And Cox1-Gene-Based Diversity of Moniezia Spp. and Avitellina Centripunctata in Ruminants from Al-Qadisiyah Province, Iraq © 2019 M

ПАРАЗИТОЛОГИЯ, 53, 1, 2019

УДК 576.895.121

18S RRNA GENE- AND COX1-GENE-BASED DIVERSITY OF MONIEZIA SPP. AND AVITELLINA CENTRIPUNCTATA IN RUMINANTS FROM AL-QADISIYAH PROVINCE, IRAQ © 2019 M. J. A. Alkaled, Yahia Ismail Khudair, M. A. A. Al-Fatlawi* College of Veterinary Medicine, University of Al-Qadisiyah, Al-Diwaniyah, Iraq *е-mail: [email protected]

Submitted 08.06.2018

The present 18S rRNA gene and Cox1 gene-based work was proposed and performed to detect and study the history of evolution of tapeworms that could be recognized through the use of molecular techniques. For this investigation, 14 tapeworms were recovered from 50 intestinal-based content samples of 50 animals (sheep, goat, cattle, and buff alo). The collected adult tapeworms were fi rst identifi ed morphologically showing 6 Moniezia expansa and 7 Moniezia benedeni. Then, DNA from 14 worms (9 for the 18S rRNA gene and 5 for the Cox1 gene) was employed for polymerase chain reaction (PCR) and partial gene sequencing techniques. The results of the PCR recorded amplifi cations of all the sequences used for both genes. The sequencing indicated, via the use of 18S rRNA gene, 5 Moniezia benedeni, 3 Moniezia expansa, and 1 Avitellina centripunctata. Moreover, it resulted, via the utilization of Cox1 gene, 3 Moniezia expansa and 2 Moniezia benedeni. The isolates stood in close matching with global isolates. The current results provide important criteria for the reliable use of the techniques utilized in this study.

Keywords: 18S rRNA, Avitellina, Cox1, Moniezia, PCR, sequencing.

DOI: 10.1134/S0031184719010034

ВЫЯВЛЕНИЕ РАЗНООБРАЗИЯ ЦЕСТОД MONIEZIA SPP. И AVITELLINA CENTRIPUNCTATA ИЗ ЖВАЧНЫХ ЖИВОТНЫХ В ПРОВИНЦИИ АЛЬ- КАДИСИЯ В ИРАКЕ С ИСПОЛЬЗОВАНИЕМ ГЕНОВ 18S РРНК И COX1

Поступила 08.06.2018 г.

Молекулярно-генетическое исследование по генам 18S рРНК A и Cox1 предпринято для ре- конструкции эволюции цестод жвачных животных. Исследовано 14 экз. цестод из кишечников

31 50 животных (овцы, козы, коровы, буйволы). Вначале половозрелые цестоды были идентифи- цированы морфологически: 6 экз. Moniezia expansa и 7 экз. Moniezia benedeni. Затем ДНК 14 червей (9 для анализа 18SрРНК и 5 для Cox1) были использованы для ПЦР и секвенирования участков генов. По результатам секвенирования участка гена 18S рРНК выявлены 5 экз. Moniezia benedeni, 3 экз. Moniezia expansa и 1 экз. Avitellina centripunctata. С помощью анализа гена Cox1 выявлены 3 экз. Moniezia expansa и 2 экз. Moniezia benedeni. Обнаружено близкое совпадение с последовательностями нуклеотидов генов в глобальном банке данных. Полученные результаты помогли установить критерии надежного использования молекулярных методик идентификации цестод. Ключевые слова: 18S rRNA, Avitellina, Cox1, Moniezia, ПЦР, секвенирование.

Moniezia spp are tapeworms that infest various ruminants such as sheep, goat, cattle, and buff alos. These worms induce some problems to the health of animals plus to industries leading to fi nancial losses via the increase cost provided for the treatment and veterinary services (Kouam et al., 2018). Two species are well-known for their infestation eff ectiveness on animal industries; Moniezia benedeni and Moniezia expansa. For the morphological recognition of these tapeworms, characteristics features are presented on them such as scolex, neck and strobila. The scolex and neck are measured to be small in sizes with noticed-long chain of strobili. These interesting worms belong to the family of Anoplocephalidae and the order of Cyclophyllidea. Extra diff erences of Moniezia genus that are characterized by the presence of clear anterior, posterior, mature, and gravid segments of these worms. Another characteristic feature is that each proglottid has repeated-sexual parts. Moniezia spp. needs mites as an intermediate host for the lifecycle to be completed via the presence of grass feeding by the aff ected animals (Denegri et al., 1998; Aboma et al., 2015; Ohtori et al., 2015). Avitellina centripunctata is cestode that infests sheep, goats, cattle, and wide range of ruminants (Yildiz, 2007). The strobili of these worms are characterized by the presence of thousands of wide-very short proglottids. The lifecycle needs certain species of arthropods, oribatid mites and barklice, to be completed (Woodland, 1935; Yildiz, 2007). The present 18S rRNA gene and Cox1 gene based work was proposed and performed to detect and study the history of evolution of tapeworms that could be recognized through the use of molecular techniques that rely on 18S rRNA and Cox1 genes. For this investigation, 14 tapeworms were recovered from 50 intestinal-based content samples of 50 animals (sheep, goat, cattle, and buff alo). PCR and Partial gene sequencing were employed for this present work to fulfi ll the goal of the study.

MATERIALS AND METHODS Sampling For this work, 50 intestinal-based content samples were collected from 50 animals (sheep, goat, cattle, and buff alo). The collection work continued from August, 2016 to January, 2017. The locations of sampling were from diff erent slaughter houses in Al-Qadisiyah province, Iraq. The tapeworms were placed separately in clean containers that contained PBS. At the Lab in the college of veterinary medicine, University of Al-Qadisiyah, adult worms were placed in containers that had 70 % ethanol and stored at –20°C until future work, starting with DNA extraction. Some of these tapeworms were subjected to morphological-based identifi cation.

32 DNA extraction A piece of the worm, 200mg, was ﬁ rst rinsed thoroughly with water to get rid of ethanol. KAPA Express Extract Kit (Cape Town, South Africa) or (Roche, Mannheim, Germany) was used to fulﬁ ll the extraction process relying on the protocol provided by the manufacturer. A NanoDrop was utilized to measure the resulted DNA for quality and quantity.

PCR and sequencing techniques The technique followed the use of specifi c primers that were designed using PrimerQuest Tool (Integrated DNA Technologies, Inc., Belgium) and NCBI-based websites. The primers of the 18S rRNA gene were F: ACGGTGAAACCGCGAATGG and R: GACATGACATGCAGTAGCAGTG that amplify a specifi c region in this gene at 841 bp. Moreover for the Cox1 gene, the primers were F: TGTTGAGTATGTGGTTTGGTGC and R: AACTACCCACCATACCACAGGATC that amplify a region at 684 bp. DNA from 14 worms (9 for the 18S rRNA gene and 5 for the Cox1 gene) was employed for the PCR. The kit that was used for the preparation of the mastermix was ordered from (Bionear, Korea). The instructions of the kit were followed for this purpose. Regarding the conditions of the thermocycler used were 95°C for 5 min as for the primary denaturation, 35 cycles of (main denaturation at 94°C for 1 min, for the 18S rRNA and Cox1 55°C and 53°C respectively for the annealing, for the 18S rRNA and Cox1 55°C for 1 min and 72°C for 2.5 min respectively), and 72°C for 5 min regarding the fi nishing extension. the PCR products in the 1.25 % agarose gels were electrophoresed and visualized via the use of ethidium-bromide-based illumination screened by a UV imager. All PCR products were sent out for partial-gene sequencing using Sanger sequencing method (Macrohen Company, Korea). The phylogenetic tree was built up using maximum likelihood via the use of MEGA 7.0 (Saitou, Nei, 1987; Tamura et al., 2013).

RESULTS According to the morphological characters, worms belonging to the genus Moniezia were recognized. The generic characters were as follows: genital pore, clear cirrus sac, vitelline gland, recognizable testes, and inter-proglottid-based glands. For the species identifi cation, adult worm and egg features were used to separate between M. expansa and M. benedeni that were recovered in this study showing 6 Moniezia expansa and 7 Moniezia benedeni (fi gs. 1, 2).The results of the PCR recorded amplifi cations of all the sequences used for both genes (fi gs. 3, 4). The sequencing indicated, via the use of 18S rRNA gene, 5 Moniezia benedeni, 3 Moniezia expansa, and 1 Avitellina centripunctata. Moreover, it resulted, via the utilization of Cox1 gene, 3 Moniezia expansa and 2 Moniezia benedeni. The current isolates, MH173843.1, MH173844.1, MH173845.1, MH173846.1, MH173847.1, MH173848.1, MH201211.1, MH201212.1 MH201213.1, and MH201214.1 stood in close matching with global isolates (fi gs. 5, 6). Tables 1 and 2 provide statistics about the isolates regarding their sampled animals.

DISCUSSION Moniezia spp. are tapeworms that infest various ruminants such as sheep, goat, cattle, and buﬀ alos. These worms induce some problems to the health of animals plus to industries leading to ﬁ nancial losses via the increase costs provided for the treatment and veterinary services (Diop et al., 2015a; Kouam et al., 2018). Two species are well-known

33 Fig. 1. A. Moniezia expansa. IPG = inter-proglottidal glands, T = Testes, Vit = Vittline gland, CS = Cirrus sac, GP = Genital pore, OV = Ovary. (X10) (We can see the IPG because they reach to the margin of segments. B. Moniezia expansa egg (Quadral form). (X10).

Table 1. Shows statistics about the isolates regarding their sampled animals via the use of 18S rRNA gene Animal ID Cestode species Cattle DIQ2 M. benedeni Cattle DIQ3 M. benedeni Cattle DIQ4 M. benedeni Sheep DIQ5 M. benedeni Sheep DIQ9 Avitellina centripunctata Buﬀ alo DIQ6 M. benedeni Buﬀ alo DIQ10 M. expansa Goat DIQ11 M. expansa Goat DIQ12 M. benedeni

34 Fig. 2. A. Moniezia benedeni, T = Testes, Vit = Vittline gland, CS = Cirrus sac, GP = Genital pore, OV = Ovary. (X10) (The inter-proglottidal glands do not reach to the margin of segments). B. Moniezia benedeni egg (Triangle). (X40). for their infestation eff ectiveness on animal industries. The present study was successful in determining the presence of Moniezia spp. via the morphological identifi cation. This step is important in the diagnosis any parasites especially tapeworms that have their external characteristic features. The use of the PCR technique confi rm that worms are identical to the genus Moniezia, thus confi rming the previous studies (Mehlhorn, 2016). These results agree with (Nguyen et al., 2012) who detected tapeworms via the use of a PCR method. The 18S rRNA gene sequencing analysis revealed 5 Moniezia benedeni, 3 Moniezia expansa, and 1 Avitellina centripunctata. This technique is proved to be reliable in identifying these tapeworms, and it is useful in detecting more species than that in the other method, that

Table 2. Shows statistics about the isolates regarding their sampled animals via the use of Cox1 gene Animal ID Cestode species Cattle DIQ14 M. benedeni Cattle DIQ15 M. benedeni Sheep DIQ13 M. expansa Sheep DIQ12 M. expansa Buﬀ alo DIQ11 M. expansa

35 Fig. 3. Image of the PCR products via gel-based electrophoresis of the 18S rRNA gene. Positive lanes are 1–8. Ladder is M lane.

Fig. 4. Image of the PCR products via gel-based electrophoresis of the Cox1 gene. Positive lanes are 1, 3, 4, and 5. Ladder is M lane.

36 Fig. 5. Phylogenetic tree based on the 18S rRNA gene partial sequencing. utilized Cox1 as a target gene. However, it was consistent, via the utilization of Cox1 gene, in detecting 3 Moniezia expansa and 2 Moniezia benedeni. The current isolates were placed in close matching with global isolates on the phylogenetic tree. However, our isolates have distinct mutations that may occur in the past and let them to branch out from the global isolates (Yan et al., 2013; Ohtori et al., 2015). The results of the phylogenetic tree may indicate that these isolates of the sampled animals were from diﬀ erent ancestors (Diop et al., 2015b; Ohtori et al., 2015; Guo, 2016). In a recent published work by (Haukisalmi et al., 2018), 6 Moniezia species were identiﬁ ed in 2 clades. Although their results showed M. expansa and M. benedeni in Clade1 of their phylogenetic tree, some of the 6 species were

37 Fig. 6. Phylogenetic tree based on the Cox1 gene partial sequencing. organized in the Clade2. Our results agree to some extent with this work especially when look at our tree that placed these both species in diff erent clades. These variations could have been initiated because the geographical diff erences between Iraq and Finland and Alaska. In Iraq, the disease control systems may not be as good as the ones in those places, and this may introduce certain impacts on generating modifi cations in the nucleotide sequences leading to the appearance of new strains. The current results provide important criteria for the reliable use of the techniques utilized in this study.

REFERENCES

Aboma R., Nesibu A., Birhanu H., Yisehak T., Teshale S. 2015. Internal and external parasites of camels (Camelus dromedarius) slaughtered at Addis Ababa Abattoir, Ethiopia. Journal of Veterinary Medicine and Animal Health 7 (2): 57–63. Denegri G., Bernadina W., Perez-Serrano J., Rodriguez-Caabeiro F. 1998. Anoplocephalid cestodes of veterinary and medical signiﬁ cance: a review. Folia Parasitologica (Praha) 45 (1): 1–8. Diop G., Yanagida T., Hailemariam Z., et al. 2015a. Genetic characterization of Moniezia species in Senegal and Ethiopia. Parasitology International 64 (5): 256-260. Diop G., Yanagida T., Hailemariam Z., et al. 2015b. Genetic characterization of Moniezia species in Senegal and Ethiopia. Parasitology International 64 (5): 256–260. Guo A. 2016. Moniezia benedeni and Moniezia expansa are distinct cestode species based on complete mitochondrial genomes. Acta Tropica 166: 287–292. Haukisalmi V. et al. 2018. Molecular taxonomy and subgeneric classiﬁ cation of tapeworms of the genus Moniezia Blanchard, 1891 (Cestoda, Anoplocephalidae) in northern cervids (Alces and Rangifer). Parasitology International 67 (2): 218–224.

38 Kouam M.K., Meningue R., Fon D.E. 2018. Parasitic causes of organ condemnation in cattle slaughtered in Fako abattoirs, South-West region of Cameroon, and estimate of fi nancial losses. Journal of Helminthology 2018: 1–5. Mehlhorn H. (Ed.) 2016. Encyclopedia of Parasitology. 4th edition. Springer, 3096 pp. Nguyen T.D., Le Q.D., Huynh V.V., Nguyen S.T., Nguyen T.V., Vu-Khac H. 2012. The development of PCR methodology for the identifi cation of species of the tapeworm Moniezia from cattle, goats and sheep in central Vietnam. Journal of Helminthology 86 (04): 426–429. Ohtori M., Aoki M., Itagaki T. 2015. Sequence diff erences in the internal transcribed spacer 1 and 5.8S ribosomal RNA among three Moniezia species isolated from ruminants in Japan. Journal of Veterinary Medical Science 77 (1): 105–107. Saitou N., Nei M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4 (4): 406–425. Tamura K., Stecher G., Peterson D., Filipski A., Kumar S. 2013. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution 30 (12): 2725–2729. Woodland W.N.F. 1935. A New Species of Avitellinine Tapeworm, Avitellina Sandgroundi , from Hippotragus Equinus. Annals of Tropical Medicine and Parasitology 29 (2): 185–189. Yan H., Bo X., Liu Y., et al. 2013. Diff erential diagnosis of Moniezia benedeni and M. expansa (Anoplocephalidae) by PCR using markers in small ribosomal DNA (18S rDNA). Acta Veterinaria Hungarica 61 (4): 463–472. Yildiz K. 2007. The scanning electron microscopic examination of Avitellina centripunctata and Thysaniezia ovilla. Turkiye parazitolojii Derg 31 (4): 292–295.