SOCS1 and SOCS3 Target IRF7 Degradation to Suppress TLR7-Mediated Type I IFN Production of Human Plasmacytoid Dendritic Cells

Published April 30, 2018, doi:10.4049/jimmunol.1700510 The Journal of Immunology

SOCS1 and SOCS3 Target IRF7 Degradation To Suppress TLR7-Mediated Type I IFN Production of Human Plasmacytoid Dendritic Cells

Chun-Feng Yu,* Wen-Ming Peng,* Martin Schlee,† Winfried Barchet,† Anna Maria Eis-Hu¨binger,‡ Waldemar Kolanus,x Matthias Geyer,{ Sebastian Schmitt,{ Folkert Steinhagen,‖ Johannes Oldenburg,# and Natalija Novak*

Type I IFN production of plasmacytoid dendritic cells (pDCs) triggered by TLR-signaling is an essential part of antiviral responses and autoimmune reactions. Although it was well-documented that members of the cytokine signaling (SOCS) family regulate TLR- signaling, the mechanism of how SOCS proteins regulate TLR7-mediated type I IFN production has not been elucidated yet. In this article, we show that TLR7 activation in human pDCs induced the expression of SOCS1 and SOCS3. SOCS1 and SOCS3 strongly suppressed TLR7-mediated type I IFN production. Furthermore, we demonstrated that SOCS1- and SOCS3-bound IFN regulatory factor 7, a pivotal transcription factor of the TLR7 pathway, through the SH2 domain to promote its proteasomal degradation by lysine 48-linked polyubiquitination. Together, our results demonstrate that SOCS1/3-mediated degradation of IFN regulatory factor 7 directly regulates TLR7 signaling and type I IFN production in pDCs. This mechanism might be targeted by therapeutic ap- proaches to either enhance type I IFN production in antiviral treatment or decrease type I IFN production in the treatment of autoimmune diseases. The Journal of Immunology, 2018, 200: 000–000.

ype I IFNs (IFN-a/b) are well documented pleiotropic receptor-associated kinase 4-TNF receptor-associated factor 6 cytokines with antiviral activities that enable them to complexes, which further interact with other signal transduction T interfere with virus replication as well as immune mod- proteins to phosphorylate and activate IFN regulatory factor (IRF) ulation by the activation of APC, B, and T cells (1). They act as 7 for dimerization and nuclear translocation to initiate the tran- key mediators of both innate and adaptive immunity (1). Although scription of type I IFNs (4–6). many cell types are able to produce type I IFNs in response to Type I IFNs from activated pDCs are important for the immune pathogen infection, plasmacytoid dendritic cells (pDCs) are con- homeostasis of the host. It has been widely reported that aberrant IFN- sidered the “professional” type I IFN–producing cells because a/b production of pDCs triggered by self-RNA/DNA is responsible they are capable of secreting up to 1000 times more IFN-a/b upon for the development or perpetuation of autoimmune diseases, such as activation than other cell types (2, 3).Type I IFN production by systemic lupus erythematodes, psoriasis, dermatomyositis, and type I pDCs is controlled by the endosomal pathogen recognition re- diabetes, through maturation of DCs and differentiation of autoreactive ceptors (PRRs) TLR 7 and 9, which recognize viral ssRNA and T and B cells (5–8). Therefore, theproductionoftypeIIFNbypDCs unmethylated CpG motifs in the dsDNA, respectively (4). Acti- has to be tightly controlled. In recent years, suppressor of cytokine vation of TLR7 or TLR9 leads to the assembly of MyD88–IL-1 signaling (SOCS) proteins have elicited interest as negative regulators of type I IFN and proinﬂammatory cytokine signaling (9, 10). Func- tions of type I IFNs are suppressed by SOCS proteins through inhi- *Department of Dermatology and Allergy, University of Bonn, 53127 Bonn, Germany; †Institute of Clinical Chemistry and Pharmacology, University of bition of cytokine receptor–JAK-STAT signaling. SOCS proteins Bonn, 53127 Bonn, Germany; ‡Institute of Virology, University of Bonn, 53127 Bonn, structurally share a variable N-terminal region, a central SH2 domain, Germany; xDepartment of Molecular Immune and Cell Biology, Life and Medical Sciences Institute, University of Bonn, 53127 Bonn, Germany; {Institute of Innate a conserved C-terminal SOCS box domain, and an N-terminal ex- Immunity, Department of Structural Immunology, University of Bonn, 53127 Bonn, tended SH2 subdomain (ESS) (9, 10). The SH2 domain is responsible ‖ Germany; Department of Anesthesiology and Intensive Care Medicine, University of for interaction with substrates through recognition of phosphorylated Bonn, 53127 Bonn, Germany; and #Institute of Experimental Hematology and Trans- fusion Medicine, University of Bonn, 53127 Bonn, Germany tyrosine residues, whereas an N-terminal ESS enhances substrate in- ORCID: 0000-0002-3043-1085 (S.S.). teraction (10). The SOCS box recruits Elongin B/C, Cullin-5, Rbx2, and E2 ubiquitin transferase to form an E3 ligase complex that tags Received for publication April 10, 2017. Accepted for publication April 10, 2018. target proteins with ubiquitin for proteasome-mediated degradation This work was supported by Deutsche Forschungsgemeinschaft Grant SFB704, a Cluster of Excellence ImmunoSensation grant, and a Christine Ku¨hne – Center for (11). In addition, SOCS1 and SOCS3 use a unique kinase inhibitory Allergy Research and Education grant. region (KIR) as pseudosubstrate to JAKs (12, 13). Address correspondence and reprint requests to Dr. Natalija Novak, Department of The importance of SOCS proteins in regulating type I IFN Dermatology and Allergy, University of Bonn, Sigmund-Freud-Strasse 25, 53127 production is partially mirrored by the fact that some viruses target Bonn, Germany. E-mail address: [email protected] SOCS proteins to dampen antiviral immunity of the host. For Abbreviations used in this article: co-IP, coimmunoprecipitation; ESS, extended SH2 a b subdomain; HA, hemagglutinin; IAV, inﬂuenza A virus; IB, immunoblotting; IP, example, Hepatitis C virus and HSV 1 impair IFN- / signal immunoprecipitation; IRF, IFN regulatory factor; KIR, kinase inhibitory region; transduction through induction of SOCS3 expression in human pDC, plasmacytoid dendritic cell; PRR, pathogen recognition receptor; SOCS, sup- hepatoma cells and amniotic cells (14, 15). Hepatitis B virus pressor of cytokine signaling. upregulates SOCS1 expression to suppress TLR9–mediated Copyright Ó 2018 by The American Association of Immunologists, Inc. 0022-1767/18/$35.00 IFN-a production in human pDCs (16). Furthermore, respiratory

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1700510 2 SOCS1/3 TARGET IRF7 TO SUPPRESS TLR7 IN HUMAN pDCs syncytial virus induces expression of SOCS1 in mouse lung epi- For gene overexpression experiments, 2 3 106 CAL-1 cells were trans- thelial cells and SOCS3 in human bronchial epithelial cells; both fected with 2 mg Flag-tagged SOCS plasmid or control plasmid pcDNA3.1 result in decreased secretion of type I IFNs (17, 18). Accumulating using Nucleofector II (Y-001, Human Monocyte Nucleofector Kit; Lonza). Transfected CAL-1 cells were recovered in 1 ml 5% FCS RPMI 1640 evidence implies that SOCS proteins modulate TLR-mediated medium for 16 h and then starved in 2.5% FCS RPMI 1640 medium for 2 h signaling, and vice-versa TLR-signaling modulates SOCS protein prior to further stimulation. expression in various cell types (10, 19). For example, SOCS1- 293XL-hTLR7 cells (with stable expression of human TLR7) (Invivo- deficient DCs were hyper-responsive to LPS and SOCS12/2 Gen) and 293T cells (ATCC) were cultured according to manufacturer’s instructions. Twenty four hours before transfection, 1.5 3 105 293T cells/ mice developed systemic autoimmune-like diseases (20). It has well or 3 3 105 293XL-hTLR7 cells/well were seeded into 24-well plates been shown that the expression of SOCS1 and SOCS3 can be induced in 500 ml DMEM medium. Alternatively, 1 3 106 HEK293 cells/well or by TLR4 or TLR9 activation (19, 21, 22). As a feedback of TLR 3 3 106 293XL-hTLR7 cells/well were seeded into six-well plates in activation, SOCS1 suppresses the TLR-MyD88–dependent activation 2 ml DMEM medium. Cells were transfected with 0.8 ∼ 2 mg plasmid ∼ m of NF-kB by targeting MyD88-adaptor–like protein (MAL), IL-1 DNA using 2 4 l Lipofectamine 3000 (Thermo Fisher Scientific, Schwerte, Germany), following the manufacturer’s instructions. receptor-associated kinase, p65 for ubiquitination and degradation (10, 13, 23) and controls MAPKs cascades by binding to apoptosis Plasmids and reagents signal-regulating kinase 1 (10). Furthermore, SOCS3 prevents NF- k The Flag-tagged SOCS1 and SOCS3 plasmids were kindly provided by Dr. A. B–dependent transcription by inhibiting the association between Yoshimura (Keio University School of Medicine Shinano-machi, Tokyo, Japan). TNF receptor-associated factor 6 and TGF-b–activated kinase 1 (24). The hemagglutinin (HA)-tagged IRF7 and IFN-a4 promoter luciferase con- However, mechanisms of SOCS protein–mediated regulation structs were kindly provided by Dr. Z. Jiang (Peking University, Beijing, China). b k of TLR7 activation and IFN-a/b expression in pDCs remain The IFN- reporter plasmid was from Dr. M. Schlee, and NF- B luciferase reporter was from Dr. W. Kolanus (University of Bonn, Bonn, Germany). The largely unknown. Renilla reporter plasmid and pcDNA3.1 were from Promega (Mannheim, Therefore, the aim of our study was to investigate whether SOCS Germany) and Thermo Fisher Scientific. Myc-tagged wild-type and mutant proteins are involved in the regulation of TLR7-mediated IFN-a/b ubiquitins were subcloned from HA-tagged wild-type and mutant ubiquitins signaling. Our results provide evidence that activation of TLR7 di- (Addgene, Cambridge, MA) into the pMyc vector (Clontech, Saint-Germain- rectly induces the expression of SOCS1 and SOCS3, which in turn en-Laye, France). Primary Abs used were anti-HA (Clone: 3F10; Roche Diagnostics), anti-Flag (Clone: M2; Sigma-Aldrich, Taufkirchen, Germany), suppress type I IFN production in pDCs by targeting IRF7 for anti-Myc (Clone: 9E10; Clontech), anti-HA (Clone: Y-11), anti-Flag (Clone: ubiquitination and degradation. D-8), anti-GAPDH (Clone: 0411), (Santa Cruz Biotechnology, Heidelberg, Germany), anti-SOCS1 (Clone: J192; IBL International, Hamburg, Germany), anti-SOCS3 (Clone: 19A5; IBL), anti-IRF7 (Clone:H-246; Santa Cruz Bio- Materials and Methods technology), anti-histone H3 (Clone: D1H2), and anti-ubiquitin (Clone: P4D1) Human pDCs purification (Cell Signaling Technology, Frankfurt, Germany). HRP-conjugated secondary Abs were purchased from Santa Cruz Biotechnology. All chemicals were from PBMCs were isolated as described and previously prepared by Ficoll Sigma-Aldrich if not otherwise mentioned. gradient centrifugation (Lymphoprep 1.077 g/ml; Axis-Shield PoC AS, Oslo, Norway) from buffy coats of human healthy blood donors provided Quantitative real-time PCR analysis from the blood bank of the University Hospital of Bonn (25). Purification of pDCs was performed with the Diamond Plasmacytoid Dendritic Cell Total mRNA was isolated with the help of the NucleoSpin RNA XS kit or Isolation Kit (Miltenyi Biotec, Bergisch Gladbach, Germany) by a com- NucleoSpin RNA kit (Macherey-Nagel, Dueren, Germany). The cDNA was bination of negative and positive selection with the autoMACS Pro Sep- synthesized and real-time PCR was performed with special Taqman reagents of arator (Miltenyi Biotec) according to the manufacturer’s instructions. The Applied Biosystems (Darmstadt, Germany) as described previously (30). Pri- purity of BDCA2+CD123+ pDCs was .98%, verified by flow cytometry mers including probes were as follows: SOCS1 (Hs00864158_m1), SOCS3 with BD FACSCanto (BD Biosciences, Heidelberg, Germany). (Hs01000485_g1), SOCS5 (Hs00751962_s1), IFN-b1 (Hs02621180_s1), and endogenous control 18s (4310893E) (Applied Biosystems). PDCs culture and stimulation Dual-luciferase reporter assays Freshly isolated pDCs were cultured as described previously (26). After 18 h, cultured pDCs were stimulated with 10 mM of the synthetic TLR7 293T or 293XL-hTLR7 cells were cotransfected with and without 50 ng ligand imiquimod (R837) (InvivoGen, Toulouse, France), with 3.3 3 106 IRF7, plus increasing amounts of Flag-tagged expression plasmid, and 25 ng genome equivalents/ml heat-inactivated influenza A virus (IAV), or with firefly luciferase reporter construct driven by IFN-a4 promoter (IFN-a4- 15 mg/ml HIV-1 derived ssRNA VIFRNA327 (GUAUUACUUUGACU- Luc), IFN-b promoter (IFN-b–luc), or 53 NF-kB responsive element (NF- GUUUUU), ssRNA40 (GCCCGUCUGUUGUGUCACUC) or control kB-Luc), as well as 25 ng Renilla reporter plasmid (pRL-TK) as internal ssRNA VIFRNA327A (59-GAAAAACAAAGACAGAAAAA-39), ssRNA41 control. Control pcDNA3.1 was used to set total transfection plasmid (59-GCCCGACAGAAGAGAGACAC-39)(EurofinsMWG,Ebersberg,Ger- amount at 800 ng/well. Twenty four hours posttransfection, cells were many) complexed with 30 mg/ml DOTAP Liposomal Transfection Reagent stimulated with 10 mg/ml R837 in fresh DMEM with 0.5% FCS for 6 h. (Roche Diagnostics, Mannheim, Germany) (26). In the experiments of cyto- Subsequently, cells were lysed using 100 mlof13 Passive Lysis Buffer kine neutralization, pDCs were stimulated with R837 for 2 h in the presence or (Promega), and reporter gene activities were measured by Dual-Luciferase absence of 2 mg/ml anti–IL-6 (clone 1936, R&D Systems, Wiesbaden, Ger- Reporter Assay kit (Promega) in a GloMax 96 Microplate Luminometer many) (26), 20 mg/ml anti-IL-10 (clone: 23738, R&D Systems) (27), or 20 mg/ml (Promega) following the manufacturer’s instructions. Data were normal- anti-TNF-a (clone 6401, R&D Systems) (26) monoclonal neutralizing Ab ized by the ratio of firefly luciferase activity to Renilla luciferase activity. or 3 mg/ml mAb against IFN-a/b receptor chain 2 (IFN-a/bR2) (clone MMHAR-2, Milipore, Darmstadt, Germany) (28). Measurement of IFN-a and IFN-b in cell culture supernatant The IFN-a and IFN-b levels in the cell culture supernatant were quantified Cell culture, transfection, and stimulation using VeriKine Human IFN-a ELISA kit and Human IFN-b ELISA kit The human pDC cell line CAL-1 (kindly provided by Drs. T. Maeda and (PBL Assay Science, NJ) according to manufacturer’s instructions. S. Kamihira, Department of Island Medicine, Nagasaki University, Japan) Cell fractionation was cultured in complete RPMI 1640 medium supplemented with 2 mM L-glutamine, 1 mM sodium pyruvate, and 10% FCS (29). Sixteen hours prior After 24 h, Lipofectamine 3000 transfected cells were starved in 0.5% FCS to stimulation, 1 3 106 CAL-1 cells/well were starved with 1 ml serum- DMEM medium for 3 h and stimulated with 10 mg/ml R837 for a further 5 h reduced medium (1% FCS) in a 48-well plate and then stimulated with before harvest. Afterward, one-third of cells were lysed with RIPA buffer 5 mg R837 or 3.3 3 106 genome heat-inactivated IAV for the indicated containing protease inhibitors (1 mM PMSF, 5 mg/ml Aprotinin, and 5 mg/ml time. For gene knockdown experiments, 1 3 106 CAL-1 cells were transfected Leupeptin) and 13 Halt Phosphatase Inhibitor Cocktail (Thermo Scientific, with 50 mM of SOCSs siRNA or Silencer Select Negative Control No. 1 Bonn, Germany). Two-thirds of harvested cells were used for cell component siRNA using 4D-Nucleofector X Unit (DN100, cell line SF; Lonza) (29). protein isolation, which was performed as described previously (31). Briefly, The Journal of Immunology 3 the cell membrane was lysed in 200 ml buffer A supplemented with 0.5% Statistical analysis Nonidet P-40. Cytoplasmic protein fraction was collected by centrifugation. The nuclear pellet was suspended in 15 ml of buffer B. After incubation and The results were all from at least n = 3 independent experiments. Statistical centrifugation, 15 ml of the supernatant was diluted with 75 mlofbufferCto analysis was performed with GraphPad Prism 5 (GraphPad Software, La Jolla, obtain the final nuclear protein extracts. The protein concentration of different CA). Quantitative values were compared among the groups by using repeated cell factions was determined using the Pierce BCA Protein Assay Kit (Thermo measures one-way ANOVA with Tukey’s multiple comparisons test or paired Fisher Scientific) or Protein Quantification Assay kit (Macherey-Nagel). Student t test for data normally distributed (passed Shapiro–Wilk normality test) and Friedmann’s test or Wilcoxon matched pairs test for data not normally Immunoprecipitation and immunoblotting distributed (not passed Shapiro–Wilk normality test). Results are shown as mean +SEM.Anyp values are two-tailed and subject to a significance level of 5%. Twenty four hours posttransfection, cells were lysed with lysis buffer and ul- trasonic disintegration of cell structures (Branson Sonifier 250, G. Heinemann Ultraschall- und Labortechnik, Schwaebisch Gmuend, Germany). Fifty ∼ 150 mg Results of whole cell protein was incubated with 0.5 mg anti-Flag or anti-HA Ab for Elevated expression of SOCS1 and SOCS3 in pDC is directly 1 h, followed by pull-down with 20 ml Protein G PLUS-Agarose (Santa Cruz induced by TLR7 activation Biotechnology) at 4˚C. For direct coimmunoprecipitation (co-IP) experiments, cell lysates were incubated with 20 ml anti-FLAG M2 affinity gel To investigate whether the expressionofSOCS1,3,and5areinduced (Sigma-Aldrich) or Anti-HA Affinity Matrix (Roche) for 3 h. After washing, by TLR7 activation, freshly isolated human pDCs were stimulated bound proteins were eluted with 0.1 M Glycine (pH 2.8) (Thermo Fisher with the synthetic TLR7 ligand R837. mRNA levels of SOCS1, m Scientific) or 1 mg/ml HA peptide and 100 g/ml FLAG peptide. SOCS3, and SOCS5 at 2 and 16 h after R837 stimulation were Fifteen ∼30-mg protein or immunoprecipitated samples were denatured and separated by SDS-PAGE and transferred to a PVDF membrane (Millipore, evaluated. mRNA expression of SOCS1 and SOCS3, but not SOCS5, Billerica, MA). Proteins were detected by primary Ab and HRP-conjugated was significantly upregulated after 2 h of stimulation (Fig. 1A). Next, secondary Ab. Target proteins were visualized with ECL or ECL plus reagent pDCs were stimulated with synthetic HIV-1–derived ssRNA or heat- (GE Healthcare, Munich, Germany) and images were acquired using Image- inactivated IAV, one natural TLR7 ligand. Interestingly, HIV-derived Quant LAS 4000 Luminescent Image Analyzer (GE Healthcare). ssRNA VIFRNA327 and ssRNA40 exclusively enhanced SOCS3, but Immunofluorescence staining not SOCS1, mRNA expression as compared with control ssRNA stimulation (Fig. 1B). Furthermore, results from immunofluorescence Immunofluorescence staining was performed as described previously (29, 30). Briefly, primary pDCs remained unstimulated or stimulated with R837 or heat- staining demonstrated that both R837 and IAV stimulation induced inactivated IAV for 3 h. Cells were then fixed in 3% paraformaldehyde and elevated protein expression of both SOCS1 and SOCS3 in human permeabilized with 0.1% saponin. Cells were seeded onto Cell-Tak (BD primary pDCs (Fig. 1C). These results demonstrate that activation of m 2 Biosciences) treated cover slips (11.16 g/cm ) and stained with anti-SOCS1 TLR7 signaling via synthetic and natural ligands could induce (Clone: J192; IBL), anti-SOCS3 (Clone: 19A5; IBL), and anti-IRF7 (Clone: H-246; Santa Cruz Biotechnology) Abs. After that, cells were stained with SOCS1 and/or SOCS3 expression in pDCs and that different types of secondary Abs conjugated with Cy3 or Cy2 (Jackson ImmunoResearch Lab- ligands distinctively modulate SOCS1 and/or SOCS3 expression. oratories, Hamburg, Germany). The nuclei were counterstained with DAPI It has been shown that upon activation, pDCs produce a large amount (Thermo Fisher Scientific). Confocal images were acquired by Leica SP5 AOBS of type Ι IFNs (IFN-a/b) as well as proinflammatory cytokines, in- 3 with SMD confocal microscope with oil immersion objective lens 63 1.4 cluding IL-6, TNF-a, and IL-10 (32), which are able to induce SOCS1 (Leica Microsystems, Wetzlar, Germany). Leica Application Suite X and CellProfiler 3.0.0 were used for picture analysis. and SOCS3 expression (12, 33–35). Therefore, we evaluated whether 293XL-hTLR7 cells were cotransfected with HA-IRF7 and Flag-tagged the upregulation of SOCS1 and SOCS3 after ligand stimulation in SOCS construct for 24 h and seeded onto poly-L-lysine coated glass pDCs was related to primary TLR7 activation or a result of secondary coverslips for overnight. After starvation in 0.5% FCS medium for 3 h, m effects mediated by cytokines released by pDCs. For this purpose, cells were stimulated with 10 g/ml R837 for 1 h and then fixed and a a b stained with the anti-FLAG M2 and anti-HA Abs followed by the Cy3- neutralizing or blocking Abs against IL-6, IL-10, TNF- ,orIFN- / conjugated and anti-Rat IgG-NorthernLights 493 (R&D) secondary Abs. receptor were added to R837-stimulated pDCs to block effects of those The nuclei were counterstained with DAPI. Confocal images were ac- cytokines on pDCs (Fig. 1D). As a result, neutralization of IL-6, IL-10, quired by an Olympus FLUOVIEW FV1000 confocal microscope with a TNF-a, or blockage of IFN-a/b receptor did not abrogate R837- 3 Plapo 60 , NA 1.49 oil immersion objective (Olympus, Hamburg, Ger- induced SOCS1 and SOCS3 mRNA expression in pDCs, indicating many). FV10-ASW 2.0 software (Olympus) was used for picture analysis. that the increased expression of SOCS1 and SOCS3 mRNA in pDCs In vivo ubiquitination assays was induced directly by TLR7 activation, but not by secondary effects of autocrine/paracrine cytokines. 293T cells were transiently cotransfected with HA-IRF7, Flag-SOCS1/3, and wild- type or mutant Myc-tagged ubiquitin constructs. Twenty four hours later, cells were SOCS1 and SOCS3 suppress TLR7-mediated type I IFN m treated with 20 M proteasome inhibitor MG132 (Tocris Bioscience, Bristol, production in human pDC cell line CAL-1 U.K.) for 6 h before harvesting. Total proteins were purified with RIPA buffer containing 1 mM PMSF, 5 mg/ml Aprotinin, 5 mg/ml Leupeptin, 1 mM Na- It has been shown that the pDC line, CAL-1 cells, share common orthovanadate, and 10 mM N-ethylmaleimide and denatured with 1% SDS at phenotypic and functional properties of freshly isolated human 95˚C for 5 min to dissociate any noncovalently bound protein. Two hundred and fifty micrograms of denatured proteins were diluted 10 times with lysis buffer for pDCs after TLR7 activation (36, 37). Thus, we used CAL-1 cells immunoprecipitation (IP) with Anti-HA Affinity Matrix, and 10% was used for to investigate the modulation of type I IFN production by SOCS1 input controls. After IP, conjugated IRF7 was eluted with 0.1 M Glycine (pH 2.8), and SOCS3 expression. and ubiquitinated IRF7 was detected by immunoblotting (IB) with anti-Myc Ab. Similar to primary human pDCs, CAL-1 cells expressed high levels In vitro ubiquitylation assays of SOCS1 and SOCS3 mRNA after stimulation with R837 (Fig. 2A). To investigate the effects of SOCS1 and SOCS3 on type I IFN HA-IRF7 and Flag-SOCS1/SOCS3 expressed in 293T cells were separately production after TLR7 activation, as a next step, CAL-1 cells were purified with MBL’s HA tagged protein purification kit (Clone: 5D8) and DDDDK-tagged protein purification kit (Clone: FLA-1) (Biozol, Eching, transfected with SOCS1 or SOCS3 siRNAs, which reduced more Germany). The assays were performed in 110 ml of ubiquitination assay than 60% of SOCS1 and SOCS3 expression without generating off- buffer with 150 mM His-ubiquitin and 2.5 mM Ub-aldehyde, 0.3 mgof target effects (Fig. 2B). Either SOCS1 or SOCS3 knockdown sig- m 3HA-IRF7, and 0.5 g of Flag-SOCS1 or Flag-SOCS3 by using Ubiquitin nificantly increased IFN-b mRNA expression as well as IFN-a and Protein Conjugation kit (all from BostonBiochem, Cambridge, MA). b Samples were incubated at 37˚C for 3 h and reactions were quenched IFN- proteinproductioninresponsetoTLR7activation(Fig.2C). with 10 mM EDTA. Ubiquitination of IRF7 was evaluated by anti-His In contrast, overexpression of SOCS1 or SOCS3 led to a significant MicroBeads (Miltenyi Biotec) pull-down and further anti-HA IB. decrease in type I IFN production after TLR7 activation (Fig. 2D). 4 SOCS1/3 TARGET IRF7 TO SUPPRESS TLR7 IN HUMAN pDCs

FIGURE 1. the mRNA expression of SOCS1 and SOCS3 are directly induced by TLR7 activation in primary human pDCs. (A) pDCs were stimulated with 10 mM R837 or left unstimulated (n = 8 donors). (B) pDCs were stimulated for 2 h with 15 mg/ml HIV-1–derived ssRNA: VIFRNA327, ssRNA40 or individual control ssRNA VIFRNA327A, or ssRNA41 complexed with 30 mg/ml DOTAP liposomal transfection reagent (n = 5 donors). SOCSs mRNA were quantiﬁed by real-time PCR, and data represented relative fold change of mRNA level to unstimulated pDCs or control VIFRNA327–treated pDCs at 2 h. The mean + SEM from indicated individual experiments is shown. (C) pDCs were stimulated with R837, (Figure legend continues) The Journal of Immunology 5

FIGURE 2. SOCS1andSOCS3negativelymodulatetypeIIFNresponse in human pDC CAL-1 line following TLR7 activation (A)mRNAexpressionof SOCS1 and SOCS3 was strongly induced in TLR7-ligand–stimulated CAL-1 cells. 1 3 106/ml CAL-1 cells starved overnight were stimulated with R837 (5 mg/ml), heat-inactivated IAV, or left unstimulated for 3 h, and SOCSs mRNA expression was assessed by real-time PCR (n =6).(B)13 106/ml CAL-1 cells were transfected with siRNA (50 mM) to knock down gene expression. After 3 h of stimulation with the combination of R837 and IAV, the efﬁciency of mRNA knockdown was evaluated by real-time PCR and presented as percentage of mRNA levels of control siRNA transfected cells, which were set as 100% (n = 10). The products of one representative real-time PCR were proven by nuclear acid electrophoresis. (C)13 106/ml CAL-1 cells were transfected with siRNAs and stimulated as described. The inﬂuence of SOCS1 and SOCS3 knockdown on type I IFN response in CAL-1 cells was evaluated by IFN-b mRNA real-time PCR (n =10) (stimulated for 3 h) and secreted IFN-a (n =6)andIFN-b (n =7)byELISA(stimulatedfor24h).(D)23 106/ml CAL-1 cells were transfected with individual Flag-tagged plasmid or pcDNA3.1 plasmid and then stimulated with R837 plus IAV for a further 24 h. IFN-a (n =7)andIFN-b (n = 7) in the cell supernatant were analyzed by ELISA. Data represent the mean + SEM from indicated independent experiments. *p , 0.05, **p , 0.01, ***p , 0.001.

Together, the data indicate that SOCS1 and SOCS3 negatively reg- human primary pDCs (Fig. 3A). After 4–8 h stimulation, signiﬁcantly ulate TLR7-mediated type I IFN production in human pDCs. higher IRF7 expression was detectedinTLR7-activatedpDCscom- pared with unstimulated primary pDCs. Interestingly, after 16 h of SOCS1 and SOCS3 suppress type I IFN production stimulation, remarkable decreased IRF7 expression was observed in through IRF7 stimulated pDCs, suggesting exit of a negative regulatory mechanism IRF7 is an essential transcription factor for type I IFN production in of IRF7 expression in TLR7-activated pDCs. Furthermore, knockdown TLR7 signaling (5, 38). We could demonstrate that stimulation of of SOCS1 and SOCS3 expression in pDC cell line CAL-1 cells sig- TLR7 by R837 or IAV-induced transient expression of IRF7 protein in niﬁcantly increased the mRNA expression of IRF7 (Fig. 3B). We next

heat-inactivated IAV, or left unstimulated. After 3 h of stimulation, the cells were fixed and subjected to immunofluorescence staining for SOCS1 and SOCS3. Representative images (left, scale bar, 10 mm) and quantification of fluorescence intensity of SOCS1/3 in different groups (right) are shown (n = 4 independent experiments, five randomly selected out of 633 fields per sample were examined). (D) pDCs were stimulated with R837 for 2 h in the presence or absence of 2 mg/ml anti–IL-6 (n = 7), 20 mg/ml anti–IL-10 (n = 8), or 20 mg/ml anti–TNF-a neutralizing Ab (n = 3); or 3 mg/ml Ab against IFN-a/b receptor chain 2 (IFN-a/bR2) (n = 4). SOCSs mRNA was quantified by real-time PCR, and data represent relative fold change of mRNA level to unstimulated pDCs. The mean + SEM from indicated experiments is shown. *p , 0.05, **p , 0.01, ***p , 0.001. 6 SOCS1/3 TARGET IRF7 TO SUPPRESS TLR7 IN HUMAN pDCs

FIGURE 3. SOCS1 and SOCS3 suppress TLR7-mediated activation of NF-kB and type I IFN production in an IRF7-dependent manner. (A)pDCswere stimulated with R837, heat-inactivated IAV, or left unstimulated. At 0, 4, 8, and 16 h, pDCs were collected and subjected to intracellular staining forIRF7.The expression of IRF7 was evaluated by flow cytometry (n = 10 donor). The mean fluorescence intensity (MFI) of IRF7 of primary pDCs is shown. (B) CAL-1 cells were transfected with siRNAs and stimulated as described elsewhere. The influence of SOCS1 and SOCS3 knockdown on IRF7 mRNA expression in CAL-1 cells was evaluated by real-time PCR (n =8).(C) 293XL-hTLR7 cells were transfected with increasing amounts of FLAG, FLAG-SOCS1, or FLAG-SOCS3 expression plasmid (100; 250; 500 ng/well), plus 25 ng/well firefly luciferase reporter construct containing individual promotor NF-kB-Luc, IFN-a4-Luc, or IFN-b–luc, plus 25 ng/well pRL-TK as an internal control. After 24 h, transfected cells were left unstimulated or stimulated with R837 (10 mg/ml) for another 6 h. (D) 293T cells were transfected with or without IRF7 (50 ng/well), plus increasing amounts of FLAG, FLAG-SOCS1, or FLAG-SOCS3 expression plasmids (100; 250; 500 ng/well) as well as 25 ng/well IFN-a4-Luc or IFN-b–luc and 25 ng/well pRL-TK for 24 h. Promoter activities were measured by dual-luciferase reporter assays, and results were presented relative to the luciferase activity in control cells. One representative of four independent experiments is shown. (E)IFN-b mRNA level in 293T cells transfected with or without IRF7 (200 ng/well), together with Flag-tagged construct (600 ng/well), was evaluated by quantitativereal-timePCR (n = 6). Mean value + SEM of n = 6 independent experiments is shown. *p , 0.05, **p , 0.01, ****p , 0.0001. wanted to investigate if SOCS1 and SOCS3 target IRF7 to down- 293T cells were transfected with expression plasmids of HA- regulate type I IFN production in pDCs. For this purpose, we transfected tagged IRF7 and Flag-tagged SOCS1/3. Direct interaction be- 293T cells with IRF7-expressing vector and SOCS1/3 expression vector tween SOCS1/3 and IRF7 was detected in reciprocal co-IP assays together with IFN-a4orIFN-b luciferase reporter construct. Dual- with anti-Flag and anti-HA Abs (Fig. 4A, 4B). Results of immu- luciferase reporter assays demonstrated that overexpression of either nofluorescence confocal microscopy demonstrated that TLR7 acti- SOCS1 or SOCS3 suppressed both NF-kB activation and IFN-b tran- vation via R837 led to the aggregation of IRF7 in the nucleus within scription after R837 stimulation (Fig. 3C). Furthermore, overexpression 60 min. Interestingly, Flag-SOCS1 or Flag-SOCS3, but not control of IRF7-induced robust IFN-a4andIFN-b transcription, which was Flag, colocalized with IRF7 in punctate nuclear structures after TLR7 dose-dependently suppressed by SOCS1 or SOCS3 overexpression activation (Fig. 4C merge). Furthermore, IB with subcellular fractions (Fig. 3D). Those results were further confirmed by real-time PCR as- demonstrated that overexpression of SOCS1 or SOCS3 did not block says in which IFN-b mRNA expression driven by IRF7 overexpression the accumulation of IRF7 in the nucleus in both unstimulated and was significantly decreased by overexpression of SOCS1 and SOCS3 R837-stimulated cells (Fig. 4D, line 1 and 5). In consistence with the (Fig. 3E). Together, the data demonstrate that IRF7 is the key target for confocal data, stronger expression of SOCS1 and SOCS3 in nuclei the suppression of SOCS1 and SOCS3 on type I IFN production. uponR837stimulationwasobserved(Fig.4D,line2and6).More- over, we could show that SOCS1/3 interacted with IRF7 mainly in SOCS1 and SOCS3 directly interact with IRF7 nuclear components, and this interaction was further enhanced by To test in which way SOCS1 and SOCS3 interact with IRF7 to R837 stimulation (Fig. 4E). The direct interactions of SOCS1 and suppress type I IFN production, co-IP experiments were performed. SOCS3 with IRF7 were further confirmed in TLR7-activated human The Journal of Immunology 7

FIGURE 4. SOCS1 and SOCS3 interact with IRF7. 293T cells were transiently transfected with combinations of HA-IRF7 and Flag or Flag-SOCS1 or Flag-SOCS3. Twenty four hours later, cell lysate was immunoprecipitated with anti-Flag (A) or anti-HA (B) or control mouse IgG followed by IB with anti- HA and anti-Flag. (C) SOCS1 or SOCS3 cotranslocates with IRF7 into the nucleus. 293XL-hTLR7 cells were transfected with combinations of HA-IRF7 and Flag-tagged constructs and stimulated with 10 mg/ml R837 for 1 h. Cellular location of IRF7 and SOCS1/3 was determined by immunoﬂuorescence microscopy (original magniﬁcation 3600). (D) and (E) 293XL-hTLR7 cells were transiently transfected with combinations (Figure legend continues) 8 SOCS1/3 TARGET IRF7 TO SUPPRESS TLR7 IN HUMAN pDCs

FIGURE 5. Deletion the SH2 domain of SOCS1 and SOCS3 prevents IRF7 binding. Various functional domains of SOCS1 and SOCS3 were sequentially deleted, which are schematically indicated in the upper panels of (A) and (B). Both wild-type and mutants of SOCS1 or SOCS3 were transfected together with IRF7 plasmids into 293T cells. The interaction of SOCS1/3 and IRF7 was detected by IP with an anti-HA Ab, followed by IB. primary pDCs (Fig. 4F). Confocal images demonstrated that IRF7 in the N-terminal portion of the SH2 domain (SH2 D79–129) or pDCs translocated into nucleus following stimulation either with R837 C-terminal portion of the SH2 domain containing NLS domain or IAV. After TLR7 activation, the nuclear colocalization of SOCS1 (SH2D130–172) did not lose their afﬁnity to IRF7 as well. In and IRF7 was, remarkably, observed. Furthermore, the colocalization contrast, deletion of the whole SH2 domain (SH2 D78–153) or of SOCS3 and IRF7 were observed in both cytoplasm and nucleus of deletion of the SH2 domain together with the NLS domain (SH2 human primary pDCs. The data demonstrate that SOCS1 and SOCS3 D79–172) completely abolished SOCS1 binding to IRF7. Similar do not affect nuclear translocationofIRF7butmightinteractwith results were achieved for SOCS3 (Fig. 5B, lower panel). Deletion IRF7 to perform modulatory functions. of KIR and ESS or SOCS Box of SOCS3 did not interfere with the interaction of SOCS1/3 with IRF7. Because SOCS3 mutants with SH2 domains of SOCS1 and SOCS3 contribute to the binding complete deletion of the SH2 domain were instable, SOCS3 to IRF7 mutants with submotif deletion in the SH2 domain were con- To identify the binding region of SOCS1 and SOCS3 to IRF7, Flag- structed (36). Neither deletion of PEST motif (SH2⊿129–163) nor tagged deletion mutants of SOCS1/3 were constructed as described BG-loop containing bG strand’s truncate (SH2⊿164–185) di- (39, 40) (Fig. 5A, 5B, upper panels), and their interactions with minished the binding capacity of SOCS3 to IRF7. However, the exogenous HA-tagged IRF7 were tested by co-IP assays (Fig. 5A, truncation of the ab helix of the SH2 domain (SH2⊿46–128) 5B, lower panels). SOCS1 mutants without KIR and ESS as abrogated SOCS3 binding to IRF7. These results imply that the well as SOCS box still bound IRF7. SOCS1 mutants lacking SH2 domain is responsible for SOCS1/3 binding to IRF7.

of HA-IRF7 and FLAG-SOCS1 or SOCS3. After 24 h, cells were stimulated with 10 mg/ml R837 for 5 h. Cells were lysed to purify nuclear proteins (NP), cytoplasm proteins (CP) and whole cell proteins (WP), and the expression of IRF7 and SOCS1/3 in individual subcellular components were detected by IB. (F) Colocalization of SOCS1 and SOCS3 with IRF7 in the human primary pDCs after 3 h stimulation with R837 or IAV. Confocal laser scanning microscopy images of SOCS1 (red), SOCS3 (red), IRF7 (green), and nuclei (blue) in human primary pDCs are shown. One of three repeatable experiments is shown (scale bar, 10 mm). The Journal of Immunology 9

FIGURE 6. SOCS1 and SOCS3 promote ubiquitination and degradation of IRF7. (A) SOCS1 and SOCS3 promote the turnover of IRF7 in a dose- dependent manner. 293T cells were transfected with 150 ng of HA-IRF7 with increasing amounts of Flag-SOCS1 or 3 (100, 300, or 650 ng) for 24 h. The presence of IRF7 and SOCS1/3 were detected by IB. IRF7 expression was determined by densitometry analysis in which the IRF7 expression of each group was normalized to control (Flag-IRF7 transfected 293T cells, and the expression was set as 100) (n = 3). (B) Half-life analysis of IRF7 in the presence of SOCS1 or SOCS3 was performed. 293T cells were transfected with 150 ng HA-IRF7 and 650 ng Flag-tagged construct. After 24 h, cells were treated with protein synthesis inhibitor cycloheximide (CHX) 200 mg/ml for the indicated time before analysis of the protein level by Western blotting. One representative experiment data from two PVDF membranes (spliced by vertical lines) are shown. IRF7 expression was determined by densitometry analysis in which the IRF7 expression of each group was normalized to the first control group (Flag-IRF7 transfected 293T cells, 0 h, and the expression was set as 100) (n = 3). (C) 293T cells were transfected with 200 ng HA-IRF7, 800 ng Flag-tagged SOCS, or 500 ng Myc-ubiquitin. Twenty four hour post transfection, cells were treated with MG-132 (10 mM) or DMSO as a control for 6 h before harvesting. IB was performed as indicated. IRF7 expression was determined by densitometry analysis in which the IRF7 expression of each group was normalized to the first control group (the expression was set as 100) (n = 3). *p , 0.05, **p , 0.01. (D) 293T cells were transfected with 500 ng HA-IRF7, 1 mg Flag-tagged SOCS, or 1 mg Myc-ubiquitin for 24 h in the presence of MG-132 during the last 6 h. Ubiquitinated IRF7 was immunoprecipitated by using anti-HA Ab and detected by IB with an Ab against Myc. (E) HA-IRF7, Flag-SOCS1, and Flag-SOCS3 were expressed in 293T cells and purified with anti-HA tag and anti-Flag tag beads. In vitro ubiquitination of IRF7 promoted by increasing amounts of SOCS1/3 in the presence of His-Ubiquitin was performed and detected by IP followed by IB. (F) 293T cells were transfected with 150 ng of HA-IRF7, 650 ng of Flag-SOCS1 or 3, and 400 ng of Myc-tagged ubiquitin mutants for 24 h. Some cells were treated with 10 mM MG-132 during the last 6 h. Afterward, cells were lysed for IB assay. IRF7 expression was determined by densitometry analysis in which the IRF7 expression of each group was normalized to the first control group (the expression was set as 100) (n = 3).

SOCS1 and SOCS3 target IRF7 for proteasomal degradation, degradation was mediated by ubiquitination. In vivo ubiq- which is mediated by polyubiquitination uitination assays revealed that remarkably more IRF7 was la- We wanted to test whether SOCS proteins cause ubiquitin-mediated beled with polyubiquitin in SOCS1 and SOCS3 overexpression degradation of IRF7. We found that steady-state level of IRF7 groups than control groups (Fig. 6D). Furthermore, in vitro protein was signiﬁcantly and dose-dependently decreased by the ubiquitination assays with synthesized proteins demonstrated expression of SOCS1 or SOCS3 in 293T cells (Fig. 6A). Analysis thatSOCS1andSOCS3coulddirectly ubiquitinate IRF7 of the IRF7 half-life showed that the rate of IRF7 protein turnover (Fig. 6E). Moreover, we determined that the ubiquitination of increased when SOCS1 or SOCS3 were simultaneously expressed IRF7 was K48- or K63-linked by utilizing ubiquitin mutants in (Fig. 6B). Furthermore, the addition of the proteasome inhibitor which only lysine 48 (K48) or 63 (K63) was retained, and other MG132 prevented SOCS1- or SOCS3-mediated IRF7 degradation lysines were replaced by arginine residues. Either the expres- (Fig. 6C). Together, these data demonstrate that SOCS1 and sion of K63 ubiquitin or the addition of the proteasome in- SOCS3 target IRF7 for proteasomal degradation. hibitor MG132 was able to reverse IRF7 degradation by Ubiquitination is an essential pathway for protein degradation. SOCS1 and SOCS3 (Fig. 6F). In contrast, coexpression of K48 As a next step, we investigated whether the observed IRF7 ubiquitin did not inﬂuence IRF7 degradation. The data suggest 10 SOCS1/3 TARGET IRF7 TO SUPPRESS TLR7 IN HUMAN pDCs

FIGURE 7. A model of feedback downreg- ulation of TLR7-induced type I IFN by SOCS1 and SOCS3. Upon TLR7 activation, pDCs re- lease type I IFN and immediately and directly upregulate expression of SOCS1 as well as SOCS3. SOCS1 and SOCS3 proteins are able to directly inhibit IFN-a/b production by targeting IRF7 for K48 ubiquitination-mediated degradation. In addition, SOCS1 protein is able to block IFN-a/b signal transduction by targeting JAK-STAT.

that IRF7 degradation induced by SOCS1 and SOCS3 depends Inhibiting dimerization and nuclear translocation of IRF3 and/or IRF7 on K48-linked ubiquitination (Fig. 7). leads to impaired type I IFN production (43, 44). Furthermore, ubiquitin-mediated degradation of IRF3 and IRF7 represents another Discussion important mechanism to regulate type I IFN production (43). In In this study, we report that SOCS1 and SOCS3 are rapidly induced humans, peptidyl-prolyl isomerase Pin1, E3 Ub ligase RBCK1, and in human pDCs upon stimulation with natural as well as syn- transcription factor FoxO1 interact with IRF3 for proteasomal deg- thetic ligands to TLR7. We demonstrate that SOCS1 and SOCS3 radation (45–47), whereas HECT domain E3 Ub ligase RAUL, tri- downregulate TLR7-mediated type I IFN production through direct partite motif family member Ro52 (TRIM21), and TRIM25 lead to interaction with IRF7 via the SH2 domain. Furthermore, we show IRF3 or IRF7 ubiquitination and subsequent degradation upon sim- that binding of SOCS1 and SOCS3 to IRF7 leads to the degradation ulation of TLR3/4 or TLR7/9 (48–51). of IRF7 through K48-linked ubiquitination. So far, it remains largely unknown how type I IFN signaling is Activated pDCs regulate innate and adaptive immunity in antiviral regulated by SOCS proteins. In this article, we demonstrate that after and inflammatory responses with their unique ability of Ag presen- TLR7 activation in pDCs, SOCS1/3 directly target IRF7 to mediate tation and marked type I IFN production. Due to their function as the degradation. Such a negative regulation of type I IFN production via main type I IFN producers, they are potential targets for invading suppression of TLR7-IRF7 signaling by SOCS1/3 identified in this pathogens. Several types of viruses, such as hepatitis C virus, hepatitis study might represent a new feedback mechanism to protect the host B virus, and respiratory syncytial virus, have developed strategies to from damage by elongated and excessive IFN-a/b production at early use SOCS proteins to circumvent the protective effects of IFNs (14–16). stages of infection (Fig. 7). However, because many types of viruses This emphasizes the essential function of SOCS proteins in the have the potential to induce the expression of SOCS1 and/or SOCS3 regulation of immune responses. It has been shown that the ex- in host cells during infection (14–18), this negative regulation might pression of SOCS1 or SOCS3 can be induced by TLR signaling. represent a novel SOCS1/3–mediated viral immune evasion mecha- For example, HIV-1, but not secreted cytokines such as IL-10 and nism, leading to the dampening of type I IFN production by pDCs to IFN-b, induce SOCS3 expression in macrophages at early time allow rapid viral replication. points to inhibit antiviral IFN-b signaling (41). In line with this Accumulating evidence suggests that the IRF family members finding, we could demonstrate that HIV ssRNA ligands induced are novel targets for SOCS proteins. Furthermore, ubiquitination is SOCS3 expression in pDCs at early stages of stimulation, which a common way of posttranslational modification of IRF expression suggests HIV may use this immune escape strategy to suppress to regulate immune responses (43). A recent observation demon- IFN-a/b production to infect other cell types. strated that the increased expression of SOCS1 induced by human The IRFs family represents a family of transcription factors im- T cell leukemia virus-1 directly interacts with IRF3 for ubiquitin- portant for type I IFN production (42). It has been shown that IRF3 is mediated degradation by SOCS-Box E3 ligase (52). In this study, a major transcription factor for TLR3 and RIG-I to prime IFN-a/b we could demonstrate that the expression of IRF7 is regulated production, whereas IRF7 is important for TLR7 and TLR9 (38). by SOCS1 and SOCS3 through K48-linked ubiquitination and The Journal of Immunology 11 proteasomal degradation of IRF7. Because many PRRs, such as 18. Oshansky, C. M., T. M. Krunkosky, J. Barber, L. P. Jones, and R. A. Tripp. 2009. Respiratory syncytial virus proteins modulate suppressors of cytokine signaling TLRs and RLR employ IRF7 as a transcription factor in their 1 and 3 and the type I interferon response to infection by a toll-like receptor signaling pathways, our data suggest that SOCS1/3 could act as pathway. Viral Immunol. 22: 147–161. part of endogenous E3 ligase to negatively regulate PRR-mediated 19. Heeg, K., and A. Dalpke. 2003. TLR-induced negative regulatory circuits: role of suppressor of cytokine signaling (SOCS) proteins in innate immunity. Vaccine type I IFN production. IRF proteins need to undergo phosphory- 21(Suppl. 2): S61–S67. lation at serine but not tyrosine residues, which are not typical 20. Hanada, T., H. Yoshida, S. Kato, K. Tanaka, K. Masutani, J. Tsukada, substrates of SOCS1/3. Detailed mechanisms of how SOCS1/3 interact Y. Nomura, H. Mimata, M. Kubo, and A. Yoshimura. 2003. Suppressor of cy- with serine-phosphorylated IRF proteins for ubiquitination and which tokine signaling-1 is essential for suppressing dendritic cell activation and systemic autoimmunity. Immunity 19: 437–450. components are recruited to the E3 ligase complexes need to be further 21. Dalpke, A. H., S. Opper, S. Zimmermann, and K. Heeg. 2001. Suppressors of elucidated. cytokine signaling (SOCS)-1 and SOCS-3 are induced by CpG-DNA and modulate cytokine responses in APCs. J. Immunol. 166: 7082–7089. In summary, we demonstrate that SOCS1 and SOCS3 are in- 22. Nakagawa, R., T. Naka, H. Tsutsui, M. Fujimoto, A. Kimura, T. Abe, E. Seki, duced by TLR7-MyD88-IRF7 signaling in pDCs and serve as a S. Sato, O. Takeuchi, K. Takeda, et al. 2002. SOCS-1 participates in negative negative feedback mechanism to directly downregulate type I IFN regulation of LPS responses. Immunity 17: 677–687. 23. Mansell, A., R. Smith, S. L. Doyle, P. Gray, J. E. Fenner, P. J. Crack, production by interacting with IRF7 for K48-linked ubiquitination S. E. Nicholson, D. J. Hilton, L. A. O’Neill, and P. J. Hertzog. 2006. Suppressor and degradation. These results might identify SOCS1 and SOCS3 of cytokine signaling 1 negatively regulates Toll-like receptor signaling by as putative therapeutic targets in human diseases in which aberrant mediating Mal degradation. Nat. Immunol. 7: 148–155. 24. Frobøse, H., S. G. Rønn, P. E. Heding, H. Mendoza, P. Cohen, T. Mandrup- type I IFN production of pDCs plays a role. Poulsen, and N. Billestrup. 2006. Suppressor of cytokine signaling-3 inhibits interleukin-1 signaling by targeting the TRAF-6/TAK1 complex. Mol. Endo- crinol. 20: 1587–1596. Acknowledgments 25. Novak, N., J. P. Allam, T. Hagemann, C. Jenneck, S. Laffer, R. Valenta, We thank the Microscopy Core Facility, University of Bonn, for offering the J. Kochan, and T. Bieber. 2004. Characterization of FcepsilonRI-bearing CD123 platform for the use of confocal microscopes and for facilitating image blood dendritic cell antigen-2 plasmacytoid dendritic cells in atopic dermatitis. J. Allergy Clin. Immunol. 114: 364–370. acquisition and analysis. We thank Juana Hart and Said Benfadal for excellent 26. Yu, C. F., W. M. Peng, J. Oldenburg, J. Hoch, T. Bieber, A. Limmer, technical assistance. G. Hartmann, W. Barchet, A. M. Eis-Hu¨binger, and N. Novak. 2010. Human plasmacytoid dendritic cells support Th17 cell effector function in response to TLR7 ligation. J. Immunol. 184: 1159–1167. Disclosures 27. Doni, A., M. Michela, B. Bottazzi, G. Peri, S. Valentino, N. Polentarutti, The authors have no financial conflicts of interest. C. Garlanda, and A. Mantovani. 2006. Regulation of PTX3, a key component of humoral innate immunity in human dendritic cells: stimulation by IL-10 and inhibition by IFN-gamma. J. Leukoc. Biol. 79: 797–802. 28. Moll, H. P., H. Freudenthaler, A. Zommer, E. Buchberger, and C. Brostjan. 2008. References Neutralizing type I IFN antibodies trigger an IFN-like response in endothelial 1. Theofilopoulos, A. N., R. Baccala, B. Beutler, and D. H. Kono. 2005. Type I cells. J. Immunol. 180: 5250–5256. interferons (alpha/beta) in immunity and autoimmunity. Annu. Rev. Immunol. 23: 29. Steinhagen, F., L. G. Rodriguez, D. Tross, P. Tewary, C. Bode, and D. M. Klinman. 307–336. 2016. IRF5 and IRF8 modulate the CAL-1 human plasmacytoid dendritic cell line 2. Ito, T., H. Kanzler, O. Duramad, W. Cao, and Y. J. Liu. 2006. Specialization, response following TLR9 ligation. Eur. J. Immunol. 46: 647–655. kinetics, and repertoire of type 1 interferon responses by human plasmacytoid 30. Peng, W. M., C. F. Yu, W. Kolanus, A. Mazzocca, T. Bieber, S. Kraft, and predendritic cells. Blood 107: 2423–2431. N. Novak. 2011. Tetraspanins CD9 and CD81 are molecular partners of trimeric 3. Liu, Y. J. 2005. IPC: professional type 1 interferon-producing cells and plas- FcRI on human antigen-presenting cells. Allergy 66: 605–611. macytoid dendritic cell precursors. Annu. Rev. Immunol. 23: 275–306. 31. Wang, P., P. Wu, M. I. Siegel, R. W. Egan, and M. M. Billah. 1995. Interleukin 4. Guiducci, C., R. L. Coffman, and F. J. Barrat. 2009. Signalling pathways leading (IL)-10 inhibits nuclear factor kappa B (NF kappa B) activation in human to IFN-alpha production in human plasmacytoid dendritic cell and the possible monocytes. IL-10 and IL-4 suppress cytokine synthesis by different mechanisms. use of agonists or antagonists of TLR7 and TLR9 in clinical indications. J. In- J. Biol. Chem. 270: 9558–9563. tern. Med. 265: 43–57. 32. Simpson, J., K. Miles, M. Tru¨b, R. MacMahon, and M. Gray. 2016. Plasmacytoid 5. Gilliet, M., W. Cao, and Y. J. Liu. 2008. Plasmacytoid dendritic cells: sensing nucleic dendritic cells respond directly to apoptotic cells by secreting immune regulatory acids in viral infection and autoimmune diseases. Nat. Rev. Immunol. 8: 594–606. IL-10 or IFN-a. Front. Immunol. 7: 590. 6. Blasius, A. L., and B. Beutler. 2010. Intracellular toll-like receptors. Immunity 33. Croker, B. A., D. L. Krebs, J. G. Zhang, S. Wormald, T. A. Willson, 32: 305–315. E. G. Stanley, L. Robb, C. J. Greenhalgh, I. Fo¨rster, B. E. Clausen, et al. 2003. 7. Deane, J. A., P. Pisitkun, R. S. Barrett, L. Feigenbaum, T. Town, J. M. Ward, SOCS3 negatively regulates IL-6 signaling in vivo. Nat. Immunol. 4: 540–545. R. A. Flavell, and S. Bolland. 2007. Control of toll-like receptor 7 expression is 34. Schindler, C., and C. Plumlee. 2008. Inteferons pen the JAK-STAT pathway. essential to restrict autoimmunity and dendritic cell proliferation. Immunity 27: Semin. Cell Dev. Biol. 19: 311–318. 801–810. 35. Kimura, A., T. Naka, S. Nagata, I. Kawase, and T. Kishimoto. 2004. SOCS-1 8. Pisitkun, P., J. A. Deane, M. J. Difilippantonio, T. Tarasenko, A. B. Satterthwaite, suppresses TNF-alpha-induced apoptosis through the regulation of Jak activa- and S. Bolland. 2006. Autoreactive B cell responses to RNA-related antigens due tion. Int. Immunol. 16: 991–999. to TLR7 gene duplication. Science 312: 1669–1672. 36. Hilbert, T., F. Steinhagen, C. Weisheit, G. Baumgarten, A. Hoeft, and 9. Elliott, J., and J. A. Johnston. 2004. SOCS: role in inflammation, allergy and S. Klaschik. 2015. Synergistic stimulation with different TLR7 ligands modu- homeostasis. Trends Immunol. 25: 434–440. lates gene expression patterns in the human plasmacytoid dendritic cell line 10. Yoshimura, A., T. Naka, and M. Kubo. 2007. SOCS proteins, cytokine signalling CAL-1. Mediators Inflamm. 2015: 948540. and immune regulation. Nat. Rev. Immunol. 7: 454–465. 37. Maeda, T., K. Murata, T. Fukushima, K. Sugahara, K. Tsuruda, M. Anami, 11. Piessevaux, J., D. Lavens, F. Peelman, and J. Tavernier. 2008. The many faces of Y. Onimaru, K. Tsukasaki, M. Tomonaga, R. Moriuchi, et al. 2005. A novel the SOCS box. Cytokine Growth Factor Rev. 19: 371–381. plasmacytoid dendritic cell line, CAL-1, established from a patient with blastic 12. Croker, B. A., H. Kiu, and S. E. Nicholson. 2008. SOCS regulation of the JAK/ natural killer cell lymphoma. Int. J. Hematol. 81: 148–154. STAT signalling pathway. Semin. Cell Dev. Biol. 19: 414–422. 38. Honda, K., and T. Taniguchi. 2006. IRFs: master regulators of signalling by Toll-like 13.Dimitriou,I.D.,L.Clemenza,A.J.Scotter,G.Chen,F.M.Guerra,andR.Rottapel. receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 6: 644–658. 2008. Putting out the fire: coordinated suppression of the innate and adaptive immune 39. Babon, J. J., E. J. McManus, S. Yao, D. P. DeSouza, L. A. Mielke, N. S. Sprigg, systems by SOCS1 and SOCS3 proteins. Immunol. Rev. 224: 265–283. T. A. Willson, D. J. Hilton, N. A. Nicola, M. Baca, et al. 2006. The structure of 14. Bode, J. G., S. Ludwig, C. Ehrhardt, U. Albrecht, A. Erhardt, F. Schaper, P. C. Heinrich, SOCS3 reveals the basis of the extended SH2 domain function and identifies an and D. Haüssinger. 2003. IFN-alpha antagonistic activity of HCV core protein involves unstructured insertion that regulates stability. Mol. Cell 22: 205–216. induction of suppressor of cytokine signaling-3. FASEB J. 17: 488–490. 40. Strebovsky, J., P. Walker, R. Lang, and A. H. Dalpke. 2011. Suppressor of cy- 15. Yokota, S., N. Yokosawa, T. Okabayashi, T. Suzutani, S. Miura, K. Jimbow, and tokine signaling 1 (SOCS1) limits NFkappaB signaling by decreasing p65 sta- N. Fujii. 2004. Induction of suppressor of cytokine signaling-3 by herpes simplex bility within the cell nucleus. FASEB J. 25: 863–874. virus type 1 contributes to inhibition of the interferon signaling pathway. J. Virol. 41. Akhtar, L. N., H. Qin, M. T. Muldowney, L. L. Yanagisawa, O. Kutsch, 78: 6282–6286. J. E. Clements, and E. N. Benveniste. 2010. Suppressor of cytokine signaling 3 16. Xu, Y., Y. Hu, B. Shi, X. Zhang, J. Wang, Z. Zhang, F. Shen, Q. Zhang, S. Sun, inhibits antiviral IFN-beta signaling to enhance HIV-1 replication in macro- and Z. Yuan. 2009. HBsAg inhibits TLR9-mediated activation and IFN-alpha phages. J. Immunol. 185: 2393–2404. production in plasmacytoid dendritic cells. Mol. Immunol. 46: 2640–2646. 42. Honda, K., A. Takaoka, and T. Taniguchi. 2006. Type I interferon [corrected] 17. Moore, E. C., J. Barber, and R. A. Tripp. 2008. Respiratory syncytial virus gene induction by the interferon regulatory factor family of transcription factors. (RSV) attachment and nonstructural proteins modify the type I interferon re- Immunity 25: 349–360. sponse associated with suppressor of cytokine signaling (SOCS) proteins and 43. Ning, S., J. S. Pagano, and G. N. Barber. 2011. IRF7: activation, regulation, IFN-stimulated gene-15 (ISG15). Virol. J. 5: 116. modification and function. Genes Immun. 12: 399–414. 12 SOCS1/3 TARGET IRF7 TO SUPPRESS TLR7 IN HUMAN pDCs

44. Tsuchida, T., T. Kawai, and S. Akira. 2009. Inhibition of IRF3-dependent an- 49. Higgs, R., J. Nı´ Gabhann, N. Ben Larbi, E. P. Breen, K. A. Fitzgerald, and tiviral responses by cellular and viral proteins. Cell Res. 19: 3–4. C. A. Jefferies. 2008. The E3 ubiquitin ligase Ro52 negatively regulates IFN- 45. Saitoh, T., A. Tun-Kyi, A. Ryo, M. Yamamoto, G. Finn, T. Fujita, S. Akira, beta production post-pathogen recognition by polyubiquitin-mediated degrada- N. Yamamoto, K. P. Lu, and S. Yamaoka. 2006. Negative regulation of tion of IRF3. J. Immunol. 181: 1780–1786. interferon-regulatory factor 3-dependent innate antiviral response by the prolyl 50. Higgs, R., E. Lazzari, C. Wynne, J. Nı´ Gabhann, A. Espinosa, M. Wahren- isomerase Pin1. Nat. Immunol. 7: 598–605. Herlenius, and C. A. Jefferies. 2010. Self protection from anti-viral responses– 46. Zhang, M., Y. Tian, R. P. Wang, D. Gao, Y. Zhang, F. C. Diao, D. Y. Chen, Z. H. Zhai, Ro52 promotes degradation of the transcription factor IRF7 downstream of the and H. B. Shu. 2008. Negative feedback regulation of cellular antiviral signaling by viral Toll-like receptors. PLoS One 5: e11776. RBCK1-mediated degradation of IRF3. Cell Res. 18: 1096–1104. 51. Wang, Y., S. Yan, B. Yang, Y. Wang, H. Zhou, Q. Lian, and B. Sun. 2015. 47. Lei, C. Q., Y. Zhang, T. Xia, L. Q. Jiang, B. Zhong, and H. B. Shu. 2013. FoxO1 TRIM35 negatively regulates TLR7- and TLR9-mediated type I interferon negatively regulates cellular antiviral response by promoting degradation of production by targeting IRF7. FEBS Lett. 589: 1322–1330. IRF3. J. Biol. Chem. 288: 12596–12604. 52. Olie`re, S., E. Hernandez, A. Le´zin, M. Arguello, R. Douville, T. L. Nguyen, 48. Yu, Y., and G. S. Hayward. 2010. The ubiquitin E3 ligase RAUL negatively S. Olindo, G. Panelatti, M. Kazanji, P. Wilkinson, et al. 2010. HTLV-1 evades regulates type i interferon through ubiquitination of the transcription factors type I interferon antiviral signaling by inducing the suppressor of cytokine IRF7 and IRF3. Immunity 33: 863–877. signaling 1 (SOCS1). PLoS Pathog. 6: e1001177.