza 11. Mao. L., Fan. Y. H.. Lotan. R.. and Hong. W. K. Frequent abnormalities of FHIT. a tion of 21 newly established esophageal cancer cell lines. Cancer (Phila.). 69: candidate tumor suppressor gene, in head and neck cancer cell lines. Cancer Res., 56: 277-284, 1992. 5128-5131. 1996. 28. Druck, T., Hadaczek, P., Fu, T. B., Ohta. M.. Siprashvili, Z.. Baffa. R.. Negrini. M.. 12. Yanagisawa, K.. Kondo. M.. Osada, H., Uchida. K.. Takagi, K.. Masuda, A.. Kastury, K., Veronese, M. L., Rosen, D., Rolhstein, J.. McCue, P.. Cotticelli, M. Gâ€ž Takahashi. T., and Takahashi. T. Molecular analysis of the FHIT gene at 3pl4.2 in Inoue, H., Croce. C. M., and Huebner, K. Structure and expression of the human lung cancer cell lines. Cancer Res., 56: 5579-5582, 1996. FHIT gene in normal and tumor cells. Cancer Res.. 57: 504-512. 1997. 13. Inoue, H., Ishii. H., Alder, H., Snyder, E., Druck, T., Huebner, K.. and Croce, C. M. 29. Kukita, Y., Tahira, T., Sommer, S. S., and Hayashi, K. SSCP analysis of long DNA Sequence of the FRA3B common fragile region: implications for the mechanism of fragments in low pH gel. Hum. MutÃ¢t.,10: 400-407, 1997. FHIT deletion. Proc. Nati. Acad. Sci. USA, 94: 14584-14589, 1997. 30. Clark, S. J.. Harrison, J., Paul, C. L., and Frommer. M. High sensitivity mapping of 14. Gemma, A.. Hagiwara, K., Ke. Y., Burke, L. M.. Khan. M. A.. Nagashima, M.. methylated cytosines. Nucleic Acids Res., 22: 2990-2997, 1994. Bennett. W. P., and Harris. C. C. FHIT mutations in human primary gastric cancer. 31. Graff, J. R., Herman, J. G.. Myohanen, S.. Baylin. S. B., and Venino. P. M. Mapping Cancer Res., 57: 1435-1437. 1997. patterns of CpG island methylation in normal and neoplastic cells implicates both 15. Ahmadian, M.. Wistuba. I. I., Fong, K. M.. Behrens, C.. Kodagoda, D. R.. Saboorian. upstream and downstream regions in de nom methylation. J. Biol. Chem., 272: M. H., Shay, J., Tomlinson. G. E., Blum, J., Minna J. D., and Gazdar, A. F. Analysis 22322-22329. 1997. of the FHIT gene and FRA3B region in sporadic breast cancer, preneoplastic lesions, 32. Gardiner-Garden. M., and Frommer. M. CpG islands in vertebrate genomes. J. Mol. and familial breast cancer probands. Cancer Res., 57: 3664-3668, 1997. Biol., /96: 261-282, 1987. 16. Sozzi, G., Tornielli, S., Tagliabue, E., Sard. L., Pezzella. F., Pastorino. U.. Minoletti. 33. BrandÃ©is.M.. Frank. D.. Keshet. I.. Siegfried. Z.. Mendelsohn. M.. Nemes, A., F., Pilotti. S., Ratcliffe. C.. Veronese, M. L., Goldstraw. P., Huebner. K.. Croce, C. M., and Pierotti. M. A. Absence of Fhit protein in primary lung tumors and cell Temper. V.. Razin. A., and Cedar, H. Spl elements protect a CpG island from de novo lines with FHIT gene abnormalities. Cancer Res.. 57: 5207-5212. 1997. methylation. Nature (Lond.), 371: 435-438, 1994. 34. Lewis, J. D.. Meehan. R. R.. Henzel. W. J.. Maurer-Fogy. I.. Jeppesen. P., Klein, F., 17. Greenspan. D. L.. Connolly. D. C.. Wu, R.. Lei, R. Y., Vogelstein, J. T., Kim, Y. T., Mok. J. E.. MuÃ±oz. N.. Bosch, F. X., Shah, K., and Cho, K. R. Loss of FHIT and Bird. A. Purification, sequence, and cellular localization of a novel chromosomal protein that binds to methylated DNA. Cell, 69: 905-914, 1992. expression in cervical carcinoma cell lines and primary tumors. Cancer Res., 57: 4692-4698, 1997. 35. Nan, X., Campoy, F. J., and Bird, A. MeCP2 is a transcriptional represser with 18. Zou, T. T., Lei, J., Shi, Y. Q., Yin, J., Wang, S., Souza, R. F., Kong, D., Shimada, Y., abundant binding sites in genomic chromatin. Cell, 88: 471-481, 1997. Smolinski, K. N., Greenwald, B. D., Abraham, J. M., Harpaz, N.. and Meltzer, S. J. 36. Sakai, T.. Ohtani, N., McGee, T. L.. Robbins, P. D., and Dryja, T. P. Oncogenic FHIT gene alterations in esophageal cancer and ulcerative colitis (UC). Oncogene. germ-line mutations in Spl and ATF sites in the human retinoblastoma gene. Nature 15: 101-105, 1997. (Lond.). 353: 83-86, 1991.

3434

Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 1998 American Association for Cancer Research. Methylation of the 5′ CpG Island of the FHIT Gene Is Closely Associated with Transcriptional Inactivation in Esophageal Squamous Cell Carcinomas

Hisashi Tanaka, Yutaka Shimada, Hideki Harada, et al.

Cancer Res 1998;58:3429-3434.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/58/15/3429

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/58/15/3429. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.