Expression in Human Airway Epithelium Via JAK and NF-Κb Signaling Pathways

IL-17 Markedly Up-Regulates β-Defensin-2 Expression in Human Airway Epithelium via JAK and NF-κB Signaling Pathways

This information is current as Cheng-Yuan Kao, Yin Chen, Philip Thai, Shinichiro Wachi, of September 25, 2021. Fei Huang, Christy Kim, Richart W. Harper and Reen Wu J Immunol 2004; 173:3482-3491; ; doi: 10.4049/jimmunol.173.5.3482 http://www.jimmunol.org/content/173/5/3482 Downloaded from

References This article cites 61 articles, 28 of which you can access for free at: http://www.jimmunol.org/content/173/5/3482.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

by guest on September 25, 2021 *average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2004 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

IL-17 Markedly Up-Regulates ␤-Defensin-2 Expression in Human Airway Epithelium via JAK and NF-␬B Signaling Pathways1

Cheng-Yuan Kao, Yin Chen, Philip Thai, Shinichiro Wachi, Fei Huang, Christy Kim, Richart W. Harper, and Reen Wu2

Using microarray gene expression analysis, we first observed a profound elevation of human ␤-defensin-2 (hBD-2) message in IL-17-treated primary human airway epithelial cells. Further comparison of this stimulation with a panel of cytokines (IL-1␣,1␤, 2Ð13, and 15Ð18; IFN-␥; GM-CSF; and TNF-␣) demonstrated that IL-17 was the most potent cytokine to induce hBD-2 message (>75-fold). IL-17-induced stimulation of hBD-2 was time and dose dependent, and this stimulation also occurred at the protein level. Further studies demonstrated that hBD-2 stimulation was attenuated by IL-17R-specific Ab, but not by IL-1R antagonist or Downloaded from the neutralizing anti-IL-6 Ab. This suggests an IL-17R-mediated signaling pathway rather than an IL-17-induced IL-1␣␤ and/or IL-6 autocrine/paracrine loop. hBD-2 stimulation was sensitive to the inhibition of the JAK pathway, and to the inhibitors that affect NF-␬B translocation and the DNA-binding activity of its p65 NF-␬B subunit. Transient transfection of airway epithelial cells with an hBD-2 promoter-luciferase reporter gene expression construct demonstrated that IL-17 stimulated promoter-reporter gene activity, suggesting a transcriptional mechanism for hBD-2 induction. These results support an IL-17R-mediated signaling http://www.jimmunol.org/ pathway involving JAK and NF-␬B in the transcriptional stimulation of hBD-2 gene expression in airway epithelium. Because IL-17 has been identified in a number of airway diseases, especially diseases related to microbial infection, these findings provide a new insight into how IL-17 may play an important link between innate and adaptive immunity, thereby combating infection locally within the airway epithelium. The Journal of Immunology, 2004, 173: 3482Ð3491.

irway epithelium directly interacts with the environment All of the known hBDs are cationic peptides. They share a con- through inhalation and exhalation, and many host de- served motif, which is composed of six spaced cysteines. The hBD A fense systems have evolved to eliminate microbial in- coding sequence is organized into two exons. The N terminus of vaders and control infection locally. In addition to providing a the translation product is led by a signal peptide, which is even- by guest on September 25, 2021 physical barrier against infection, the epithelium secretes a variety tually cut off to form a propeptide and then a mature peptide. of antimicrobial substances that can inhibit or neutralize invading Currently, expression of five hBDs has been identified in airway pathogens (1–4). Defensins are one of the two major vertebrate cells (8). hBD-1 was isolated from human plasma and is expressed antimicrobial peptide families that provide the chemical shields in most epithelial cells (9, 10). hBD-2 was originally isolated from against a broad spectrum of microorganism infections (5). Based human skin and is highly expressed after proinflammatory induc- on different arrangements of the six-cysteine motifs, human de- tion in the lung (11). hBD-3 was found recently through the use of fensins are categorized into ␣- and ␤-defensin subfamilies (6). The several different approaches, which included a genomics-based ␣-defensins are produced by neutrophils and intestinal Paneth’s PCR search and a traditional peptide purification. hBD-3 could be cells, while human ␤-defensins (hBDs)3 are mostly produced by detected in lung tissue following induction with IL-1 (12–14). epithelial cells of the skin and the tracheobronchial tree (7). hBD-4, which is also reported to be expressed by lung epithelial cells, was discovered through a direct BLAST search of genome sequences on chromosome 8 (15). Using an ORFeome-based Hid- Center for Comparative Respiratory Biology and Medicine, University of California, den Markov Model search, we recently identified a novel ␤-de- Davis, CA 95616 fensin, hBD-6, verified its expression, and confirmed the bacteri- Received for publication December 29, 2003. Accepted for publication June 24, 2004. cidal activity of the peptide in human airways (8). hBD-6 was The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance found recently to also be expressed in the epididymis (16). All the with 18 U.S.C. Section 1734 solely to indicate this fact. ␤-defensins have a broad spectrum of antimicrobial activity at mi- 1 This work was supported by National Institutes of Health Grants HL35635, cromolar concentrations. ES09701, ES00628, and AI 50496, and California Tobacco-Related Disease Research hBD-2 represents the first human defensin that is produced by ep- Program Grant 10RT-0262. Y.C. was aided by a grant from American Lung Asso- ciation of California Research Program. P.T. was supported by National Institutes of ithelial cells following contact with bacteria, viruses, or cytokines, Health Training Grant HL007013. R.W.H. was supported by National Institutes of such as IL-1 and TNF-␣ (2, 17–22). Although the nature of the reg- Health KO8 Grant HL04404. 2 ulation is not completely characterized, both the MAPK signal trans- Address correspondence and reprint requests to Dr. Reen Wu, Center for Compar- ␬ ative Respiratory Biology and Medicine, Surge 1 Annex, Room 1121, University of duction pathway and the NF- B transcription factor have been sug- California, One Shields Avenue, Davis, CA 95616. E-mail address: [email protected] gested to be involved (23, 24). Using a panel of cytokines that 3 Abbreviations used in this paper: hBD, human ␤-defensin; BI, Transwell chamber included IL-1␣,1␤, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, and with air-liquid interface condition; CG, collagen gel-coated surface; Ct, threshold ␥ ␣ cycle; hIL, human IL; mBD, mouse ␤-defensin; TBE, tracheobronchial epithelial; TC, 18; IFN- ; GM-CSF; and TNF- , we report that IL-17 is the most plastic tissue culture surface. potent cytokine to stimulate hBD-2 expression in well-differentiated

Copyright © 2004 by The American Association of Immunologists, Inc. 0022-1767/04/$02.00 The Journal of Immunology 3483 primary human tracheobronchial epithelial (TBE) cells. hBD-2 stim- Cytokine, antagonist, and inhibitor treatment ulation increased 75-fold after IL-17 treatment as compared with only Recombinant human cytokines were dissolved in PBS with 1% BSA and 5- to 10-fold with IL-1 and TNF-␣ treatments. This stimulation also added directly to both the apical and basal sides of medium of the primary occurred at the protein level. TBE cultures (0–100 ng/ml). The control treatments had the same amount IL-17 is a proinflammatory cytokine originally identified as of PBS-1% BSA added. In the receptor antagonist studies, the antagonists CTLA-8 (25). It displays 58% homology to the T-lymphotropic (40, 200, and 1000 ng/ml) were added to the cultures 30 min before IL-17 treatment. Helenalin, sulfasalazine, AG490, and JAK inhibitor I were dis- Herpesvirus Saimiri gene 13 product (26, 27). Subsequent studies solved in DMSO, and they were also added to the culture 30 min before of human IL-17 (hIL-17 or IL-17A) demonstrated exclusive ex- IL-17 treatment. The optimal dose for each of the selected inhibitors was pression of this cytokine by activated T cells, predominantly of the determined based on the current literature and by following the manufac- prototypic CD45ϩROϩCD4ϩ subtype (28). The other potential turer’s recommendations. A dye exclusion assay with trypan blue was used to test the cell viability of cultured cells treated with each chemical. No source of IL-17 was suggested from a recent mouse lung study that obvious cytotoxicity (Ͻ0.5%) was found in cultures treated with these demonstrated the potential role of TLR-4 and IL-23 in mediating chemicals at the doses used. the stimulation of IL-17 production by CD4ϩ and CD8ϩ T cells (29). It was reported that IL-17 could regulate pulmonary neutro- RNA isolation and Affymetrix GeneChip array analysis phil emigration in the context of local bacterial infections (30, 31). RNA was extracted from cultures using RNA TRIzol reagent (Invitrogen, Recent studies have led to the discovery of several other IL-17 Carlsbad, CA), according to the manufacturer’s protocol. Affymetrix Ge- gene family members, IL-17B, C, D, E, and F, which are thought neChip HuGene-U133A oligonucleotide microarrays (Santa Clara, CA) were used to profile gene expression patterns of TBE cells after IL-6 and to have overlapping physiological functions with hIL-17/IL-17A IL-17 treatments. An initial 30 ␮g of RNA of each sample was sent to the (32, 33). However, the physiological functions of these new IL-17 University of California, Davis Microarray Core Facility (Sacramento, Downloaded from gene family members are still unknown. CA). Image data were further analyzed by statistical analysis tools written IL-17 has been found to be elevated in a variety of inflammatory in R through the Bioconductor project (http://www.bioconductor.org). conditions such as with asthma and Gram-negative bacterial pneu- Real-time RT-PCR expression analysis monia (33). IL-17 stimulates NF-␬B activation and also the ex- Five micrograms of total RNA was reverse transcribed with Moloney murine pression of IL-6, IL-8, ICAM, MIP-2, Gro, and GM-CSF in rodent leukemia virus-reverse transcriptase (Promega, Madison, WI) by oligo(dT) and human cells (34). In human macrophages, IL-17 stimulated the primers for 90 min at 42°Cin20␮l and then further diluted to 100 ␮l with http://www.jimmunol.org/ production of proinflammatory cytokines, such as IL-1␤ and water for the following procedures. A total of 2 ␮l of diluted cDNA was TNF-␣ (35). We have recently demonstrated that IL-17 stimulates analyzed using 2ϫ SYBR green PCR master mix (Applied Biosystems, Foster MUC gene expression partly through a JAK-2-dependent and IL-6 City, CA) by an ABI 5700 or ABI PRISM 7900HT Sequence Detection Sys- tem (Applied Biosystems), following the manufacturer’s protocol. Gene-spe- autocrine/paracrine loop in primary human TBE cells (36). cific primers were designed according to the sequences to cover the conserved In the present study, initially through microarray gene expres- peptide sequence regions. PCR primers used were: hBD-1, forward, sion profile analysis, we identify a selective activation of hBD-2 CAGTCGCCATGAGAACTTCCT, and reverse, CTGCTGACGCAATTG expression by IL-17. Further studies with a panel of cytokines TAATGA; hBD-2, forward, GCCTCTTCCAGGTGTTTTTG, and reverse, GAGACCACAGGTGCCAATTT; hBD-3, forward, GGTGAAGCCTAG demonstrate that IL-17 is the most potent cytokine that stimulates CAGCTATGAG, and reverse, CGCCTCTGACTCTGCAATAAT; mouse by guest on September 25, 2021 hBD-2 expression. This stimulation appears to occur at the tran- ␤-defensin-3 (mBD-3), forward, GTCTCCACCTGCAGCTTTTAG, and re- scriptional level through JAK/NF-␬B-dependent, and IL-1- and verse, ACTGCCAATCTGACGAGTGTT; ␤-actin, forward, AGAAAATCT IL-6-independent mechanisms. GGCACCACACC, and reverse, GGGGTGTTGAAGGTCTCAAA; and GAPDH, forward, CAATGACCCCTTCATTGACC, and reverse, GA CAAGCTTCCCGTTCTCAG. The PCR was conducted in 96-well optical Materials and Methods reaction plates, and each well contained a 50 ␮l reaction mixture that contained Reagents 25 ␮l of the SYBR green PCR master mix, 1 ␮l of each forward and reverse primer, 21 ␮l of water, and 2 ␮l of cDNA samples. The SYBR green dye was Recombinant human IL-1␣,1␤, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, measured at 530 nm during the extension phase. The threshold cycle (Ct) value 17, and 18; TNF-␣; IFN-␥; GM-CSF; IL-1R antagonist; and IL-17R Ab reflects the cycle number at which the fluorescence generated within a reaction were purchased from R&D Systems (Minneapolis, MN). Mammalian cells crosses a given threshold. The Ct value assigned to each well thus reflects the secreting recombinant IL-17A, B, C, D, and E in conditioned medium were point during the reaction at which a sufficient number of amplicons have been obtained from ProteinBank (San Diego, CA). Helenalin, sulfasalazine, accumulated. The relative mRNA amount in each sample was calculated based AG490, and JAK inhibitor I were purchased from Calbiochem-Novabio- on its Ct in comparison with the Ct of housekeeping genes, such as ␤-actin and chem (San Diego, CA). GAPDH. The results were presented as 2ˆ (Ct of housekeeping gene – Ct of hBD-2), an arbitrary unit. The purity of amplified product was determined as Cell culture from human and mouse airway tissues a single peak of the dissociation curve. Real-time PCR was conducted in du- Human tracheobronchial tissues were obtained from the University of Cal- plicate for each sample, and the mean value was calculated. This procedure ifornia Medical Center (Sacramento, CA) with patient consent, and also was performed in two or three independent experiments. from National Disease Research Interchange (Philadelphia, PA). The Uni- Quantification of hBD-2 by a competitive ELISA method versity Human Subjects Review Committee approved all procedures involved in tissue procurement. Tissues were collected only from patients Goat polyclonal Ab to hBD-2 was purchased from Santa Cruz Biotech- without known respiratory tract diseases. Primary cultures derived from nology (Santa Cruz, CA). Synthetic mature hBD-2 (GIG DPV TCL KSG these airway tissues have been established before (37, 38). Protease-dis- AIC HPV FCP RRY KQI GTC GLP GTK CCK KP) and DEFB-106 (FFD sociated TBE cells were plated on a collagen gel substratum-coated Trans- EKC NKL KGT CKN NCG KNE ELI ALC QKF LKC CRT IQP CGS well (Corning Costar, Corning, NY) chamber (25 mm) at 1–2 ϫ 104 cells/ IID) (8) peptides (Alpha Diagnostic International, San Antonio, TX) were cm2,inaHam’s F12/DMEM (1:1) supplemented with insulin (5 ␮g/ml), dissolved in 0.01% acetic acid with 0.2% BSA (Sigma-Aldrich, St. Louis, transferrin (5 ␮g/ml), epidermal growth factor (10 ng/ml), dexamethasone MO). A single Western blot band was detected with the synthetic mature (0.1 ␮M), cholera toxin (10 ng/ml), bovine hypothalamus extract (15 ␮g/ hBD-2 peptide, but not the DEFB-106 peptide, by the commercial anti- ml), BSA (0.5 mg/ml), and all-trans-retinoic acid (30 nM). After 1 wk in hBD-2 polyclonal Ab (data not shown). For a competitive ELISA, hBD-2 an immersed culture condition, these primary TBE cultures were trans- was coated in immunoassay microplates (Immulon 2 HB; Fisher Scientific, ferred to an air-liquid interface (biphasic) culture condition. HBE1 cell line Pittsburgh, PA) at 200 ng/well in coating buffer (0.1 M sodium bicarbon- is an immortalized line of normal human airway epithelial cells (39). HBE1 ate/carbonate and 0.02% sodium azide, pH 9.6) overnight at 4°C. Plates cells were cultured under four different conditions: 1) plastic tissue culture were washed once with the washing solution, PBS/Tween 20 (0.05%) surface (TC), 2) Transwell chamber with air-liquid interface condition buffer (pH 7.4), and nonspecific binding sites were blocked by incubation (BI), 3) collagen gel-coated surface (CG), and 4) collagen gel-coated with PBS/Tween 20/3% BSA buffer for 30 min at room temperature. Plates Transwell chamber with an air-liquid interface condition (BI-CG). were further washed twice with the PBS-Tween washing solution (200 3484 IL-17 INDUCES hBD-2 EXPRESSION IN AIRWAY EPITHELIUM

␮l/well). A standard 1/1000 dilution of primary goat anti-hBD-2 Ab competition mixture containing different amounts of referenced hBD-2 peptide (0–50 ng/mixture) and samples of culture medium prepared from these airway cell cultures was added to each well (200 ␮l/well), and incubated at 37°C for 2 h. After four more washings, 200 ␮l/well of 1/1000 dilution of alkaline phosphatase-conjugated anti-goat IgG secondary Ab (Vector Lab- oratories, Burlingame, CA) was added to each well, and the incubation was continued at 37°C for 1 h. Wells were washed five times, and 200 ␮l/well of a 1 mg/ml solution of p-nitrophenyl phosphate (Sigma-Aldrich) in sub- strate buffer (10% diethanolanine and 0.02% sodium azide, pH 9.8) was added for color development (20–40 min at room temperature). The plate was read at 405 nm for the absorbance. Unknown samples were preassayed at three different dilutions to assure that the data were within the linear range of the competition by referenced hBD-2. The results indicated a sensitivity of the competitive ELISA for referenced hBD-2 at 10 ng/well. The results were averaged from triplicate wells of one representative experiment from three independent assays. There was no detectable cross- reaction with the DEFB-106 peptide with this anti-hBD-2 Ab (data not shown). Cloning of the hBD-2 promoter-luciferase reporter plasmid A DNA fragment containing the proximal 2.2 kb of the hBD-2 promoter region (Ϫ2210 to ϩ24) was amplified from PstI-digested genomic DNA Downloaded from by PCR with the following primers: GTTGCTAGCCTTTGGGACTTC FIGURE 1. A three-dimensional scatter plot analysis of global gene ex- CCCAGCTATG (forward primer with NheI tail) and TTTAAGCTTTG pression patterns by primary human TBE cells after IL-17 or IL-6 treat- GCTGATGGCTGGGAGCTT (reverse primer with HindIII tail). The am- ment. RNAs were isolated from primary cultures after 24-h treatment with plified product was subcloned into a pGL-3 vector (Promega) with firefly these cytokines (10 ng/ml). A global gene expression analysis was con- luciferase reporter gene to generate hBD2-2210/Luc plasmid. The authen- ticity of the clone was confirmed and reconfirmed by DNA sequencing. ducted on Affymetrix gene chip, HuGene U133A. Each dot on the plot represents the relative level of expression of a single gene related to cy- http://www.jimmunol.org/ Transient transfection and luciferase assay tokine-treated and -untreated cultures. For showing differential expression HBE1 cells were seeded into 24-well plates at a density of 5 ϫ 104 cells/ of genes in the analysis, these dots are plotted three dimensionally. A well. One day after plating, cells were transfected with 0.3 ␮g of hBD2- majority of genes are not differentially expressed, and they are diagonally 2210/Luc plasmid DNA and 50 ng of Renilla luciferase expression vector projected at the center of the plot. These include the expression of various pRL-TK (Promega) using FuGENE 6-based gene transfer protocol (Roche ␣-defensins and hBD-1, as shown in red dots in the enlarged inset. The Diagnostic Systems, Indianapolis, IN), according to the manufacturer’s in- expression of hBD-2 and CCL20 (MIP-3␣), also shown in red dots, was struction. Eighteen hours after the transfection, cells were treated with highly differentially expressed with a preferential elevation toward the various concentrations of IL-17, and cell extracts were prepared for re- IL-17 axis. porter gene assays 24 h after the cytokine treatment. The reporter gene

assays were conducted with the Dual-Glo Luciferase Assay System (Pro- by guest on September 25, 2021 mega), according to the manufacturer’s protocol. The relative hBD-2 promoter activities were expressed as relative light units after normalization to hBD-2 and MIP-3␣ (data not shown). Our data confirm the induc- the control, Renilla luciferase activity. The results were averaged from tion of IL-8 and G-CSF by IL-17 (34). triplicate wells of three separate experiments. To further evaluate induction of hBD-2, primary TBE cells were Statistical analysis treated with a panel of cytokines (10 ng/ml), including IL-1␣,1␤, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, and 18; IFN-␥; Ϯ Data are expressed as mean SE. The number of repeats for each exper- GM-CSF; and TNF-␣. Real-time RT-PCR analysis was conducted iment is described under Results and also in the figure legends. Group differences were calculated by ANOVA, and p values Ͻ0.05 were consid- for hBD-2 expression in these cytokine-treated samples. As shown ered significant. in Fig. 2, hBD-2 message was elevated in TBE cells by IL-1␣, IL-1␤, IL-6, IL-17, and TNF-␣, whereas other cytokines had little Results influence. Inductions of hBD-2 by IL-1␣, IL-1␤, and TNF-␣ treat- Profound effect of IL-17 on the stimulation of hBD-2 expression ment are consistent with previous reports (17, 18, 41). The ob- in human primary TBE cells served moderate induction by IL-6 has not been reported before. Our recent work has demonstrated that, among a panel of cyto- Overnight (16-h) treatment of airway epithelial cells with IL-17 kines, both IL-6 and IL-17 are the most potent mediators to stim- consistently resulted in a Ͼ70-fold induction of hBD-2 message. ulate mucin gene expression in primary human TBE cells (36). As Treatments of airway cells with IL-2, 3, 4, 8, 9, 10, 11, 12, and 13, an extension of this work, Affymetrix microarray analysis was even at higher doses (50 ng/ml), did not result in increased hBD-2 conducted to profile the gene expression patterns in cells treated message (data not shown). We did not observe any cytokine-in- with these cytokines. As shown in Fig. 1, the three-dimensional duced cytotoxicity. Cell viability, assessed by the trypan blue ex- scatter plot of the array data showed that IL-17 pronouncedly stim- clusion method, routinely was greater than 95%. ulated both hBD-2 and MIP-3␣, but not other antimicrobial genes, hBD-1 and various ␣-defensins by IL-17, whereas IL-6 had little Stimulation of hBD-2 expression by IL-17A and rhIL-17, not by influence on these genes. MIP-3␣ was recently shown to have other IL-17 variants antimicrobial activity (40). According to these data, the magnitude The stimulation of hBD-2 expression was further tested with dif- of the induction for both hBD-2 and MIP-3␣ is similar, although ferent IL-17 variants. Mammalian cell-secreted recombinant IL- the basal level of hBD-2 is 7-fold higher than MIP-3␣. Because of 17A, B, C, D, and E conditioned medium was obtained from a this analysis, this study focused on hBD-2 expression. In the mi- commercial source, and the effects of these secretory products on croarray data set, we also observed that IL-17 induced the eleva- hBD-2 expression were examined. For comparison, rhIL-17, used tion of IL-8 and G-CSF expression. There was a Ͼ2-fold induction in the experiments described above, was included in this study. As of IL-8 and a Ͼ3-fold induction of G-CSF, although these induc- shown in Fig. 3, only rhIL-17 and IL-17A conditioned medium tion levels were small compared with the Ͼ8-fold induction of was able to stimulate hBD-2 expression after both 24- and 72-h The Journal of Immunology 3485

FIGURE 2. Real-time PCR analysis of hBD-2 mRNA levels in primary human TBE cells after cytokine treatment. Primary cultures were con- FIGURE 3. Real-time PCR analysis of hBD-2 mRNA levels in primary human TBE cells after cytokine treatment. Recombinant human IL-17 (20 ducted under air-liquid interface culture condition, as described in the text. Downloaded from On day 21 after plating, cytokines (10 ng/ml) were added to both the apical ng/ml) or undiluted IL-17A, B, C, D, E medium was added to both the and basal sides of the culture. Total RNA was collected after overnight apical and basal sides of the culture. Total RNA was collected after 24- and incubation (16 h). Cytokines: IL-1␣,1␤,2,3,4,5,6,7,8,9,10,11,12, 72-h incubation. The expression of mRNA was analyzed by real-time PCR 13, 15, 16, 17, and 18; TNF-␣; IFN-␥; and GM-CSF. The expression of and normalized to ␤-actin. The relative quantity was further normalized mRNA was normalized to ␤-actin, and the relative quantity was further with the control. Results are means Ϯ SE of duplicate samples from one .p Ͻ 0.05, compared with control ,ء .normalized with the control. Control is vehicle (PBS/1% BSA)-treated cul- representative experiment tures. Results are expressed as means Ϯ SE for duplicate samples from one http://www.jimmunol.org/ representative experiment of three independent primary cultures from dif- p Ͻ 0.05, compared with control. course. Remarkably, up to 100-fold stimulation was seen at 48 h ,ء .ferent donors after treatment. IL-17 had no effects on hBD-1 and hBD-3 expression at any time point. incubation, whereas other IL-17 variants had no effect. These re- A competitive ELISA revealed that hBD-2 gene induction was sults confirm the specificity of the IL-17A variant in the induction associated with a significant increase in levels of hBD-2 peptide of hBD-2 expression. compared with control medium both after 24-h treatment with ␤ IL-17 in biphasic cultured primary human TBE cells and after 1 IL-17 stimulates the mouse homologue -defensin gene, mBD-3 by guest on September 25, 2021 wk treatment with IL-17 in biphasic cultured HBE1 cells (Fig. 7B). To test the evolutionary conservation of IL-17-induced hBD-2 ex- Secretion of hBD-2 peptide was significantly increased from epi- pression, the expressions of mouse homologues, mBD-3 and thelial cells exposed to IL-17 compared with those without IL-17 mBD-4, by mouse primary tracheal epithelial cells were analyzed treatment. Although the dose study of mRNA production (Fig. 5) by real-time RT-PCR. C57BL/6 mouse tracheal epithelial cells shows a significant induction starting from 10 ng/ml IL-17 in TBE were isolated and cultured under an air-liquid interface condition, similar to that of human primary TBE cells, for 2 wk. IL-17 at 10 ng/ml was added to these cultures, and RNA was harvested 24 h later for real-time RT-PCR quantification, as described in Materi- als and Methods. Baseline mBD-4 expression was very low, and there was no IL-17 stimulation (data not included). However, IL-17 was able to significantly stimulate mBD-3 message in primary mouse tracheal epithelial cells (Fig. 4). This result is consistent with a recent report demonstrating increased mBD-3 expression, but not mBD-4 expression in mouse cells after bacterial challenge (42, 43). This result provides further support that IL-17 has a significant effect on hBD-2/mBD-3 expression.

Kinetics studies of IL-17 effects on hBD-2 expression The effects of IL-17 on hBD-2 gene expression were dose dependent (Fig. 5). IL-17 concentrations as low as 1 ng/ml elicited sig- niﬁcant stimulation of hBD-2 gene expression in primary TBE cells after 48 h of treatment. Peak stimulation occurred at 50 ng/ml dose, with no further increase at 100 ng/ml level. Importantly, IL-17 had no effects on hBD-1 and hBD-3 expressions at all the FIGURE 4. Evolutionary conservation of IL-17 effect of mBD-3 gene expression. C57BL/6 mouse primary tracheal epithelial cells grown under concentrations tested (1–100 ng/ml). air-liquid interface for 2 wk were replaced with medium containing Time course studies revealed that the effect of IL-17 on hBD-2 20 ng/ml IL-17 or PBS-BSA (control). Total RNA was collected after 24-h gene expression was also time dependent (Fig. 6). A signiﬁcant treatment. The level of mBD-3 message was analyzed by real-time PCR level of stimulation of hBD-2 message by IL-17 (20 ng/ml) was and normalized to ␤-actin. Values are mean Ϯ SE of three independent seen within 3 h, and a maximum stimulation was seen at 12 h. This experiments and were compared between control- and IL-17-treated sam- .p Ͻ 0.05 ,ء .maximal stimulation was maintained for the duration of this time ples 3486 IL-17 INDUCES hBD-2 EXPRESSION IN AIRWAY EPITHELIUM

FIGURE 5. Dose-dependent elevation of hBD-2 gene expression by hu-

man rIL-17. Primary human TBE cells were treated with various amounts Downloaded from of IL-17, as indicated. RNAs were harvested 48 h after the treatment and analyzed by real-time RT-PCR, as described in the text. Notably, no induction of hBD-1 and hBD-3 messages was seen in cultures treated with different amounts of IL-17. Values are means Ϯ SE of three independent primary cultures derived from different donors and were compared between .p Ͻ 0.05 ,ء .untreated and IL-17-treated samples http://www.jimmunol.org/ cells, IL-17-induced protein release was not detected at lower doses (data not shown). However, a long-term 10 ng/ml IL-17 treatment in biphasic HBE1 cells shows a signiﬁcant induction of the apical hBD-2 peptide release.

IL-17 also stimulates hBD-2 promoter activity To further determine whether the observed effect of IL-17 on hBD-2 expression was due to a transcriptional activation, study of by guest on September 25, 2021 the effect of IL-17 on hBD-2 promoter activity was conducted in HBE1 cells using a transient transfection approach with hBD2- 2210/Luc chimeric construct DNA. The HBE1 cell line was used simply because it is difficult to carry out gene transfer on primary TBE cells. We also grew HBE1 cells under four different culture conditions: 1) TC, 2) CG, 3) BI, or 4) BI-CG. As shown in Fig. 8, HBE1 cells grown under various culture conditions all responded to IL-17 (10 ng/ml) for elevated hBD-2 expression. These results support the notion that we can study hBD-2 gene expression on this cell line under various culture conditions, including the less differentiated TC condition. To elucidate the promoter activity, HBE1 cells were plated on a TC dish, and transfection was conducted, as described in the text. As shown in Fig. 9, there was a dose-dependent increase in the relative hBD-2 promoter-based luciferase activity by IL-17. At 5 ng/ml level, IL-17 had a significant effect on the hBD-2 promoter activity, and this effect was maximized at 100 ng/ml level. These results were consistent with the mRNA data, further supporting a FIGURE 6. Time course-dependent IL-17-induced hBD-2 expression. transcriptional mechanism of IL-17 in the regulation of hBD-2 Primary human TBE cells were treated with IL-17 (20 ng/ml), and RNAs expression. were harvested at various times, as indicated. Real-time RT-PCR was conducted to quantify the level of the expression, as described in the text. A Involvement of IL-17R A-mediated JAK/NF-␬B activation in the and C, No induction of hBD-1 and hBD-3 messages was seen in cultures regulation of hBD-2 expression treated with IL-17 at any time point. B, The effect of IL-17 on hBD-2 expression is time dependent. Values are means Ϯ SE of three independent To elucidate whether this stimulation goes through the IL-17R A, experiments. the neutralizing anti-IL-17R A-specific Ab was used. Various amounts of anti-IL-17R A-specific Ab were applied to primary TBE cells with or without IL-17. Fig. 10 shows a dose-dependent 5 ␮g/ml level. This result suggests the stimulation of hBD-2 ex- inhibition of IL-17-mediated hBD-2 expression by anti-IL-17R A pression by IL-17 is via the IL-17R A. Ab. At 1 ␮g/ml level, the inhibition of the IL-17 stimulation was Because IL-17 has been shown to stimulate the secretion of 50%, while the inhibition reached 65% when the Ab was used at several proinflammatory cytokines, such as IL-1␣,1␤, 6, and 8, in The Journal of Immunology 3487

FIGURE 8. Effects of the culture conditions on IL-17-induced hBD-2 Downloaded from expression in HBE1 cell line. HBE1 cells were plated on four different culture conditions: 1) TC, 2) BI, 3) CG, and 4) BI-CG in the culture medium supplemented as described for primary human TBE cells. At day 21, these cultures were treated with human rIL-17 (10 ng/ml). For those cultures (BI and BI-CG) that were maintained in air-liquid interface condition, IL-17 was added to both the apical and basal sides of the culture. Total RNA was collected after 48-h incubation. The expression of mRNA was http://www.jimmunol.org/ analyzed by real-time PCR and normalized to ␤-actin. Results are expressed as means Ϯ SE for duplicate samples from one representative .p Ͻ 0.05 compared with tissue culture condition control ,ء .experiment

Inhibition of IL-17-dependent hBD-2 expression by JAK and NF-␬B inhibitors To gain an insight into the possible IL-17-mediated signaling on

FIGURE 7. A competitive ELISA for the quantification of hBD-2 se- by guest on September 25, 2021 the regulation of hBD-2 expression, various signaling pathway in- cretion by culture airway epithelial cells after IL-17 treatment. A, Serial dilutions of synthetic mature hBD-2 peptide were used to generate a com- hibitors were used. Among these inhibitors, we found JAK inhib- petitive standard curve. The log of hBD-2 peptide concentration is plotted itor I and several NF-␬B-related inhibitors were the most potent against the absorbance value. B, Apical culture fluids, including 300 ␮lof washing fluid, were collected from primary human TBE cells that were grown to confluency under an air-liquid interface condition, as described in the text. IL-17 was added at 100 ng/ml level 24 h before the medium collection. For the HBE1 cell line, cells were also cultured under an air- liquid interface condition, as described for primary human TBE cells. IL-17 (10 ng/ml) was added to the HBE1 cultures three times per week. At the end of incubation (24-h incubation), apical culture fluids including the wash (total 500 ␮l) were collected. These collected culture fluids, after a centrifugation to pellet cell debris, were subjected to the competitive hBD-2 ELISA. Secretion of hBD-2 peptide was significantly increased from both airway epithelial cells exposed to IL-17 compared with those .p Ͻ 0.05 ,ء .without IL-17 treatment

a number of cell types, including the human TBE cells (44–47), some of these secretions may serve as an autocrine/paracrine function, as the IL-6 did for IL-17-mediated mucin gene expression, as shown in our recent publication (36). To rule out this possibility, various neutralizing Abs were used. For IL-8, there was no stim- FIGURE 9. The effect of IL-17 on hBD-2 promoter-reporter gene ex- ulation of hBD-2 expression by this cytokine, which rules out the pression activity. HBE1 cells plated on plastic tissue culture dish were possible IL-8 autocrine/paracrine loop in IL-17-mediated stimula- transfected with the hBD2-2210/Luc construct. One day after transfection, different amounts of IL-17 were added, and cells were harvested 24 h later tion. For IL-1␣ and IL-1␤, IL-1R antagonist at various doses was for the reporter gene activity assay, as described in the text. The relative unable to down-regulate IL-17 stimulation (Fig. 10). A similar reporter gene, luciferase activity after normalization for the transfection negative result was obtained with anti-IL-6-neutralizing Ab (data efﬁciency with the control reporter gene activity, was expressed as fold of not shown). These results support the notion that there was no activation relative to the unstimulated control. Values are mean Ϯ SE of autocrine/paracrine loop mechanism involved in IL-17-mediated three independent experiments and were compared between untreated and .p Ͻ 0.05 ,ء .hBD-2 expression. IL-17-treated samples 3488 IL-17 INDUCES hBD-2 EXPRESSION IN AIRWAY EPITHELIUM

FIGURE 10. The effect of receptor antagonists on IL-17-induced hBD-2 expression. Primary TBE cells were cultured, as described in the text. Conﬂuent cultures were pretreated with 40 ng/ml (lane 3), 200 ng/ml (lane

4), and 1000 ng/ml (lane 5) IL-1R antagonist, and 0.5 ␮g/ml (lane 7), 1 Downloaded from ␮g/ml (lane 8), and 5 ␮g/ml (lanes 6 and 9) IL-17R A Ab 30 min before IL-17 (20 ng/ml) treatment (lanes 2-5 and lanes 7Ð9). Cells were harvested 24 h later. Lane 1 was control culture without any treatment with antagonist and IL-17. Lane 2 was IL-17 only. Results in IL-1R antagonist experiment are expressed as means Ϯ SE for duplicate samples from one representative experiment. Results in IL-17R Ab neutralization are expressed as

means Ϯ SE for samples from two independent primary cultures derived http://www.jimmunol.org/ p Ͻ 0.05 when compared with IL-17 treatment,ء .from different donors alone (lane 2).

ones to reverse the enhancement. As shown in Fig. 11A, the re- versal of IL-17-mediated hBD-2 expression by JAK inhibitor I was dose dependent. However, the JAK-2-specific inhibitor, AG490, did not diminish IL-17-induced hBD-2 expression (Fig. 11A). On the contrary, there was a superinduction effect for AG490 at the by guest on September 25, 2021 dose normally reported to be sufficient for the inhibition of JAK-2 FIGURE 11. The effect of JAK and NF-␬B inhibitors on IL-17-induced until a much higher pharmacological dose was used. Fig. 11B hBD-2 expression. A, Primary TBE cells were cultured under the same shows that both helenalin, an inhibitor for the DNA-binding ac- condition as described in Fig. 9. A, Thirty minutes before IL-17 (20 ng/ml) tivity of NF-␬B p65 subunit, and sulfasalazine, an inhibitor to treatment (lanes 2-8), cultures were treated with 10 nM (lane 3), 100 nM ␮ ␮ block nuclear translocation of NF-␬B, were very effective in ab- (lane 4), and 1000 nM (lane 5) JAK inhibitor I, and 2 M(lane 6), 10 M ␮ rogating IL-17-mediated hBD-2 expression. Fig. 11C, in a prelim- (lane 7), and 50 M(lane 8) AG490. Cultures were harvested 24 h later for RNA isolation and real-time PCR analysis. Lane 1 was the control without inary fashion, shows no synergistic effect for the combined treat- any treatment. B, Primary TBE cells were pretreated with 5 ␮M(lane 3), ment of JAK inhibitor I with helenalin or sulfasalazine. These 20 ␮M(lane 4), and 50 ␮M(lane 5) helenalin, and 100 ␮M(lane 6), results support the notion that both JAK signaling and the activa- 300 ␮M(lane 7), and 1000 ␮M(lane 8) sulfasalazine 30 min before IL-17 tion of NF-␬B are involved in IL-17-mediated hBD-2 expression. (20 ng/ml) treatment (lanes 2-8). Cells were harvested 24 h later after IL-17 treatment for RNA and real-time PCR quantitation. Lane 1 was the control Discussion without any treatment. C, TBE cells were cultured and treated, as described This study describes a novel finding of IL-17 stimulation of hBD-2 above. Thirty minutes before IL-17 treatment (lanes 2-6), cultures were expression in human airway epithelial cells. Among a panel of 21 pretreated with a combination of 100 nM (lane 3) and 1000 nM (lane 4) ␮ cytokines selected for this study, IL-17 was the most potent stim- JAK inhibitor I and 5 M helenalin; and a combination of 100 nM JAK inhibitor I with 300 ␮M(lane 5) and 1000 ␮M(lane 6) sulfasalazine. Lane ulatory cytokine, inducing a 75-fold elevation of hBD-2 message. Ϯ ␣ ␤ ␣ 1 was the control without any treatment. Values in A and B are means Other cytokines, such as IL-1 ,1 , 6, and TNF- , also have stim- SE of two to three independent primary cultures derived from different ulatory effects, but to a much lesser extent (5- to 20-fold). Induc- donors and were compared between IL-17- and inhibitor-treated samples. p Ͻ 0.05 when compared with IL-17 treatment alone (lane 2). Results ,ء -tions of hBD-2 by IL-1␣, IL-1␤, and TNF-␣ treatment are consis tent with previous reports (17, 18, 41). hBD-2 is expressed in in C are expressed as means Ϯ SE for duplicate samples from one repre- p Ͻ 0.05 when compared with IL-17 treatment ,ء .epithelia of many organs, including the airways of the lungs, where sentative experiment the message is found in both surface epithelia and the serous cells alone (lane 2). of the submucosal glands (17). The known function of hBD-2 in innate immunity is believed to be related to its antimicrobial activity and to its chemotactic effects on immature dendritic cells and memory T cells (48). IL-17, mainly secreted by activated T cells crobial infections (49). Thus, the stimulatory effects of IL-17 on (26, 27), is prominently elevated in the airway lumen after micro- hBD-2 expression suggest an important role of IL-17 for either bial infections (47, 49) and has a proinflammatory role in mediat- directing or amplifying the airway inflammatory response from ing neutrophil migration (50) and the production of IL-6 and IL-8 innate response processes to adaptive response mechanisms (51, 52). IL-17R knockout mice have impaired clearance of mi- (Fig. 12). The Journal of Immunology 3489 Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 FIGURE 12. Schematic diagram of the role of IL-17-induced hBD-2 and MIP-3␣ in an airway inflammatory response to a bacteria infection. Both hBD-2 and MIP-3␣ are essential components of airway innate immunity. Through CCR6, immature dendritic cells and activated T cells are recruited by hBD-2/MIP-3␣ to boost the defense mechanism. Activated T cells are able to secrete IL-17 locally and to act on IL-17R A, which is located at the basal side of the polarized airway epithelia. Through JAK and NF-␬B pathways, hBD-2 and MIP-3␣ are further induced to provide more antimicrobial activity and the chemotactic recruitment of more inflammatory cells to achieve adaptive immunity.

Consistent with this finding, we found that IL-17 can also stim- IL-17 has been reported to induce the production of proinflam- ulate MIP-3␣ expression based on microarray analysis (Fig. 1). matory cytokines (47). For example, IL-17 up-regulated IL-1␤ ex- IL-17’s stimulation of hBD-2 is quite selective because other hBDs pression and synthesis in a dose- and time-dependent fashion in do not seem affected by IL-17. Like hBD-2, MIP-3␣ has recently human macrophages (35). IL-1␤ has also been reported to be a been shown to have potent antimicrobial activity (40) and the che- major activator of hBD-2 expression in A549 cells cultured with moattract activity for both dendritic and T cells through their mononuclear phagocytes (24). Furthermore, IL-1␣ and IL-1␤ have CCR6 receptors (53). Although these two peptides have no se- both been reported to stimulate the expression of hBD-2 in various quence homology and they belong to two different gene families, tissues (19, 54, 55). It is thus reasonable to hypothesize that the they share many similarities in the properties of antimicrobial ac- IL-17 effect on hBD-2 gene expression be mediated in an auto- tivities, chemotactic activities, binding to the CCR6 receptor, and crine/paracrine manner via locally secreted IL-1. However, be- now, regulation by IL-17. Although the significance of this finding cause the IL-1R antagonist did not block IL-17 stimulation of remains unclarified, the similarities and the redundant activity of hBD-2 expression, it is unlikely that IL-1 could be involved in hBD-2 and MIP-3␣ suggest an important role for these molecules IL-17-stimulated hBD-2 expression in human airway epithelial in airway innate immunity. The present studies demonstrate the specificity of IL-17’s effects cells. Although the present studies show that IL-6 can mildly in- on hBD-2 and on the mouse homologue, mBD-3. Our data show an duce hBD-2 and IL-17 can induce the release of IL-6, treatment of IL-17 time- and dose-dependent stimulation of hBD-2 expression IL-17-treated cells with an anti-IL-6 Ab did not block hBD-2 gene in airway epithelial cells. A concentration of IL-17 as low as 1 expression. This suggests that the IL-17 effect was not mediated ng/ml was able to significantly stimulate hBD-2 expression. Other through IL-6. Taken together, hBD-2 gene expression appears to variants of the IL-17 superfamily IL-17 B, C, D, E, and F (32, 33) be modulated by IL-17 via a unique pathway that is independent of failed to exhibit any stimulation of hBD-2. This finding was further an IL-1 or IL-6 autocrine/paracrine loop. This IL-17-dependent buttressed by the fact that anti-IL-17R A-neutralizing Ab inhibited mechanism could serve to amplify an acquired immune response the stimulation. against a pathogen by directing innate immune mechanisms (such 3490 IL-17 INDUCES hBD-2 EXPRESSION IN AIRWAY EPITHELIUM

as antimicrobial peptide or chemoattraction of inflammatory cells) had more time to develop, activated T cells arrive to the site of toward sites of T lymphocyte activation. infection and locally release IL-17. A preliminary study has shown We have earlier shown that IL-17 induced up-regulation of mu- the presence of IL-17R A at the basal side of the polarized airway cin gene MUC5B expression through an IL-6 autocrine/paracrine epithelia (data not shown). The locally secreted IL-17 can presum- loop, and the JAK/STAT pathway (36). However, different JAK ably augment the local airway antibacterial defense via its binding isotypes appear to be involved in their regulation of MUC5B and to the IL-17R via a JAK/NF-␬B signaling pathway, thus further hBD-2. In the case of MUC5B, the stimulation by IL-17 was activating the induction of hBD-2 and/or other chemokines such as blocked by the JAK2 inhibitor, AG490. However, hBD-2 was not MIP-3␣ in neighboring epithelial cells. inhibited by this inhibitor, and its induction by IL-17 was actually To our knowledge, no studies have previously shown that IL-17 accentuated by the AG490 treatment. How this induction is aug- can induce hBD-2 gene expression in airway epithelial cells. Our mented by a JAK2 inhibitor is not entirely clear at this point. results add to the growing body of evidence of the important role Although IL-17A has a low affinity with its receptor, various JAK that cytokines play in regulating hBD-2 gene expression. We be- isotypes, such as JAK-1, -2, -3, and Tyk-2, have been demon- lieve that the ability of IL-17 to induce hBD-2 gene expression strated to interact with IL-17R A on binding to its ligand in human could play an important role in the airway host defense against U937 monocytic leukemia cells (56). Our previous and present bacterial pathogens. Because IL-17 is notable for its ability to stim- results, showing the sensitivity of IL-17’s induction of MUC5B ulate IL-6/IL-8 secretion and to regulate neutrophil migration, it and hBD-2 to JAK inhibitors, support the notion that the IL-17R A would be intriguing to speculate whether it may play a role in in airway epithelial cells may interact with various JAK isotypes inflammatory airway diseases characterized by neutrophil infiltra-

upon the ligand binding. The sensitivity of hBD-2 expression to a tion such as chronic obstructive pulmonary disease and cystic ﬁ- Downloaded from JAK inhibitor I, which is considered to be not a very speciﬁc JAK brosis (34). inhibitor, suggests the likely involvement of JAK-1, -2, -3, and/or In conclusion, the results from the present study indicate a novel Tyk-2 in the receptor-mediated signaling regulation (57). role for IL-17 in directly stimulating hBD-2 gene expression in Further promoter-reporter gene transfection studies in the im- primary airway epithelial cells. We further demonstrated that mortalized normal human bronchial epithelial cell line HBE1 (39) IL-17 mediates its effect on hBD-2 mostly through JAK and

were conducted to further elucidate the molecular nature of this NF-␬B signaling events. Further investigations should address http://www.jimmunol.org/ regulation. This cell line behaves similarly to primary TBE cells in whether the involvement of other pathways, such as MAPK path- its response to IL-17 for inducing hBD-2 expression. We observed ways, are also involved in IL-17-mediated hBD-2 gene expression. an IL-17-induced stimulation of the hBD-2 promoter activity in The present results widen the spectrum of known cytokines that these transfected cells. This result supports an increased transcrip- can regulate defensin expression and offer preliminary evidence tional activity as a mechanism for hBD-2 induction. We further for a novel IL-17-related mechanism coordinating select innate demonstrated that inhibitors of NF-␬B attenuate IL-17-induced and adaptive immune responses. hBD-2 expression. Because IL-17 has been shown to activate NF-␬B in other cell types (58–60), these ﬁndings suggest this also

Acknowledgments by guest on September 25, 2021 occurs in airway epithelial cells and that hBD-2 is activated down- ␬ We thank Yu Hua Zhao for her suggestion on performing the competitive stream to NF- B activation. These results are consistent with other ELISA for hBD-2 and the superior cell culture work in providing primary ␬ studies showing the importance of NF- B in the regulation of human TBE cell cultures used in the study. We also acknowledge the hBD-2 expression by LPS and by other cytokines (24). Interest- support from the Microarray Core Lab at University of California Davis ingly, in mouse airway epithelial cultures, we observed IL-17- Cancer Center for performing the microarray analysis for this study. stimulated mBD-3 expression, but not mBD-4. Both mBD-3 and Drs. Suzette Smiley-Jewell and Carroll E. Cross are thanked for their ed- mBD-4 are mouse homologues of hBD-2. However, the sequence iting of the manuscript. analysis reveals the presence of a putative cis-binding site for NF-␬B transcriptional factor in the mBD-3 gene, whereas no such References putative site can be found in the 5Ј-flanking region of the mBD-4 1. Diamond, G., D. Legarda, and L. K. Ryan. 2000. The innate immune response of gene. This result further strengthens the participation of NF-␬B- the respiratory epithelium. Immunol. Rev. 173:27. 2. Becker, M. N., G. Diamond, M. W. Verghese, and S. H. Randell. 2000. CD14- mediated transcriptional mechanisms in IL-17-enhanced hBD-2 dependent lipopolysaccharide-induced ␤-defensin-2 expression in human tra- expression. cheobronchial epithelium. J. Biol. Chem. 275:29731. Taking these data together, we propose an IL-17R A-dependent 3. Ganz, T. 2002. Immunology: versatile defensins. Science 298:977. ␬ 4. Ganz, T. 2002. Epithelia: not just physical barriers. Proc. Natl. Acad. Sci. USA JAK and NF- B signaling pathway for the transcriptional induc- 99:3357. tion of hBD-2 gene by IL-17 in airway epithelial cells. Because 5. Lehrer, R. I., A. K. Lichtenstein, and T. Ganz. 1993. Defensins: antimicrobial and IL-17 is the most potent cytokine in the stimulation of hBD-2, and cytotoxic peptides of mammalian cells. Annu. Rev. Immunol. 11:105. 6. Ganz, T. 2002. Antimicrobial polypeptides in host defense of the respiratory tract. because IL-17 elevation has been associated with microbial infec- J. Clin. Invest. 109:693. tions of the airways (34), we propose that such a signaling mech- 7. Schutte, B. C., and P. B. McCray, Jr. 2002. ␤-Defensins in lung host defense. anism may play a role in regulating the adaptive and innate im- Annu. Rev. Physiol. 64:709. 8. Kao, C. Y., Y. Chen, Y. H. Zhao, and R. Wu. 2003. ORFeome-based search of mune responses in the airways (Fig. 12). We hypothesize that airway epithelial cell-specific novel human ␤-defensin genes. Am. J. Respir. Cell during the early stages of an airway bacterial infection, microbial Mol. Biol. 29:71. products, such as LPS, bind to nonspecific receptors such as the 9. Bensch, K. W., M. Raida, H. J. Magert, P. Schulz-Knappe, and W. G. Forssmann. 1995. hBD-1: a novel ␤-defensin from human plasma. FEBS Lett. 368:331. TLR-4 on epithelial cells to stimulate a low level induction of 10. Zhao, C., I. Wang, and R. I. Lehrer. 1996. Widespread expression of ␤-defensin hBD-2. This innate type of response gives limited protection from hBD-1 in human secretory glands and epithelial cells. FEBS Lett. 396:319. bacterial invasion through the antimicrobial and chemotactic ac- 11. Harder, J., J. Bartels, E. Christophers, and J. M. Schroder. 1997. A peptide an- tivities of hBD-2 (61). Recently, Happel et al. (29) have demon- tibiotic from human skin. Nature 387:861. ϩ ϩ 12. Garcia, J. R., F. Jaumann, S. Schulz, A. Krause, J. Rodriguez-Jimenez, strated that the IL-17 production by CD4 and CD8 T cells in U. Forssmann, K. Adermann, E. Kluver, C. Vogelmeier, D. Becker, et al. 2001. bacteria-infected mouse lung could be boosted by IL-23 through a Identification of a novel, multifunctional ␤-defensin (human ␤-defensin 3) with specific antimicrobial activity: its interaction with plasma membranes of Xenopus TLR-4-dependent pathway. Regardless of the source of IL-17, it oocytes and the induction of macrophage chemoattraction. Cell Tissue Res. can be expected that when these acquired immune responses have 306:257. The Journal of Immunology 3491

13. Harder, J., J. Bartels, E. Christophers, and J. M. Schroder. 2001. Isolation and Expression of mucin synthesis and secretion in human tracheobronchial epithelial characterization of human ␤-defensin-3, a novel human inducible peptide anti- cells grown in culture. Am. J. Respir. Cell Mol. Biol. 3:467. biotic. J. Biol. Chem. 276:5707. 38. Wu, R., Y. H. Zhao, and M. M. Chang. 1997. Growth and differentiation of 14. Jia, H. P., B. C. Schutte, A. Schudy, R. Linzmeier, J. M. Guthmiller, conducting airway epithelial cells in culture. Eur. Respir. J. 10:2398. G. K. Johnson, B. F. Tack, J. P. Mitros, A. Rosenthal, T. Ganz, and P. B. McCray, 39. Yankaskas, J. R., J. E. Haizlip, M. Conrad, D. Koval, E. Lazarowski, Jr. 2001. Discovery of new human ␤-defensins using a genomics-based approach. A. M. Paradiso, C. A. Rinehart, Jr., B. Sarkadi, R. Schlegel, and R. C. Boucher. Gene 263:211. 1993. Papilloma virus immortalized tracheal epithelial cells retain a well-differ- 15. Garcia, J. R., A. Krause, S. Schulz, F. J. Rodriguez-Jimenez, E. Kluver, entiated phenotype. Am. J. Physiol. 264:C1219. K. Adermann, U. Forssmann, A. Frimpong-Boateng, R. Bals, and 40. Yang, D., Q. Chen, D. M. Hoover, P. Staley, K. D. Tucker, J. Lubkowski, and W. G. Forssmann. 2001. Human ␤-defensin 4: a novel inducible peptide with a J. J. Oppenheim. 2003. Many chemokines including CCL20/MIP-3␣ display an- specific salt-sensitive spectrum of antimicrobial activity. FASEB J. 15:1819. timicrobial activity. J. Leukocyte Biol. 74:448. 16. Yamaguchi, Y., T. Nagase, R. Makita, S. Fukuhara, T. Tomita, T. Tominaga, 41. O’Neil, D. A., E. M. Porter, D. Elewaut, G. M. Anderson, L. Eckmann, T. Ganz, H. Kurihara, and Y. Ouchi. 2002. Identification of multiple novel epididymis- and M. F. Kagnoff. 1999. Expression and regulation of the human ␤-defensins ␤ specific -defensin isoforms in humans and mice. J. Immunol. 169:2516. hBD-1 and hBD-2 in intestinal epithelium. J. Immunol. 163:6718. 17. Singh, P. K., H. P. Jia, K. Wiles, J. Hesselberth, L. Liu, B. A. Conway, 42. Bals, R., X. Wang, R. L. Meegalla, S. Wattler, D. J. Weiner, M. C. Nehls, and E. P. Greenberg, E. V. Valore, M. J. Welsh, T. Ganz, et al. 1998. Production of ␤ ␤ J. M. Wilson. 1999. Mouse -defensin 3 is an inducible antimicrobial peptide -defensins by human airway epithelia. Proc. Natl. Acad. Sci. USA 95:14961. expressed in the epithelia of multiple organs. Infect. Immun. 67:3542. 18. Harder, J., U. Meyer-Hoffert, L. M. Teran, L. Schwichtenberg, J. Bartels, 43. Jia, H. P., S. A. Wowk, B. C. Schutte, S. K. Lee, A. Vivado, B. F. Tack, S. Maune, and J. M. Schroder. 2000. Mucoid Pseudomonas aeruginosa, TNF-␣, C. L. Bevins, and P. B. McCray, Jr. 2000. A novel murine ␤-defensin expressed and IL-1␤, but not IL-6, induce human ␤-defensin-2 in respiratory epithelia. in tongue, esophagus, and trachea. J. Biol. Chem. 275:33314. Am. J. Respir. Cell Mol. Biol. 22:714. 19. Liu, A. Y., D. Destoumieux, A. V. Wong, C. H. Park, E. V. Valore, L. Liu, and 44. Laan, M., Z. H. Cui, H. Hoshino, J. Lotvall, M. Sjostrand, D. C. Gruenert, T. Ganz. 2002. Human ␤-defensin-2 production in keratinocytes is regulated by B. E. Skoogh, and A. Linden. 1999. Neutrophil recruitment by human IL-17 via interleukin-1, bacteria, and the state of differentiation. J. Invest. Dermatol. C-X-C chemokine release in the airways. J. Immunol. 162:2347. 118:275. 45. Molet, S., Q. Hamid, F. Davoine, E. Nutku, R. Taha, N. Page, R. Olivenstein, 20. Liu, L., A. A. Roberts, and T. Ganz. 2003. By IL-1 signaling, monocyte-derived J. Elias, and J. Chakir. 2001. IL-17 is increased in asthmatic airways and induces Downloaded from cells dramatically enhance the epidermal antimicrobial response to lipopolysac- human bronchial fibroblasts to produce cytokines. J. Allergy Clin. Immunol. charide. J. Immunol. 170:575. 108:430. 21. Duits, L. A., P. H. Nibbering, E. van Strijen, J. B. Vos, S. P. Mannesse-Lazeroms, 46. Laan, M., L. Palmberg, K. Larsson, and A. Linden. 2002. Free, soluble interleu- M. A. van Sterkenburg, and P. S. Hiemstra. 2003. Rhinovirus increases human kin-17 protein during severe inflammation in human airways. Eur. Respir. J. ␤-defensin-2 and -3 mRNA expression in cultured bronchial epithelial cells. 19:534. FEMS Immunol. Med. Microbiol. 38:59. 47. Ye, P., P. B. Garvey, P. Zhang, S. Nelson, G. Bagby, W. R. Summer, 22. Uehara, N., A. Yagihashi, K. Kondoh, N. Tsuji, T. Fujita, H. Hamada, and P. Schwarzenberger, J. E. Shellito, and J. K. Kolls. 2001. Interleukin-17 and lung ␤ host defense against Klebsiella pneumoniae infection. Am. J. Respir. Cell Mol. N. Watanabe. 2003. Human -defensin-2 induction in Helicobacter pylori-in- http://www.jimmunol.org/ fected gastric mucosal tissues: antimicrobial effect of overexpression. J. Med. Biol. 25:335. Microbiol. 52:41. 48. Yang, D., A. Biragyn, L. W. Kwak, and J. J. Oppenheim. 2002. Mammalian 23. Krisanaprakornkit, S., J. R. Kimball, and B. A. Dale. 2002. Regulation of human defensins in immunity: more than just microbicidal. Trends Immunol. 23:291. ␤-defensin-2 in gingival epithelial cells: the involvement of mitogen-activated 49. Ye, P., F. H. Rodriguez, S. Kanaly, K. L. Stocking, J. Schurr, protein kinase pathways, but not the NF-␬B transcription factor family. J. Im- P. Schwarzenberger, P. Oliver, W. Huang, P. Zhang, J. Zhang, et al. 2001. Re- munol. 168:316. quirement of interleukin 17 receptor signaling for lung CXC chemokine and 24. Tsutsumi-Ishii, Y., and I. Nagaoka. 2003. Modulation of human ␤-defensin-2 granulocyte colony-stimulating factor expression, neutrophil recruitment, and transcription in pulmonary epithelial cells by lipopolysaccharide-stimulated host defense. J. Exp. Med. 194:519. mononuclear phagocytes via proinflammatory cytokine production. J. Immunol. 50. Hoshino, H., J. Lotvall, B. E. Skoogh, and A. Linden. 1999. Neutrophil recruit- 170:4226. ment by interleukin-17 into rat airways in vivo: role of tachykinins. Am. J. Respir. 25. Rouvier, E., M. F. Luciani, M. G. Mattei, F. Denizot, and P. Golstein. 1993. Crit. Care Med. 159:1423.

CTLA-8, cloned from an activated T cell, bearing AU-rich messenger RNA in- 51. Kawaguchi, M., F. Kokubu, H. Kuga, S. Matsukura, H. Hoshino, K. Ieki, T. Imai, by guest on September 25, 2021 stability sequences, and homologous to a herpesvirus Saimiri gene. J. Immunol. M. Adachi, and S. K. Huang. 2001. Modulation of bronchial epithelial cells by 150:5445. IL-17. J. Allergy Clin. Immunol. 108:804. 26. Yao, Z., S. L. Painter, W. C. Fanslow, D. Ulrich, B. M. Macduff, M. K. Spriggs, 52. Jones, C. E., and K. Chan. 2002. Interleukin-17 stimulates the expression of and R. J. Armitage. 1995. Human IL-17: a novel cytokine derived from T cells. interleukin-8, growth-related oncogene-␣, and granulocyte-colony-stimulating J. Immunol. 155:5483. factor by human airway epithelial cells. Am. J. Respir. Cell Mol. Biol. 26:748. 27. Yao, Z., W. C. Fanslow, M. F. Seldin, A. M. Rousseau, S. L. Painter, 53. Schutyser, E., S. Struyf, and J. Van Damme. 2003. The CC chemokine CCL20 M. R. Comeau, J. I. Cohen, and M. K. Spriggs. 1995. Herpesvirus Saimiri en- and its receptor CCR6. Cytokine Growth Factor Rev. 14:409. codes a new cytokine, IL-17, which binds to a novel cytokine receptor. Immunity 54. Moon, S. K., H. Y. Lee, J. D. Li, M. Nagura, S. H. Kang, Y. M. Chun, 3:811. F. H. Linthicum, T. Ganz, A. Andalibi, and D. J. Lim. 2002. Activation of a 28. Fossiez, F., O. Djossou, P. Chomarat, L. Flores-Romo, S. Ait-Yahia, C. Maat, Src-dependent Raf-MEK1/2-ERK signaling pathway is required for IL-1␣-in- J. J. Pin, P. Garrone, E. Garcia, S. Saeland, et al. 1996. T cell interleukin-17 duced up-regulation of ␤-defensin 2 in human middle ear epithelial cells. Bio- induces stromal cells to produce proinflammatory and hematopoietic cytokines. chim. Biophys. Acta 1590:41. J. Exp. Med. 183:2593. 55. McDermott, A. M., R. L. Redfern, B. Zhang, Y. Pei, L. Huang, and R. J. Proske. 29. Happel, K. I., M. Zheng, E. Young, L. J. Quinton, E. Lockhart, A. J. Ramsay, 2003. Defensin expression by the cornea: multiple signalling pathways mediate J. E. Shellito, J. R. Schurr, G. J. Bagby, S. Nelson, and J. K. Kolls. 2003. Cutting IL-1␤ stimulation of hBD-2 expression by human corneal epithelial cells. Invest. edge: roles of Toll-like receptor 4 and IL-23 in IL-17 expression in response to Ophthalmol. Visual Sci. 44:1859. Klebsiella pneumoniae infection. J. Immunol. 170:4432. 30. Miyamoto, M., O. Prause, M. Sjostrand, M. Laan, J. Lotvall, and A. Linden. 56. Subramaniam, S. V., R. S. Cooper, and S. E. Adunyah. 1999. Evidence for the 2003. Endogenous IL-17 as a mediator of neutrophil recruitment caused by en- involvement of JAK/STAT pathway in the signaling mechanism of interleukin- dotoxin exposure in mouse airways. J. Immunol. 170:4665. 17. Biochem. Biophys. Res. Commun. 262:14. 31. Ferretti, S., O. Bonneau, G. R. Dubois, C. E. Jones, and A. Trifilieff. 2003. IL-17, 57. Thompson, J. E., R. M. Cubbon, R. T. Cummings, L. S. Wicker, R. Frankshun, produced by lymphocytes and neutrophils, is necessary for lipopolysaccharide- B. R. Cunningham, P. M. Cameron, P. T. Meinke, N. Liverton, Y. Weng, and induced airway neutrophilia: IL-15 as a possible trigger. J. Immunol. 170:2106. J. A. DeMartino. 2002. Photochemical preparation of a pyridone containing tet- 32. Aggarwal, S., and A. L. Gurney. 2002. IL-17: prototype member of an emerging racycle: a Jak protein kinase inhibitor. Bioorg. Med. Chem. Lett. 12:1219. cytokine family. J. Leukocyte Biol. 71:1. 58. Shalom-Barak, T., J. Quach, and M. Lotz. 1998. Interleukin-17-induced gene 33. Moseley, T. A., D. R. Haudenschild, L. Rose, and A. H. Reddi. 2003. Interleu- expression in articular chondrocytes is associated with activation of mitogen- ␬ kin-17 family and IL-17 receptors. Cytokine Growth Factor Rev. 14:155. activated protein kinases and NF- B. J. Biol. Chem. 273:27467. 34. Kolls, J. K., S. T. Kanaly, and A. J. Ramsay. 2003. Interleukin-17: an emerging 59. Awane, M., P. G. Andres, D. J. Li, and H. C. Reinecker. 1999. NF-␬B-inducing role in lung inflammation. Am. J. Respir. Cell Mol. Biol. 28:9. kinase is a common mediator of IL-17-, TNF-␣-, and IL-1␤-induced chemokine 35. Jovanovic, D. V., J. A. Di Battista, J. Martel-Pelletier, F. C. Jolicoeur, Y. He, promoter activation in intestinal epithelial cells. J. Immunol. 162:5337. M. Zhang, F. Mineau, and J. P. Pelletier. 1998. IL-17 stimulates the production 60. Hata, K., A. Andoh, M. Shimada, S. Fujino, S. Bamba, Y. Araki, T. Okuno, and expression of proinflammatory cytokines, IL-␤ and TNF-␣, by human mac- Y. Fujiyama, and T. Bamba. 2002. IL-17 stimulates inflammatory responses via rophages. J. Immunol. 160:3513. NF-␬B and MAP kinase pathways in human colonic myofibroblasts. 36. Chen, Y., P. Thai, Y. H. Zhao, Y. S. Ho, M. M. DeSouza, and R. Wu. 2003. Am. J. Physiol. 282:G1035. Stimulation of airway mucin gene expression by interleukin (IL)-17 through IL-6 61. Yang, D., O. Chertov, S. N. Bykovskaia, Q. Chen, M. J. Buffo, J. Shogan, paracrine/autocrine loop. J. Biol. Chem. 278:17036. M. Anderson, J. M. Schroder, J. M. Wang, O. M. Howard, and J. J. Oppenheim. 37. Wu, R., W. R. Martin, C. B. Robinson, J. A. St. George, C. G. Plopper, 1999. ␤-Defensins: linking innate and adaptive immunity through dendritic and G. Kurland, J. A. Last, C. E. Cross, R. J. McDonald, and R. Boucher. 1990. T cell CCR6. Science 286:525.