Resilient Properties of Olfactory Ensheathing Cells After Neuronal Injury

RESILIENT PROPERTIES OF OLFACTORY ENSHEATHING CELLS AFTER NEURONAL INJURY

by Tanu Sharma

A dissertation submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy

Baltimore, Maryland

October, 2016

Abstract The adult mammalian peripheral olfactory system has the remarkable ability to completely regenerate itself after an injury. This property is in part due to the presence of olfactory ensheathing cells (OEC), which provide a growth-permissive environment for the regeneration of olfactory sensory neurons (OSN). OECs ensheath the OSN axons as they project from the nasal cavity to the olfactory bulb. The goal of this thesis was to examine

OEC biology during the OSN regeneration process. Since OECs are closely associated with

OSN axons, we hypothesized that OSN loss induces critical changes in OECs that promote

OSN regeneration. Therefore, we examined cellular and molecular changes in adult OECs after injury-induced OSN loss and during subsequent regeneration. We analyzed morphology of sparsely-labeled OECs using PLP1-CreER/mTmG mouse line, and observed that OEC morphology does not significantly change after OSN loss. Our EdU- labeling experiment showed that OECs rarely proliferate following OSN injury. To examine molecular changes, we performed RNAseq on OECs that were FACS-sorted directly from the olfactory mucosa of PLP1-eGFP reporter mice at various timepoints after OSN injury.

OEC transcriptome analysis showed that overall only a few genes were differentially expressed in OECs after OSN loss. Our results indicate that OECs remain largely unaffected by the loss and regeneration of OSN. We studied the OEC biology further by driving the expression of DTA176, an attenuated form of diphtheria toxin chain A, using the PLP1-

CreER transgene to ablate a portion of the OEC population and assess the overall changes in the mucosa and OSN transcriptome. Analysis of OSN transcriptome after OEC ablation showed differential expression of a very few genes in OSNs. OEC ablation also lead to proliferation of the remaining OECs, which is in contrast to the lack of OEC proliferation observed after OSN loss. This data suggests that OECs are capable of re-entering the cell

ii cycle to perhaps replenish the OEC population and to maintain a permissive environment for OSN growth. We conclude that the role of OECs in adult mice is to maintain an overall steady environment for continuous regeneration of OSN.

Thesis Advisor: Randall R. Reed, Ph.D.

Thesis Reader: Seth Blackshaw, Ph.D.

iii

Acknowledgment First and foremost, I would like to express my sincerest gratitude to my advisor,

Randy Reed, for giving me the opportunity to pursue my thesis in his lab. I am grateful for the support he has given me over the years and for believing in me. Randy has provided an intellectually stimulating environment that also gave me the freedom to make mistakes so that I could learn from them. The lessons and skills that I have learned under his guidance were the most invaluable part of this experience, which I will treasure for life. He is the best mentor a student could ask for.

Besides my advisor, I would like to thank my wonderful and knowledgeable thesis committee members: Angelika Doetzlhofer, Ahmet Hoke, Seth Blackshaw, and King Wai

Yau. I would like to thank them all for their continued support, helpful insights into my data, and valuable suggestions about my project. Their guidance, kindness, and time were an integral part of the completion of my thesis and for that I am truly grateful.

I would like to thank my lab members Heather, our talented lab technician for helping me with anything and everything I needed in lab, and Renee, our recently retired administrative assistant for always bringing much-appreciated positive energy to lab. I would also like to thank past Reed lab members for helpful discussions and fun happy hours –

Mike, Adrian, Jon, Yang, and especially Abby for immediately making me feel welcome when I first joined the lab as a rotation student. I am also thankful for the members of the

Doetzlhofer and Potter labs for being our wonderful Center for Sensory Biology neighbors

– help was always around the corner at any given time of the day. Special thanks to Marquis

Walker for being a mentor during my undergrad years and continuing to be a support during my graduate school years.

My thesis work would not have been complete without the help of Ada Tam at the

Flow Cytometry core, who helped me during the challenging part of sorting OECs. In addition, many thanks to the Deep Sequencing and Microarray core facility for generating

RNAseq data, and Dr. Sarah Wheelan and her team for analyzing my RNAseq data.

Finally, I am extremely grateful to be surrounded by such amazing friends and family, who have provided me with endless love and support and without whom grad school would have been more of a challenge. I am very lucky to have the support of Allison Suarez who has gone above and beyond the call of duty for me on numerous occasions, and is always willing to discuss my data with me to make sense of it all. I am thankful for my grandparents

– Nirmal and Dev Raj Bajaj – who have been my biggest cheerleaders. I would like to thank my sister Reema for providing me with words of encouragement, helping me stay humble and grounded, and always looking out for me. A big thank you to my mother, Rajni, without whom this would not have been possible. She has been the constant source of unconditional love and encouragement for me, which made going through grad school significantly easier.

Additionally, I am thankful for her for planting the “Science Bug” in me at a young age, and for being my role model. Lastly, I want to thank my past and present (fur)babies – Lara the

Black Lab and Dexter the Ginger Cat – for instantly cheering me up after a long day in lab.

Table of Contents

Title Page……………………….………………………………………………………..…...i Abstract……………………………………………………………………………………..ii Acknowledgement…………………………………………………….………………………iv Table of Contents…………………………………………………………………………….vi List of Tables………………………………………………………………………...……..viii List of Figures……………………………………………………………………...………...ix Abbreviations…………………………………………………………………...………….....x

Chapter 1: General Introduction……...………………………………………………….1 Background and Motivation………………………………………..………………2 Properties of Olfactory Ensheathing Cells……………………………………..…...4 Comparison of OECs to Schwann Cells and Astrocytes………………………...….4 Molecular responses of glial cells after injury…………………...……………..……5 OE Lesioning Paradigms...…………………………………………………...…….7 Approach…………………………………………………………….…...……..…8 References………………………………………………………………………...12

Chapter 2: Properties of Olfactory Ensheathing Cells after Neuronal Injury…...…...16 Introduction…………………………..…………...……….………..…………….17 Materials and Methods...………….……………………………………………….20 Results…………………………………………………….………..…….……….27 Discussion…………………………………………………..….……....………….38 References………………………………………….………..……………………80

Chapter 3: Effects of Olfactory Ensheathing Cell loss on Olfactory Mucosa……..…86 Introduction……………………………………….……………………..….…….87 Materials and Methods...……………………………………………..……………89 Results……………………………………………………………..…..………….93 Discussion……………………………………………………...... ……………….98 References…………………………………………………...………………..….117

Overall Summary and Conclusions…………………………………...………………119

Appendices………………………………………...……………………………..…….124

Appendix A: Technique: Fluorescence activated cell sorting of OECs from whole olfactory mucosa of adult mice……………………………………..……………125 Appendix B: Technique: Clearing Olfactory Mucosa using SeeDB and Imaging Individual OECs…….……………………………………………………..…….128 Figure A………..…………………………………………………………...……131 Figure B..…………………………………………………………………...……132

Curriculum Vitae……………………………………………………………………….133

vii

List of Tables CHAPTER 2 Table 2.1. A summary of number of biological replicates, mice used, eGFP (+) OECs collected, and RNAseq reads per timepoint……………….………………………………47

Table 2.2. List of RT-PCR primers used in this study……………………………...……..48

Table 2.3. Number of genes expressed in OEC after each timepoint post-MeBr lesion…..49

Table 2.4. List of candidate OEC-specific markers……………………………………….50

Table 2.5. Number of differentially-expressed genes in OECs post-MeBr lesion fulfilling various parameters ………………………...………………………………...……………51

CHAPTER 3 Table 3.1. List of enriched Biological Process (BP) Gene Ontology terms in OSNs after OEC ablation (all terms with p-value equal or greater than 0.05 shown)……………..…...102 Table 3.2. List of all enriched Molecular Functions (MF) Gene Ontology terms in OSNs after OEC ablation………………………………………………………………………104 Table 3.3. List of all enriched Cellular Components (CC) Gene Ontology terms in OSNs after OEC ablation………………………………………………………………………104

viii

List of Figures CHAPTER 1 Figure 1.1. Anatomy of the olfactory mucosa…………………………………………….10 CHAPTER 2 Figure 2.1. PLP1-eGFP transgenic mouse can be used as a tool to study OEC………...…52 Figure 2.2. PLP1/DM20 protein expression at various ages……………………………...54 Figure 2.3. PLP1/DM20 protein is detected in OB, but not OM, in adult mice………….56 Figure 2.4. Proliferation in OM after MeBr lesion. ………………………….…………...58 Figure 2.5. OM tissue clearing using SeeDB………………………….…………………..60 Figure 2.6. Sparse labeling of OECs in OM……………………….…….………………..62 Figure 2.7. Morphology of individual OECs and their morphometrics…………………...64 Figure 2.8. Isolation of OECs from PLP1-eGFP adult mice……………………………..66 Figure 2.9. PLP1 transcript expression in OECs. ………………………………………..68 Figure 2.10. Differentially expressed genes in OECs after MeBr lesion. …………………70 Figure 2.11. RT-PCR analysis of expression of select upregulated genes in FACS-sorted OEC at various timepoints after MeBr lesion. ………………..………...………………....72 Figure 2.12. Ngfr transcript upregulation in OECs after MeBr lesion…...... ….…...... 74 Figure 2.13. Validation of Ngfr gene upregulation in OECs after MeBr lesion………...….76 Figure 2.14. NGFR protein expression in OECs after MeBr lesion………………………78 CHAPTER 3 Figure 3.1. OEC ablation in the LP and the OB seven days after tamoxifen administration …………………………………………………………………………………………..105 Figure 3.2. OEC ablation in the LP and the OB five days after tamoxifen administration………………………………….……………………………..……….…107 Figure 3.3. RT-PCR analysis of key OSN and OEC marker expression in whole mucosa after OEC ablation. …………………………………………………………...…………109 Figure 3.4. OEC proliferation after OEC ablation. ……………………………………..111 Figure 3.5. OSN isolation after OEC ablation. …………………………………………113 Figure 3.6. List of all of the DE genes in OSNs after OEC ablation. ………………...…115

Abbreviations

CNS Central Nervous System DPL Days post lesion GBC Globose basal cells GCL Glomerular Cell Layer HBC Horizontal basal cells IP Intraperitoneal LP Lamina propria MeBr Methyl bromide mG Membrane-tagged EGFP mT Membrane-tagged tdTomato NGFR Nerve Growth Factor Receptor Nrg1 Neuregulin 1 OB Olfactory bulb OE Olfactory epithelium OEC Olfactory ensheathing cells OM Olfactory mucosa OMP Olfactory marker protein ONL Olfactory Nerve Layer OR Olfactory receptor OSN Olfactory sensory neurons PFA Paraformaldehyde PLP1 Proteolipid protein 1 PNS Peripheral Nervous System TPM Transcript per million

CHAPTER 1

GENERAL INTRODUCTION

Olfactory ensheathing cells (OECs) are specialized glial cells found exclusively in the olfactory system. A unique property of the peripheral olfactory system is its remarkable ability to continually regenerate itself. Due to this property, the peripheral olfactory system makes for an excellent model system to study not only neurogenesis, but also neuron-glia interaction. In this study, we focused on the interaction between the olfactory sensory neurons (OSN) and OECs. Overall, our goal was to further our understanding of OECs and their role in the context of OSN regeneration.

Background and Motivation

OSNs are bipolar cells whose cell bodies reside in the OE (Figure 1.1). The receptive ends of OSNs in the nasal cavity are directly exposed to the external environment, making them the only type of neurons directly in contact with the outside world, and therefore, also making them vulnerable to chemical insults and injury. The axons of OSNs exit the epithelium, cross the basal lamina and aggregate into bundles. The axon bundles then traverse through the cribriform plate and reach the central nervous system, where they defasiculate and make synapses with the second order neurons in the olfactory bulb (OB) structure of the brain. Due to the direct exposure to the external environment, the OE has evolved a mechanism to replenish OSNs. The basal layer of the OE contains multipotent stem cells that proliferate and differentiate into OSNs (Mackay-Sim and Kittel, 1991,

Caggiano et al., 1994, Iwai et al., 2008). Experimentally-induced injury that produces extensive damage to the OE in mice leads to robust proliferation of the basal cells, resulting in the initial reconstitution of the OE within a few days after the injury and is largely complete by 2-3 weeks. The OSNs have the remarkable ability not only for replacement, but also to extend their axons through the cribriform plate and establish new functional synapses

2 in the brain. As the axons traverse from the nasal cavity to the brain, specialized OECs are closely associates with them throughout their entire journey.

First described in the late 1800s by Golgi and Blanes, OECs are the only type of glial cells found in the peripheral olfactory system (Golgi, 1875, Blanes, 1898). The axons of

OSNs are very small caliber and unmyelinated. OECs ensheath the OSN axon bundles as they project from OE in the nasal cavity to the OB in the brain. Therefore, the presence of

OECs in the peripheral nervous system and the central nervous system makes them unique among glial cell types. In addition, the presence of OEC in the olfactory system, where continual, successful regeneration of neurons occur, indicates that OECs play an important role in this process.

The regeneration of OSNs has been the focus of many studies; however, the response of OECs to neuronal loss and regeneration in vivo has been largely unexplored. This is surprising given that OECs are closely associated with axonal processes of sensory neurons.

We initiated this study by hypothesizing that because OECs are physically associated with the OSN axons, the loss of OSNs would lead to alterations in molecular and cellular properties of OECs that are critical for successful re-growth and maintenance of the OSNs.

Therefore, the goal of this project was to observe molecular and cellular changes that take place in OECs in response to OSN loss and regeneration. While several studies have used cultured OEC as a substrate for axonal growth, an important aspect of our study is that we studied OECs in their natural environment.

OECs are known to support regeneration of OSN axons and provide a permissive environment for neuronal regrowth (Ramon-Cueto and Avila, 1998). Due to these properties,

OECs have become an attractive therapeutic agent for neuronal injuries, and therefore, have been the focus of many transplantation studies (Roet and Verhaagen, 2014). The conclusion

3 of many studies has been that OECs promote axonal regeneration and functional recovery.

The goal of study was not to develop a better transplantation method for OECs; rather it was to understand the biology of OECs that might inform other scientists and assist in generating a superior transplantation paradigm for treating neuronal injuries, such as spinal cord injury, stroke, and Parkinson’s disease.

Properties of Olfactory Ensheathing Cells

OECs can be characterized based on their morphology, developmental origin, and molecular and cellular properties. Moreover, OECs can also be characterized based on their similarities to Schwann cells and astrocytes, glial cells of the peripheral nervous system and the central nervous system, respectively. Morphologically, OEC have been observed to be heterogeneous in vitro. Studies have variously described OECs as having a) bipolar body b) flat body, c) multipolar body with long processes (Pixley, 1992, van den Pol and Santarelli,

2003, Vincent et al., 2003, Huang et al., 2008) and that the in vitro morphology of OECs can be manipulated based on the growth conditions (van den Pol and Santarelli, 2003, Huang et al., 2011). In vivo, the extensive processes of OECs ensheath the fascicles along the entire length. Developmentally, OECs are derived from the neural crest cells (Barraud et al., 2010); hence, OECs share a common developmental origin as the Schwann cells of the peripheral nervous system. OECs also express growth-promoting proteins – such as L1 and NCAM

(cell adhesion molecules), nerve growth factor (NGF), platelet-derived growth factor

(PDGF), and neuropeptide Y – that provide a permissive environment for the growth of

OSNs (Ramon-Cueto and Avila, 1998).

Comparison of OECs to Schwann cell and Astrocytes

OECs are unique in that they share properties with Schwann cells and astrocytes. OECs and Schwann cells secrete similar axon growth-promoting molecules, and are marked by

4 p75NGFR and S100β expression. Like astrocytes, OECs express glial fibrillary acidic protein

(GFAP), have Nestin/Rat-401 immunoreactivity, and form the glia limitans (Ramon-Cueto and Avila, 1998). In terms of the in vitro morphology, OECs can have a bipolar morphology similar to Schwann cells, and a flat morphology like astrocytes (Pixley, 1992).

Although OECs possess properties of CNS and PNS glial cells, there are a few properties that distinguish the overall OEC population from other types of glia. For instance, in vitro when Schwann cells and astrocytes are co-cultured, they occupy separate domains and do not mingle. In contrast, OECs isolated from the olfactory bulbs are able to freely mingle with both Schwann cells and astrocytes in culture (Lakatos et al., 2000). This data, along with other studies suggest that OECs are able to cross the PNS-CNS border. It is this property of OECs that makes them an attractive therapeutic tool for repairing CNS injury i.e. spinal cord injury.

Molecular responses of glial cells after injury

The mammalian CNS is comprised of distinct glial cell types including astrocytes, microglia, oligodendrocytes, and NG2+ oligodendrocyte progenitors. Each of these glial cells respond to lesions/damage in ways that are injury-type dependent. For instance, astrocytes proliferate in response to invasive brain injury and transiently express markers of radial glial cells (Nestin and BLBP) indicating that these astrocytes assume stem-cell like properties; while ischemic injury leads to astrocyte-derived cells that adopt a neuronal fate

(Peron and Berninger, 2015). The radial glial cell population plays an important role in early brain development and in the adult as they initially give rise to CNS glial cells and, in the cerebral cortex, neurons. NG2+ oligodendrocytes have the capacity to migrate towards the site of injury, proliferate and renew the oligodendrocyte population (Burda and Sofroniew,

2014).

In the murine gut, the adult glial cells in the enteric nervous system (ENS) are similar to OECs in that they are derived from the neural crest cells, and express S100β, GFAP, and

Sox10 (a neural crest cell marker) (Jessen and Mirsky, 1980, Ferri et al., 1982, Hoff et al.,

2008, Laranjeira and Pachnis, 2009). In response to chemically-induced enteric ganglia injury,

ENS glia are capable of regenerating enteric neurons (Laranjeira et al., 2011). Similarly,

Muller glial cells in the retina demonstrate a neurogenic potential in response to retinal injury

(Hamon et al., 2016). Although these studies show glial-derived neurogenesis, further examination is required to strengthen the evidence for it.

Compared to other glial cells, the response of Schwann cells in PNS after neuronal injury is relatively well understood. Schwann cells, derived from neural crest like OECs, play an important role in peripheral nerve regeneration after an injury, such as a nerve crush or a transection. In response to nerve injury, Schwann cells dedifferentiate, demyelinate, and assume a proliferative state. The Raf/ERK pathway plays an important role in activating the repair response of Schwann cells after nerve injury, which includes dedifferentiation and proliferation. Additionally, c-jun – a transcription factor – also plays an important role in the repair response, and is upregulated in Schwann cells distal to the nerve injury (Shy et al.,

1996). Upregulation of c-jun in Schwann cells leads to upregulation of cell surface proteins and neurotrophic factors. These neurotrophic factors include NGFR, GDNF, artemin and

BDNF, and N-cadherin (Jessen et al., 2015). Neuregulin1/ErbB2 pathway also plays a role in nerve repair in adult mice (Lee et al., 2014).

The response of OEC after loss of olfactory sensory neurons due to injury is not well studied. In neonatal mice (Postnatal day 4), OECs in the peripheral olfactory system (i.e. olfactory mucosa) proliferate following bulbectomy, a surgical procedure that induces OSN degeneration in the OE (Chehrehasa et al., 2012). These OECs from the nasal cavity then

6 migrate through the cribriform plate into the bulbar cavity to form the plexus. On the other hand, in adult mice (1 month old), the peripheral olfactory system OECs do not proliferate or migrate following zinc sulfate irrigation method of ablating OE (Williams et al., 2004).

Zinc sulfate irrigation kills OSNs, sustentacular cells, and many of the basal cells in the OE.

Overall, the response of adult OECs to OSN injury is not very well studied, especially on the molecular and cellular level. This thesis will elucidate OM-OECs response to OSN injury in adult mice.

OE Lesioning Paradigms

Two common methods of ablating OSNs in the OE are bulbectomy and chemical- induced injury. Bulbectomy – surgical removal of the olfactory bulb(s) – induces degeneration of the ipsilateral OSNs in the nasal cavity. The OBs provide trophic support to the OSNs; therefore, when the axons are severed from the OB following bulbectomy, OSNs undergo rapid apoptosis (Costanzo, 1984, Schwob et al., 1992, Holcomb et al., 1995). In response, basal cells proliferate to repopulate the OE. Lack of target tissue and formation of scar tissue following bulbectomy, leaves OSNs in a continuous atrophied state (Costanzo,

1984, Schwob et al., 1992). An advantage of this method is that it effectively and selectively ablates the neurons in the OE. A disadvantage of bulbectomy is that removal of the OB abolishes guidance cues and a target for regenerating OSN in the OE.

Another method to ablate OE is by chemical exposure. The most important advantage of chemical-induced ablation of OE is that the OSNs can regenerate and coalesce at their target glomeruli in the OB. Zinc sulfate irrigation, methimazole (intraperitoneal (IP) injection), and methyl bromide gas (MeBr) inhalation are a few ways of chemically ablating

OE. While not shown directly, it is proposed that MeBr reacts with cytochrome P450 in the sustentacular cells in the OE, resulting in generation of free radicals. These free radicals

7 result in the death of essentially all the cells in the OE. The concentration of MeBr that is used in our laboratory leaves some basal cells intact, which subsequently repopulate the OE.

Methimazole, on the other hand, is administered systemically. Originally developed as a drug to treat hyperthyroidism, methimazole can be used to ablate OE in mice and rats. Flavin- containing monooxygenase in the OE oxidizes methimazole, subsequently creating olfactotoxic intermediates (Kedderis and Rickert, 1985). Zinc sulfate is irrigated in the nasal cavity, and ablates the OE by inducing general necrosis of the tissue (Cancalon, 1982).

Although the mechanism of action employed by these various olfactotoxic compounds may vary, the overall lesion produced by these compounds is similar in terms of loss of various cell types in the OE, and the subsequent regeneration of the OE.

MeBr gas treatment is preferable over methimazole or zinc sulfate because the flow of the gas is computer-controlled, which results in reduction in human error during treatment.

Methimazole, administered systemically via an IP injection, produces similar results to MeBr gas, however, the damage to the OE is more severe, and therefore, OE regeneration time course is relatively longer and IP injections introduce mouse-to-mouse variability. Zinc sulfate-induced OE ablation tends to be highly variable due to the length of the irrigation i.e. length of the contact between zinc sulfate and the olfactory tissue. On the other hand, a batch of multiple mice can be exposed to MeBr at the same time, resulting in reduced treatment variability. For these reasons, MeBr is preferred over methimazole and zinc sulfate.

Approach

In the first part of the thesis, I explored the biology of OECs and the molecular and cellular changes that take place in them upon neuronal injury and subsequent neuronal regeneration in adult mice. The objective was to study adult OECs in their natural environment; therefore, experiments were designed to study OEC in situ, taking advantages

8 of the modern tools and reagents available to us. We performed next generation sequencing on OEC sorted directly from the tissue, and subsequently, analyzed the molecular profile of

OEC in unlesioned and MeBr-lesioned animals. We studied the cellular and morphological changes in OECs post MeBr-induced injury by combining a tissue clearing technique with confocal microscopy to image individual OECs. This technique allowed us to analyze morphological changes in OEC without the use of electron microscopy. Complementary to the first, in the second part of the thesis we explored the molecular changes that take place in OSN after OEC ablation. We took advantage of the Cre-lox system to conditionally drive the expression of an attenuated version of diphtheria toxin to ablate OECs in the lamina propria (LP-OECs). This is the first experiment to ablate OEC in the OM and explore its consequences on the olfactory mucosa. Lastly, we isolated the OSNs post-OEC ablation via

FACS, and performed RNAseq to analyze their molecular profile.

Figure 1.1. Anatomy of the olfactory mucosa. Cross section of the olfactory mucosa

(OM) shows two layers separated by the basal lamina (dashed line): Olfactory epithelium

(OE) and lamina propria (LP). The OE is a pseudostratified epithelium that faces the nasal cavity and contains many cell types, including the cell bodies of mature olfactory sensory neurons (OSNs)(shown). OSNs are bipolar neurons whose receptive end is exposed to the external environment (nasal cavity), while the axons project to the OB where they make synapse with the second order neurons. The OSN fascicles are ensheathed by olfactory ensheathing cells (OECs) in the LP, which is located between the OE and the cartilage.

OECs are identified through S100β immunoreactivity (red channel). f = OSN fascicle. Scale bar = 20 µm.

Nasal Cavity

OSN Olfactory Epithelium (OE)

Lamina Propria Olfactory (LP) Mucosa (OM)

To Olfactory Bulb (OB) f anti-S100β } Cartilage

11 REFERENCES

Barraud P, Seferiadis AA, Tyson LD, Zwart MF, Szabo-Rogers HL, Ruhrberg C, Liu KJ,

Baker CV (2010) Neural crest origin of olfactory ensheathing glia. Proc Natl Acad

Sci U S A 107:21040-21045.

Blanes T (1898) Sobre algunos puntos dudosos del la estructura del bulbo olfactorio. Rev

Trim Micrograf 3:99–127.

Burda JE, Sofroniew MV (2014) Reactive gliosis and the multicellular response to CNS

damage and disease. Neuron 81:229-248.

Caggiano M, Kauer JS, Hunter DD (1994) Globose basal cells are neuronal progenitors in

the olfactory epithelium: a lineage analysis using a replication-incompetent retrovirus.

Neuron 13:339-352.

Cancalon P (1982) Degeneration and regeneration of olfactory cells induced by ZnSO4 and

other chemicals. Tissue Cell 14:717-733.

Chehrehasa F, Ekberg JA, Lineburg K, Amaya D, Mackay-Sim A, St John JA (2012) Two

phases of replacement replenish the olfactory ensheathing cell population after injury

in postnatal mice. Glia 60:322-332.

Costanzo RM (1984) Comparison of neurogenesis and cell replacement in the hamster

olfactory system with and without a target (olfactory bulb). Brain Res 307:295-301.

Ferri GL, Probert L, Cocchia D, Michetti F, Marangos PJ, Polak JM (1982) Evidence for the

presence of S-100 protein in the glial component of the human enteric nervous

system. Nature 297:409-410.

Golgi C (1875) Sulla fina struttura dei bulbi olfattorii. Reggio-Emilia: Tipografia di Stefano

Calderini.

Hamon A, Roger JE, Yang XJ, Perron M (2016) Muller glial cell-dependent regeneration of

the neural retina: An overview across vertebrate model systems. Dev Dyn 245:727-

738.

Hoff S, Zeller F, von Weyhern CW, Wegner M, Schemann M, Michel K, Ruhl A (2008)

Quantitative assessment of glial cells in the human and guinea pig enteric nervous

system with an anti-Sox8/9/10 antibody. J Comp Neurol 509:356-371.

Holcomb JD, Mumm JS, Calof AL (1995) Apoptosis in the neuronal lineage of the mouse

olfactory epithelium: regulation in vivo and in vitro. Dev Biol 172:307-323.

Huang ZH, Wang Y, Cao L, Su ZD, Zhu YL, Chen YZ, Yuan XB, He C (2008) Migratory

properties of cultured olfactory ensheathing cells by single-cell migration assay. Cell

Res 18:479-490.

Huang ZH, Wang Y, Yuan XB, He C (2011) RhoA-ROCK-Myosin pathway regulates

morphological plasticity of cultured olfactory ensheathing cells. Exp Cell Res

317:2823-2834.

Iwai N, Zhou Z, Roop DR, Behringer RR (2008) Horizontal basal cells are multipotent

progenitors in normal and injured adult olfactory epithelium. Stem Cells 26:1298-

1306.

Jessen KR, Mirsky R (1980) Glial cells in the enteric nervous system contain glial fibrillary

acidic protein. Nature 286:736-737.

Jessen KR, Mirsky R, Lloyd AC (2015) Schwann Cells: Development and Role in Nerve

Repair. Cold Spring Harb Perspect Biol 7:a020487.

Kedderis GL, Rickert DE (1985) Loss of rat liver microsomal cytochrome P-450 during

methimazole metabolism. Role of flavin-containing monooxygenase. Drug Metab

Dispos 13:58-61.

Lakatos A, Franklin RJ, Barnett SC (2000) Olfactory ensheathing cells and Schwann cells

differ in their in vitro interactions with astrocytes. Glia 32:214-225.

Laranjeira C, Pachnis V (2009) Enteric nervous system development: Recent progress and

future challenges. Auton Neurosci 151:61-69.

Laranjeira C, Sandgren K, Kessaris N, Richardson W, Potocnik A, Vanden Berghe P,

Pachnis V (2011) Glial cells in the mouse enteric nervous system can undergo

neurogenesis in response to injury. J Clin Invest 121:3412-3424.

Lee HJ, Shin YK, Park HT (2014) Mitogen Activated Protein Kinase Family Proteins and c-

jun Signaling in Injury-induced Schwann Cell Plasticity. Exp Neurobiol 23:130-137.

Mackay-Sim A, Kittel P (1991) Cell dynamics in the adult mouse olfactory epithelium: a

quantitative autoradiographic study. J Neurosci 11:979-984.

Peron S, Berninger B (2015) Reawakening the sleeping beauty in the adult brain:

neurogenesis from parenchymal glia. Curr Opin Genet Dev 34:46-53.

Pixley SK (1992) The olfactory nerve contains two populations of glia, identified both in

vivo and in vitro. Glia 5:269-284.

Ramon-Cueto A, Avila J (1998) Olfactory ensheathing glia: properties and function. Brain

Res Bull 46:175-187.

Roet KC, Verhaagen J (2014) Understanding the neural repair-promoting properties of

olfactory ensheathing cells. Exp Neurol 261:594-609.

Schwob JE, Szumowski KE, Stasky AA (1992) Olfactory sensory neurons are trophically

dependent on the olfactory bulb for their prolonged survival. J Neurosci 12:3896-

3919.

Shy ME, Shi Y, Wrabetz L, Kamholz J, Scherer SS (1996) Axon-Schwann cell interactions

regulate the expression of c-jun in Schwann cells. J Neurosci Res 43:511-525.

14 van den Pol AN, Santarelli JG (2003) Olfactory ensheathing cells: time lapse imaging of

cellular interactions, axonal support, rapid morphologic shifts, and mitosis. J Comp

Neurol 458:175-194.

Vincent AJ, West AK, Chuah MI (2003) Morphological plasticity of olfactory ensheathing

cells is regulated by cAMP and endothelin-1. Glia 41:393-403.

Williams SK, Franklin RJ, Barnett SC (2004) Response of olfactory ensheathing cells to the

degeneration and regeneration of the peripheral olfactory system and the

involvement of the neuregulins. J Comp Neurol 470:50-62.

CHAPTER 2

CHARACTERIZATION OF OLFACTORY ENSHEATHING CELLS AFTER NEURONAL INJURY

INTRODUCTION

The mammalian peripheral olfactory system is one of the few regions in the adult nervous system where continual regeneration takes place throughout the lifetime of an organism (Graziadei and Graziadei, 1979) and perhaps the only region that can undergo essentially complete replacement.. Unlike most other regions of the nervous system, the peripheral olfactory system is directly exposed to the environment, making it vulnerable to insults from toxic chemicals present in the environment. Therefore, the adult peripheral olfactory system has evolved a mechanism to regenerate after injury. This remarkable ability of the peripheral olfactory system to regenerate itself is in part due to the growth permissive environment created by olfactory ensheathing cells (OECs).

In the peripheral olfactory system, the cell bodies of olfactory sensory neurons

(OSN) reside in the olfactory epithelium (OE). OECs are located in the lamina propria (LP-

OECs), the layer located underneath the olfactory epithelium (OE) (Chapter 1: Figure 1.1).

OECs ensheath the unmyelinated axon fascicles of OSN along the entire length as they traverse from the OE to the olfactory bulb (OB). Each OEC in the lamina propria (LP) ensheaths hundreds of OSN axons. The LP and OE together are referred to as the olfactory mucosa (OM) (Chapter 1: Figure 1.1). OECs are also found in the outer nerve layer of the

OB, henceforth, referred to as OB-OECs. Although LP-OECs and OB-OECs are both neural-crest cell derived (Barraud et al., 2010), they have differing properties, including molecular profiles (Guerout et al., 2010).

In contrast to the OE, which is capable of regenerating after an acute injury, neuronal regeneration in the CNS (brain and spinal cord) after injury is restricted and

17 therefore, the damage is permanent. The reason for this is likely complex but a major contributor may not be the inherent inability of CNS neurons to regrow; rather, the induction of various factors following injury (for instance, glial scar formation) together creates a growth-prohibitive environment (David and Aguayo, 1981). Since OECs provide a permissive environment for OSN regrowth after injury, OECs are a candidate therapeutic tool for promoting regrowth of CNS neurons after spinal cord injury. The ability of OECs to intermingle with CNS glial cells also makes OECs an attractive candidate for transplantation into injured spinal cord (Lakatos et al., 2000). Transplantation studies using

OECs from the LP and OB have shown that OECs can promote axonal regrowth and functional recovery in rodent models to a certain extent (Roet and Verhaagen, 2014). In one study conducted in human, autologous LP-OEC transplantation into the injured spinal cord resulted in improvement of patients’ lower limb movements (Tabakow et al., 2013).

Although the repair properties of OECs have generated considerable interest as therapeutic tools, OEC biology is still not well understood. Understanding OEC biology, however, has proven to be complicated since different laboratories have used different sources of OECs

(LP vs. OB), ages (neonatal vs. adult), and have used various methods of OEC isolation from tissue. Moreover, the majority of the studies conducted so far have used in vitro models.

In this chapter, we focused on studying LP-OECs in adult mice in their natural environment. More specifically, we wanted to study OEC biology in the context of the OSN injury. While neuronal injury has been the focus of many studies, no direct examination of effect of OSN loss on OECs has been conducted. Because OECs ensheath OSN axons, and therefore, are physically associated with OSNs, we hypothesized that injury-induced OSN loss would lead to critical changes in OECs. Therefore, we studied various aspects of OEC

18 biology after acute OSN injury caused by methyl bromide gas (MeBr). We explored whether

OECs proliferated and underwent morphological changes in response to OSN loss and its subsequent regeneration. Finally, we studied the molecular profile of OECs that were directly isolated via FACS from the mucosa of a reporter mouse line.

MATERIALS AND METHODS

Mice

Adult mice of mixed sexes were used. All mice were housed in a temperature and humidity controlled facility supervised by the Division of Comparative Medicine, and were provided rodent chow and water ad libitum.

PLP1-eGFP transgenic mice have been previously described (Mallon et al., 2002), and were provided by D. Bergles (Johns Hopkins University). In the PLP1-eGFP transgenic mouse line, PLP promoter and 3’ UTR of PLP are fused to EGFP. In these mice, EGFP expression was reported in oligodendrocytes, Schwann cells, and satellite cells. PLP1-CreER transgenic mouse line has been described (Leone et al., 2003), was provided by D. Bergles. In this mouse line, tamoxifen-inducible variant of the Cre recombinase (CreERT2) was placed under the control of PLP promoter. ROSA26-mTmG knock-in mouse line has been previously described (Muzumdar et al., 2007). In this mouse line, all cells express membrane-tagged tdTomato (mT). Cre-mediated recombination leads to mT sequence excision, resulting in expression of membrane-tagged GFP (mG).

Methyl Bromide-induced neuronal injury

Mice (P30-P45) were exposed to methyl bromide (MeBr) as previously described (Schwob et al., 1995). MeBr gas was exposed to mice for 5 hours in a closed chamber at a flow rate of

4.9 cc/min (~300 ppm) mixed with purified air at the flow rate of 10 L/min. Food and water were provided to mice ad libitum after the treatment. Mice were killed 2, 5, and 7 days post lesion (DPL).

Olfactory tissue preparation for in situ hybridization and immunofluorescence

Mice were killed by an overdose of Avertin (intraperitoneal (IP) injection), transcardially perfused with cold PBS followed by cold 4% paraformaldehyde (4% PFA). The heads were post-fixed overnight in 4% PFA. For in situ hybridization, mice were perfused with DEPC- treated PBS and 4% PFA solutions. Next, the heads were cryoprotected and decalcified in

30% sucrose/250 mM EDTA (DEPC-treated) solution for 48 hours. The heads were embedded in OCT (Tissuetek) and subsequently, frozen in liquid nitrogen. The tissue OCT blocks were sectioned on a cryostat (Microm). All tissue sections (14-20 µm thick) were placed on charged glass slides and stored at -80C.

EdU Labeling and cell counting

Mice were injected with EdU (50 mg EdU/kg body weight, IP injection) and sacrificed two hours later. Olfactory tissue sections (14-20 µm) were stained for EdU using EdU click-iT

Imaging kit (Thermo Scientific, USA). Images were acquired on a Zeiss 780 inverted confocal microscope (Zeiss, Germany) using a 20x objective. EdU-positive cells in the OE and LP were counted along the dorsal septum (300 µm) in multiple sections from approximately the same regions of the olfactory tissue with three mice per timepoint. A total of 140 tissue sections were analyzed (unlesioned (n=18), 2 DPL (n=28), 5 DPL (n=28), and

7 DPL (n=36)). Data is represented as mean ± SEM.

In situ hybridization

Digoxigenin-labeled riboprobes were generated from cDNA-containing pBluescript-KSII(+) vectors. Full-length PLP1 riboprobe was generated from pLH116, a gift from Lynn Hudson

(Addgene plasmid# 22651) (Hudson et al., 1987). The riboprobes were hybridized to 4%

PFA-fixed tissue sections. Briefly, tissue sections were fixed in 4% PFA for 30 minutes, treated with Proteinase K [10 mg/ml] for 10 minutes, and acetylated for 10 minutes.

Subsequently, the tissue sections were incubated with Hybridization buffer [50% formamide,

5X SSC, 5X Denhardt’s, 0.3 mg/ml baker’s yeast RNA (R6750, Sigma), 500 mg/ml Herring sperm DNA (15634-017, Invitrogen) for two hours at room temperature before DIG- labeled probes were applied to the slides (200 ng/100 µl/slide) and placed in a hybridization oven (Boekel Scientific, USA) at 62C for 16-20 hours. The tissue sections were washed with

SSC solutions [20X SSC: 3M NaCl, 0.3M sodium citrate (pH 7.0)] at 62C in the following order: 5X SSC, 2X SSC, and 0.2X SSC. The tissue sections were then washed with Buffer T1

(0.05% Tween-20/TBS), blocked (10% normal goat serum in T1), and incubated with anti-

DIG alkaline phosphatase (AP)-labeled antibody overnight. Slides were washed in Buffer T1 to remove unbound antibody, equilibrated in NTMT buffer [100 mM Tris-Cl (pH 9.5), 100

mM NaCl, 50 mM MgCl2] and incubated with BCIP/NBT solution to develop the signal.

Images were captured using a Zeiss AxioCam color CCD camera.

Immunofluorescence

PFA-fixed tissue sections were permeabilized in Buffer B1 (0.5% Triton X-100/PBS) and blocked (10% normal goat serum in B1) before overnight incubation with primary antibodies. AlexaFluor secondary antibodies were used to visualize immunoreactivity, and sections were exposed briefly to DAPI for counterstaining nuclei before mounting.

Following antibodies were used in this study: S100 (S2644, Sigma), Ki67 [Sp6] (Abcam),

NGFR (Ab1554, Millipore), and Plp1/DM20 (PA3-151, ThermoFisher Scientific). Images were captured using Zeiss 780 and Zeiss 700 confocal microscope.

Tamoxifen preparation and administration for OEC sparse labeling

Tamoxifen was initially partially dissolved in 100 µl of 100% ethanol. Warm sunflower seed oil (~65C) was then added to fully dissolve tamoxifen at final concentration of 0.1 mg/ml.

For sparse labeling OECs, PLP1-CreER/ROSA-mTmG mice (~P14) were injected with the tamoxifen solution (0.01 mg/100 µl/pup, IP injection).

Tissue clearing and imaging individual OECs in olfactory mucosa

Olfactory tissue was prepared as described above. After post-fixing, a 3 x 3 mm piece of olfactory mucosa was dissected from the nasal septum cartilage. The SeeDB tissue clearing technique (Ke et al., 2013) was modified for clearing olfactory mucosa. Dissected pieces of olfactory mucosa were serially incubated in 20%, 40%, 60% fructose solutions (w/v) for one hour each; 80% and 100% fructose for 2 hours each, and SeeDB solution (80.2% w/w or

~115% w/v fructose) overnight. All of the fructose solutions were prepared using deionized water (Millipore). Cleared olfactory mucosa was placed on a glass slide, with the lamina propria surface facing up, and a 0.17 mm glass coverslip was gently placed on top of the tissue. Z-stacks of individual OECs were acquired using a Zeiss 780 inverted confocal microscope fitted with a 40x Plan-Apochromat (1.4 NA) oil objective and a photo-inverter tube.

OEC morphology analysis

A total of 167 OECs (unlesioned (n=43); 2 DPL (n=42); 5 DPL (n=46); 7 DPL (n=36)) were imaged. Length of each individual OEC in its longest dimension was measured using

Zen software (Zeiss). Each OEC z-stack was analyzed using Imaris software (Bitplane) to measure the surface area and volume. The following parameters were applied to each OEC

23 z-stack: Background subtraction (50 µm) and then Gaussian filter (0.2 µm). For creating a surface, “Surface” was chosen as the style, and surface area detail level value of 0.1 µm was applied. A total of 140 OECs (unlesioned (n=28); 2 DPL (n=36); 5 DPL (n=43); 7 DPL (n

=33)) were analyzed with Imaris, and surface area-to-volume ratio for each OEC analyzed was calculated.

QQ plots were generated to determine Normal distribution of length, surface area, and volume data. Kruskal-Wallis statistical test (p < 0.05) was used to determine significant difference in length, surface area, volume, and surface area-to-volume ratio between various timepoints.

Tissue dissociation for Fluorescence Activated Cell Sorting (FACS) of OECs

OECs were sorted directly from olfactory mucosa of adult (P30-P45) PLP1-eGFP transgenic

mice. Briefly, 3-6 mice per timepoint were killed by CO2 inhalation and decapitated. The heads were opened parallel to the septum and immediately placed in cold DMEM/F12 media. The olfactory mucosa was dissected off the septum and placed in cold low-calcium

Ringer’s Solution (LCRS) [140 mM NaCl, 5 mM KCl, 10 mM HEPES, 1 mM EDTA, 10 mM Glucose]. The tissue was digested with 0.05% trypsin in a 37C water bath for 15 minutes, and then gently triturated using a P1000 pipette tip. A cocktail of enzymes [1.5 mg/ml hyaluronidase, 1.2 mg/ml collagenase, 10 mg/ml bovine serum albumin (BSA), 0.5 mg/ml soybean trypsin inhibitor, and papain in Ringer’s solution (140 mM NaCl, 5 mM KCl,

1 mM CaCl2, 1 mM MgCl2, 10 mM HEPES, 10 mM Glucose)] was added and incubated for

30 minutes in a 37C water bath. Following enzymatic digestion, the tissue was triturated with a fire-polished 9" Pasteur pipette, filtered through a 40 µm filter, spun down, and resuspended in 0.5% BSA/Hanks’s Buffer/DNaseI solution. 7AAD dye was added to the

24 cell suspension to mark the non-viable cells. eGFP-(+) and 7AAD-(-) cells were collected directly from the BD FACS Aria cell sorter into RNA lysis buffer (Buffer RLT, QIAGEN).

Number of events collected per timepoint is shown in Table 2.1.

Total RNA isolation for RNAseq and RT-PCR

Total RNA from sorted OSNs was isolated using RNeasy Micro Kit (QIAGEN, USA) using manufacturer’s protocol. The quality and the concentration of RNA were analyzed using

Agilent Bioanalyzer. Total RNA from whole olfactory mucosa was isolated using RNeasy

Mini Kit (QIAGEN, USA) using the manufacturer’s protocol.

RNAseq data analysis

Total RNA isolated from OECs of PLP1-eGFP mice was used for generating cDNA libraries for RNAseq. Three biological replicates were generated for unlesioned, 5 DPL, and

7 DPL timepoints; and, one biological replicate was generated for 2 DPL timepoint. Number of mice used per timepoint is summarized in Table 2.1. cDNA libraries for RNAseq were generated by the Johns Hopkins Deep Sequencing and Microarray core facility using Nugen

RNAseq kit and Illumina TruSeq DNA library prep kit. The samples were sequenced on

Illumina HiSeq 2500. For each sample, we obtained 50 bp, single-end reads. Number of reads per sample is summarized in Table 2.1.

RNAseq data was analyzed using RSEM (version 1.2.19) (Li and Dewey, 2011). Reads were aligned to mouse genome (mm10). Read counts and alignments were visualized using

Integrative Genomics Viewer (IGV) (Robinson et al., 2011, Thorvaldsdottir et al., 2013).

EBseq module of RSEM was used for differential gene expression analysis (Leng et al., 2013).

We used a false discovery rate of 0.05 to identify differentially expressed genes. After

25 obtaining a list of differentially-expressed genes, we selected for genes with Posterior

Probability of Differential Expression (PPDE) greater than 0.99999. Next, we selected for

genes with -1> log2>1 fold change, and those that were present in more than one timepoint.

Finally, we eliminated known OSN-specific genes.

Real time PCR

Relative mRNA abundance was determined by RT-PCR using an iScript cDNA synthesis kit

-ΔΔC (Biorad) SYBR kit (Biorad), and run on the C1000 Thermocycler (Biorad). The 2 T method was used for determining relative gene expression analysis. Primers used in this study are listed in Table 2.2.

RESULTS

PLP1-eGFP transgenic mouse line to detect OECs

Proteolipid protein 1 (PLP1), a major structural component of myelin, is widely expressed in

CNS oligodendrocytes, PNS Schwann cells, and enteric nervous system glia (Griffiths et al., 1998,

Rao et al., 2015). We obtained a PLP1 promoter-driven eGFP transgenic reporter mouse line to examine whether PLP1 was also expressed in lamina propria (LP)-OECs (Mallon et al., 2002). In the peripheral olfactory system, eGFP expression was restricted to axon fascicles within the lamina propria (LP) pattern consistent with PLP1 serving as a specific marker for OECs (Figure 2.1A).

Immunostaining for the S100β protein – a pan-glial marker – on PLP1-eGFP olfactory tissue sections (Figure 2.1B) showed that the eGFP-expressing cells in the mucosa co-labeled with S100β protein (Figure 2.1D). This observation supports the conclusion that OECs are efficiently and effectively marked by the PLP1-eGFP reporter transgene.

In mice, the Plp1 gene encodes PLP1 and DM20, a splice variant resulting from exon 3B alternative splicing. PLP1 protein is the major product in myelinated CNS glia. The alternatively spliced DM20 isoform is expressed in embryonic and pre-myelinated CNS and, in the PNS, at all ages in myelinating and non-myelinating PNS glia. In the OECs located in olfactory nerve layer

(ONL) of the olfactory bulb (OB), DM20 is the predominant isoform at the transcript and protein level (Dickinson et al., 1997). We examined whether Plp1/dm20 mRNA transcripts were also present in adult LP-OE. Semi-quantitative PCR showed higher levels of DM20 than Plp1 using

RNA isolated from whole olfactory mucosa (OM) (data not shown). Using in situ hybridization, we detected Plp1/dm20 transcripts in adult LP-OECs using DIG-labeled full length Plp1 riboprobes

(Figure 2.1E). At the protein level, PLP1/DM20 was detected at P3 (Figure 2.2A) and P21

(Figure 2.2B), but not at >P30 (Figure 2.2C) in LP-OECs using a commercially available antibody that is expected to detect both PLP1 and DM20 isoforms. Immunoreactivity for PLP1/DM20

27 protein was weakly present in the OB-OECs but was apparent in more central cells of the adult OB

(Figure 2.3).

We next wanted to observe changes in LP-OEC upon OSN injury and during subsequent regeneration. Methyl bromide (MeBr) exposure induces acute injury to the OE by damaging OSNs and other cell types present in the OE (Schwob et al., 1995). Adult PLP1-eGFP mice (P30-P45) were exposed to MeBr and examined at several timepoints of OE regeneration: 2, 5, and 7 days post lesion (DPL). Following MeBr exposure, the majority of the cells in OE layer are killed with only subset of basal cells spared at 2 DPL (Figure 2.4B, DAPI (blue channel)). These remaining, intact basal stem cells proliferate and begin to repopulate the OE that is several cell layers thick by 5 DPL

(Figure 2.4C, DAPI). By 7 DPL, the OE contains many more OSN derived from the proliferative basal stem cells, and the thickness of OE approaches that of an unlesioned OE (Figure 2.4A,D,

DAPI). While MeBr causes dramatic changes in the appearance of the OE, the LP remains intact.

Reporter eGFP expression in LP-OECs and its pattern appears unchanged in lesioned animals

(Figure 2.4A-D, GFP (green channel)). This apparent stability could result from either OECs remaining unaffected or a rapid replacement of OECs following MeBr lesion. Regardless, the PLP1 gene is an effective marker of OECs, and the PLP1-eGFP line provides a mechanism for following

OEC cell fate during injury.

OEC proliferation assessment after MeBr-induced neuronal injury

In the PNS, Schwann cells in adult mice proliferate in response to peripheral nerve injury.

Similarly, LP-OECs in neonatal mice proliferate following bulbectomy – surgical removal of OB that leads to OSN death (Chehrehasa et al., 2012). In adult mice, OECs in the OB have been shown proliferate following MeBr lesion (Schwob et al., 1999); however, in this study, an OEC specific marker was not used. This prompted us to examine whether LP-OECs in adult mice respond similarly to Schwann cells post-neuronal injury and OB-OECs after MeBr lesion. We used adult

PLP1-eGFP mice to assess OEC proliferation in LP after MeBr-induced OSN injury by detecting

EdU incorporation in OECs. EdU, an analog of thymidine, gets incorporated into the DNA of cells during DNA replication. We conducted an EdU-pulse experiment by injecting EdU at various timepoints (unlesioned, 2, 5, and 7 DPL) and subsequently, sacrificing the mice two hours later.

Using this strategy (EdU-pulse), we were able to obtain a snapshot of proliferating cells in the OM.

In adult unlesioned OM, a small number of EdU positive cells that presumably represent multipotent horizontal basal cells/globose basal cells were present in the OE layer, but there was essentially no EdU-labeling in the LP (Figure 2.4A, red channel). After MeBr-induced injury, the number of EdU-positive cells increased dramatically in the epithelium (Figure 2.4E, gray bars).

The highest number of EdU-positive cells in the OE layer was at 7 DPL. However, very few EdU- positive cells were observed in the LP at any given timepoint (Figure 2.4E, white bars). Among the EdU-positive cells in the LP, an even smaller number of cells were OECs based on co-labeling in the PLP1-eGFP reporter line (Figure 2.4E, black bars), indicating that, in contrast to Schwann cells, OECs rarely proliferate after neuronal injury. These observations raise the possibility that

OECs may dedifferentiate like Schwann cells after injury and cease to express the PLP1-eGFP transgene. Alternatively, the GFP-negative EdU-positive cells in the LP found close to the fascicles may represent recruited macrophages. To explore this possibility, we conducted a preliminary experiment in which we injected mice with EdU at 7 DPL and sacrificed them one day, instead of two hours, later at 8 DPL. Similar to the EdU-pulse experiment, the results from this “EdU-chase” experiment did not show EdU-labeled GFP-positive OECs (data not shown). Proliferation after

MeBr was also assessed by immunostaining for Ki67, a proliferation marker, on olfactory mucosal tissue sections from unlesioned and lesioned mice. Many Ki67-positive cells were present in the mucosa, especially in the OE at timepoints after lesioning, but Ki67-positive OECs were rarely observed. In summary, proliferating GFP-positive OECs are rarely observed after MeBr injury.

OEC morphology analysis after MeBr-induced neuronal injury

OECs are physically closely associated with olfactory sensory neuronal axons. In cross- sections of the olfactory mucosal tissue, OECs are observed to surround the fascicles and extend their processes within them. This close juxtaposition of OECs and OSNs suggested that the loss of

OSNs after injury could affect OEC morphology. OEC morphology is highly variable in vitro and difficult to resolve in vivo. In PLP1-eGFP mice, the morphology and membrane processes of individual OECs residing within the collagen-rich LP are difficult to distinguish. The SeeDB technique (Ke et al., 2013) in combination with scanning confocal microscopy helped reduce light scattering and enabled deep imaging of the OM at high magnification (Figure 2.5). After clearing

OM from a PLP1-eGFP mouse, we were able to acquire a Z-stack of the LP from the side adjacent to the septal cartilage through its entire thickness (up to 50 µm) (Figure 2.5C). The 3D reconstruction of the LP Z-stacks provided a unique perspective of OECs in that it revealed for the first time a broad view of the conduits formed by OECs along multiple nerve fascicles. OECs are seemingly connected end-to-end along the nerve fascicles without any gaps. Additionally, we observed that the relatively flat cell bodies are unevenly spaced (Figure 2.5C).

To sparsely label and image individual OECs, we crossed a PLP1-CreER mouse line to

ROSA26-mTmG mice (Doerflinger et al., 2003, Muzumdar et al., 2007) (Figure 2.6A). In this

PLP1-CreER/mTmG mouse line, all cells express membrane-tagged tdTomato (mT) prior to recombination and, after tamoxifen-induced recombination, PLP1-expressing cells selectively express membrane-tagged GFP (mG). The brightness and membrane enrichment of these reporters facilitated visualization of fine cellular processes. OECs were sparsely labeled in the

PLP1-CreER/mTmG mouse line by administrating a low dose of tamoxifen at ~P14 sufficient to induce recombination in a small number of OECs (Figure 2.6B, 2.6C).

In unlesioned mice, OECs are large, elongated cells with a complex morphology (Figure

2.7A,B). Typically, the OEC cell body resides immediately outside of the olfactory nerve fascicle, with processes extending within that fascicle. The processes from multiple OECs together form a matrix within the fascicles. Additionally, while multiple process of an OEC might overlap with processes of other OECs within the fascicles, the part of the OECs surrounding the fascicles does not seem to overlap with neighboring OECs (data not shown).

Next, we determined whether OSN depletion and its subsequent replacement and axonal regeneration affected OEC morphology. Morphological changes in OECs in response to MeBr- induced OSN injury were examined by comparing several morphometric parameters of OECs in unlesioned and lesioned mice. We focused on examining overall changes rather than focusing on finer structures of OECs. The average maximum extent (i.e. the longest dimension) of OECs in unlesioned mice was 78 ± 19.7 µm (n=43, range: 29-126 µm) (Figure 2.7C). The distribution of

OEC length at 2, 5, and 7 DPL timepoints (n=42, n=46, n=36, respectively) was similar to that observed for OECs in unlesioned animals (n=43) (Figure 2.7C). Similarly, surface area and volume as calculated by Imaris software for each OEC was also measured. Due to the wide range of OEC length and assuming the cell volume stayed constant, it was appropriate to calculate the surface area- to-volume ratio for each OEC to compare overall morphological changes (i.e., physical changes due to OEC process extension/retraction). Our analysis showed that the surface area-to-volume ratio of

OECs does not dramatically change in lesioned mice (Figure 2.7D). Our data suggests that as the epithelium is undergoing dramatic changes after MeBr lesion – from the death of OSNs and other

OE cells to the regeneration of new OSNs that extend their axons through the LP to the OB – the overall shape and size of OECs stay consistent.

Transcriptome analysis of OECs post-neuronal injury

Our results indicate that at cellular level LP-OECs rarely proliferate and undergo at most modest morphological changes. We extended our examination of OEC response to neuronal injury at the molecular level. Therefore, we analyzed the OEC transcriptome in normal tissue and at several timepoints during OSN regeneration post-MeBr exposure. OECs from adult PLP1-eGFP mice were sorted via FACS (fluorescence-activated cell sorting) at 2, 5, and 7 DPL timepoints post-

MeBr exposure. In contrast to previous studies that examined adult OECs in culture, we developed a protocol to dissociate OM of PLP1-eGFP mice, and subsequently, isolated GFP(+) OECs via

FACS (Figure 2.8A). Isolating OECs, which are embedded in the collagen-rich LP, proved to be technically challenging; however, using our tissue dissociation and FACS protocol, we were able to significantly enrich for OECs as assessed by expression of key OEC markers (PLP1 and eGFP)

(Figure 2.8B) and OSN markers (OMP and OE3) (Figure 2.8C) in GFP-positive and GFP- negative FACS-sorted populations, and whole mucosa from PLP1-eGFP mice using real time-PCR

(RT-PCR). Compared to the expression in whole OM, the PLP1 and eGFP relative expression in

GFP-positive sorted population was ~20 and ~30 fold higher, respectively (Figure 2.8B). PLP1 and eGFP expression in GFP-negative sorted population was significantly lower compared to whole OM

(Figure 2.8B). On the other hand, OMP and O/E3 relative expression did not significantly change in either GFP-positive or GFP-negative populations. This could be due to the fact that majority of the cells in the mucosa are OSNs and they outnumber OECs.

Our RNAseq data analysis showed that out of 23,382 genes in the mouse genome

(mm10), about 85% of genes (or ~20,010 genes with average Transcript per Million (TPM)

≥ 0.01) were expressed in OECs isolated from unlesioned mice (Table 2.3). The percentage of genes expressed in OECs at other timepoints was also similar. Gm20594 was consistently

32 the most abundant gene in OECs at all timepoints (Average TPM [all timepoints] = 220,970

± 28,058). The function of Gm20594 is currently unknown.

PLP1 was also among the most abundant genes present in OECs at all timepoints

(Figure 2.9). Mapped reads for Plp1 at various timepoints were visualized using IGV software (Robinson et al., 2011, Thorvaldsdottir et al., 2013) (Figure 2.9A). Alternative splicing of Exon 3B, which results in DM20 is highlighted (grey box around Exon 3,

Figure 2.9A). Based on the TPM values at various timepoints (Figure 2.9B), Plp1 was among the genes with the highest TPM values (top 1% of all expressed genes), making it one of the most highly expressed genes in OECs. This high Plp1 expression in OECs was confirmed via in situ hybridization (Figure 2.9C). In conclusion, Plp1 gene is highly expressed in OECs even though OECs do not myelinate OSN axons.

Next, using published RNAseq data for CNS glial cells (Zhang et al., 2014) and OSNs

(Kanageswaran et al., 2015), we explored whether we could identify candidate OEC-specific genes.

To accomplish this, we first identified the top 1% most abundant OEC genes (number of genes =

201). Of these 201 genes, we did not include ribosomal genes and housekeeping genes (GAPDH) in our analysis. Subsequently, we determined whether these top 1% most abundant OEC genes were among the top 100 most abundant genes in astrocytes, myelinating oligodendrocytes, and/or microglia (Zhang et al., 2014). We selected for OEC genes that were not among the most abundant genes in these CNS glia. Next, we compared the TPM values of these selected OEC genes to those in OSNs (FACS-sorted from homozygous OMP-GFP transgenic reporter mice). Because OSNs outnumber OECs, our RNA samples and data had some contamination from OSNs. Therefore, we selected for OEC genes that had an extremely low expression (TPM = 0) in OSNs. To summarize our criteria, we selected for genes that were among the most abundant in OECs, but not other CNS

33 glial cells and OSNs. Using these criteria, we were able to identify at least 8 candidate OEC-specific genes using the transcriptome data (Table 2.4).

In order to assess the similarities between OECs and other glial and non-glial cell types, we compared our RNAseq data of OEC from unlesioned timepoint to the published transcriptome data for mouse brain astrocytes, various types of oligodendrocytes, microglia/macrophages, and endothelial cells (Zhang et al., 2014). Among the top 10% most abundant genes in OEC at unlesioned timepoints, we noticed that there were several genes that are also highly expressed in oligodendrocytes, astrocytes, and microglia/macrophages. For instance, Malat1, SparcL1, and Cpe are highly expressed in astrocytes compared to neurons, glial cells, and endothelial cells. B2m and

Sparc are highly expressed in microglia/macrophages and endothelial cells, but not in astrocytes, oligodendrocytes, or neurons. Cst3 is highly expressed in macrophages in the mouse brain. Dcn was highly expressed in oligodendrocyte-progenitor cells (OPC) compared to other cell types. Plp1,

Plekhb1, Apod, and Aplp1 are highly expressed in newly formed and myelinating oligodendrocytes.

While some oligodendrocyte- and astrocyte-specific genes are among the most abundant genes in

OECs, some genes that are relatively highly expressed in other glial types such as GFAP (astrocytes),

Slc1a3 (astrocytes) and Mobp (oligodendrocytes) are expressed at very low levels in OECs. Vimentin, a marker of various types of Schwann cells in PNS (e.g. myelinating and non-myelinating) and endothelial cells in the CNS, is also in the top 10% of most abundant genes in OECs. These observations provide support for the fact that OECs share properties of various glial cells.

We analyzed our RNAseq data further for differential gene expression using EBseq (Leng et al., 2013). We selected/eliminated genes that fulfilled a certain set of criteria: (1) selected genes with posterior probability of differential expression (PPDE) of at least 0.99999; (2) selected genes with

more than two-fold or less than 0.5-fold change (i.e. -1 > log2 > 1); (3) eliminated known

OSN-specific genes; these genes were expressed at low levels and were uniformly down-regulated in

34 lesioned animals and presumably represent the loss of OSNs and their associated mRNAs at these time points and, (4) selected genes that were differentially expressed in two or more timepoints.

After the first elimination step (eliminating genes with PPDE < 0.99999), only ~2% of all genes

(~23,400 genes total) remained (Table 2.5). After selecting for genes with -1 > log2 (fold change) >

1 and eliminating OSN-specific genes, ~1% of all genes remained (Table 2.5). At 2 DPL, the largest number of differentially-expressed (DE) genes were observed (~300 genes); whereas, the smallest number of DE genes were present at 7 DPL (~120 genes) (Table 2.5). Lastly, selecting for DE genes that were present at more than two timepoints surprisingly narrowed the list down to only 116 distinct genes, indicating that a significant number of DE genes were present at one of the

timepoints only. All 116 DE genes with their log2 fold changes are shown in (Figure 2.10A). Top 20 up- and downregulated genes based on average log2 fold change are shown in (Figures 2.10B and

2.10D). With the exception of a few genes, any gene identified as differentially expressed by the software at only one timepoint could possibly be an artifact since OE regeneration after MeBr is a steady, continuous process; therefore, these genes were eliminated. Of the remaining 116 genes, surprisingly only 12 genes were up/downregulated at all three timepoints. At 2 DPL, majority of the genes are upregulated (83 genes), while only a small number of genes are downregulated (8 genes)

(Figure 2.10C). At 5 DPL, number of downregulated genes increases while the number of upregulated genes stays the same (Figure 2.10C). Additionally, the largest number of DE genes is present at 5 DPL. Lastly, at 7 DPL when the OE thickness is reaching that of unlesioned mice, fewer genes are differentially expressed, and the number of up- and downregulated genes is similar

(Figure 2.10C). The remarkably few genes that display altered expression profiles during OE regeneration is consistent with the absence of proliferation and constancy of morphology which was observed in our other experiments. Of these DE genes, relative expression levels of select genes in independent FACS-sorted OEC samples were validated via RT-PCR (Figure 2.11) and in situ

35 hybridization. Our RT-PCR analysis showed that eGFP expression (OEC marker) remains unchanged, and confirmed that Lgals3, Mmp3, and Spp1 are upregulated in OECs following MeBr lesion (Figure 2.11).

Upon examination of the list of DE genes, we noticed that the expression of OEC markers

– PLP1 and S100β – did not change after MeBr-lesion. Expression of highly abundant genes, such as Malat1 and Gm20594, also did not significantly change. Since OECs share some properties with astrocytes, we examined whether GFAP expression increased at timepoints following MeBr lesion since an increase in GFAP expression marks reactive astrocytes. GFAP is expressed at low levels in

OECs in unlesioned mice. After MeBr lesion, GFAP was differentially expressed at 2 DPL only.

Although GFAP expression increased ~10 fold, its expression level at 2 DPL was moderate in terms of TPM value. GZMB, Chi3l4, Lrrc15, Prg4, and Mmp3 were the among the top five upregulated genes; while, Ppp1r42, Kcnf1, Acbd7, and Pnmal1 were the top five downregulated genes in OECs after MeBr injury.

The list of DE genes was further analyzed using DAVID (Database for Annotation, Visualization and Integrated Discovery) to gain further insight into pathways active in OECs after OSN injury (Huang da et al., 2009a, b). Using the KEGG pathway application, the top three pathways that the differentially expressed genes in OECs are involved in were extracellular matrix-receptor interaction, focal adhesion, and Erbb2 signaling pathways.

While the aim of this objective was to assess the overall changes in OEC transcriptome after

MeBr lesion, we noticed that the nerve growth factor receptor (NGFR) (also known as p75NTR) was among the top-scoring differentially expressed genes in OECs at 2 and 5 DPL. NGFR is used as a common OEC marker and its expression is known to significantly increase after PNS neuronal injury (eg. axotomy or nerve crush) in NGFR-expressing cells (Ibáñez and Simi, 2012). Since upregulation of NGFR in OEC may play a role in the regeneration process of OSN after MeBr

36 lesion, we decided to confirm its expression pattern. Our RNAseq data showed that while NGFR is expressed in adult OECs at relatively low levels in unlesioned mice, its expression increases over 20- fold by 2 DPL and remains high until at least 5 DPL (Figure 2.12A,B). We confirmed NGFR expression and its upregulation in OECs after MeBr lesion by RT-PCR (Figure 2.13C), in situ hybridization (ISH) (Figure 2.13B), and immunofluorescence (IF) (Figure 2.14). Using DIG- labeled riboprobes for ISH, NGFR expression in OECs at 2 and 5 DPL was high enough to be detected, while too low to be detected at unlesioned and 7 DPL timepoints (Figure 2.13B). The intensity of signal observed in OEC cell bodies at 2 and 5 DPL was roughly equivalent, however, the number of NGFR-positive OECs (as determined by morphology and location) was higher at 2 DPL relative to 5 DPL and other timepoints. Additionally, we noticed that NGFR mRNA expression was upregulated in a portion of OECs and was not uniformly upregulated across all OECs at 2 DPL or 5

DPL (Figure 2.13B). At the protein level, NGFR expression was not observed in unlesioned mice, but it was observed at 2 and 5 DPL mostly in the processes of OEC (visualized by endogenous eGFP expression) (Figure 2.14). Similar to ISH results, numerous NGFR-positive cells were observed at 2 DPL. Number of NGFR-positive OECs observed decreased by 5 DPL, and by 7 DPL,

NGFR-positive OECs were not observed. Also similar to ISH results, NGFR protein was expressed in a portion of OECs in LP even at 2 DPL when the NGFR transcript expression (per RNAseq data) was the highest. In conclusion, NGFR expression is the highest right after MeBr injury (2

DPL), but gradually decreases during the OE regeneration process as the OE becomes progressively thicker.

DISCUSSION

We have studied various aspects of LP-OEC biology in adult mice to understand its role in OE regeneration after injury. Unlike previous studies, our aim was to study OECs in their natural environment. Therefore, we obtained the PLP1-eGFP reporter transgenic mouse line to mark OECs in situ. Originally created to study oligodendrocytes, we showed that the PLP1-eGFP transgenic mouse line could be used as a tool to study LP-OECs since the eGFP expression is restricted to OECs in the peripheral olfactory system. This mouse line is not suited well to study OB-OECs since there are other cell types (e.g. oligodendrocytes) present in the OB that also express the eGFP reporter.

Plp1/DM20 is expressed in the OB-OECs (Dickinson et al., 1997); however, direct evidence did not existed for its expression in adult LP-OECs. Although LP-OECs do not myelinate OSN axons, we detected Plp1/dm20 transcript expression in adult LP-OECs via in situ hybridization. Our RNAseq data also showed a very high expression of Plp1/dm20 transcript in FACS-sorted LP-OECs from adult mice. At the protein level, we were able to detect PLP1/DM20 in LP-OEC in neonatal and young mice; however, we were not able to detect it in adult mice. A possible explanation for these observations could be that Plp1 mRNA is not translated at adult timepoints and therefore PLP1/DM20 protein expression in LP-OECs dramatically reduces in adulthood. Alternatively, unknown post-transcriptional modifications perhaps prevent the commercially available antibody from detecting

PLP1/DM20 in adult LP-OECs. Regardless, the PLP1-eGFP transgene remains active in adult LP-OECs, which allowed us to visualize OECs in situ, study OEC proliferation, and most importantly, isolate OECs directly from OM via FACS for transcriptome analysis.

Absence of OEC proliferation following MeBr Lesion

Myelinating Schwann cells re-enter the cell cycle following a nerve injury, such as axotomy or nerve crush (Gaudet et al., 2011). Since OECs and Schwann cells share a few similarities in terms of neural crest cell origin and markers (SOX10, S100β, PLP1), we wanted to explore whether OSN injury elicited a similar response in OECs in adult mice.

Surprisingly, proliferating OECs were rarely observed after MeBr lesion. The difference in responses could be explained by the lack of myelination of axons by OECs. Evaluating nonmyelinating Schwann cell (NMSC) response to nerve injury reveals that terminal

Schwann cells, like OECs, do not proliferate after denervation (Griffin and Thompson,

2008). Terminal Schwann cells, or perisynaptic Schwann cells, are located at neuromuscular junctions. However, the response of various types of NMSC is nonhomogeneous, as Remak

Schwann cells - the NMSCs that ensheath small caliber axons and are found along the nerve

– proliferate like myelinating Schwann cells following denervation (Griffin and Thompson,

2008). At this point, the degree of similarity between OEC and NMSC molecular profiles is unclear.

OEC morphology after OSN injury

We examined OEC morphology during the OSN degeneration and regeneration process following MeBr treatment. We wanted to observe if the loss/regeneration of OSNs had an effect on overall OEC morphology. For instance, we questioned whether OEC processes retracted in response to OSN loss, or whether the OECs extended their processes while the axons of newly generated OSN traversed through the existing conduit formed by

OECs. OEC morphology after zinc sulfate-induced injury was previously examined in tissue sections via electron microscopy (EM) (Williams et al., 2004). While a high-resolution of

39 cross sections of OEC processes could be observed, the EM results of this study did not provide an overall view of the OEC morphology. Therefore, we developed a unique technique to produce EM-like 3D reconstruction of whole OECs without employing the labor-intensive process of EM. We examined OEC morphology in their natural environment by imaging individual sparsely-labeled OECs in SeeDB-cleared whole mucosa of PLP1-

CreER;ROSA-mTmG mice. Our results showed that OECs are generally elongated cells with a complex morphology. The wide range of OEC length suggests heterogeneity in the

LP-OEC population. OEC heterogeneity in the OB has been indicated previously based on physiological data, including calcium imaging and voltage-dependent membrane current

(Rieger et al., 2007, Rela et al., 2010, Thyssen et al., 2013, Rela et al., 2015). We also noticed that LP-OEC morphology significantly differs from OB-OECs. For the majority of the LP-

OECs, cell bodies exist on the periphery of fascicles, while the long, flat processes extend only within the fascicles. On the fascicle periphery, OECs are flat and isolate the fascicles from the surrounding LP environment. In a study that examined OB-OEC morphology by dye-filling, the OB-OEC morphology was also flat, complex and varied like that of LP-

OECs (Rela et al., 2010). However, the processes emanating from the cell body of OB-

OECs extended in multiple directions, unlike the processes of majority of the LP-OECs.

This difference in morphology could be explained by the difference in axonal organization in the LP versus the OB, and the role that OECs might play in guiding these axons. In the LP, the axons coalesce to form fascicles; however, once the axons reach the OB they defasciculate to reach their appropriate glomeruli.

Our OEC morphometric analysis showed that after MeBr lesion the morphology does not change significantly. Assuming that the cell volume stays constant, we used the surface-area-to-volume ratio to assess any changes in the process. We wondered whether the

OSN loss would prompt OECs to retract/extend their processes or maintain the overall shape as the growth cones of newly regenerated mature OSN are traversing through the conduit to reach OB. Our data supports the latter because significant changes are not observed in the parameters. Our data suggests that OECs possibly maintain their shape to maintain the conduit for regrowth of OSNs after MeBr lesion. Support for this hypothesis can be found in an EM study conducted in rats that showed that OECs seemed to maintain open channels in an axotomy-induced OSN degeneration model (Li et al., 2005). Taken together, our results suggest that OECs in adult mice do not proliferate or undergo morphological changes after MeBr-induced OSN degeneration and during its subsequent regeneration. Nonetheless, these features may contribute to a permissive environment for

OSN regeneration after injury.

OEC transcriptome after neuronal injury

The combination of three factors: (1) availability of a mouse reporter line (PLP1- eGFP) for marking OECs, (2) development of a protocol for isolating OECs from collagen- rich whole mucosa via FACS, and (3) advances in next generation sequencing (RNAseq), allowed us to analyze LP-OEC transcriptome. Previous microarray data were obtained from cultured OECs and possibly did not provide an accurate representation of their molecular profile as many molecular-level changes can take place in cells after being removed from their natural environment. Therefore, our data provides a better representation of the adult

OEC molecular profile before and after OSN injury.

Following MeBr treatment, dramatic changes take place in the epithelium. Following peripheral nerve injury, marked changes take place in Schwann cells, one of which includes dedifferentiation of mature SC into immature SC. Based on this, we hypothesized that

41 dramatic changes would also take in LP-OEC transcriptome. Surprisingly, very few – but important – genes are up/downregulated in LP-OECs after MeBr-induced OSN injury

Overall, modest gene expression changes take place in OECs after OSN loss.

Analyzing a specific cell type in a complex tissue – like OECs in the OM – that does not undergo major gene expression changes represents significant technical challenges even with the use of a reporter mouse line and stringent cell purification and data analysis criteria since the cells of interest are outnumbered by the other cells in the tissue that are undergoing major changes in cell abundance or gene expression. Therefore, most of the gene expression changes observed are either artifacts or reflect varying levels of contamination by other cell types present in the tissue. For instance, in our analysis we noticed that a few of the up/downregulated genes were OSN-specific, which we subsequently eliminated. Although the gating parameters for sorting OECs via FACS were relatively stringent, the presence of

OSN-specific genes in our analysis was not a surprise given that OSN greatly outnumber

OECs (~15-20 fold) in the OM. A few sources of contamination could have been (1) cellular contamination: small fragments of OSN were present in the gated OEC population; (2) molecular contamination: mRNA released from lysed OSN was present in the single-cell suspension prior to FACS, and likely made its way into the collection tube along with

GFP(+) OECs; and (3) axonal fragments physically in contact with sorted OECs were also collected. Due to these reasons, it was difficult to discern whether the source of downregulated genes were OECs or contamination from OSNs. For example, our RNAseq data analysis showed that Coch (Cochlin or Coagulation Factor C) was among the most downregulated genes. However, in situ hybridization results showed that Coch was not expressed in OECs; rather, it appeared to be specifically and abundantly expressed in the apical microvillar cells in the OE. Coch expression in the microvillar cells has not been

42 previously reported, and is potentially a new marker for these cells. Coch expression in microvillar cells would have to be confirmed by co-labeling these cells with known markers of microvillar cells (e.g. TRPM5).

Although our aim of the OEC transcriptome study was to observe overall changes after MeBr lesion, NGFR upregulation was notable among the top upregulated genes in

OECs after MeBr lesion. In the adult PNS, NGFR is expressed at low but functional levels.

Upregulation of NGFR expression is induced after injury and has been observed in myelinating Schwann cells, oligodendrocytes, astrocytes, and microglia/macrophages

(Meeker and Williams, 2014). Reactive nonmyelinating terminal Schwann cells – that do not proliferate after neuronal injury like OECs – also display NGFR upregulation after denervation of motor endplate (Woolf et al., 1992). We have shown that a robust upregulation of NGFR expression is also seen in OECs after neuronal injury. NGFR, a member of the TNF family, is a multifunctional receptor with wide range of functions ranging from apoptosis to cell survival. NGFR signals mainly through effector proteins, and its wide range of functions can be explained by multiple signaling partners (e.g. Trk receptors,

Nogo, sortilin) (Meeker and Williams, 2015). NGFR function seems dependent on the context. In the case of OSN injury, NGFR upregulation in OECs may promote OSN regrowth. Support for this hypothesis is provided by previously published studies showing impaired neuronal repair in NGFR-knockout models (Meeker and Williams, 2015). Future studies on how NGFR functions in OECs may shed light on growth-promoting properties of OECs.

Lgals3 was also among the top differentially-expressed genes in OECs at 2 and 5

DPL. Lgals3 (also known as Galectin-3 or Mac-2) is not expressed in intact PNS and CNS.

However, Lgals3 expression is upregulated during PNS and CNS Wallerian degeneration and is observed specifically in Schwann cells, recruited macrophages, and microglia that phagocytose degenerated myelin (Reichert et al., 1994, Rotshenker, 2009). Additionally,

Lgals3 is upregulated in reactive astrocytes in cortex gray matter after stab wound injury

(Sirko et al., 2015). Similarly, Lgals3 expression in OECs in intact OM is very low, but increases dramatically in OECs after MeBr-lesion (eg. 87x fold change at 2 DPL) (Figure

2.10, Figure 2.11). By 7 DPL when there are significantly more newly-regenerated OSNs in the OE, Lgals3 expression is not significantly upregulated relative to control. Upregulation of Lgals3 expression suggests that OECs become reactive after MeBr-lesion. These reactive

OECs then remove cellular debris (axons of dead OSNs) via phagocytosis, and as a result, promote regeneration of new OSNs. In the peripheral nerves, myelin debris from injured nerves express neuronal growth inhibitory factors, such as myelin-associated glycoprotein

(MAG) and oligodendrocyte-myelin glycoprotein (OMgp) (Gaudet et al., 2011). Clearance of this myelin debris by Schwann cells allows for neuronal regrowth. This is in contrast to CNS nerve injury where a combination of factors – including the inability of oligodendrocytes and astrocytes to phagocytosis myelin/cellular debris – leading to formation of glial scars results in neuronal regrowth inhibition (Gaudet et al., 2011). While myelin is absent in the olfactory nerve fascicles in the LP, the presence of axonal debris may nonetheless result in inefficient

OSN regeneration. Support for axonal debris clearance by OECs is provided by a study that showed Tuj1-positive neuronal debris in the cytoplasm of adult mouse LP-OECs (Su et al.,

2013). This study also showed that while Iba1-positive macrophages are present in the LP after bulbectomy and engulf axonal debris, OECs seem to be the primary cell type responsible for axonal debris clearance via phagocytosis (Su et al., 2013). OECs have been observed to phagocytose olfactory neuronal debris as early as E14.5 during olfactory system

44 development (Nazareth et al., 2015). In another study, cultured LP-OECs from neonatal mice are also capable of phagocytosis of axonal debris (Tello Velasquez et al., 2014). In conclusion, upregulation of Lgals3 in LP-OECs soon after MeBr lesion could indicate that

OECs are involved in efficient debris clearance after neuronal injury, thereby, promoting

OSN regrowth within days of lesion. This debris clearance property of OEC – along with their ability to interact with CNS glial – has made transplantation of OEC in injured spinal cord a viable option for promoting neuronal regrowth.

Conclusion

Taken together, OEC response to OSN injury seems to be a combination of various

PNS and CNS glial cell type responses to injury. This is not surprising, since OECs share properties with PNS and CNS glial cells. The fact that the overall molecular profile of OECs after OSN injury remains constant indicates that OECs maintain a constant growth- permissive environment for the OSNs. However, a few important changes take place in

OECs in terms of gene expression that further implicates OECs in the OSN regeneration process following acute injury. While GFAP upregulation - generally associated with injury in various glial cell types – is not observed in OECs, upregulation of other markers such as

Lgals3 and Ngfr is observed in OECs similar to astrocytes and myelinating and nonmyelinating Schwann cells. At early timepoints after MeBr lesion when the OSNs are in the processes of degeneration and early regeneration, upregulation of these markers suggests that OECs phagocytose axonal debris, and simultaneously, promote OSN regrowth.

Expression of Ngfr and Lgals3 seems to be inversely correlated with the OE thickness after injury. As the OE regenerates and starts to resemble unlesioned OE, the overall Lgals3 and

Ngfr expression – along with other DE genes – decreases, and most likely returns to pre-

MeBr lesion level eventually when OE regeneration is complete.

While many unanswered questions remain about the mechanism of action of several differentially-expressed genes, our study has provided an insight into the molecular profile of

OECs before and after acute OSN injury. There is already an interest in using OECs as a therapeutic tool for CNS nerve regeneration. Our data – in combination with other techniques – can provide useful insights for making OECs even a more efficient tool for promoting nerve regeneration after injury.

Table 2.1. A summary of number of biological replicates, mice used, GFP (+) OECs collected, and RNAseq reads per timepoint.

Biological No. GFP(+) FACS RNAseq Timepoint Replicate Of Events Reads # mice Collected

1 6 ~52,000 164,819,639

Unlesioned 2 6 ~56,000 162,897,901

3 8 ~19,500 43,865,994

2 DPL 1 6 ~23,000 33,291,196

1 9 ~24,000 38,409,130

5 DPL 2 5 ~31,000 157,824,507

3 10 ~38,000 167,955,501

1 4 ~28,000 184,668,957

7 DPL 2 3 ~27,000 162,019,273

3 9 ~13,000 39,360,443

Table 2.2. List of RT-PCR primers used in this study.

Gene Forward (5’à3’) Reverse (5’à3’) NGFR CCCTGCCTGGACAGTGTTAC ACAGGGAGCGGACATACTCT PLP1/DM20 ATGACCTTCCACCTGTTTATTGCT TTAAGGACGGCGAAGTTGTAAGT eGFP CTGCTGCCCGACAACCA ATGTGATCGCGCTTCTCGTT Lgals3 TATCCTGCTGCTGGCCCTTATG GTTTGCGTTGGGTTTCACTG

Mmp3 CTATACGAGGGCACGAGGAG CCACCCTTGAGTCAACACCT

Pnmal1 CCCTCGAGTCTCCAAAGATTCC CCAACGGTTCACAGTCAGGT

Ppp1r42 CCACAGGTGGGTAAGCCAAA CCTTCAAGGACAGATTCCCTATGT

Spp1 CCTTGCTTGGGTTTGCAGTC TGGTCGTAGTTAGTCCCTCAGA OMP AGCCCGCTGTGACCTTAGG GATCAAGCCCCGCTGTCAT OE3 GGCAATGGGAACGGATTCAG ATCGGGGGAACAACAAGTCCTGTC

L19 (as GGTCTGGTTGGATCCCAATG CCCGGGAATGGACAGTCA reference)

Table 2.3. Number of expressed genes (TPM ≥ 0.01) in OECs at various timepoints after MeBr lesion.

Genes with Percentage Timepoint TPM ≥ 0.01 (out of 23,382 genes) Unlesioned 20,011 86% 2 DPL 17,508 75% 5 DPL 20,202 86% 7 DPL 19,885 85%

Table 2.4. List of candidate OEC-specific markers. Candidate OEC-specific markers were selected based on the following two-step criteria: (1) absence in the Top 100 most abundant genes in astrocytes, myelinating oligodendrocytes, and microglia; (2) extremely low expression in OSNs.

Average TPM in Gene ID Gene Name OECs Acta2 Actin, Alpha 2 3732 Myl9 Myosin Light Chain 9 1757 Mgp Matrix Gla Protein 1457 Ifitm3 Interferon Induced Transmembrane Protein 1148 Tpt1 Tumor Protein, Translationally-Controlled 1098 Crip1 Cysteine Rich Protein 768 A630089N07Rik 672 Tpm2 Tropomyosin 2 (Beta) 439

Table 2.5. Number of differentially-expressed genes in OECs post-MeBr fulfilling various parameters.

# of differentially expressed genes in OEC at various timepoints after MeBr injury Timepoints I. II. III. (vs. Unlesioned) PPDE above threshold* è Fold change = è After eliminating

-1>log2>1 known OSN genes 2 DPL 400 314 309 5 DPL 520 310 247

7 DPL 356 215 124

*: PPDE >0.99999

Figure 2.1. PLP1-eGFP transgenic mouse can be used as a tool to study OEC. A: A cross section of OM from an adult PLP1-eGFP transgenic mouse. B: anti-

S100 immunofluorescence on PLP1-eGFP OM tissue section. C: Nuclei are stained with

DAPI (blue). D: Overlap of PLP1-eGFP, S100β immunoreactivity, and DAPI signals. E: In situ hybridization using full-length Plp1 probe showing Plp1/dm20 transcript expression in

OECs in an adult mouse OM. Arrowheads shows location of basal lamina. Scale bar = 20

µm.

52 PLP1-eGFP anti-S100β

A B

DAPI Merge OE

C D

E Plp1/dm20 ISH

53 Figure 2.2. PLP1/DM20 expression at various ages. Cross sections of mouse OM showing PLP1/DM20 immunoreactivity (red) at P3 (A), P21 (B), and 8 weeks of age (C).

Nuclei are stained with DAPI (blue). Arrowheads indicate location of basal lamina. Scale bar

= 20 µm.

54 P3 P21 8 weeks old A anti-PLP1 B C

55 Figure 2.3. PLP1/DM20 protein is detected in OB, but not OM, in adult mice. A cross section of an adult PLP1-eGFP mouse olfactory tissue showing the OB and the OM.

The tissue section was stained for PLP1/DM20 protein. PLP1/DM20 immunoreactivity

(top panel, red) is seen in the OB but not in the OM (nasal cavity). Endogenous eGFP expression driven by the PLP1 promoter (bottom panel, green) marks OECs in the nasal cavity and OB. Nuclei are stained with DAPI (blue, bottom panel). Scale bar = 100 µm.

56 OB

Nasal Cavity OM

anti-PLP1

Merge

57 Figure 2.4. Proliferation in OM after MeBr lesion. EdU staining on cross sections of

OM of PLP1-eGFP adult mice at various timepoints after MeBr lesion: Unlesioned (A), 2

DPL (B), 5 DPL (C), and 7 DPL (D). EdU-labelled cells are shown in red. Arrows show

EdU-labeled cells in LP. Arrowheads indicate location of basal lamina. E: Quantification of

EdU-labelled cells in the OM. Bars in the graph represent average number of EdU positive cells quantified in a specific 300 µm region of the septum OE in multiple sections.

Quantification of EdU-(+)/GFP-(+)-OECs is shown by black bars. Quantification of EdU positive cells in LP and OE are shown by white and gray bars, respectively. Error bars: SEM

(n = 3). Scale bar = 50 µm.

58 Unlesioned 2 DPL

A B

5 DPL 7 DPL

C D

E 20

15 A LP LP + GFP 10 OE

5 per 300 um long region

Average # ofAverage EdU-labeled cells 0 Unlesioned 2 DPL 5 DPL 7 DPL

59 Figure 2.5. OM tissue clearing using SeeDB. A: Dissected OM from PLP1-eGFP after overnight postfixation in 4% PFA, prior to SeeDB. B: OM (from A) cleared using SeeDB. A’ and B’ show endogenous eGFP expression in dissected OM before and after SeeDB. Note enhanced clarity of eGFP in fascicles after SeeDB. Images in A’ and B’ were taken using the same exposure time and other imaging parameters. C: 3D reconstruction of LP from

SeeDB-cleared OM of a PLP1-eGFP mouse. Multiple fascicles are seen ensheathed by

OECs (eGFP, green) is seen. Bright green punta represent OEC cell bodies.

60 Before SeeDB After SeeDB

~3 mm

A ~3 mm B

A’ B’

61 Figure 2.6. Sparse labeling of OECs in OM. A: Schematic showing strategy for creating

PLP1-CreER/mTmG mouse for OEC sparse labeling in vivo. B: Experimental paradigm for sparsely labeling OECs in PLP1-CreER/mTmG mice. Mice were injected tamoxifen at

~P14 and sacrificed between P30 and P40. C: Cross section of OM from a PLP1-

CreER/mTmG mouse showing sparsely labeled OECs (green). In PLP1-CreER/mTmG mice, cells in which recombination does not take place express membrane-tagged tdTomato

(red). Nuclei are stained with DAPI (blue). Location of basal lamina is indicated by arrowheads. v = blood vessel. Scale bar = 20 µm.

62 A

PLP1-CreER ROSA-mTmG

PLP1-CreER; ROSA-mTmG

+ Tamoxifen

PLP1-CreER; ROSA-mTmG

B Tamoxifen Sac

P0 P14 P30-P40

C mG-OEC

63 Figure 2.7. Morphology of individual OECs and their morphometrics. A and B:

Individual OECs imaged in SeeDB-cleared OM after sparse-labeling. Length of OEC in B is

72 µm, which is representative of the average OEC length. Magnified view of OEC in inset.

B’: Z-stack of the OEC in B. B’’: 3D reconstruction of the OEC in B using Imaris software.

C: Boxplots of OEC length at various timepoints. D: Boxplots of surface area-to-volume ratio of OECs at various timepoints. No significant changes in OEC length and surface area- to-volume ratios were observed after MeBr lesion. Scale bar in A = 20 µm. Scale bar in B =

10 µm.

64 B’

A B

B’’

C D 140 3.0

120

2.0 100

80 1.5 Length (microns) 60 Surface Area-to-Volume Ratio Area-to-Volume Surface 1.0 40

Unlesioned 2DPL 5DPL 7DPL Unlesioned 2DPL 5DPL 7DPL

65 Figure 2.8. Isolation of OECs from adult PLP1-eGFP mice. A: FACS plot indicating

GFP-positive events (Region P5) and eGFP-negative events (Region P6) collected from

PLP1-eGFP mice. B and C: RT-PCR analysis showing relative quantity of OEC markers

(PLP1 and eGFP) and OSN markers (OMP and OE3) in sorted GFP-positive events, eGFP-negative events, and PLP1-eGFP whole mucosa. Data is normalized to whole mucosa from PLP1-eGFP mice. Higher expression of OEC markers in GFP-positive sorted population vs. the whole mucosa indicates enrichment of OECs. Error bars: 95% confidence interval.

66 A

GFP(+)

B C

60 OEC Markers 60 OSN Markers

50 50

40 40

30 30

20 20 Relative Quantity Relative Quantity Relative

10 10

0 0 Plp1 eGFP Plp1 eGFP Plp1 eGFP OMP O/E3 OMP O/E3 OMP O/E3 eGFP-(+) eGFP-(-) Whole eGFP-(+) eGFP-(-) Whole population population Mucosa population population Mucosa

67 Figure 2.9. Plp1 transcript expression in OECs. A: Visualization of mapped reads for

Plp1 transcript at various timepoints after MeBr lesion using IGV software. Alternative splicing of Exon 3B results in DM20. Exon 3 is boxed. Each row represents individual biological replicates. B: Bar graph showing TPM values of Plp1 gene at various timepoints after MeBr lesion. C: In situ hybridization on OM using full-length PLP1 probe showing

PLP1 mRNA expression in OECs in LP (arrows). Arrowhead shows basal lamina.

68 Alternatively-spliced exon A 3A 3B

Unlesioned

2 DPL

5 DPL

7 DPL

B C 2500 PLP1 - TPM Values n.s. 2000

1500

1000

500

2 DPL 5 DPL 7 DPL Unlesioned

69 Figure 2.10. Differentially-expressed genes in OECs after MeBr lesion. A: Log2 fold changes of all differentially-expressed genes in OECs at various timepoints after MeBr lesion

(selected based on a criteria). Green represents most upregulated genes. Red represents most downregulated genes. B: List of top 20 upregulated genes in OECs after MeBr lesion. C:

Table summarizing number of genes differentially expressed at each timepoint and the number of unique genes differentially expressed across all timepoints. D: List of top 20 downregulated genes in OECs after MeBr lesion.

70 A B Top 20 upregulated genes in OECs post-neuronal injury Average Fold Change Gene vs. 2 DPLvs. 5 DPLvs. 7 DPLAverage Gene Symbol Description Gzmb 10.06 6.83 8.44 (Log2) Chi3l4 6.57 6.68 7.64 6.96 Gzmb Granzyme B 8.44 Lrrc15 6.53 5.30 5.92 Prg4 7.29 4.33 5.81 Chi3l4 Chitinase-like 4 6.96 Mmp3 6.33 4.76 5.54 Syt6 6.61 4.26 5.43 Lrrc15 Leucine rich repeat containing 15 5.92 Lgals3 6.37 3.37 4.87 Cda 4.99 4.54 4.76 Prg4 Proteoglycan 4 5.81 Ngfr 4.46 4.40 4.43 Clca2 4.95 3.86 4.41 Mmp3 Matrix metallopeptidase 3 5.54 Gdf15 4.83 3.55 4.19 Serpina3n 5.27 3.80 3.15 4.07 Syt6 Synaptotagmin 6 5.43 Has2 4.40 3.27 3.83 Cd109 3.58 3.72 3.65 Lgals3 Lectin, galactoside-binding, soluble 3 4.87 Gpnmb 4.34 2.82 3.58 Prss56 4.93 2.23 3.58 Cda Cytidine deaminase 4.76 Gdnf 4.44 2.64 3.54 Clca1 3.86 3.14 2.83 3.28 Ngfr Nerve growth factor receptor 4.43 Spp1 4.53 2.97 2.18 3.22 Plaur 3.64 2.70 3.17 Clca2 Chloride Channel accessory 2 4.41 Myo16 3.58 2.62 3.10 Btc 2.70 3.41 3.05 Gdf15 Growth differentiation factor 15 4.19 Ucn2 3.66 2.43 3.05 Gadd45a 3.14 2.80 2.97 Serpina3n Serine (or cysteine) peptidase inhibitor, 4.07 Tnc 3.13 2.68 2.91 clade A, member 3N Clec4d 2.70 2.98 2.84 Cthrc1 2.72 2.83 2.78 Has2 Hyaluronan Synthase 2 3.83 Lcn2 2.86 2.34 2.60 Cd44 3.11 2.01 2.56 Cd109 Cluster Differention 109 3.65 Greb1 2.90 2.48 2.00 2.46 Runx2 2.53 2.29 2.41 Gpnmb Glycoprotein nmb 3.58 Sema4f 2.47 2.33 2.40 Klhl30 2.67 2.05 2.36 Prss56 Protease, serine 56 3.58 Shc4 2.63 2.01 2.32 Fstl4 2.68 1.88 2.28 Gdnf Glial cell line derived neurotropic factor 3.54 Fn1 2.58 1.83 2.20 Slitrk6 1.89 2.48 2.19 Clca1 Chloride channel accessory 1 3.28 Itga5 2.55 1.79 2.17 Ccl22 2.28 2.07 2.17 Spp1 Secreted phosphoprotein 1 3.22 Hilpda 2.39 1.91 2.15 Zfp57 2.42 1.82 2.12 Plaur Plasminogen activator, urokinase 3.17 Serpine1 2.29 1.88 2.08 receptor S100a4 2.67 1.49 2.08 Odz3 2.22 1.86 2.04 Postn 2.26 1.74 2.00 Slc2a9 2.89 1.01 1.95 C Ntng1 1.85 2.03 1.94 Fermt1 2.17 1.70 1.94 Col18a1 2.31 1.51 1.91 Cdh19 1.82 1.99 1.91 Serinc5 1.89 1.89 1.89 LOC100038947 2.38 1.36 1.87

Igf2bp2 2.48 1.25 1.86 Cd300lf 2.23 1.47 1.85 Igfp3 2.25 1.45 1.85 Sox10 1.84 1.78 1.81 Aebp1 2.34 1.25 1.79 Tns4 2.09 1.47 1.78 Bcl3 2.03 1.33 1.68 Itga2 2.14 1.65 1.19 1.66 Neat1 2.01 1.24 1.63 C4b 1.75 1.51 1.63 Csmd1 1.91 1.32 1.61 Nav2 1.99 1.20 1.60 Bhlhe40 1.70 1.47 1.59 Rhoc 1.95 1.18 1.56 Homer3 1.83 1.26 1.55 Cxcl10 1.59 1.44 1.51 Plekha4 1.65 1.31 1.48 D Inhba 1.82 1.14 1.48 Top 20 downregulated genes in OECs post-neuronal injury Scube1 1.66 1.26 1.46 Average Fold Change Ccl9 1.65 1.24 1.45 Gene Symbol Description Vat1l 1.68 1.20 1.44 (Log2) Gpr56 1.77 1.09 1.43 Ppp1r42 protein phosphatase 1, regulatory -3.35 D8Ertd82e 1.56 1.30 1.43 Plxnb3 1.68 1.11 1.39 subunit 42 Casp12 1.46 1.30 1.38 Kcnf1 potassium voltage-gated channel -3.23 Reln 1.73 1.02 1.38 modifier subfamily F member 1 Igsf10 1.45 1.30 1.37 Acbd7 acyl-CoA binding domain containing 7 -3.02 Runx3 1.54 1.14 1.34 Sorcs1 1.56 1.03 1.30 Pnmal1 paraneoplastic Ma antigen family-like 1 -2.92 Csrnp1 1.27 1.26 1.27 Plscr1 1.34 1.19 1.26 Sybu syntabulin -2.72 Frmd8 1.46 1.05 1.25 Plekhh3 1.23 1.25 1.24 Coch cochlin -2.30 Cebpd 1.17 1.29 1.23 Fcgr2b 1.45 1.00 1.23 Rgr retinal G protein coupled receptor -1.94 Atp10b 1.35 1.03 1.19 Tnip1 1.32 1.00 1.16 Rasgrp4 RAS guanyl releasing protein 4 -1.79 Asap3 1.20 1.06 1.13 Cyp2j9 1.18 1.06 1.12 Wdr78 WD repeat domain 78 -1.68 Src 1.11 1.03 1.07 Erbb2 1.09 1.02 1.06 Hepacam2 HEPACAM family member 2 -1.62 Nme3 -1.06 -1.02 -1.04 Gm15545 -1.07 -1.03 -1.05 Atp6v0c ATPase H+ transporting V0 subunit c -1.57 Rnls -1.12 -1.04 -1.08 Atp5s -1.04 -1.27 -1.16 Gm9958 -1.55 Htatp2 -1.19 -1.12 -1.16 Zfp78 -1.28 -1.16 -1.22 3010026O09Rik -1.16 -1.40 -1.28 Tspyl5 testis-specific protein, Y-encoded-like 5 -1.47 Sh3bgrl2 -1.73 -1.02 -1.37 Tctn2 -1.87 -1.04 -1.23 -1.38 Ccl27a chemokine (C-C motif) ligand 27A -1.44 Ccl27a -1.66 -1.21 -1.44 Tspyl5 -2.25 -1.02 -1.13 -1.47 Tctn2 tectonic family member 2 -1.38 Gm9958 -1.23 -1.87 -1.55 Atp6v0c -1.51 -1.63 -1.57 Sh3bgrl2 SH3 domain binding glutamic acid-rich -1.37 Hepacam2 -1.68 -1.94 -1.22 -1.62 protein like 2 Wdr78 -1.59 -1.76 -1.68 3010026O09Rik -1.28 Rasgrp4 -1.63 -1.96 -1.79 Rgr -2.62 -1.26 -1.94 Zfp78 zinc finger protein 78 -1.22 Coch -3.26 -2.02 -1.62 -2.30 Sybu -3.88 -1.68 -2.58 -2.72 Pnmal1 -2.96 -2.88 -2.92 Htatip2 HIV-1 Tat interactive protein 2 -1.16 Acbd7 -4.23 -2.09 -2.73 -3.02 Kcnf1 -3.91 -2.55 -3.23 Atp5s ATP synthase, H+ transporting, -1.16 Ppp1r42 -3.11 -3.60 -3.35 mitochondrial F0 complex, subunit S 71 Figure 2.11. RT-PCR analysis of expression of select upregulated genes in FACS- sorted OECs at various timepoints after MeBr lesion. Independent samples of FACS- sorted OECs were used for validation [minimum of 5 mice used per timepoint; pooled].

Relative quantity values were calculated for each gene using the delta-delta CT method. Data is normalized to the unlesioned timepoint. eGFP, marker of OECs, remained unchanged after MeBr lesion, however, Lgals3, Mmp3, and Spp1 were upregulated in sorted-OECs after

MeBr.

72 20.00 18.00 16.00 14.00 12.00 10.00 8.00

Relative Quantity Relative 6.00 4.00 2.00 0.00 2 DPL 5 DPL 7 DPL 2 DPL 5 DPL 7 DPL 2 DPL 5 DPL 7 DPL 2 DPL 5 DPL 7 DPL Unlesioned Unlesioned Unlesioned Unlesioned eGFP Lgals3 Mmp3 Spp1

73 Figure 2.12. Ngfr transcript upregulation in OECs after MeBr lesion. A: Visualization of mapped reads for Ngfr transcript at various timepoints after MeBr lesion using IGV software. Each row represents individual biological replicates. B: Bar graphs shows TPM values of NGFR genes at various timepoints after MeBr lesion. EBseq analysis showed that

Ngfr expression was significant upregulated at 2 and 5 DPL as indicated by the asterisks (*), but not 7 DPL. n.s. = not significant.

74 A

Unlesioned

2 DPL

5 DPL

7 DPL

B NGFR - TPM Values 350 * * n.s. 300

250

200

150

100

2 DPL 5 DPL 7 DPL Unlesioned

75 Figure 2.13. Validation of Ngfr gene upregulation in OECs after MeBr lesion. A: RT-

PCR analysis of NGFR expression shows upregulation in independent FACS-sorted OEC samples at various timepoints after MeBr injury [minimum of 5 mice used per timepoint; pooled]. B: In situ hybridization using Ngfr-specific riboprobe shows upregulation of NGFR transcript in OECs after MeBr lesion. Arrows show Ngfr expression in OECs at 2 DPL and

5 DPL.

76 A RT-PCR: NGFR 50.00 45.00 40.00 35.00 30.00 25.00 20.00 15.00 10.00 5.00 0.00

2 DPL 5 DPL 7 DPL Unlesioned

B Unlesioned 2 DPL

5 DPL 7 DPL

77 Figure 2.14. NGFR protein expression in OECs after MeBr lesion. Cross sections of

PLP1-eGFP OM at various lesion timepoints stained with anti-NGFR antibody.

Endogenous GFP (green) is expressed in OECs. NGFR immunoreactivity (red) is observed in LP (indicated by arrows) at 2 and 5 DPL. Nuclei are stained with DAPI. Arrowheads show basal lamina. Scale bar = 20 µm.

78 Merge PLP1-eGFP NGFR DAPI Unlesioned

A 2 DPL

B 5 DPL

C 7 DPL

79 REFERENCES Barraud P, Seferiadis AA, Tyson LD, Zwart MF, Szabo-Rogers HL, Ruhrberg C, Liu KJ,

Baker CV (2010) Neural crest origin of olfactory ensheathing glia. Proc Natl Acad

Sci U S A 107:21040-21045.

Chehrehasa F, Ekberg JA, Lineburg K, Amaya D, Mackay-Sim A, St John JA (2012) Two

phases of replacement replenish the olfactory ensheathing cell population after injury

in postnatal mice. Glia 60:322-332.

David S, Aguayo AJ (1981) Axonal elongation into peripheral nervous system "bridges" after

central nervous system injury in adult rats. Science 214:931-933.

Dickinson PJ, Griffiths IR, Barrie JM, Kyriakides E, Pollock GF, Barnett SC (1997)

Expression of the dm-20 isoform of the plp gene in olfactory nerve ensheathing

cells: evidence from developmental studies. Journal of neurocytology 26:181-189.

Doerflinger NH, Macklin WB, Popko B (2003) Inducible site-specific recombination in

myelinating cells. Genesis (New York, NY : 2000) 35:63-72.

Gaudet AD, Popovich PG, Ramer MS (2011) Wallerian degeneration: gaining perspective on

inflammatory events after peripheral nerve injury. J Neuroinflammation 8:110.

Graziadei PP, Graziadei GA (1979) Neurogenesis and neuron regeneration in the olfactory

system of mammals. I. Morphological aspects of differentiation and structural

organization of the olfactory sensory neurons. Journal of neurocytology 8:1-18.

Griffin JW, Thompson WJ (2008) Biology and pathology of nonmyelinating Schwann cells.

Glia 56:1518-1531.

Griffiths I, Klugmann M, Anderson CTT, Vouyiouklis D, Nave KA (1998) Current concepts

of PLP and its role in the nervous system. Microscopy Research and Technique

41:344-358.

80 Guerout N, Derambure C, Drouot L, Bon-Mardion N, Duclos C, Boyer O, Marie JP (2010)

Comparative gene expression profiling of olfactory ensheathing cells from olfactory

bulb and olfactory mucosa. Glia 58:1570-1580.

Huang da W, Sherman BT, Lempicki RA (2009a) Bioinformatics enrichment tools: paths

toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res

37:1-13.

Huang da W, Sherman BT, Lempicki RA (2009b) Systematic and integrative analysis of large

gene lists using DAVID bioinformatics resources. Nat Protoc 4:44-57.

Hudson LD, Berndt JA, Puckett C, Kozak CA, Lazzarini RA (1987) Aberrant splicing of

proteolipid protein mRNA in the dysmyelinating jimpy mutant mouse. Proc Natl

Acad Sci U S A 84:1454-1458.

Ibáñez CF, Simi A (2012) p75 neurotrophin receptor signaling in nervous system injury and

degeneration: paradox and opportunity. Trends in Neurosciences 35:431-440.

Kanageswaran N, Demond M, Nagel M, Schreiner BS, Baumgart S, Scholz P, Altmuller J,

Becker C, Doerner JF, Conrad H, Oberland S, Wetzel CH, Neuhaus EM, Hatt H,

Gisselmann G (2015) Deep sequencing of the murine olfactory receptor neuron

transcriptome. PLoS One 10:e0113170.

Ke MT, Fujimoto S, Imai T (2013) SeeDB: a simple and morphology-preserving optical

clearing agent for neuronal circuit reconstruction. Nature neuroscience 16:1154-

1161.

Lakatos A, Franklin RJ, Barnett SC (2000) Olfactory ensheathing cells and Schwann cells

differ in their in vitro interactions with astrocytes. Glia 32:214-225.

81 Leng N, Dawson JA, Thomson JA, Ruotti V, Rissman AI, Smits BMG, Haag JD, Gould

MN, Stewart RM, Kendziorski C (2013) EBSeq: An empirical Bayes hierarchical

model for inference in RNA-seq experiments. Bioinformatics.

Leone DP, Genoud S, Atanasoski S, Grausenburger R, Berger P, Metzger D, Macklin WB,

Chambon P, Suter U (2003) Tamoxifen-inducible glia-specific Cre mice for somatic

mutagenesis in oligodendrocytes and Schwann cells. Mol Cell Neurosci 22:430-440.

Li B, Dewey CN (2011) RSEM: accurate transcript quantification from RNA-Seq data with

or without a reference genome. BMC Bioinformatics 12:323.

Li Y, Field PM, Raisman G (2005) Olfactory ensheathing cells and olfactory nerve

fibroblasts maintain continuous open channels for regrowth of olfactory nerve

fibres. Glia 52:245-251.

Mallon BS, Shick HE, Kidd GJ, Macklin WB (2002) Proteolipid Promoter Activity

Distinguishes Two Populations of NG2-Positive Cells throughout Neonatal Cortical

Development. The Journal of Neuroscience 22:876-885.

Meeker R, Williams K (2014) Dynamic nature of the p75 neurotrophin receptor in response

to injury and disease. J Neuroimmune Pharmacol 9:615-628.

Meeker RB, Williams KS (2015) The p75 neurotrophin receptor: at the crossroad of neural

repair and death. Neural Regen Res 10:721-725.

Muzumdar MD, Tasic B, Miyamichi K, Li L, Luo L (2007) A global double-fluorescent Cre

reporter mouse. Genesis (New York, NY : 2000) 45:593-605.

Nazareth L, Lineburg KE, Chuah MI, Tello Velasquez J, Chehrehasa F, St John JA, Ekberg

JA (2015) Olfactory ensheathing cells are the main phagocytic cells that remove axon

debris during early development of the olfactory system. J Comp Neurol 523:479-

494.

82 Rao M, Nelms BD, Dong L, Salinas-Rios V, Rutlin M, Gershon MD, Corfas G (2015)

Enteric glia express proteolipid protein 1 and are a transcriptionally unique

population of glia in the mammalian nervous system. Glia.

Reichert F, Saada A, Rotshenker S (1994) Peripheral nerve injury induces Schwann cells to

express two macrophage phenotypes: phagocytosis and the galactose-specific lectin

MAC-2. J Neurosci 14:3231-3245.

Rela L, Bordey A, Greer CA (2010) Olfactory ensheathing cell membrane properties are

shaped by connectivity. Glia 58:665-678.

Rela L, Piantanida AP, Bordey A, Greer CA (2015) Voltage-dependent K+ currents

contribute to heterogeneity of olfactory ensheathing cells. Glia 63:1646-1659.

Rieger A, Deitmer JW, Lohr C (2007) Axon-glia communication evokes calcium signaling in

olfactory ensheathing cells of the developing olfactory bulb. Glia 55:352-359.

Robinson JT, Thorvaldsdottir H, Winckler W, Guttman M, Lander ES, Getz G, Mesirov JP

(2011) Integrative genomics viewer. Nat Biotechnol 29:24-26.

Roet KC, Verhaagen J (2014) Understanding the neural repair-promoting properties of

olfactory ensheathing cells. Exp Neurol 261:594-609.

Rotshenker S (2009) The role of Galectin-3/MAC-2 in the activation of the innate-immune

function of phagocytosis in microglia in injury and disease. J Mol Neurosci 39:99-

103.

Schwob JE, Youngentob SL, Mezza RC (1995) Reconstitution of the rat olfactory epithelium

after methyl bromide-induced lesion. J Comp Neurol 359:15-37.

Schwob JE, Youngentob SL, Ring G, Iwema CL, Mezza RC (1999) Reinnervation of the rat

olfactory bulb after methyl bromide‐induced lesion: Timing and extent of reinnervation. Journal of Comparative Neurology 412:439-457.

83 Sirko S, Irmler M, Gascón S, Bek S, Schneider S, Dimou L, Obermann J, De Souza Paiva D,

Poirier F, Beckers J, Hauck SM, Barde Y-A, Götz M (2015) Astrocyte reactivity after

brain injury—: The role of galectins 1 and 3. Glia 63:2340-2361.

Su Z, Chen J, Qiu Y, Yuan Y, Zhu F, Zhu Y, Liu X, Pu Y, He C (2013) Olfactory

ensheathing cells: the primary innate immunocytes in the olfactory pathway to engulf

apoptotic olfactory nerve debris. Glia 61:490-503.

Tabakow P, Jarmundowicz W, Czapiga B, Fortuna W, Miedzybrodzki R, Czyz M, Huber J,

Szarek D, Okurowski S, Szewczyk P, Gorski A, Raisman G (2013) Transplantation

of autologous olfactory ensheathing cells in complete human spinal cord injury. Cell

Transplant 22:1591-1612.

Tello Velasquez J, Watts ME, Todorovic M, Nazareth L, Pastrana E, Diaz-Nido J, Lim F,

Ekberg JA, Quinn RJ, St John JA (2014) Low-dose curcumin stimulates

proliferation, migration and phagocytic activity of olfactory ensheathing cells. PLoS

One 9:e111787.

Thorvaldsdottir H, Robinson JT, Mesirov JP (2013) Integrative Genomics Viewer (IGV):

high-performance genomics data visualization and exploration. Brief Bioinform

14:178-192.

Thyssen A, Stavermann M, Buddrus K, Doengi M, Ekberg JA, St John JA, Deitmer JW,

Lohr C (2013) Spatial and developmental heterogeneity of calcium signaling in

olfactory ensheathing cells. Glia 61:327-337.

Williams SK, Franklin RJ, Barnett SC (2004) Response of olfactory ensheathing cells to the

degeneration and regeneration of the peripheral olfactory system and the

involvement of the neuregulins. J Comp Neurol 470:50-62.

84 Woolf CJ, Reynolds ML, Chong MS, Emson P, Irwin N, Benowitz LI (1992) Denervation of

the motor endplate results in the rapid expression by terminal Schwann cells of the

growth-associated protein GAP-43. J Neurosci 12:3999-4010.

Zhang Y, Chen K, Sloan SA, Bennett ML, Scholze AR, O'Keeffe S, Phatnani HP, Guarnieri

P, Caneda C, Ruderisch N, Deng S, Liddelow SA, Zhang C, Daneman R, Maniatis T,

Barres BA, Wu JQ (2014) An RNA-sequencing transcriptome and splicing database

of glia, neurons, and vascular cells of the cerebral cortex. J Neurosci 34:11929-11947.

CHAPTER 3

EFFECTS OF OEC ABLATION ON WHOLE MUCOSA AND OLFACTORY SENSORY NEURONS

INTRODUCTION In Chapter 2, we examined the changes in OEC properties following OSN loss and during its subsequent regeneration, and observed that OECs remain largely unaffected following MeBr-induced OSN injury. In this chapter, we explored the complementary question to Chapter 2, i.e. what is the effect of OEC loss on OSNs?

The effect of OEC loss has never been explored. From our studies in Chapter 2, we concluded that OECs might play a role in maintaining a steady growth-permissive environment for OSNs. Therefore, we wondered about the effects of disrupting this homeostatic relationship by depleting OECs. We also asked whether depleting a portion of the OECs would induce changes in the OSN molecular profile. In the process of examining changes in OSNs, we could further our understanding of OEC biology by observing changes in the remaining OEC population. We hypothesized that OEC depletion would disrupt the mucosal environment and subsequently, adversely affect OSN.

To study the effects of OEC loss, we conditionally-ablated OECs by driving the expression of an attenuated version of diphtheria toxin chain A (DTA) in OECs using the

PLP1-CreER mouse line. DTA, an enzyme that inactivates elongation factor 2 (EF2) (Honjo et al., 1968, Van Ness et al., 1980), leads to cessation of protein production followed by cell death. DTA176, an attenuated version of DTA discovered via mutagenesis, is a result of a missense mutation, which leads to reduced enzymatic activity (Uchida et al., 1973,

Yamaizumi et al., 1978). This is apparent in the number of DTA molecules that are needed to kill a cell. For example, only one molecule of DTA in the cytoplasm is sufficient to kill a

87 cell (Yamaizumi et al., 1978); however, 100-200 DTA176 molecules are needed to kill a cell

(Maxwell et al., 1987). Using DTA176 was therefore advantageous because it prevented any cell ablation due to leaky DTA176 expression.

In this chapter, we describe establishment of appropriate mouse lines and paradigm for OEC ablation in vivo. Following OEC ablation, we analyzed proliferation in the mucosa, and analyzed the molecular profile of OSNs. As in Chapter 2, our aim was to study in the effects in vivo, therefore, the OSNs were also directly sorted from the mucosa for transcriptome analysis.

MATERIALS AND METHODS

Mice

ROSA26-DTA176 knock-in mouse line has been described (Wu et al., 2006), and was obtained from Jackson Laboratories (USA). In this mouse line, sequence of DTA176, an attenuated version of diphtheria toxin A chain (DTA), is placed downstream of a loxP- flanked STOP cassette in the ROSA26 locus. When crossed to a Cre recombinase expressing mouse line, this loxP-flanked STOP cassette is excised, leading to DTA176 expression.

OE3-EGFP (knock-in) mouse line has been described previously (Wang et al., 2004). In this mouse line, EGFP expression marks immature and mature OSNs.

Olfactory tissue preparation for immunostaining

Mice were killed by an overdose of Avertin (IP injection), transcardially perfused with cold

PBS followed by cold 4% paraformaldehyde (4% PFA). The heads were post-fixed overnight in 4% PFA. Next, the heads were cryoprotected and decalcified in 30% sucrose/250 mM EDTA (DEPC-treated) solution for 48 hours. The heads were embedded in OCT (Tissuetek), and frozen in liquid nitrogen. The tissue OCT blocks were sectioned on a cryostat (Microm). All tissue sections (14-20 µm thick) were placed on charged glass slides and stored at -80C.

Tissue Dissociation for Fluorescence Activated cell Sorting of OSNs

OSNs were sorted directly from olfactory mucosa of OE3-EGFP;PLP1-CreER;

ROSA-DTA176 mice. Briefly, mice were killed by CO2 inhalation and decapitated. The heads were opened parallel to the septum and immediately placed in cold DMEM/F12 media. The olfactory mucosa was dissected off the septum and placed in cold low-calcium

1 mM CaCl2, 1 mM MgCl2, 10 mM HEPES, 10 mM Glucose)] was added and incubated for

30 minutes in a 37C water bath. Following enzymatic digestion, the tissue was triturated with a P1000 tip, filtered through a 40 µm filter, spun down, and resuspended in 0.5%

BSA/HBSS/DNaseI solution. 7AAD dye was added to the cell suspension to mark the non- viable cells. eGFP-(+) and 7AAD-(-) cells were collected directly from the BD FACSJazz cell sorter into RNA lysis buffer (Buffer RLT, QIAGEN).

Tamoxifen preparation and administration for OEC ablation

Tamoxifen was initially partially dissolved in 100 µl of 100% ethanol. Warm sunflower seed oil (~65C) was then added to fully dissolve tamoxifen at final concentration of 20 mg/ml.

For OEC ablation, PLP1-eGFP;PLP1-CreER;ROSA-DTA176 and OE3-GFP; PLP1-

CreER;ROSA-DTA176 mice (age ~P14) were injected with the tamoxifen solution (2 mg/100 µl/pup, IP injection), and killed five days later.

RNA isolation

Total RNA from sorted OSNs was isolated using RNeasy Micro Kit (QIAGEN, USA) using

90 manufacturer’s protocol. The quality and the concentration of RNA were analyzed using

Agilent Bioanalyzer. Total RNA from whole olfactory mucosa was isolated using RNeasy

Mini Kit (QIAGEN, USA) according to manufacturer’s protocol.

EdU Labeling and cell counting

Mice were injected with EdU (50 mg EdU/kg body weight, IP injection) and sacrificed two hours later. Olfactory tissue sections (14-20 µm) were stained for EdU using EdU click-iT

Imaging kit (Thermo Scientific, USA). Images were acquired on a Zeiss 780 inverted confocal microscope (Zeiss, Germany). EdU-labeled cells in the LP were counted along the dorsal septum (300 µm) in multiple sections from approximately the same regions of the olfactory tissue.

Immunofluorescence

PFA-fixed tissue sections were permeabilized in Buffer B1 (0.5% Triton X-100/PBS) and blocked (10% normal goat serum in B1) before overnight incubation with anti-Ki67 [Sp6]

(Abcam) primary antibody. AlexaFluor secondary antibodies were used to visualize immunoreactivity, and sections were exposed briefly to DAPI for counterstaining nuclei before mounting

RNAseq

Total RNA isolated from OSNs from OE3-EGFP;PLP1-CreER;ROSA26-DTA176 mice

(n=3) and OE3-EGFP mice (n=3, control) were used. cDNA libraries for RNAseq were generated by the Johns Hopkins Deep Sequencing and Microarray core facility using Nugen

RNAseq kit. The samples were sequenced on Illumina NextSeq 500. For each sample, we

91 obtained ~32 million 75 bp, single-end reads.

RNAseq data was analyzed using RSEM (1.2.29) (Li and Dewey, 2011). Reads were aligned to mouse genome (mm10). EBseq module of RSEM was used for differential gene expression analysis (Leng et al., 2013). We used a false discovery rate of 0.05 to identify differentially expressed genes. After obtaining a list of differentially-expressed genes, we selected for genes with Posterior Probability of Differential Expression (PPDE) greater than

0.99999.

RESULTS Depletion of OECs in Lamina Propria

The depletion of OSNs during MeBr lesion is associated with only modest changes in OECs.

Specifically, the absence of OEC proliferation, accompanied by largely unaltered morphology, and molecular profile suggests that OECs are responsible for a stable axonal environment. We next sought to examine the effects of OEC depletion on OSNs and the olfactory mucosa. To selectively deplete the OEC population in the LP, we initially established a PLP1-eGFP, PLP1-CreER, and

ROSA-DTA176 expressing mouse line. In the PLP1-eGFP;PLP1-CreER;ROSA-DTA176 mouse line (“PGCD”), the PLP1-eGFP transgene permitted OEC visualization; PLP1-CreER, in the presence of tamoxifen, directed expression of an attenuated diphtheria toxin A chain (DTA176) upon tamoxifen administration in OECs (Maxwell et al., 1987, Wu et al., 2006). This is the first study to report OEC depletion in mice, and to study the effects of OEC depletion on the olfactory mucosal tissue.

The goal of these experiments was to efficiently induce DTA176 expression with a relatively large dosage of tamoxifen in P14 mice, since tamoxifen-mediated recombination is much more efficient in younger animals. To accomplish this goal, we evaluated several conditions to ablate

OECs. PLP1-CreER driven expression of DTA176 in other glial cell types (e.g. Schwann cells and oligodendrocytes) restricted the experimental window for these experiments. For example, we were able to deplete a portion of OECs - as assessed by the absence of eGFP-positive cells - in the LP after injecting a relatively large dose of tamoxifen at P14 and sacrificing seven days later (Figure

3.1A, 3.1B). However, by the end of this experiment, the health of the mice showed signs of impairment. Tamoxifen-induced recombination is much more efficient in the brain, therefore, we observed ablation of a significant portion of OECs in the OB-ONL; this accounts for the absence

93 of eGFP signal (Figure 3.1C, 3.1D). By administering a single dose of tamoxifen at ~P14, and subsequently sacrificing pups five, instead of seven, days later, we were still able to successfully deplete a portion of the OEC population while reducing the severity of health issues in injected mice

(Figure 3.2). We assessed OEC ablation by also analyzing PLP1 transcript levels by RT-PCR in whole mucosa of tamoxifen-injected PLP1-CreER(+)/DTA176(+) mice and control mice (PLP1-

CreER and/or DTA176-negative). The Plp1 transcript expression level was much lower in

PLP1-CreER(+)/DTA176(+) mice compared to the PLP-CreER(-)/DTA176(-) control mouse, indicating loss of OECs (Figure 3.3). Levels of O/E3 and OMP, which are OSN markers, however, did not change in PLP1-CreER(+)/DTA176(+) mice compared to control mice. This result indicates that at the message level, OEC ablation has little to no effect on OMP and O/E3 expression levels.

Effect of OEC ablation on whole mucosa

We wanted to examine the effects of OEC depletion on the olfactory mucosa, including the remaining OECs. While a fraction of the OEC population in LP was ablated, the thickness and structure of OE appeared normal overall, regardless of the dose of tamoxifen administered and the length of time after tamoxifen administration (Figure 3.1A, 3.1B, 3.2A, 3.2B, DAPI channel). We asked whether OEC proliferation took place in PCGD mice after tamoxifen administration.

Therefore, PCGD were administered an EdU dose two hours prior to their sacrifice at various times after tamoxifen administration. We stained OM from these mice for EdU to label proliferating

OECs. The OM was also stained with Ki67 to confirm the results. We noticed EdU/Ki67 signal was present in the nuclei of eGFP-positive cells in the LP of these PCGD mice, which indicated proliferation of OECs (Figure 3.4A). Subsequently, we quantified OEC proliferation in a PCGD mouse and its control that were injected with tamoxifen at ~P14 and sacrificed five days later. We

94 counted the number of EdU/Ki67-labeled cells (eGFP-positive and –negative) in the LP along a specific 300 µm long region of the septum in multiple sections. Our preliminary data showed that in the PCGD mouse, an average of 6.4 Ki67/EdU-labeled cells per section were observed in the LP

(number of sections analyzed = 14) (Figure 3.4B). Of these labeled cells in the LP, an average of

4.9 cells per section (76.9%) were also GFP-positive, indicating that most of the proliferating cells were OECs. In the control mouse (PLP1-CreER(-); DTA176(+);PLP1-eGFP(+)), we observed an average of 1.8 Ki67/EdU-labeled cells per section in the LP (number of sections analyzed = 8).

However, only 1 out of 15 Ki67/EdU-labeled cells was also GFP-positive (Figure 3.4B). These data indicate that (1) significantly more proliferation in LP takes place in PCGD mouse compared to the control mouse and that (2) the majority of these proliferating cells are eGFP-expressing OECs.

We also noticed more Ki67/EdU-labeled OECs in mice administered a higher amount of tamoxifen

(data not shown). Interestingly, EdU-labeled GFP-positive OECs in the OB olfactory nerve layer

(ONL) were also observed (Figure 3.4C). These results are in sharp contrast to the results of our

EdU-pulse experiment in the previous chapter, which showed that OSN loss does not induce OEC proliferation. In conclusion, depletion of a portion of the OEC population leads to proliferation of the remaining OECs.

Analysis of OSN transcriptome after OEC ablation

Although the OE appeared normal visually, we wanted to investigate whether OEC depletion led to changes in OSNs at the transcriptome level. We utilized an OE3-eGFP reporter mouse line in which all OSN and their precursors express eGFP (Wang et al., 2004) to isolate OSNs for transcriptome analysis via RNAseq after OEC depletion. We crossed the OE3-eGFP transgenic mouse line to PLP1-CreER;DTA176 mouse line, resulting in OE3-eGFP;PLP1-CreER;DTA176

(OPD) mouse line (Figure 3.5A). Using OPD mice, we were able to drive the expression of

DTA176 using PLP1-CreER, leading to OEC depletion, and subsequently, sort GFP-positive OSNs via FACS (Figure 3.5B). The experimental paradigm is presented in Figure 3.5A. OSNs sorted from tamoxifen-injected OE3-eGFP-(positive)/PLP1-CreER- (negative)/DTA176-(negative) mice were used as controls.

Our RNAseq data analysis showed that OE3-eGFP-(+) OSNs isolated from control and

OPD mice expressed about 75-77% genes in the mouse genome reference database (UCSC version mm10; selected for genes with TPM ≥ 0.01). Next, EBseq was used to determine differentially expressed genes. Our analysis showed that very few genes were up-/downregulated in OSNs after

OEC depletion (total = 74 genes or ~0.42% of all of the expressed genes) (Figure 3.6). Of these genes, the number of upregulated genes was roughly equal to the number of downregulated genes.

In terms of the extent of fold change relative to control, changes were modest in OSNs after OEC ablation, with the highest change of roughly 5.5x (upregulation) and the lowest change of roughly

11.5x (downregulation). KEGG pathway analysis (DAVID) showed that the majority of the differentially-expressed (DE) genes were involved in the olfactory transduction pathway (i.e. olfactory receptor and similar genes). The DE genes were classified further based on gene ontology

(DAVID). The most enriched molecular function (MF) GO terms were: olfactory receptor activity, microtubule binding, tubulin binding, and microtubule motor activity. The top cellular components

(CC) terms were: cell projection part and microtubule cytoskeleton. Lastly, among the top enriched biological process (BP) terms were to sensory perception-related processes, cell surface receptor linked signal transduction, and neurological system process. Enriched GO terms are summarized in

Tables 3.1-3.3.

Among the DE genes, we identified neuregulin1 (Nrg1) as one of the upregulated genes in OSNs after OEC depletion. NRG1 is known to act as an axonal signal that plays an

96 important role in regulating many aspects of Schwann cell biology, including development, axon ensheathment, and myelin thickness (Birchmeier and Nave, 2008) via receptor tyrosine kinases ErbB receptors expressed on Schwann cell surface. While there are other isoforms of

Nrg1, Type III Nrg1 is the predominant isoform that is expressed in sensory neurons, such as OSNs (Meyer et al., 1997, Parodi and Kuhn, 2014). We observed that Nrg1 expression is almost in the top 5% of the most abundantly expressed genes (of all genes with TPM ≥

0.01); therefore, it is relatively highly expressed in FACS-sorted OSNs from control mice.

After OEC ablation, however, Nrg1 expression significantly increases in OSNs in OPD mice by 1.7x. On the other hand, OMP expression stays unchanged after OEC ablation. In conclusion, OSN transcriptome undergoes minor but perhaps important changes after OEC ablation.

DISCUSSION

In this chapter, we explored the LP-OEC biology further by genetically-ablating a portion of the OEC population. To the best of our knowledge, this is the first study to conditionally-ablate OECs and study its effect on the OM. To ablate OECs, we created mouse lines in which PLP1-CreER drove the expression of DTA176, an attenuated form of

DTA, after tamoxifen administration. We created two mouse lines: one for visualizing OECs

(PCGD mouse line) and another one for FACS-sorting OSNs (OPD mouse line) after OEC ablation. Using this strategy, we were able to successfully ablate a portion of OEC population in LP. A disadvantage of these mouse lines was that PLP1-CreER expression was not restricted to OECs. Therefore, after tamoxifen-induced recombination, other PLP1-

CreER-positive cells (such as oligodendrocytes in the brain, Schwann cells around motor neurons, ENS glial cells, etc.) also expressed DTA176 and died shortly after as a result, leading to overall health problems in mice. This severely restricted our experimental timeframe. In the future, using our RNAseq data from the previous chapter to determine an

OEC-specific marker and subsequently, establishing an OEC-specific promoter driven

CreER mouse line may resolve this issue of widespread glial death. Nonetheless, we were able to observe effects of OEC ablation on OM with the use of PLP1-CreER mouse line.

Using the PCGD mice, we noticed that OEC ablation led to proliferation of some of the remaining OECs in the LP. LP-OEC proliferation will have to be quantified in more

PCGD mice in the future. Presence of EdU-labeled GFP(+) cells in the ONL of OB may indicate that OB-OECs are also able to proliferate after OEC ablation. Additionally, we observed more proliferating OECs in the olfactory nerve compared to the LP perhaps due to higher recombination efficiency in the olfactory nerve and/or due to the presence of higher number of OEC per unit area. This data is important because, in contrast to their

98 resilient properties observed after OSN loss, OECs are indeed capable of proliferating. Our data suggests that OECs in young mice (~P19) re-enter the cell cycle to possibly close the gap in the conduit created by the loss of surrounding OECs. This observation also suggests that OECs are capable of sensing loss of neighboring OECs. This “quorum sensing” property of OECs possibly explains its proliferation after depletion and suggests that a role of OECs is to maintain a homeostatic environment in order to allow for continual OSN regeneration. However, our observations raise several questions such as: What are the molecular events that trigger OEC proliferation? What is the fate of these proliferating

OECs? How does the depletion of OECs affect OSN regeneration after an injury?

Unfortunately, due to the short examination window after the induction of DTA176 expression, we were not able to answer these questions. Further experiments will have to be conducted to explore these questions. Future studies can examine transcriptome of these proliferating OECs to shed more light on the process of OEC proliferation after their ablation.

Lastly, we examined the transcriptome of OSNs FACS-sorted from OPD after OEC ablation. Because Cre-recombination in OM is relatively more efficient in younger mice compared to adult mice, we decided to inject a single large dose of tamoxifen around P14, and then sacrificed mice five days later for examination before severe health issues emerged.

The changes in OSN transcriptome were modest after OEC ablation. This could arise because axon fascicles of adult mouse OSNs travel long distances (~4-5 mm) from the nasal cavity to the OB and are ensheathed by hundreds of OECs. The depletion of a small fraction of OECs at variable intervals along the fascicles might not lead to major OSN gene expression changes. Therefore, depletion of a large enough fraction of the total OEC population may have resulted in a robust change in OSN transcriptome. Examining the

OSN transcriptome at a longer timepoint could have also led us to observe more pronounced changes. Nonetheless, upregulation of Nrg1 transcript in OSNs after OEC ablation suggests that there are consequences in OSNs of OEC depletion, especially since

NRG1 has been implicated in many aspects of Schwann cell biology – from development to nerve repair.

NRG1 is a protein that is expressed on axonal surface. There are multiple isoforms of the Nrg1 gene, but type III isoform predominates in neurons projecting in PNS. NRG1 signals via ErbB2/ErbB3 heterodimer receptors present on Schwann cell surface, and activates multiple downstream signaling pathways that control various Schwann cell processes (Birchmeier and Nave, 2008). One of the processes controlled by Nrg1 type III isoform is Schwann cell proliferation (Maurel and Salzer, 2000). Since NRG1 type III is the main isoform expressed in OSNs also, our RNAseq data suggests that perhaps Nrg1 upregulation promotes OEC proliferation as observed in PCGD mice, which then increases ensheathment of axon fascicles. Since NRG1 signals via ErbB receptors, we examined ErbB receptor levels in OECs in unlesioned mice using our RNAseq data from Chapter 2 (Figure

2.10A). There are four types of ErbB receptors: EGFR, ErbB2, ErbB3, and ErbB4. Of these four ErbB receptors, ErbB4 was not expressed in sorted LP-OECs. The rest of the ErbB receptors had modest expression, with EGFR having the highest relative expression. After

MeBr lesion, only ErbB2 is significantly upregulated (Chapter 2 Figure 2.10A) at 2 and 5

DPL when the least number of mature OSNs are present. It is possible that NRG1 type III isoform signals via ErbB2/3 receptors on OECs. Therefore, the increase in NRG1 levels in

OSN after OEC ablation raises the question whether ErbB receptor expression in OECs also increases. Similarly, after MeBr lesion, ErbB2 upregulation might lead to an increase in

100

Nrg1 expression in OSNs. In the future, the role of Nrg1/ErbB signaling in the context of loss of OECs will have to be explored further to gain a better understanding of OECs.

101

Table 3.1. List of enriched Biological Process (BP) Gene Ontology terms in OSNs after OEC ablation (all terms with p-value equal or greater than 0.05 shown).

% of DE Term Count P-value Genes genes (n=74) OLFR411, LDB1, OLFR849, OLFR875, ITGA4, GO:0007166 OLFR139, OLFR749, OLFR791, CTNNB1, OLFR446, cell surface receptor linked 22 30.55555556 1.25E-04 UBE2N, TAAR9, OLFR1042, OLFR924, MACF1, signal transduction OLFR635, OLFR368, OLFR1047, NRG1, OLFR1037, OPRD1, OLFR1152 OLFR411, OLFR849, OLFR875, OLFR139, OLFR749, GO:0007608 14 19.44444444 1.81E-04 OLFR791, OLFR446, OLFR924, OLFR1042, OLFR635, sensory perception of smell 102 OLFR368, OLFR1047, OLFR1037, OLFR1152 GO:0007606 OLFR411, OLFR849, OLFR875, OLFR139, OLFR749, sensory perception of chemical 14 19.44444444 3.44E-04 OLFR791, OLFR446, OLFR924, OLFR1042, OLFR635, stimulus OLFR368, OLFR1047, OLFR1037, OLFR1152 OLFR411, OLFR849, OLFR875, OLFR139, OLFR749, GO:0050877 OLFR791, CTNNB1, OLFR446, OLFR924, OLFR1042, 16 22.22222222 9.41E-04 neurological system process OLFR635, OLFR368, OLFR1047, NRG1, OLFR1037, OLFR1152 OLFR411, OLFR849, OLFR875, OLFR139, OLFR749, GO:0007600 14 19.44444444 0.001596783 OLFR791, OLFR446, OLFR924, OLFR1042, OLFR635, sensory perception OLFR368, OLFR1047, OLFR1037, OLFR1152 OLFR411, OLFR849, OLFR875, OLFR139, OLFR749, GO:0050890 14 19.44444444 0.002602036 OLFR791, OLFR446, OLFR924, OLFR1042, OLFR635, cognition OLFR368, OLFR1047, OLFR1037, OLFR1152 OLFR411, OLFR849, OLFR875, OLFR139, OLFR749, GO:0007186 OLFR791, OLFR446, OLFR924, OLFR1042, TAAR9, G-protein coupled receptor 16 22.22222222 0.002886364 OLFR635, OLFR368, OLFR1047, OLFR1037, OPRD1, protein signaling pathway OLFR1152 GO:0007018 4 5.555555556 0.006410781 KIF5B, KIF19A, DNAHC11, DST microtubule-based movement GO:0006281: DNA repair 5 6.944444444 0.009512222 UBE2N, REV1, RAD21, PRKDC, REV3L GO:0006301 2 2.777777778 0.014930573 UBE2N, REV1 postreplication repair GO:0006974: response to 5 6.944444444 0.022395139 UBE2N, REV1, RAD21, PRKDC, REV3L DNA damage stimulus GO:0000902 5 6.944444444 0.028390328 ARHGEF2, MACF1, NRG1, DST, CTNNB1 cell morphogenesis GO:0007369: gastrulation 3 4.166666667 0.031418279 MACF1, LDB1, CTNNB1 GO:0032989: cellular 5 6.944444444 0.042286299 ARHGEF2, MACF1, NRG1, DST, CTNNB1 component morphogenesis GO:0007017

103 4 5.555555556 0.044602802 KIF5B, KIF19A, DNAHC11, DST microtubule-based process GO:0006928: cell motion 5 6.944444444 0.048439562 MACF1, PRKDC, DNAHC11, ITGA4, NRG1

Table 3.2. List of all enriched Molecular Functions (MF) Gene Ontology terms in OSNs after OEC ablation.

% of DE Term Count genes p-value Genes (n=74) OLFR411, OLFR849, OLFR875, OLFR139, OLFR749, GO:0004984~olfactory 14 19.44444444 4.84E-04 OLFR791, OLFR446, OLFR924, OLFR1042, OLFR635, receptor activity OLFR368, OLFR1047, OLFR1037, OLFR1152 GO:0008017~microtubule 4 5.555555556 0.001932976 ARHGEF2, MACF1, KIF5B, DST binding GO:0015631~tubulin 4 5.555555556 0.003617307 ARHGEF2, MACF1, KIF5B, DST binding

104 GO:0003777~microtubule 3 4.166666667 0.0354509 KIF5B, KIF19A, DNAHC11 motor activity

Table 3.3. List of all enriched Cellular Components (CC) Gene Ontology terms in OSNs after OEC ablation.

% of DE genes Term Count p-value Genes (n=74) GO:0044463~cell projection part 4 5.555555556 0.027322371 ARHGEF2, KIF5B, DNAHC11, CTNNB1 GO:0015630~microtubule ARHGEF2, MACF1, KIF5B, KIF19A, 6 8.333333333 0.028394771 cytoskeleton DNAHC11, DST

Figure 3.1. OEC ablation in the LP and the OB seven days after tamoxifen administration. Tamoxifen was injected at P14 and the mice were analyzed seven days later at P21. OEC ablation was assessed by the absence of GFP expression. A: Septum of a P21 control mouse (PLP1-eGFP; uninjected). B: Septum of a tamoxifen-administered PCGD mouse at P21 from approximately the same region as in A. C: Olfactory bulb (OB) of the control mouse showing the glomerular cell layer (GCL) and the olfactory nerve layer (ONL)

(separated by a dashed line). OB-OECs (GFP) are present in the ONL. D: OB of the PCGD mouse in B. Absence of GFP signal indicates loss of OECs in the ONL. Nuclei are stained with DAPI (Blue). Asterisks (*) indicate a few regions devoid of OECs. Arrowheads represent basal lamina. Scale bar = 50 µm.

105

Tamoxifen Sac

P0 P14 P21

P21

Control PCGD

* * A B

OB OB *

GCL ONL GCL ONL *

* C D

106 Figure 3.2. OEC ablation in the LP five days after tamoxifen administeration.

Tamoxifen was injected at P14 and the mice were analyzed at P19. OEC ablation was assessed by the absence of GFP signal. A: Septum of a control mouse at P19 (PLP1-eGFP; uninjected). A’: Magnified view of the region highlighted in the red box in A. B: Septum of a

PCGD mouse from a similar region as in A. B’: Magnified view of the region highlighted by the red box in B. Circles indicate fascicles. Encircled fascicle in B' is devoid of OECs. Nuclei were stained with DAPI (blue). Scale bars in A & B = 50 µm. Scale bars in A’ and B’ = 20

µm.

107

Tamoxifen Sac

P0 ~P14 ~P19

P19 Control PCGD

A’ B’

A B

A’ B’

108 Figure 3.3. RT-PCR analysis of key OSN and OEC marker expression in whole mucosa after OEC ablation. Expression of O/E3 and OMP (markers of OSNs) and PLP1

(marker of OECs) was assessed in whole mucosa obtained from PLP1-CreER/DTA176- positive mice (n =2) and control mice (PLP1-CreER and/or ROSA26-DTA176 negative) (n

= 2). These mice were injected with tamoxifen at P14 and sacrificed five days later. Relative

quantity was calculated using the delta-delta CT method. For each gene, data was normalized to the PLP1-CreER(-)/DTA176(-) negative mouse. Plp1 expression was lower in PLP1-

Cre(+)/DTA(+) mice, indicating OEC ablation. OSN marker expression remained unchanged.

109

1.20

1.00

0.80

0.60

0.40 Relative Quantity Relative 0.20

0.00 + + + _ + + + _ + + + _ PLP1-CreER ______ROSA26-DTA176 + + + + + +

O/E3 OMP PLP1

110 Figure 3.4. OEC proliferation after OEC ablation. A: OEC proliferation was assessed by

EdU labeling of OM from a PCGD mouse (tamoxifen injection P14; analyzed five days later at P19). EdU-labeled cells are indicated in red. OECs are marked by GFP expression (PLP1- eGFP; green). Nuclei are stained with DAPI (blue). Arrows represent EdU-labeled OECs.

Arrowheads represent basal lamina. B: Quantification of OEC proliferation in a control and a PCGD mouse (tamoxifen injection at P14; sacrificed five days later at P19). Boxplots show the total number of EdU/Ki67-labeled cells in the LP and the number of EdU/Ki67-labeled

OECs. EdU/Ki67-labeled cells in LP were quantified along a 300 µm long region of the mucosa on the septum. More proliferating cells were observed in the PCGD LP compared to the control. Majority of the proliferating cells in the PCGD LP were OECs. [Number of sections analyzed: 14 (PCGD) and 8 (control)]. C. EdU-labeled GFP(+) OECs were also observed in the ONL layer of the OB in the PCGD mouse in A. Arrows indicate EdU- labeled eGFP-positive cells. Scale bar = 50 µm.

111

A B Merge

EdU 8

6 m region of L P

4 per 300

PLP1-eGFP No. of 2 Ed U/ Ki67-labeled Cells

LP OEC LP OEC

Control PCGD

C Merge EdU PLP1-eGFP

GCL

112 Figure 3.5. OSN isolation after OEC ablation. A: A schematic showing strategy for generating O/PD mouse line for OSN isolation via FACS, and the experimental paradigm for ablating OECs. Pups (~P14) were administered a large dose of tamoxifen and OSNs were sorted five days later. B: A plot of FACS showing gating parameter for isolating OE3- eGFP OSNs from mucosa of O/PD mice after OEC ablation.

113

PLP1-CreER ROSA-DTA176

PLP1-CreER; ROSA-DTA176 OE3-eGFP

Tamoxifen OE3-eGFP;PLP1-CreER; Sort OE3-GFP(+) (P14-P16) ROSA-DTA176 (O/PD) neurons after 5 days to ablate OECs

114 Figure 3.6. List of all of the DE genes in OSNs after OEC ablation. Genes are arranged in the descending order from most-upregulated to downregulated. Green represents the most upregulated genes. Red represents the most downregulated genes. Average TPM values

of each DE gene in control and experimental mice are shown in the middle columns. Log2 fold changes (vs. Control) were calculated and are shown in the last column.

115

Control Experimental Log2 fold Gene (TPM) (TPM) change Olfr139 5.79484842 36.30525481 2.474 Olfr924 5.67660513 34.77571517 2.444 Rpl34 44.7942094 171.8876685 1.919 Taar9 20.0782123 69.42804213 1.745 Art5 7.67593584 27.71756852 1.738 Olfr368 17.0643806 57.04687988 1.691 Olfr1042 25.061859 81.0241873 1.659 Olfr411 23.9676503 69.88538446 1.509 Olfr635 19.4291595 53.38616544 1.418 Olfr1047 28.6382673 76.65796449 1.393 Olfr749 33.8390526 87.71161055 1.351 Olfr1037 28.6812622 73.68274744 1.335 Olfr 875 37.8239604 95.40312646 1.314 Olfr791 47.3354975 105.1931201 1.138 Olfr446 48.53721 106.8636259 1.124 Nqo1 2196.26637 4428.278859 1.011 I27l1 47.615452 91.92180536 0.936 Zfp341 55.3994134 103.1657781 0.886 Nrg1 155.512112 261.560453 0.747 Acsm4 1463.33286 2301.343065 0.653 Pcdhac2 630.179281 981.7142474 0.639 E d2 118.143546 182.5489445 0.624 Fam32a 323.704894 469.7642595 0.536 Trp53i11 398.518117 570.3769875 0.516 Zcchc12 314.023258 444.5588954 0.5 Ccnh 265.63086 367.3299434 0.466 Srebf2 1181.05527 1573.689822 0.414 Cherp 466.11025 610.4561381 0.389 Psmd7 482.335751 600.4112113 0.315 Dennd4a 2035.593 2487.122256 0.289 Arhgef2 1577.86608 1890.715717 0.261 Tspyl4 5852.89451 6845.011169 0.226 Tmbim6 8517.09245 9880.337477 0.214 Ube2n 1876.29237 2134.402961 0.186 Rad21 2596.05432 2888.642576 0.154 Ctnnb1 3996.49145 4387.846089 0.135 Kif5b 9669.64024 10525.59646 0.122 Hnrnpk 5313.68185 577 0.651248 0.119 Macf1 16784.332 15331.54952 -0.131 Eif2c2 2884.41307 2570.375599 -0.166 Rev3l 3853.19625 3399.644139 -0.181 Dst 6310.90658 5474.621754 -0.205 Ldb1 1428.41987 1204.362656 -0.246 Fam3c 870.635499 719.0455502 -0.276 Otud7b 922.24147 751.1385827 -0.296 Prkdc 882.154682 709.0144639 -0.315 D4Wsu53e 2162.99 125 1710.615707 -0.338 Rev1 697.858479 550.9568867 -0.341 Dnahc11 3039.39468 2355.355017 -0.368 Cdyl 620.795504 478.3353347 -0.375 Slc 38a2 1722.67178 1326.670909 -0.377 Zbtb37 601.210103 447.0854278 -0.427 Tmed4 529.36946 393.5072015 -0.427 Gon4l 863.22663 628.3207636 -0.458 Pcf11 1650.53373 1191.548802 -0.47 Cbx5 764.678297 551.9529901 -0.47 Itga4 1265.78726 912.5149756 -0.472 Zfp111 337.786207 238.4649085 -0.501 Hydin 333.480678 232.8689187 -0. 516 Snhg11 609.783568 367.0877352 -0.731 Kif19a 810.119815 484.1258531 -0.742 B230206F22Rik 247.279068 146.0837705 -0.756 Gt(ROSA)26 Sor 482.803014 269.2668732 -0.84 Ms4a6c 135.644214 71.97554283 -0.906 Zbbx 276.612698 135.8427019 -1.021 Gm15880 89.2630071 42.05039221 -1.07 4930431F12Rik 177.019361 79.36119664 -1.148 Olfr849 149.697729 48.90127107 -1.597 Olfr1152 38.6409615 10.61386581 -1.782 Car5a 33.4293964 7.273490108 -2.074 Arhgap27 22.594 2982 3.417309745 -2.451 Rnaset2a 82.4554634 13.63026338 -2.522 Oprd1 22.9663663 2.898844802 -2.651 Rpl34-ps1 161.952703 13.19620311 -3.532 116 REFERENCES

Birchmeier C, Nave KA (2008) Neuregulin-1, a key axonal signal that drives Schwann cell

growth and differentiation. Glia 56:1491-1497.

Honjo T, Nishizuka Y, Hayaishi O (1968) Diphtheria toxin-dependent adenosine

diphosphate ribosylation of aminoacyl transferase II and inhibition of protein

synthesis. J Biol Chem 243:3553-3555.

Leng N, Dawson JA, Thomson JA, Ruotti V, Rissman AI, Smits BMG, Haag JD, Gould

MN, Stewart RM, Kendziorski C (2013) EBSeq: An empirical Bayes hierarchical

model for inference in RNA-seq experiments. Bioinformatics.

Li B, Dewey CN (2011) RSEM: accurate transcript quantification from RNA-Seq data with

or without a reference genome. BMC Bioinformatics 12:323.

Maurel P, Salzer JL (2000) Axonal regulation of Schwann cell proliferation and survival and

the initial events of myelination requires PI 3-kinase activity. J Neurosci 20:4635-

4645.

Maxwell F, Maxwell IH, Glode LM (1987) Cloning, sequence determination, and expression

in transfected cells of the coding sequence for the tox 176 attenuated diphtheria

toxin A chain. Molecular and cellular biology 7:1576-1579.

Meyer D, Yamaai T, Garratt A, Riethmacher-Sonnenberg E, Kane D, Theill LE, Birchmeier

C (1997) Isoform-specific expression and function of neuregulin. Development

124:3575-3586.

Parodi EM, Kuhn B (2014) Signalling between microvascular endothelium and

cardiomyocytes through neuregulin. Cardiovasc Res 102:194-204.

117

Uchida T, Pappenheimer AM, Jr., Greany R (1973) Diphtheria toxin and related proteins. I.

Isolation and properties of mutant proteins serologically related to diphtheria toxin. J

Biol Chem 248:3838-3844.

Van Ness BG, Howard JB, Bodley JW (1980) ADP-ribosylation of elongation factor 2 by

diphtheria toxin. NMR spectra and proposed structures of ribosyl-diphthamide and

its hydrolysis products. J Biol Chem 255:10710-10716.

Wang SS, Lewcock JW, Feinstein P, Mombaerts P, Reed RR (2004) Genetic disruptions of

O/E2 and O/E3 genes reveal involvement in olfactory receptor neuron projection.

Development 131:1377-1388.

Wu S, Wu Y, Capecchi MR (2006) Motoneurons and oligodendrocytes are sequentially

generated from neural stem cells but do not appear to share common lineage-

restricted progenitors in vivo. Development 133:581-590.

Yamaizumi M, Mekada E, Uchida T, Okada Y (1978) One molecule of diphtheria toxin

fragment A introduced into a cell can kill the cell. Cell 15:245-250.

118

OVERALL SUMMARY AND CONCLUSIONS

119

OVERALL SUMMARY AND CONCLUSIONS

The overall goal of this study was to further our understanding of OEC biology.

More specifically, the two main objectives of this study were to (1) analyze molecular and cellular changes in OECs after OSN loss, and (2) assess the effects of OEC ablation on the

OM. We focused our efforts on studying LP-OECs in adult mice. An important aspect of our study was that we examined OECs in their natural environment.

The adult OE has the remarkable ability to completely regenerate itself after an acute injury. This is in part due to the presence of OECs in the OM that provide a permissive environment for OSN regrowth. Due to these reasons, the OM is an excellent model system for studying neurogenesis and neuron-glia interaction. Additionally, the growth-promoting properties of OECs and their unique ability to intermingle with CNS and PNS glia make them a candidate therapeutic tool for cell-mediated neuronal repair, but the knowledge about

OEC biology remains limited.

In Chapter 2, we explored the effects of injury-induced OSN loss on OECs in the

LP. OECs ensheath OSN axons as they project from the nasal cavity to the OB. Because of the close physical association of these cell types, we hypothesized that OSN loss would lead to critical changes in OECs. We studied OEC proliferation, and changes in morphology and transcriptome of OEC at various timepoints following MeBr-induced acute OSN injury. Our goal was to study OECs in situ, therefore, we identified and used PLP1-eGFP transgenic reporter mouse line as a way to mark OECs in LP. Results from our proliferation study showed that OECs rarely proliferate following MeBr lesion. OSN loss and its subsequent regeneration did not induce OEC proliferation. Next, we analyzed changes in OEC morphology after MeBr lesion. We developed a unique technique to image and study changes in individual OECs. Our study showed that OECs are elongated cells (average

120 length = ~78 microns) with a complex morphology. Overall changes in OEC were insignificant after MeBr lesion. These studies showed that OECs remain largely unaltered at the cellular level after OSN loss and during its regeneration.

OEC transcriptome was analyzed next to explore molecular level changes after MeBr lesion. We performed RNAseq on OECs isolated from PLP1-eGFP mice via FACS. Our transcriptome data gave insight into the most abundant genes in OECs. For example, we discovered that Plp1 is among the most highly expressed genes in OECs, even though

OECs do not myelinate OSN axons. Our RNAseq data also allowed us to compare OECs to other glial cell types by comparing expression level of certain genes. Based on the published

RNAseq data of other glial cell types and OSNs, we were able to generate a preliminary list of OEC-specific markers. Differential gene expression analysis showed that very few genes

(~115 genes) are up/downregulated in OECs after MeBr. NGFR was among the highly upregulated genes in OECs after MeBr, which may have a role in promoting nerve regrowth.

Lgals3 was also among the most highly upregulated genes in OECs after MeBr lesion, which implies that OECs may be involved in removing axonal debris to promote OSN regrowth.

Analyzing the function of other differentially-expressed genes in OECs may shed light on other possible functions of OECs. Overall, very few genes are differentially-expressed in

OECs after OSN loss, which is consistent with the lack of proliferation and change in morphology. Our data suggests OSN loss does not induced dramatic molecular and cellular changes in OECs. Based on our data from Chapter 2, we conclude that the role of OECs is to provide an overall steady environment to allow for continual OSN regrowth.

In Chapter 3, we explored the OEC biology further by depleting a portion of the

OEC population and examining its effects on the OM. To the best of our knowledge, this study is the first to report an OEC ablation strategy in vivo. We established an experimental

121 paradigm that depletes a portion of the OECs in LP, but does not adversely affect the health of the animals. To ablate OECs, we drove the expression of DTA176 in OEC via PLP1-

CreER. A downside of this OEC ablation strategy is that PLP1-CreER is also active in other cells types. Therefore, upon tamoxifen-administration DTA176 expression is driven in other

PLP1-expressing cells such as Schwann cells and oligodendrocytes. In the future, determining OEC-specific markers using the RNAseq data from Chapter 2 will be helpful, as it will allow us to generate an OEC-specific promoter driven CreER mouse line, which will allow us to conduct more OEC-focused experiments. Next, we assessed the proliferation in

OM after OEC ablation. We noticed that OEC ablation led to proliferation of other OECs in the LP and OB suggesting that OECs are capable of re-entering the cell cycle. This result is interesting since OSN loss does not lead to OEC proliferation. In the future, the fate of the proliferating OECs would have to be determined. Lastly, we analyzed changes in OSN molecular profile after OEC ablation. Our results showed that fewer than 100 genes were differentially expressed in OSNs after OEC ablation. This result was consistent with the overall normal appearance of the OE after OEC ablation. Among the most differentially expressed genes was Nrg1 (neuregulin 1). NRG1, expressed by peripheral axons, plays an important in multiple aspects of Schwann cell biology. Based on this, Nrg1 expressed by

OSNs may have a role in OEC biology. NRG1 in OSNs may signal via ErbB receptors present on OEC surface. While Nrg1 is upregulated in OSNs after OEC ablation, ErbB2 is upregulated in OEC after OSN loss. These data suggest that NRG1/ERBB pathway may be involved in the regrowth process of OSNs. Further studies will need to be conducted to confirm expression of Nrg1 and various types of ErbB receptors in OSNs and OECs.

Based on the data described in chapters 2 and 3 of this thesis, we conclude that a role of OECs to provide a steady environment for the continual regrowth of OSNs.

122

Additionally, OEC maintain this permissive environment around the fascicles and protect the OSN axons from the parenchymal environment by re-entering the cell cycle to likely replace the gaps in the conduit left by the lost OECs.

123

APPENDICES

124

APPENDIX A

Technique: Fluorescence activated cell sorting (FACS) of OECs from whole olfactory mucosa of adult mice

OECs were FACS-sorted directly from the olfactory mucosa of adult PLP1-eGFP transgenic mice for transcriptome analysis via RNAseq. All of the mice used were between the ages P30-P45. The following detailed protocol was optimized for processing olfactory mucosa from up to six mice per batch. Cold reagents were used for each step. Dissected tissue was kept and processed on ice, except during enzymatic digestion steps. All spins were performed at 4C.

1. Mice were killed by carbon dioxide gas exposure and decapitated.

2. The fur/skin on the head, the lower jaw, and the zygomatic bones from both sides

were removed. See Figure A for all trim marks.

3. The trimmed heads were cut coronally through the parietal bone with a sharp single-

edged blade to remove the posterior part of the head (Figure A).

4. The heads were cut parallel to the septum with a clean single-edged blade and

immediately placed in cold DMEM/F12 media on ice.

5. Halved heads were briefly washed with cold Hank’s Balanced Salt Solution (HBSS).

6. The brain, including the olfactory bulbs, was carefully removed using curved-tip

forceps (Jeweler’s style #7). The remaining skull was carefully removed using a fine

pair of scissors. The nose was immediately placed in cold low-calcium Ringer’s

solution (LCRS).

125

7. The olfactory mucosa was dissected from the septum cartilage using a clean surgical

blade (No. 11) and carefully lifted using straight fine-tipped forceps and placed in

cold LCRS immediately on ice. Olfactory mucosa is identified by its yellowish

appearance compared to the respiratory mucosa (Figure B).

8. To increase surface area, pieces of olfactory mucosa were gently pulled apart in ~10

ml cold LCRS in a 35 x 10 mm tissue culture petri dish with two straight fine-tipped

forceps. The tissue was poured into a 50 ml conical tube. To transfer any remaining

pieces of olfactory mucosa, the petri dish was rinsed with ~10 ml of additional cold

LCRS and poured into the 50 ml conical tube.

9. Pieces of the whole mucosa in the 50 ml conical tube were spun at 200xg for 10

minutes at 4C. LCRS was decanted after the spin.

10. 500 µl of 0.05% trypsin was added to the tissue, and then incubated for 15 minutes

in a 37C water bath. The tissue was then gently triturated using a P1000 pipette tip.

11. A cocktail of enzymes (1 ml) was added and incubated for an additional 30 minutes

in a 37C water bath. The enzyme cocktail consisted of hyaluronidase, collagenase,

bovine serum albumin, soybean trypsin inhibitor, and papain, and Ringer’s solution.

12. Following enzymatic digestion, the tissue was spun at 400xg for 5 minutes, the

enzyme cocktail was decanted, and fresh 2 ml of cold DMEM/F12 media was

added.

13. With a fire-polished 9" Pasteur pipette, the tissue was triturated between 35-40 times

on ice.

14. To the cell suspension, 10 ml of cold DMEM/F12 media was added. The cell

suspension was then filtered through a 40 µm filter in a new tube, spun down at

400xg for 8 minutes.

126

15. Cells were resuspended in 500 µl 0.5% BSA/HBSS/DNaseI solution.

16. 15 µl 7AAD dye (eBioscience) was added to the cell suspension and incubated

between 5-10 minutes to mark the dead cells. eGFP(+) and 7AAD(-) cells were

collected directly in 350 µl Buffer RLT (QIAGEN).

17. Up to 100 µl of events/cells were collected in 350 µl Buffer RLT. For volume

greater than 100 µl, the volume of Buffer RLT was adjusted accordingly.

Enzyme Cocktail 100 µl [12 mg/ml] Collagenase 150 µl [10 mg/ml] Hyaluronidase 100 µl 10% Bovine Serum Albumin 50 µl [10 mg/ml] Soybean Trypsin Inhibitor 12 µl Papain Solution (Sigma) 680 µl Ringer’s Solution 1000 µl Total volume

127

Appendix B

Technique: Clearing Olfactory Mucosa using SeeDB and Imaging Individual OECs

Individual OECs were imaged in cleared whole mucosa of PLP1-CreER/mTmG mice to study changes in their morphology post MeBr lesion. A detailed protocol is outlined here for clearing whole olfactory mucosa using SeeDB technique (Ke et al, 2013) and then imaging individual OECs.

1. Mice were killed by an overdose of Avertin (IP injection).

2. They were perfused with cold PBS transcardially, followed by cold 4% PFA.

3. The heads were trimmed as described in Appendix A, and then post-fixed in 4%

PFA overnight (Figure A).

4. An approximately 3 x 3 mm long piece of olfactory mucosa was dissected from the

septum cartilage (Figure B).

5. The dissected pieces of olfactory mucosa were serially incubated in 20%, 40%, and

60% fructose solutions (w/v) for an hour each, protected from light on a shaker§.

6. Next, the pieces of olfactory mucosa were incubated in 80% and 100% fructose

solutions for 2 hours each, on a shaker and protected from light.

7. Finally, the pieces were carefully transferred to the SeeDB solution (80.2% w/w or

~115% w/v fructose), and incubated overnight, with moderately vigorous shaking

and protected from light§.

8. The following day, cleared olfactory mucosa was carefully lifted out of the SeeDB

solution with clean forceps and laid flat on a glass slide, with the lamina propria side

128

facing up. Any air bubbles were carefully removed.

9. A small drop of SeeDB was placed on the tissue. Then small drops of petroleum jelly

- injected from a syringe fitted with a blunt, 20-gauge needle – were placed around

the tissue to support the weight of the glass coverslip and to keep the coverslip in

place.

10. Lastly, a No. 1.5 (0.17 mm thick) glass coverslip was gently placed on top of the

tissue.

11. Using Zeiss 780 inverted confocal microscope was fitted with a 40x Plan-

Apochromat (NA 1.4) oil objective and a photo-inverter tube (Model 300T, LSM

Tech), Z-stacks of individual OECs were acquired.

12. 3D reconstructions were generated using Zeiss Zen software and Imaris (Bitplane)

for analysis.

§: Note about preparation of fructose solutions:

1: All fructose solutions, including SeeDB, were prepared in double distilled water

(Millipore).

2: For 20%, 40%, 60%, and 80% fructose solutions: Fructose dissolves easily in

water at room temperature with vigorous shaking.

3: For 100% and SeeDB solutions: Fructose does not dissolve at room temperature.

Each solution is prepared in a clean 50 ml conical tube (Corning), heated in a 65C

water bath for a few hours, and vigorously shaken at 30 minute intervals until

fructose is fully dissolved. These solutions are cooled to room temperature before

use. 129

4: Pieces of olfactory mucosa can be incubated in 20% through 100% fructose

solutions in the same petri dish. However, they must be incubated in SeeDB in a

fresh petri dish (35x10 mm), sealed with a piece of Parafilm to prevent water

evaporation and maintain the correct fructose concentration.

REFERENCE

Ke MT, Fujimoto S, Imai T (2013) SeeDB: a simple and morphology-preserving optical clearing agent for neuronal circuit reconstruction. Nature neuroscience 16:1154-1161.

130

Figure A. Dorsal view of the mouse skull. Trim marks are represented by red lines. Source: http://www.oocities.org/virtualbiology/skull.gif

131

Figure B Mid-sagittal view of the olfactory tissue. Olfactory mucosa (OM) has a yellowish appearance relative to the respiratory mucosa (RM). OM was carefully dissected from the septum. Source: http://www.jcdr.net/articles/images/3562//jcdr-7-2419-g001.jpg

132

CURRICULUM VITAE

133

TANU SHARMA 855 N. Wolfe Street Rangos 440 Baltimore, MD 21205 410.790.9062 | [email protected]

EDUCATION 2009-present Ph.D. Candidate, Neuroscience Graduate Program, The Johns Hopkins University School of Medicine, Baltimore, MD Thesis Advisor: Dr. Randall Reed

2009 Bachelor of Science, University of Maryland, Baltimore County, Baltimore, MD (Cum laude) Biochemistry and Molecular Biology Meyerhoff Scholar MARC U*STAR Scholar

AWARDS 2012-15 Ruth L. Kirschstein National Research Service Award (F31) 2015 Greater Baltimore Society of Neuroscience poster competition winner

RESEARCH EXPERIENCE 2010-present Graduate thesis research Advisor: Dr. Randall R. Reed, Department of Neuroscience & Department of Molecular Biology and Genetics, The Johns Hopkins University School of Medicine. • Studied molecular and cellular characteristics of Olfactory Ensheathing Cells (OEC). • Used next generation sequencing (RNAseq) to explore OEC and olfactory sensory neurons transcriptomes. 2006-09 Dept. of Biology, University of Maryland, Baltimore County. Probing the Counterion to the Protonated Schiff Base in Melanopsin Mentor: P. R. Robinson, Ph.D. 2008 Amgen Scholars Program at University of California, San Francisco. Mentor: Geeta Narlikar, Ph.D.

TEACHING/MENTORING EXPERIENCE 2014 Science Outreach Program. Designed science curriculum for elementary school students.

134

2013 Teaching Assistant – Nervous System & Special Senses, Johns Hopkins School of Medicine. 2013 Junior Biomedical Scholars Mentorship Program. Mentored and assisted a high school student with their research project. 2012 Teaching Assistant – Nervous System & Special Senses, Johns Hopkins School of Medicine.

PUBLICATIONS Sharma T, Reed RR. (Manuscript in Preparation). Sharma T, Reed RR. Balancing survival: the role of CTGF in controlling experience-modulated olfactory circuitry. Neuron. 2013 Sep 18;79(6):1037-9. Charles GM, Chena C, Shiha SC, Collins SR, Beltrao P, Zhang X, Sharma T, Tan S, Burlingame AL, Krogan NJ, Madhani HD, Narlikar GJ. Site-specific acetylation mark on an essential chromatin-remodeling complex promotes resistance to replication stress. PNAS. 2011 Jun 28;108(26):10620-5.

CONFERENCE PRESENTATIONS Sharma T, Reed R. Resilient Changes In The Properties Of Olfactory Ensheathing Cells After Neuronal Loss. • American Society of Cell Biology. San Diego, CA. December 2015. (Poster). • Greater Baltimore Society for Neuroscience. Baltimore, MD. November 2015. (Poster) • Association for Chemoreception Sciences. Bonita Springs, FL. April 2015. (Poster)

135