PEA15 Promotes Liver Metastasis of Colorectal Cancer by Upregulating the ERK/MAPK Signaling Pathway

ONCOLOGY REPORTS 41: 43-56, 2019

PEA15 promotes liver metastasis of colorectal cancer by upregulating the ERK/MAPK signaling pathway

BO TANG1, WENJIN LIANG2, YONG LIAO2, ZEMING LI2, YAN WANG1 and CHAO YAN1

1School of Pharmacy, Shanghai Jiao Tong University, Shanghai 200240; 2Department of Hepatobiliary Surgery, Guilin Medical University, Affiliated Hospital, Guilin, Guangxi 541004, P.R. China

Received March 30, 2018; Accepted September 24, 2018

DOI: 10.3892/or.2018.6825

Abstract. Liver metastasis is one of the major causes of death reason leading to the death of patients with colorectal cancer in patients with colorectal cancer, and although treatment has is distant invasion and metastasis such as liver, lung and bone improved recently, the long‑term survival rate of patients has metastasis, while liver metastasis of colorectal cancer is the not improved significantly. In the present study, we used immu- most common (3). Although the diagnosis and treatment nohistochemistry to determine that phosphoprotein enriched in strategies for liver metastasis of colorectal cancer have greatly astrocytes‑15 kDa (PEA15) was highly expressed in colorectal improved in recent years, to date, the overall survival rate of ca ncer tissues a nd liver metastatic ca ncer tissues. It was a lso h igh ly patients has not significantly improved. Therefore, exploring expressed in metastatic colorectal cancer patients compared to the mechanism of liver metastasis of colorectal cancer can non‑metastatic patients. Through clinicopathological data of provide effective guidance for potential clinical interventions, patients with liver metastasis of colorectal cancer, we found that thus improving the long‑term prognosis of patients. high expression of PEA15 was positively correlated with TNM PEA15 is a 15‑kDa‑sized small molecule protein containing staging, liver metastasis and poor prognosis of colorectal cancer an NH2 terminal death effector domain and a COOH terminal patients. Using confocal immunofluorescence microscopy, irregular structure distributed in the cytoplasm. Its DNA sequence western blotting and cell proliferation, migration and invasion is located on chromosome 1q21‑22 and it is highly conserved in assays, we also determined that PEA15 could promote cancer cell mammalian gene sequences (4,5). PEA‑15 is widely expressed in proliferation in vitro and in vivo, epithelial mesenchymal transi- human tissues and participates in the interaction between various tion (EMT) and the characteristics of cancer stem cells in vitro, proteins. It can regulate cell apoptosis, proliferation and glucose thus promoting the abilities of invasion and migration. In addi- metabolism by acting on the key functions of cellular effec- tion, we revealed that PEA15 promoted the liver metastasis of tors in vivo (6‑8). At present, it has been revealed that PEA‑15, colorectal cancer cells in a xenograft tumor metastasis model. In through its death‑effector domain (DED) and ERK1/2‑targeted addition, concerning the mechanism, we used gene chip analysis binding, inhibited ERK1/2 phosphorylation and nucleus transfer, to determine that PEA15 upregulated the ERK/MAPK signaling thus playing an anti‑apoptotic role (9). Some studies have pathway in colorectal cancer cells. Therefore, we concluded demonstrated that PEA15 is highly expressed in tumors such as that PEA15 may be a potential biomarker for liver metastasis liver (10), lung (11), breast (12) and ovarian cancer (13). However, of colorectal cancer therapy. Collectively, PEA15 promoted the it has a dual role in the regulation of tumors (14). It has been development of liver metastasis of colorectal cancer through the revealed that phosphorylation of PEA15 phosphorylated ERK ERK/MAPK signaling pathway. and promoted the proliferation and invasion of hepatocellular carcinoma cells (10), whereas the unphosphorylated state of Introduction PEA15 inhibited the phosphorylation of ERK and EGFR, thus inhibiting proliferation, invasion and metastasis of breast (12) Colorectal cancer is the third most common cancer in the and ovarian cancer (13). However, whether PEA15 plays a role in world and its annual fatality rate ranks third (1,2). The main liver metastasis of colorectal cancer is still unknown. In the present study, we revealed that PEA15 was highly expressed in colorectal cancer tissues and metastatic liver tissues. High expression of PEA15 was positively correlated with TNM stage, liver metastasis and indicated a poor prog- Correspondence to: Dr Chao Yan or Dr Yan Wang, School of nosis. In vitro and in vivo experiments confirmed that PEA15 Pharmacy, Shanghai Jiao Tong University, 800 Dongchuan Road, Shanghai 200240, P.R. China promoted the proliferation, invasion, migration and EMT E‑mail: [email protected] of colorectal cancer cells. To determine its mechanism, we E‑mail: [email protected] used gene chip analysis and found that PEA15 regulated the ERK/MAPK signaling pathway to promote the invasion and Key words: PEA15, clinicopathological correlation, liver metastasis migration of colorectal cancer cells. Concurrently, xenograft of colorectal cancer, ERK/MAPK pathway tumor experiments also confirmed that PEA15 promoted liver metastasis of colorectal cancer cells in vivo. 44 TANG et al: PEA15 PROMOTES LIVER METASTASIS OF COLORECTAL CANCER

Materials and methods P‑40, and 5 mM protease inhibitor cocktail; pH 7.4] was added to extract total proteins. Then the protein concentration was Experimental reagents and antibodies. Lipofectamine assessed by BCA (bicinchoninic acid) kit (Beyotime Institute 2000 liposomes and TRIzol reagent were purchased from of Biotechnology) and the appropriate amount of loading buffer Invitrogen (Thermo Fisher Scientific, Inc., Waltham, MA, was added. Protein sample (30 µg) was added to 10% sodium USA). Primary antibodies for PEA15 (cat. no. ab133217), dodecyl sulfate‑polyacrylamide gel electrophoresis system PLD1 (cat. no. ab50695), ERK (cat. no. ab184699), p38 (SDS‑PAGE) for electrophoresis separation and then trans- (cat. no. ab170099), MAP2K6 (cat. no. ab154901), JNK ferred to polyvinylidene difluoride (PVDF) membranes (cat. no. ab47337), PRKX (cat. no. ab109389) and FLNB (Bio‑Rad Laboratories, Inc., Hercules, CA, USA). Then, 5% (cat. no. ab97457) proteins were purchased from Abcam non‑fat milk was used to incubate the PVDF membranes, (Cambridge, MA, USA). Primary antibodies for E‑cadherin and peroxidase‑labeled secondary antibodies (HRP‑labeled (cat. no. #14472), N‑cadherin (cat. no. 13116), vimentin goat anti‑rabbit IgG; cat. no. A0208; Beyotime Institute of (cat. no. 5741) and β‑actin (cat. no. 3700) were purchased Biotechnolgy) at a 1:10,000 were used for incubation for 1 h from Cell Signaling Technology (Danvers, MA, USA). Other at room temperature. Subsequently, chemiluminescence was reagents were purchased from Sigma‑Aldrich (Merck KGaA, used to display the imprinting, and the results were analyzed Darmstadt, Germany). using the Tannon 5200 chemiluminescent imaging system (Tanon Science and Technology, Shanghai, China). Patient and samples. The present study included 40 cases of colorectal cancer and corresponding clinicopathological data, Quantitative reverse transcription polymerase chain which contained 19 cases of liver metastasis tissue specimens. reaction (qRT‑PCR). The collected cells and tissues were These specimens were all paraffin specimens and obtained added to TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.) from the Department of General Surgery of the Affiliated and total RNA was extracted according to the RNAiso Plus Hospital of Guilin Medical University from August 2000 to kit instructions (Takara Bio, Inc., Otsu, Japan). The RNA August 2016 and all the specimens were clinically diagnosed by concentration was assessed using the NanoDrop spectro- the Department of Pathology. All clinical cases and specimen photometer (Thermo Fisher Scientific, Inc.). The FastQuant tissues were reviewed and approved by the Ethics Committee cDNA First‑Strand Synthesis kit (Tiangen Biotech, Co., of Guilin Medical University, and informed consents were Ltd., Beijing, China) was used for reverse transcription. A signed by the patients according to the Declaration of Helsinki. qRT‑PCR kit FastStart Universal SYBR Green Master Mix Clinicopathological data included sex, age, tumor diameter, (Rox) (Roche Diagnostics GmbH, Mannheim, Germany) tumor differentiation, TNM staging and liver metastasis. was used to produce the reaction system and amplification Follow‑up of patients was performed until March 2018. according to the manufacturer's instructions. The reaction cycling conditions were performed as follows: 1 cycle at Immunohistochemistry. The surgically resected paraffin 95˚C for 15 min, followed by 40 cycles at 95˚C for 10 sec specimens were collected from the Department of Pathology and at 60˚C for 60 sec, and then relative mRNA expression of the Affiliated Hospital of Guilin Medical University and was analyzed using the comparative quantification cycle (Cq) were prepared into 4‑mm thick slices. According to the method followed by normalization to β‑actin expression EnVision two‑step procedure (14), dewaxing and hydration (Applied Biosystems; Thermo Fisher Scientific, Inc.) (15). were carried out, after EDTA buffer high pressure antigen The primers used for amplification were as follows: PEA15 retrieval. Subsequently a primary antibody against PEA15 forward, 5'‑GTTCTGTAGTCAACCACCAT‑3' and reverse, (Abcam) with a dilution of 1:100 was added, and the speci- 5 ' ‑ A C C AAC AAC ATC ACC C T T ‑ 3 ' ; β‑actin forward, 5'‑TCT mens were incubated at room temperature for 1 h, then washed TCATGGTGCTGGGAG‑3') and reverse, 5'‑AATGAGCGG and incubated at room temperature for 0.5 h with a secondary TTCCGTTGC‑3' which was used as the internal control. antibody (MaxVisionTM HRP‑polymer anti‑Rabbit IHC Kit, cat. no. KIT‑5006, MXB Biotechnologies, Fuzhou, China) Cell culture and cell transfection. Colorectal cancer cells followed by washing with phosphate‑buffered saline (PBS) (HT‑29, Caco‑2, COLO 205, HCT‑116, RKO, SW‑620 and buffer. A DAB Horseradish Peroxidase Color Development SW‑480) were purchased from the Cell Bank of Chinese kit (Beyotime Institute of Biotechnology, Haimen, China) was Academy of Sciences (Shanghai, China). Dulbecco's modi- used for color development and scored using the Olympus X71 fied Eagle's medium (DMEM; Life Technologies; Thermo inverted microscope (Olympus Corp., Tokyo, Japan). Based on Fisher Scientific, Inc.) was used for HT‑29, Caco‑2, HCT‑116 the staining intensity, samples were divided into the following and RKO and Roswell Park Memorial Institute‑1640 medium grades: 0, <10% of tumor cells were positively stained; (RPMI‑1640) (Life Technologies; Thermo Fisher Scientific, 1+, 11‑25% of tumor cells were positively stained; 2+, 26‑50% Inc.) was used for COLO 205, SW‑620 and SW‑480. All of tumor cells were positively stained; and 3+, >50% of tumor cell culture media contained 10% fetal calf serum (FCS; cells were positively stained. Immunohistochemical analysis Life Technologies; Thermo Fisher Scientific, Inc.) and were and scoring were conducted by two researchers, respectively. cultured in a 37˚C incubator with 5% CO2/95% air. The procedure aforementioned was used for the preparation and Western blotting. Cell samples were collected and lysis buffer transfection of ERK1/2 siRNA and ERK1/2 plasmid (16). [50 mM Tris‑HCl, 137 mM NaCl, 10% glycerol, 100 mM For primary colorectal cancer cells, 16 colorectal cancer sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride specimens (aged 35‑70 years) were collected from patients (PMSF), 10 mg/ml aprotinin, 10 mg/ml leupeptin, 1% Nonidet who underwent colorectal cancer resection at the Affiliated ONCOLOGY REPORTS 41: 43-56, 2019 45

Hospital of Guilin Medical University from October 2014 to the Carl Zeiss Confocal Imaging System (LSM 780; Carl October 2016. Specimens were obtained with the approval Zeiss, Jena, Germany). of the Medical Ethics Committee of the Affiliated Hospital of Guilin Medical University. Fresh tumor tissue was cut and Detection of colorectal cancer stem cell characteristics. A incubated with type IV collagenase (Sigma‑Aldrich; Merck prepared primary colorectal cancer single cell suspension KGaA) for 5‑10 min at 37˚C and a single cell suspension was counted (Luna II; Logos Biosystems, Anyang, Korea), was filtered using a 100‑mm cell strainer (BD Biosciences, and 1x106 cells were added into tumor stem cell culture Franklin Lakes, NJ, USA). Cell viability was detected via medium suspension for culture, and shaken 1 time every 6 h staining using Trypan blue (Sigma‑Aldrich; Merck KGaA), on the 1st and 2nd days to prevent cell adherence. When the and CD45+ cells in fresh tumor tissue were removed using the cell spheres became larger and the brightness decreased, the CD45 removal kit (Depletion kit; Miltenyi Biotec, Bergisch structure was loosened. Accutase enzyme (Thermo Fisher Gladbach, Germany). Scientific, Inc.) was used for digestion passage. The parental cells and the passaged cells were cultured in a 6‑well plate Cell proliferation experiments. The prepared cell suspension at 1x105 cells/well for approximately 6 days, the conglom- was seeded in a 96‑well plate (100 µl/well) with a cell density eration rate was calculated. The surface antigen (EPCAM and of 2x103 cells/well, and 10 µl of Cell Counting kit‑8 (CCK‑8) CD133) of the primary colorectal cancer cells was sorted by solution (Dojindo Laboratories, Kumamoto, Japan) was added flow cytometry, and the proportion of side population cells to each well after the predefined different culture time. The was counted and analyzed. plates were placed in an incubator for ~1 h and then placed in a microplate reader (SpectraMax plus 384; Molecular Devices, Construction of cell lines of stably upregulated and down‑ San Jose, CA, USA) to assess the absorbance at 450 nm. regulated PEA15. Construct retroviruses were coated with vector pBabe‑puro‑PEA15 and with vector pSuper‑retro‑ Plate cloning experiment. The prepared cell suspension was puro‑PEA15‑shRNA. The extraction of retroviruses and seeded on a 6‑well plate at 600 cells/well. Cell colonies were transfection of tumor cells were performed as previously formed after being cultured for ~2 weeks. Cells were fixed described (17) and the expression of PEA15 was verified using with 4% paraformaldehyde for 20 min and stained overnight qRT‑PCR and western blotting. with 1% crystal violet (cat. no. G1062; Solarbio, Tokyo, Japan). After three washes in PBS, the images of the results In vivo tumor growth and metastasis. Forty BALB/c 8‑week‑old were observed and captured using a fluorescence microscope male nude mice weighing 18 g‑20 g (20 were used for tumor (IX71; Olympus Corporation) and the number of colonies/well growth while the other 20 were used for a tumor metastasis was calculated using ImageJ (National Institutes of Health, model) were purchased from the Animal Experimental Center Bethesda, MD, USA). of Guilin Medical University and all animals were used in accordance with the operating instructions and approved by the Experiments of cell invasion and migration. A Transwell Animal Care Committee of Guilin Medical University, with chamber (8 µm; BD Biosciences) (the chamber for invasion room temperature atmosphere and ad libitum. Tumor cell lines detection was coated with Matrigel, and the chamber for migra- in logarithmic growth phase were collected and washed with tion detection was without Matrigel) was placed into a 24‑well PBS to prepare a cell suspension. The prepared cell suspen- plate with ~600 µl medium containing 10% FBS which was sion (2x106 cells/ml) was subcutaneously injected into the added to the bottom chamber. The prepared cell suspension right groin area of 8‑week‑old nude mice. The tumor volume was seeded in a Τranswell chamber at 1,000 cells/well. One or was assessed weekly. Nude mice were sacrificed by cervical two days later, the cell preparation in the small chamber was dislocation. Twenty‑eight days after surgery, the tumors were observed under a fluorescence microscope (IX71; Olympus excised and the tumor weights were recorded. For the tumor Corporation). After an appropriate number of cells had passed metastasis model, the cells were collected and washed with through the cell pores, the cells were fixed with 4% parafor- PBS and then prepared into a cell suspension. The cell suspen- maldehyde and stained with 1% crystal violet (cat. no. G1062; sion with a concentration of 1x107 cells/ml was injected into Solarbio) and images were captured. the hepatic portal vein of nude mice. All mice were sacrificed by cervical dislocation 60 days after inoculation. Confocal immunofluorescence microscopy.Cells were seeded on a special slide (Costar, Manassas, VA, USA). After 24 h, Gene chip analysis. The quality of total RNA was assessed the cells on the slides were washed with PBS and 4% para- using the Agilent 2100 Bioanalyzer (Agilent Technologies, formaldehyde was added to fix the cells. After the cell Inc., Santa Clara, CA, USA) and the NanoDrop ND‑1000 spec- membrane was permeabilized with 0.5% Triton X‑100, the trophotometer. RNA expression was then analyzed using the cells were blocked by adding 10% FBS for 30 min at room Affymetrix HU U133 plus 2.0 array according to the manufac- temperature. The primary antibody was added for incubation turer's instructions. The raw data was normalized by the Robust overnight at 4˚C, and then the cells were washed three times Multiarray Average (RMA) of expression control platform with PBS, followed by the addition of a fluorescein isothio- software (Affymetrix; Thermo Fisher Scientific, Inc.). Scatter cyanate (FITC)‑labeled secondary antibody (cat. no. A‑21063; plot analysis of the gene with significant changes in PEA15 Invitrogen; Thermo Fisher Scientific, Inc.) and incubation for in the downregulation group and the control group to screen 1 h in a dark chamber. After washing three times with PBS, the genes with upregulation or downregulation of expression the cells were stained with DAPI for 5 min and analyzed with ≥3 times was performed. Gene Cluster v3.0 software cluster 46 TANG et al: PEA15 PROMOTES LIVER METASTASIS OF COLORECTAL CANCER

Figure 1. PEA15 expression in colorectal cancer and metastatic liver cancer tissues and its correlation with clinical prognosis of patients with liver metastasis of colorectal cancer. (A‑C) IHC was used to detect the expression of PEA15 in colorectal cancer tissues and metastatic liver cancer tissues (magnifica- tion, x400): a, normal intestinal tissue; b, colorectal cancer tissue without liver metastasis; c, colorectal cancer tissue with liver metastasis; d, normal liver tissue; e, metastatic liver cancer tissue; f, metastatic liver cancer tissue with vascular invasion. (D) ROC curve analysis of the dividing point of PEA15 expression. (E and F) K‑M survival curves were used to analyze the correlation between the expression of PEA15 and (E) the overall survival and (F) the disease‑free survival of postoperative patients of colorectal cancer. (G) K‑M survival curve analysis of the correlation between PEA15 expression and the overall survival rate of postoperative patients with liver metastasis patients. ##P<0.01 compared to the para‑tumor, **P<0.01 compared to the No‑met tumor.

(Stanford University, Stanford, CA, USA) was used for cluster tissues were assessed using Spearman's rank correlation test. analysis, and Java TreeView v1.1.4r3 software (Alok Saldanha; Multigroup comparisons of the means were carried out by http://jtreeview.sourceforge.net/) was used for thermal image one‑way analysis of variance (ANOVA) test with post hoc visualization. contrasts by Student‑Newman‑Keuls test. The Kaplan‑Meier method was used to estimate the correlation between the Statistical analysis. Experimental data were statistically expression of PEA15 and the 5‑year survival rate of patients analyzed using GraphPad Prism 5 (GraphPad Software, after diagnosis. The log‑rank test was used to compare the Inc., San Diego, CA, USA) and SPSS v.18.0 (SPSS Inc., survival curves of different groups. P<0.05 was considered Chicago, IL, USA). The Chi‑square test (χ2) was used to indicate a statistically significant difference. to evaluate the association between the expression of PEA15 and the clinicopathological features of the patients. Results Comparisons between different groups were undertaken using the Student's two‑tailed t‑test. Correlation between PEA15 is highly expressed in colorectal cancer and meta‑ PEA15 expression with BRAF and RAS mutation in colon static liver cancer tissues and positively correlated with ONCOLOGY REPORTS 41: 43-56, 2019 47

Table I. Correlations between PEA15 expression and clinicopathological parameters in 40 colorectal carcinoma patients.

PEA15 expression ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ Variables Low (21) High (19) Total P‑value

Age (years) 0.548 <40 9 (47) 10 (53) 19 ≥40 12 (57) 9 (43) 21 Sex 0.125 Male 7 (39) 11 (61) 18 Female 14 (64) 8 (36) 22 Tumor diameter (cm) 0.062 <5 5 (33) 10 (67) 15 ≥5 16 (64) 9 (36) 25 Tumor differentiation 0.292 Well 3 (33) 6 (67) 9 Moderate 8 (50) 8 (50) 16 Poor 10 (67) 5 (33) 15 TNM stage 0.028a Ⅰ‑Ⅱ 6 (33) 12 (67) 18 Ⅲ‑Ⅳ 15 (68) 7 (32) 22 Liver metastasis <0.001a No 17 (81) 4 (19) 21 Yes 4 (21) 15 (79) 19 aSignificant P‑value.

Table II. Multivariate analysis with a Cox proportional hazards regression model.

Univariate analysis Multivariate analysis ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ Variables RR 95% CI P‑value RR 95% CI P‑value

Age (years) (<40 vs. >40) 0.521 0.420‑0.647 0.760 0.671 0.520‑0.864 0.078 Sex (male vs. female) 1.638 1.318‑2.034 0.782 0.753 0.592‑0.957 0.082 Tumor diameter (cm) (<5 vs. >5) 1.509 1.217‑1.872 0.325 3.337 2.599‑4.284 0.095 Tumor differentiation (well vs. poor) 1.144 0.616‑2.124 0.370 0.544 0.421‑0.703 0.061 TNM stage (I‑II vs. III‑IV) 0.807 0.657‑0.991 0.041a 0.633 0.499‑0.803 0.003a Liver metastasis (No vs. yes) 7.758 5.598‑10.75 <0.001a 7.410 5.181‑10.6 0.001a PEA15 (Positive vs. negative) 4.434 3.356‑5.858 <0.001a 3.698 2.636‑5.189 0.016a

RR, relative risk; CI, confidence interval.a Significant P‑value.

tumor TNM stage. We randomly collected 40 cases of be involved in the hematogenous metastasis of tumors. colorectal cancer and the corresponding liver metastasis Combined with clinicopathological data of patients with liver tissues with immunohistochemical detection. The results metastasis of colorectal cancer, we analyzed the correlation revealed that the expression level of PEA15 in colorectal between the expression of PEA15 and the clinicopathological cancer and metastatic liver cancer tissues was significantly features of patients. After mapping the ROC curve of PEA15 higher than the corresponding paracancerous tissues. In addi- expression (Fig. 1D) and determining the division point of tion, the expression level of PEA15 in liver cancer tissues was high or low PEA15 expression, we divided the patients into significantly higher than that in non‑metastatic liver cancer a PEA15‑high expression group and a low expression group. tissues (Fig. 1A‑C). Notably, we found that the expression The statistical results revealed that the expression of PEA15 of PEA15 was also significantly increased in endangium was correlated with TNM stage (P<0.05) and liver metastasis of liver metastasis (Fig. 1Aa‑f), indicating that PEA15 may (P<0.001) (Table I). 48 TANG et al: PEA15 PROMOTES LIVER METASTASIS OF COLORECTAL CANCER

Figure 2. The correlation between high expression of PEA15 and the mutation rates of RAS and BRAF in colorectal cancer tissues. (A and B) High expression of PEA15 was positively correlated with (A) BRAF mutation (P<0.05), but not with (B) RAS mutation (P>0.05).

Figure 3. PEA15 regulates the proliferation of colorectal cancer cells in vitro and in vivo. (A) Western blotting and (B and C) qRT‑PCR were used to detect the expression of PEA15 in different colorectal cancer cell lines. (D and E) PEA15 expression levels were detected by western blotting in colorectal cancer cells after knockdown of its expression using (D) PEA15 shRNA plasmid or upregulation of its expression using (E) PEA15 plasmid. **P<0.01 compared to the controls.

PEA15 is positively correlated with the clinical prognosis of addition, in patients with liver metastatis, the total survival time patients with liver metastasis of colorectal cancer and the (median, 13 months vs. 15 months, P<0.01) of the PEA15‑low BRAF mutation. Through follow‑up of 5‑year survival time expression group was longer than that of the PEA15‑high with patients after being clinically diagnosed, a Kaplan‑Meier expression group (Fig. 1G). Multivariate Cox regression anal- survival curve was used to analyze the correlation between ysis revealed that PEA15 overexpression (relative risk=3.698; the expression level of PEA15 and clinical prognosis, and the P=0.016) could be used as a relatively independent predictor of overall survival time (median, 13 vs. 32 months; P<0.001) and poor prognosis in patients with liver metastases of colorectal disease‑free survival time (median, 11 months vs. 28 months; cancer (Table II). Furthermore, we detected and analyzed the P<0.05) of patients with liver metastasis of colorectal cancer correlation between the high expression of PEA15 and the and low PEA15 expression were significantly better than mutation rates of RAS and BRAF in colorectal cancer tissues. those of the PEA15‑overexpression group (Fig. 1E and F). In The results revealed that the high expression of PEA15 was ONCOLOGY REPORTS 41: 43-56, 2019 49

Figure 4. PEA15 regulates the proliferation of colorectal cancer cells in vitro and in vivo. (A‑C) Plate cloning experiments were used to detect colony formation after (A and B) upregulation and (C) downregulation of PEA15. (D‑F) CCK‑8 kit detection of cell proliferation with (D and E) upregulation and (F) downregulation of PEA15 expression. (G and H) Xenograft nude mouse model of in vivo tumorigenesis was used to confirm cell growth after (G) downregulation and (H) upregulation of PEA15. Data are represented as the mean ± SD of three independent experiments and analyzed by paired t‑test, *P<0.05, **P<0.01 and ***P<0.001 compared to controls.

positively correlated with BRAF mutation but not with RAS significantly less than that of the normal and negative control mutation (Fig. 2A and B). group (Fig. 4A and B), but the colony formation of SW‑480 cells after PEA15 upregulation was significantly more than PEA15 promotes the proliferation of colorectal cancer cells that of the normal and negative control group (Fig. 4C). in vivo and in vitro. To investigate the regulatory effect of The CCK‑8 kit assay results revealed that the proliferation PEA15 on colorectal cancer cell lines, we first selected seven ability of HT‑29 and RKO cells was significantly weakened colorectal cancer cell lines (HT‑29, Caco‑2, HCT‑116, RKO, after PEA15 downregulation (Fig. 4D and E) compared with COLO‑205, SW‑620 and SW‑480). The expression of PEA15 normal group and negative control group, while the prolif- in different cell lines was detected by PCR and western blot- eration of SW‑480 cells increased after PEA15 upregulation ting, respectively. The results revealed that the expression (Fig. 4F). In vivo, it was also confirmed that downregulation level of PEA15 was significantly increased in colorectal of PEA15 significantly reduced the tumor weight in nude cancer cell lines with metastatic potential (Fig. 3A‑C). To mice, whereas upregulation of PEA15 increased the tumor evaluate the role of PEA15 in cell proliferation and tumor weight (Fig. 4G and H). growth, we selected the HT‑29 and RKO cell lines that produce PEA15 at high levels and proceeded to knockdown PEA15 promotes the invasion and migration of colorectal its expression using short hairpins RNAs (PEA15‑shRNA cancer cells in vitro and participates in the regulation of plasmid). We also selected the SW‑480 cell line to transfect EM T. According to Transwell chamber invasion and migra- with the PEA15 plasmid as aforementioned (Fig. 3D and E). tion experiments, the invasion and migration abilities of The plate cloning results revealed that the colony formation HT‑29 and RKO cells was evidently decreased after down- of HT‑29 and RKO cells after PEA15 downregulation was regulation of PEA15 (Fig. 5A and B), while in SW‑480 cells, 50 TANG et al: PEA15 PROMOTES LIVER METASTASIS OF COLORECTAL CANCER

Figure 5. PEA15 regulates the invasion and migration abilities of colorectal cancer cells in vitro. (A and B) Invasion and migration abilities of HT29 and RKO cells were significantly decreased after downregulation of PEA15. (C) SW‑480 cell invasion and migration abilities were enhanced after upregulation of PEA15. **P<0.01 compared to controls.

these abilities were enhanced after PEA15 was upregulated the ability of spheroid formation of SW‑480 cells and RKO (Fig. 5C). Subsequently, we examined the effect of PEA15 cells by upregulation or downregulation of PEA15. The results on the expression of EMT‑related proteins in colorectal revealed that with the upregulation of PEA15, the ability of cancer cells by immunofluorescence confocal microscopy spheroid formation of SW‑480 cells and RKO cells was and western blotting. The results revealed that after PEA15 enhanced. In contrast, the ability of spheroid formation of downregulation, the expression of E‑cadherin in HT‑29 and both cells weakened after PEA15 downregulated (Fig. 7A). RKO cells increased, while the expression of N‑cadherin and Subsequently, we used flow cytometry to detect the propor- vimentin decreased (Fig. 6A and B); while in SW‑480 cells, tion of surface cancer antigen marker molecules (EPCAM the opposite was observed after PEA15 was downregulated and CD133) of the colorectal cancer cells and the ratio of side (Fig. 6C). The aforementioned results indicated that PEA15 population cells. The experimental results revealed that the promoted the invasion and migration of tumor cells by regu- high expression of PEA15 in colorectal cancer cells exhibited lating the EMT of colorectal cancer cells. more of EPCAM+ and CD133+ (Fig. 7B). Side population (SP) cell ratio analysis revealed that the proportion of SP increased PEA15 induces stem cell‑like features of colorectal cancer in SW‑480 cells after PEA15 was upregulated, whereas the cells. In order to investigate whether PEA15 regulated the proportion of SP in RKO cells decreased after PEA15 was stem cell characteristics of colorectal cancer cells, we detected downregulated (Fig. 7C). Therefore, the aforementioned ONCOLOGY REPORTS 41: 43-56, 2019 51

Figure 6. PEA15 participates in the regulation of EMT of colorectal cancer cells. (A and B) Following PEA15 downregulation, the expression of E‑cadherin in HT29 and RKO cells increased, while the expression of N‑cadherin and vimentin decreased. (C) After PEA15 upregulation, the expression of E‑cadherin in SW‑480 cells decreased, but N‑cadherin and vimentin expression increased.

results indicated that PEA15 could regulate the stem cell char- analysis revealed that these genes were involved in a variety acteristics of colorectal cancer cells. of signaling pathways, including the MAPK signaling pathway, the TGF‑β signaling pathway, the PI3K/AKt PEA15 promotes the development of colorectal cancer by signaling pathway, the stem cell regulatory pathway and the regulating the MAPK signaling pathway. In order to further HIF‑1 signaling pathway, while the most noticeable differ- explore the mechanism of PEA15 in the regulation of liver ence gene change was in the MAPK signaling pathway metastasis of colorectal cancer, we compared the gene (Fig. 8A). These results indicated that PEA15 affected the expression differences of HT‑29 cells between the control development of colorectal cancer cells mainly through the group and the PEA15‑downregulation group by gene chip regulation of the MAPK signaling pathway. We further analysis (the data is not currently available in GEO). Scatter detected the expression of MAPK signaling pathway‑related plots were used to analyze the significantly changed genes proteins before and after PEA15 downregulation by western in the PEA15‑downregulation group and the control group. blotting. The results revealed that the expression of PEA15, More than 400 genes with upregulation or downregulation PLD1, ERK, MAP2K6, c‑Myc and PRKX proteins decreased change of more than 3 times were selected. Gene microarray and the expression of FLNB protein increased in RKO cells 52 TANG et al: PEA15 PROMOTES LIVER METASTASIS OF COLORECTAL CANCER

Figure 7. PEA15 induces stem cell‑like features of colon cancer cells. (A) Upon upregulation of PEA15, the ability of spheroid formation of SW‑480 cells and RKO cells was enhanced. In contrast, the ability of spheroid formation of both cells weakened after PEA15 downregulation. (B) The high expression of PEA15 in colorectal cancer cells exhibited more of EPCAM+ and CD133+. (C) The proportion of SP in RKO cells decreased after PEA15 downregulation, whereas the proportion of SP increased in SW‑480 cells after PEA15 upregulation. **P<0.01 and ***P<0.001 compared to controls.

Figure 8. PEA15 promotes the development of colorectal cancer by regulating the MAPK signaling pathway. (A) Gene microarray analysis revealed that these genes were involved in a variety of signaling pathways. (B) The expression of PEA15, PLD1, ERK, MAP2K6 and PRKX proteins decreased and the expression of FLNB protein increased in RKO cells after downregulation of PEA15, while the expression of p38 and JNK proteins had no significant changes. *P<0.05 and **P<0.01 compared to controls. ONCOLOGY REPORTS 41: 43-56, 2019 53

Figure 9. ERK1/2 plays a key role in the regulation of colorectal cancer cells. (A and B) Downregulation of ERK1/2 can inhibit (A) the proliferation and (B) invasion and migration abilities of RKO cells. (C) The expression of MAP2K6, c‑Myc and PRKX proteins decreased while the expression of FLNB protein increased in RKO cells after downregulation of PEA15. *P<0.05, **P<0.01 and ***P<0.001 compared to controls. after downregulation of PEA15, while the expression of p38 Discussion and JNK proteins exhibited no significant changes (Fig. 8B). Furthermore, we downregulated ERK1/2 and found that the A previous study revealed that PEA15 is a key member of the proliferation, invasion and migration abilities of RKO cells anti‑apoptotic family that inhibits apoptosis by restraining were all suppressed (Fig. 9A and B). Moreover, the results the formation of the death‑inducing signal complex (DISC) revealed that the expression of MAP2K6, c‑Myc and PRKX and blocking the cascade activation of caspases (18). The proteins decreased while the expression of FLNB protein present study confirmed that PEA15 promoted the prolifera- increased in RKO cells after downregulation of ERK1/2 tion of colorectal cancer cells in vitro and in vivo. Notably, (Fig. 9C). The aforementioned results indicated that PEA15 we also found that the expression of PEA15 in colorectal regulated the development of colorectal cancer by regulating cancer with liver metastasis was significantly higher than the ERK/MAPK signaling pathway. that without metastasis. In addition, the clinical TNM stage and BRAF gene mutation were positively correlated with PEA15 promotes the formation of metastases of colorectal PEA15 expression. These results indicated that PEA15 may cancer cells in vivo. In order to verify the effect of PEA15 on be involved in the regulation of liver metastasis of colorectal the metastatic potential of colorectal cancer cells in vivo, we cancer. upregulated PEA15 in the RKO cell line and injected it into the Current studies have revealed that EMT of colorectal hepatic portal vein of nude mice. After 60 days of inoculation, cancer cells is a key factor in the distant metastasis of nude mice were sacrificed by cervical dislocation, and the liver colorectal cancer (19). The present study revealed that when metastasis foci were recorded. The results revealed that the PEA15 was downregulated, the expression of E‑cadherin in foci number of liver metastases significantly increased after colorectal cancer cells increased, however, V‑cadherin and PEA15 upregulation (Fig. 10A and B). Meanwhile, immuno- vimentin decreased, and the invasion and migration capacities histochemistry revealed that the expression of PEA15 in liver of colorectal cancer cells were significantly weakened. Tumor tissues was significantly higher in the PEA15‑upregulated stem cell characterization test results also revealed that with colorectal cancer cell group (Fig. 10C). The aforementioned downregulation of PEA15, the ability of cell formation became results confirmed that PEA15 promoted the development weaker and the proportion of side population cells decreased. of liver metastasis of colorectal cancer by regulating the While with upregulation of PEA15, the opposite results were ERK/MAPK signaling pathway (Fig. 11). obtained. Therefore, we conclude that PEA15 regulated EMT 54 TANG et al: PEA15 PROMOTES LIVER METASTASIS OF COLORECTAL CANCER

Figure 10. PEA15 promotes the formation of metastases of colorectal cancer cells in vivo. (A and B) The foci number of liver metastases of colorectal cancer in nude mice increased significantly after PEA15 upregulation. (C) Immunohistochemistry revealed that the expression of PEA15 in liver tissues was significantly higher with PEA15 upregulation. **,##P<0.01 compared to pBabe.

Figure 11. Schematic diagram of the ERK/MAPK signaling pathway in liver metastasis of colorectal cancer regulating by PEA15. ONCOLOGY REPORTS 41: 43-56, 2019 55 to promote liver metastasis of colorectal cancer and induced Funding stem cell characteristics of colorectal cancer cells. Current studies have also found that the MAPK signaling The present study was supported in part by The National Natural pathway may be involved in the regulation of colorectal cancer Science Foundation of China (no. 81560393), the Guangxi of liver metastasis (20). The MAPK signaling pathway is one of Science Fund for Distinguished Young Scholars Program the most important regulatory pathways, and its signal‑related (no. 2016GXNSFFA380003), the Natural Science Foundation of proteins are widely distributed in the nucleus, cytoplasm, Guangxi (no. 2015jjDA40010) and the Scientific Research and mitochondria and Golgi participating in regulating the various Technology Development Project for Guilin (no. 20140310‑2‑2). life activities of the body (21). The ERK/MAPK signaling pathway can regulate cell proliferation and invasion, promote Availability of data and materials the EMT process and finally promote the development of colorectal cancer (22,23). However, phosphorylation of two The datasets used during the present study are available from sites, Ser‑104 and Ser‑116 in PEA15 can promote tumor inva- the corresponding author upon reasonable request. sion and migration (24). The present study revealed that the expression of PEA15, PLD1, ERK, MAP2K6 and PRKX was Authors' contributions downregulated, and the expression of FLNB was upregulated, while the expression of p38 and JNK was not markedly changed BT, YW and CY conceived and designed the experiments. BT after PEA15 downregulation. In addition, downregulation of and WL performed the experiments. BT, WL, YL, and ZL ERK1/2 supressed the proliferation, invasion and migration analyzed the data. YW, CY supervised the whole experimental abilities of RKO cells. Therefore, we concluded that PEA15 work and revised the manuscript. BT and WL wrote the paper. regulated the ERK/MAPK signaling pathway. Research has All authors read and approved the manuscript and agree to be shown that phosphorylated PEA15 can phosphorylate ERK in accountable for all aspects of the research in ensuring that the combination with PLD1, thereby exerting a tumor‑promoting accuracy or integrity of any part of the work are appropriately effect (25). In gliomas, Ser116 phosphorylation of PEA‑15 investigated and resolved. regulates the ERK/MAPK signaling axis and antagonizes glioma cell death due to glucose deficiency (26). In addition, Ethics approval and consent to participate PEA15 could regulate PRKX to promote tumor epithelial cell proliferation, invasion and vascular structure formation (27). All clinical cases and specimen tissues were reviewed Our results also revealed that the expression of PLD1 and and approved by the Ethics Committee of Guilin Medical PRKX proteins decreased when PEA15 was downregulated, University, and informed consents were signed by the patients and PEA15 expression was positive in vascular endothelium according to the Declaration of Helsinki. The animal experi- in metastatic liver tissues. These results confirmed that PEA15 ments were approved by the Animal Care Committee of Guilin promoted the invasion and migration of colorectal cancer cells Medical University. through the ERK/MAPK signal axis, and promoted EMT of colorectal cancer cells and generation of stem cell characteris- Patient consent for publication tics, thereby contributing to the occurrence of liver metastasis of colorectal cancer. Not applicable. In summary, the present study confirmed that PEA15 is highly expressed in colorectal and metastatic liver tissues. Competing interests We also determined for the first time that high expression of PEA15 was positively correlated with tumor TNM stage and The authors declare that they have no competing interests. liver metastasis, and acted as a relatively independent predictor of poor prognosis in patients with liver metastasis of colorectal References cancer. Concurrently, the present study revealed that PEA15 not only regulated proliferation ability, but also the invasion 1. Siegel RL, Miller KD and Jemal A: Cancer statistics, 2017. CA and migration capacities, as well as EMT characteristics, and Cancer J Clin 67: 7‑30, 2017. 2. Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, Jemal A, induced the stem cell characteristics of cancer cells. In rela- Yu XQ and He J: Cancer statistics in China, 2015. CA Cancer tion to its mechanism, we determined for the first time that the J Clin 66: 115‑132, 2016. PEA15/ERK/MAPK signaling pathway induced invasion and 3. Wu Z, Wei D, Gao W, Xu Y, Hu Z, Ma Z, Gao C, Zhu X and Li Q: TPO‑induced metabolic reprogramming drives liver metastasis migration by regulating the EMT of colorectal cancer cells of colorectal cancer CD110+ tumor‑initiating cells. Cell Stem and induced tumor stem cell characteristics. Cell 17: 47‑59, 2015. 4. Renault F, Formstecher E, Callebaut I, Junier MP and Chneiweiss H: The multifunctional protein PEA‑15 is involved Acknowledgements in the control of apoptosis and cell cycle in astrocytes. Biochem Pharmacol 66: 1581‑1588, 2003. We wish to particularly acknowledge the patients enrolled 5. Danziger N, Yokoyama M, Jay T, Cordier J, Glowinski J and Chneiweiss H: Cellular expression, developmental regulation, and in this study for their participation, and the Department of phylogenic conservation of PEA‑15, the astrocytic major phosphopro- Pathology and Physiopathology, Guilin Medical University, tein and protein kinase C substrate. J Neurochem 64: 1016‑1025, 1995. for its collaboration in providing the human samples and the 6. Farina B, Doti N, Pirone L, Malgieri G, Pedone EM, Ruvo M and Fattorusso R: Molecular basis of the PED/PEA15 interaction with clinical information used in this study with the appropriate the C‑terminal fragment of phospholipase D1 revealed by NMR ethics approval. spectroscopy. Biochim Biophys Acta 1834: 1572‑1580, 2013. 56 TANG et al: PEA15 PROMOTES LIVER METASTASIS OF COLORECTAL CANCER

7. Nagarajan A, Dogra SK, Liu AY, Green MR and Wajapeyee N: 18. Urosevic J, Garcia‑Albéniz X, Planet E, Real S, Céspedes MV, PEA15 regulates the DNA damage‑induced cell cycle check- Guiu M, Fernandez E, Bellmunt A, Gawrzak S, Pavlovic M, et al: point and oncogene‑directed transformation. Mol Cell Biol 34: Colon cancer cells colonize the lung from established liver 2264‑2282, 2014. metastases through p38 MAPK signalling and PTHLH. Nat Cell 8. Fiory F, Formisano P, Perruolo G and Beguinot F: Frontiers: Biol 16: 685‑694, 2014. PED/PEA‑15, a multifunctional protein controlling cell survival 19. Loboda A, Nebozhyn MV, Watters JW, Buser CA, Shaw PM, and glucose metabolism. Am J Physiol Endocrinol Metab 297: Huang PS, Van't Veer L, Tollenaar RA, Jackson DB, Agrawal D, E592‑E601, 2009. et al: EMT is the dominant program in human colon cancer. 9. Mace PD, Wallez Y, Egger MF, Dobaczewska MK, Robinson H, BMC Med Genomics 4: 9, 2011. Pasquale EB and Riedl SJ: Structure of ERK2 bound to PEA‑15 20. Formisano P, Ragno P, Pesapane A, Alfano D, Alberobello AT, reveals a mechanism for rapid release of activated MAPK. Nat Rea VE, Giusto R, Rossi FW, Beguinot F, Rossi G and Commun 4: 1681, 2013. Montuori N: PED/PEA‑15 interacts with the 67 kD laminin 10. Quintavalle C, Hindupur SK, Quagliata L, Pallante P, Nigro C, receptor and regulates cell adhesion, migration, proliferation and Condorelli G, Andersen JB, Tagscherer KE, Roth W, Beguinot F, apoptosis. J Cell Mol Med 16: 1435‑1446, 2012. et al: Phosphoprotein enriched in diabetes (PED/PEA15) 21. Mor A and Philips MR: Compartmentalized Ras/MAPK promotes migration in hepatocellular carcinoma and confers signaling. Annu Rev Immunol 24: 771‑800, 2006. resistance to sorafenib. Cell Death Dis 8: e3138, 2017. 22. Fang JY and Richardson BC: The MAPK signalling pathways 11. Zanca C, Garofalo M, Quintavalle C, Romano G, Acunzo M, and colorectal cancer. Lancet Oncol 6: 322‑327, 2005. Ragno P, Montuori N, Incoronato M, Tornillo L, Baumhoer D, et al: 23. Gu Y, Wang Q, Guo K, Qin W, Liao W, Wang S, Ding Y and PED is overexpressed and mediates TRAIL resistance in human Lin J: TUSC3 promotes colorectal cancer progression and epithe- non‑small cell lung cancer. J Cell Mol Med 12: 2416‑2426, lial‑mesenchymal transition (EMT) through WNT/β‑catenin and 2008. MAPK signalling. J Pathol 239: 60‑71, 2016. 12. Shin M, Lee KE, Yang EG, Jeon H and Song HK: PEA‑15 24. Lee J, Bartholomeusz C, Krishnamurthy S, Liu P, Saso H, facilitates EGFR dephosphorylation via ERK sequestration Lafortune TA, Hortobagyi GN and Ueno NT: PEA‑15 unphos- at increased ER‑PM contacts in TNBC cells. FEBS Lett 589: phorylated at both serine 104 and serine 116 inhibits ovarian 1033‑1039, 2015. cancer cell tumorigenicity and progression through blocking 13. Bartholomeusz C, Rosen D, Wei C, Kazansky A, Yamasaki F, β‑catenin. Oncogenesis 1: e22, 2012. Takahashi T, Itamochi H, Kondo S, Liu J and Ueno NT: PEA‑15 25. Sulzmaier F, Opoku‑Ansah J and Ramos JW: Phosphorylation induces autophagy in human ovarian cancer cells and is associ- is the switch that turns PEA‑15 from tumor suppressor to tumor ated with prolonged overall survival. Cancer Res 68: 9302‑9310, promoter. Small GTPases 3: 173‑177, 2012. 2008. 26. Eckert A, Böck BC, Tagscherer KE, Haas TL, Grund K, Sykora J, 14. Pinato DJ, Tan TM, Toussi ST, Ramachandran R, Martin N, Herold‑Mende C, Ehemann V, Hollstein M, Chneiweiss H, et al: Meeran K, Ngo N, Dina R and Sharma R: An expression The PEA‑15/PED protein protects glioblastoma cells from signature of the angiogenic response in gastrointestinal neuro- glucose deprivation‑induced apoptosis via the ERK/MAP kinase endocrine tumours: Correlation with tumour phenotype and pathway. Oncogene 27: 1155‑1166, 2008. survival outcomes. Br J Cancer 110: 115‑122, 2014. 27. Li X, Iomini C, Hyink D and Wilson PD: PRKX critically regu- 15. Livak KJ and Schmittgen TD: Analysis of relative gene lates endothelial cell proliferation, migration, and vascular‑like expression date using real‑time quantitative PCR and the structure formation. Dev Biol 356: 475‑485, 2011. 2(‑Delta Delta C(T)) method. Method 25:402‑408, 2001. 16. Li F and Mahato RI: RNA interference for improving the outcome of islet transplantation. Adv Drug Deliv Rev 63: 47‑68, This work is licensed under a Creative Commons 2011. 17. Sotelo J, Esposito D, Duhagon MA, Banfield K, Mehalko J, Attribution-NonCommercial-NoDerivatives 4.0 Liao H, Stephens RM, Harris TJ, Munroe DJ and Wu X: International (CC BY-NC-ND 4.0) License. Long‑range enhancers on 8q24 regulate c‑Myc. Proc Natl Acad Sci USA 107: 3001‑3005, 2010.