bioRxiv preprint doi: https://doi.org/10.1101/2021.06.24.449787; this version posted June 24, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Danish dementia and excitatory transmission

1 § Familial Danish dementia young Knock-in rats expressing humanized APP and human

2 Ab show impaired pre and postsynaptic glutamatergic transmission

3 § Tao Yin1, Wen Yao1,2, Kelly A. Norris1 & Luciano D’Adamio1*

4 5 6 1Department of Pharmacology, Physiology & Neuroscience, Brain Health Institute, New Jersey Medical 7 School, Rutgers, The State University of New Jersey, 205 South Orange Ave, Newark, NJ, 07103, USA 8 2Present address: Biomedical Research Center, Southern Medical University, 1023 South Shatai Road, 9 Guangzhou, Guangdong, 510515, China. 10 11 12 13 *To whom correspondence should be addressed: [email protected] 14 15 Running title: Danish dementia and excitatory transmission

16 Keywords: Familia Danish Dementia, precursor (APP), Amyloid b, 17 neurodegeneration, synaptic plasticity, rat, animal model, glutamate, Familial Danish Dementia, 18 BRI2, Integral membrane protein 2B (ITM2b) 19 20 ABSTRACT 46 synaptic facilitation in the hippocampal 21 Familial British and Danish dementia 47 Schaeffer-collateral pathway. These changes 22 (FBD and FDD) are two neurodegenerative 48 are like those observed in adult mice 23 disorders caused by mutations in the Integral 49 producing rodent Ab and carrying either the 24 membrane protein 2B (ITM2b). BRI2, the 50 Danish or British mutations into the mouse 25 protein encoded by ITM2b, tunes excitatory 51 Itm2b . Collectively, the data show that 26 synaptic transmission at both pre- and post- 52 the pathogenic Danish mutation alters the 27 synaptic terminus. Too, BRI2 interacts with 53 physiological function of BRI2 at 28 and modulates proteolytic processing of 54 glutamatergic synapses; these functional 29 Amyloid-b precursor Protein (APP), whose 55 alterations are detected across species and 30 mutations cause familial forms of Alzheimer 56 occur early in life. Future studies will be 31 disease (FAD). To study pathogenic 57 needed to determine whether this phenomenon 32 mechanism triggered by the Danish mutation 58 represents an early pathogenic event in human 33 we generated rats carrying the Danish 59 dementia. 34 mutation into the rat Itm2b gene (Itm2bD rats). 60 35 Given the BRI2/APP interaction and the INTRODUCTION 61 Model organisms that reproduce the 36 widely accepted relevance of human Ab, a 62 pathogenesis of human diseases are useful to 37 proteolytic product of APP, to AD, Itm2bD rats 63 dissect disease mechanisms, identify 38 were engineered to express two humanized 64 therapeutic targets and test therapeutic 39 App alleles, to produce human Ab. Here, we D 65 strategies. Because genetic manipulation has 40 studied young Itm2b rats to investigate early 66 been easier in mice, mice have overtaken rats 41 pathogenic changes. We found that peri- D 67 as the major rodent-based model organism in 42 adolescent Itm2b rats present subtle changes 68 neurodegeneration research. Thus, to study 43 in human Ab levels along with decreased 69 FDD and FBD, fifteen years ago we generated 44 spontaneous glutamate release and AMPAR- 70 mice carrying the pathogenic Danish and 45 mediated responses but increased short-term 71 British dementia mutations (Itm2bD and Itm2bB

1 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.24.449787; this version posted June 24, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Danish dementia and excitatory transmission

72 mice) into the Itm2b mouse gene (1-3). We 122 of neurodegenerative diseases over mice. For 73 choose a knock in (KI) approach rather than 123 example, alternative spicing of tau (12-15), 74 the more common transgenic overexpression 124 which forms NFTs and is mutated in 75 approach for several reasons. KIs mimic the 125 Frontotemporal Dementia (16-23), leads to 76 genetic of FDD and FBD and make no 126 expression of tau isoforms with three or four 77 assumption about pathogenic mechanisms 127 microtubule binding domains (3R and 4R, 78 (except the unbiased genetic one), while the 128 respectively). Adult human and rat brains 79 transgenic approach aims to reproduce 129 express both 3R and 4R tau isoforms (24): in 80 pathology (plaques, Neurofibrillary tangles 130 contrast, adult mouse brains express only 4R 81 (NFTs), etc.), under the assumption that this 131 tau(25), suggesting that the rat may be a better 82 “pathology” is pathogenic. In KI models, 132 model organism for dementias with tauopathy, 83 expression of mutant is controlled by 133 such as FDD and FBD. 84 endogenous regulatory elements, avoiding 134 BRI2 physically interacts with and 85 issues related to over-expression of disease- 135 modulates processing of APP, which bears 86 in a non-physiological quantitative- 136 relevance to AD pathogenesis (26-30). In 87 spatial-temporal manner. Finally, potential 137 addition, APP processing mediates LTP and 88 confounding “insertion” effects of transgenes 138 memory deficits of Danish and British KI 89 are avoided. 139 mice (31-36). Aggregated forms of Aβ, a 90 Because rats are better suited to study 140 product of APP processing, are by and large 91 neurodegenerative diseases, we took 141 considered the main pathogenic molecule in 92 advantage of recent developments in gene- 142 AD. Rat and human APP differ by 3 amino- 93 editing technologies and introduced the 143 acids in the Aβ region: given that human Aβ 94 familial Danish mutation into the genomic 144 are believed to have higher propensity to form 95 Itm2b rat locus (Itm2bD rats). The rat was the 145 toxic Aβ species as compared to rodent Aβ, 96 organism of choice for most behavioral, 146 we produced rats carrying the humanized Aβ 97 memory and cognitive research -which is 147 sequence (Apph rats) (37,38). Thus, to study 98 critical when studying neurodegenerative 148 possible interactions between the Danish 99 diseases- because physiological processes are 149 mutation and human Aβ, Itm2bD rats were 100 similar in rats and humans and the rat is an 150 backcrossed to Apph rats. Hence, all rats used 101 intelligent and quick learner (4-7). 151 in this study produce human and not rodent 102 Several procedures that are important in 152 Aβ species. D 103 dementia research are more easily performed 153 Here, we studied peri-adolescent Itm2b 104 in rats as compared to mice due to the larger 154 rats, with the purpose of investigating early 105 size of the rat brain. Cannulas -to administer 155 dysfunctions that may underlie initial 106 drugs, biologics, viruses etc.- and micro- 156 pathogenic mechanisms leading to dementia 107 dialysis probes –for sampling extracellular 157 later in life. 108 brain levels of neurotransmitters, Ab, soluble 158 RESULTS 109 tau etc.- can be accurately directed to 159 Generation of Itm2bD KI rats carrying 110 individual brain regions, causing less damage 160 humanized Apph alleles. 111 and increasing specificity. In vivo brain 161 The knock-in founder F0-Itm2bD rat, 112 imaging techniques, such as MRI (8) and PET 162 which is carrying FDD mutation on Itm2b rat 113 (9-11), can assess the extent and course of 163 gene, was generated by CRISPR/Cas-mediated 114 neurodegeneration with better spatial 164 genome engineering as described in 115 resolution in rats. Moreover, rats are large 165 Experimental Procedures and Supporting 116 enough for convenient in vivo 166 Information. The F0-Itm2bD rat, which is a 117 electrophysiological recordings or serial 167 chimera for the Itm2b gene, was crossed to 118 sampling of cerebrospinal fluid for detection 168 WT (Itm2bw/w) Long-Evans rats to generate 119 of biomarkers. 169 F1-Itm2bD/w rats. F1-Itm2bD/w rats were crossed 120 Finally, gene-expression differences 170 to WT Long-Evans to generate F2-Itm2bD/w 121 suggest that rats may be advantageous model 171 rats. These crossing were repeated three more

2 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.24.449787; this version posted June 24, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Danish dementia and excitatory transmission

172 times to obtain F5-Itm2bD/w rats. The 222 terminus by proprotein convertase to produce 173 probability that F5 rats carry unidentified off- 223 the NH2-terminal mature BRI2 (mBRI2) and 174 target mutations (except those, if present, on 224 the 23 amino acid-long COOH-terminal 175 Chr. 15) is ~1.5625%. Male and female F5- 225 peptide called Bri23 (40). As noted above, in 176 Itm2bD/w rats were crossed to obtain Itm2bD/w, 226 the Danish patients, a frameshift caused by a 177 Itm2bD/D and Itm2bw/w rats. 227 10 nucleotides duplication 5’ to the stop codon 178 The FDD mutation consist of a 10 228 leads to the synthesis of a BRI2 precursor 179 nucleotides duplication one codon before the 229 protein 11 amino acids larger-than-normal 180 normal stop codon (39). This produces a 230 (39). Convertase-mediated cleavage of 181 frameshift in the BRI2 sequence generating a 231 immature Danish BRI2 generates a WT-like 182 precursor protein 11 amino acids larger-than- 232 mBRI2 and a 34 amino acid long peptide 183 normal (Figure 1A). To verify that the Danish 233 called ADan, which co-deposits with Aβ 184 mutation was correctly inserted into Itm2b 234 species in amyloid fibrils in patients. For 185 exon 6, we amplified by PCR the Itm2b gene 235 clarity, we will refer to the wild type imBri2 186 exon 6 Itm2bD/w, Itm2bD/D and Itm2bw/w rats. 236 as Bri2-Bri23, and to the Danish mutant 187 Sequencing of the PCR products shows that 237 imBri2 as Bri2-ADan. 188 the Danish mutation was correctly inserted in 238 To determine whether the Itm2bD allele 189 the Itm2b gene exon 6 (Figure 1B) and 239 codes for Bri2-ADan we examined Bri2 190 encoded for the COOH-terminus of the Danish 240 expression in total neuronal lysates isolated 191 BRI2 mutant. When we generated FDD KI 241 from male and female 2 months old Itm2bD/w, 192 mice, we humanized the mouse COOH- 242 Itm2bD/D and Itm2bw/w rats. However, the Bri2 193 terminal region of BRI2 by introducing an 243 antibody tested identified many non-specific 194 alanine (A) was substituted for threonine (T) 244 bands (Figure S1), making a rigorous 195 at codon 250 (3). Since that humanization did 245 assessment of Bri2 expression in rat brains 196 not result into deposition of ADan peptides in 246 challenging. 197 amyloid plaques in KI mice (3), that 247 Analysis of mouse Itm2bw/w and Itm2bD/D 198 modification was not repeated in rats. 248 primary neurons showed that the mBri2/Bri2- 199 To generate Itm2bD/w, Itm2bD/D and 249 Bri23 ratio in Itm2bw/w primary neurons was 200 Itm2bw/w rats on a background in which rat App 250 significantly higher than the mBri2/Bri2- 201 has a humanized Aβ region, Itm2bD/w and 251 ADan ratio in Itm2bD/D primary neurons (41). 202 Apph/h rats were crossed to generate 252 In addition, lysosomal inhibition caused 203 Itm2bD/w;Apph/w rats. The Appw allele was 253 accumulation of mBri2 but not Bri2-Bri23 in 204 removed in subsequent crosses. Henceforth, 254 Itm2bw/w primary neurons; in contrast, both 205 Itm2bD/D, Itm2bD/w and Itm2bw/w rats used in 255 mBri2 and Bri2-ADan accumulated in 206 this study have an Apph/h background and 256 Itm2bD/D primary neurons (41). These 207 produce human and not rodent Aβ species. 257 observations indicated that the Danish 208 To determine whether Itm2b expression is 258 mutation reduced maturation of the mutant 209 disrupted by the introduced mutations, we 259 precursor Bri2 in mouse neurons. Based on 210 examined Itm2b mRNA levels in p21 Itm2bD/D 260 these observations, we probed whether 211 and Itm2bw/w rats by standard RNA-Seq 261 primary neurons could be used to assess 212 analysis on total brain RNA. The mRNA 262 mBri2, Bri2-Bri23 and Bri2-ADan expression 213 expression of Itm2b shows no significant 263 in KI rats. Primary neurons are a simpler 214 difference between Itm2bD/D and Itm2bw/w rats 264 system compared to total brain; this, per se’, 215 (Figure1C). 265 may reduce the number of non-specific bands 216 The Itm2bD allele encodes for a longer 266 identified by anti-Bri2 antibodies. Moreover, 217 Bri2 precursor protein (Bri2-ADan) that 267 inhibition of lysosome-mediated degradation 218 accumulates in primary neurons. 268 of Bri2 species in primary neurons may help 219 BRI2 is a type II membrane protein that is 269 identify specific Bri2 molecules. Thus, w/w 220 synthesized as an immature precursor 270 primary neurons derived from Itm2b and D/D 221 (imBRI2). imBRI2 is cleaved at the COOH- 271 Itm2b rat were treated with the lysosomal 272 inhibitor chloroquine and analyzed by Western

3 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.24.449787; this version posted June 24, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Danish dementia and excitatory transmission

273 blot. The anti-Bri2 antibody identified a band 324 contrast, there was a slight but significant 274 of ~34 kDa in all samples, which was 325 increase in Aβ42 as well as the Aβ42/Aβ40 275 increased by chloroquine (Figure 2A and 2C). 326 ratio in Itm2bD/D compared to Itm2bw/w rats 276 These observations are consistent with the ~34 327 (Figure 3C). Small but statistically 277 kDa corresponding to mBri2. A second band 328 significant decreases in both Aβ43 and 278 of ~36 kDa was detected in Itm2bw/w primary 329 Aβ43/Aβ42 ratio were evident in Itm2bD/D as 279 neurons (Figure 2A). In contrast, a slightly 330 compared to Itm2bw/w rats (Figure 3C). 280 larger second band (~37 kDa) that was 331 Overall, these data indicate a gene dosage- 281 increased by chloroquine treatment, was 332 dependent minor increase in steady-state 282 detected in Itm2bD/D primary neurons (Figure 333 levels of Aβ42, and decrease in Aβ43, in 283 2A and 2C). These observations are consistent 334 peri-adolescent Itm2bD rats. Analysis of older 284 with the ~36 kDa and ~37 kDa bands 335 rats will be needed to determine whether the 285 corresponding to Bri2-Bri23 and Bri2-ADan, 336 Danish mutation in Itm2b alters APP 286 respectively. 337 processing in KI rats and whether these 287 Without treatment, the levels of Bri2- 338 alterations may more robustly change the 288 ADan in Itm2bD/D primary neurons were 339 steady-state levels of APP metabolites with 289 significantly higher than the levels of Bri2- 340 aging. 290 Bri23 in Itm2bw/w primary neurons (Figure 2A 341 It has been postulated that toxic forms of 291 and 2C) and the mBri2/Bri2-Bri23 ratio in 342 Aβ are oligomeric (45). Thus, we tested 292 Itm2bw/w primary neurons was significantly 343 whether toxic oligomers are augmented in 293 higher than the mBri2/Bri2-ADan ratio in 344 peri-adolescent Itm2bD rats. To this end, we 294 Itm2bD/D primary neurons (Figure 2A and 2C). 345 used the prefibrillar oligomer-specific 295 Chloroquine significantly reduced the LC3A 346 antibody A11 to perform dot blots (46). We 296 I/LC3A II and LC3B I/LC3B II ratios (Figure 347 found no evidence supporting an increase in 297 2B and 2C), confirming inhibition of 348 neurotoxic brain oligomer levels in peri- 298 lysosome-mediated degradation. 349 adolescent Itm2bD/w and Itm2bD/D rats as 299 Subtle increase in Aβ42 levels in young 350 compared with Itm2bw/w rats (Figure 4). 300 Itm2bD KI rats. 351 However, Aβ oligomers appeared to be 301 Sequential processing of APP by α-/γ- 352 significantly increased in Itm2bD/w rats 302 secretase and β-/γ-secretase generate the 353 compared to Itm2bD/D animals (Figure 4). 303 following APP metabolites: sAPPβ, sAPPα, 354 Analysis of older rats will be needed to 304 β-CTF, α-CTF, AID/AICD, P3 and Aβ. 355 clarify the relevance of this odd observation. 305 Since BRI2 interacts with APP and 356 Glutamatergic synaptic transmission at 306 modulates APP processing by α-, β- and γ- 357 hippocampal SC–CA3>CA1 synapses is 307 secretase (26-30), we determined the steady- 358 impaired in peri-adolescent Itm2bD rats. 308 state levels of several of these APP 359 Bri2 modulates glutamatergic synaptic 309 metabolites in the central nervous system 360 transmission at both pre- and post-synaptic 310 (CNS) of young male and female Itm2bD KI 361 termini of Schaeffer-collateral pathway (SC)– 311 rats. Full length APP, α-CTF and β-CTF 362 CA3>CA1 synapses (47). This function is 312 were measured by Western blot: soluble 363 compromised in both adult Itm2bD and Itm2bB 313 APPs (sAPPα/sAPPβ) were detected by 364 KI mice (41). Here, analyzed glutamatergic 314 ELISA, and human Aβ species (Aβ38, Aβ40, 365 transmission at SC–CA3>CA1 synapses in 315 Aβ42 and Aβ43) were detected by human Aβ 366 young peri-adolescent Itm2bD male and 316 specific-ELISA. These measurements have 367 female rats. First, we analyzed miniature 317 previously been used for other KI rats 368 excitatory postsynaptic currents (mEPSC), 318 generated in our lab (38,42-44). 369 the frequency of which is determined, in part, 319 Levels of full-length APP, CTFs, Aβ38, 370 by the probability of release (Pr) of 320 Aβ40, Aβ43, sAPPα and sAPPβ were 371 glutamatergic synaptic vesicles release (48). 321 unchanged in 8 weeks old Itm2bD/w, Itm2bD/D 372 Thus, mEPSC frequency is regulated mostly 322 and Itm2bw/w rats (Figure 3A-C), nor was the 373 by pre-synaptic mechanisms: As shown in 323 Aβ43/Aβ42 ratio altered (Figure 3C). In 374 Figure 5A, B,C, the Danish Itm2b mutation

4 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.24.449787; this version posted June 24, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Danish dementia and excitatory transmission

375 caused a significant reduction in the 425 rats. These alterations are like those seen in 376 frequency of mEPSC: this reduction is gene- 426 Itm2b KO and Itm2bD/Itm2bB KI adult mice. 377 dosage dependent (Itm2bw/w vs. Itm2bD/w, 427 378 P=0.003; Itm2bw/w vs. Itm2bD/D, P<0.0001; 428 DISCUSSION 379 Itm2bD/w vs. Itm2bD/D, P=0.0051) and suggests 429 The choice of the genetic approach and 380 a decrease in Pr of glutamatergic synaptic 430 the model organisms used to model human 381 vesicles. 431 diseases have major implications on the 382 The amplitude of mEPSC is instead 432 phenotypic expression of disease-associated 383 dependent on post-synaptic AMPA receptor 433 genetic mutations. For the last 13 years, our 384 (α-amino-3-hydroxy-5-methyl-4-isoxazole 434 laboratory has modeled AD and AD-like 385 propionic acid-receptor, AMPAR) responses. 435 neurodegenerative disorders in mice, using a 386 AMPAR-mediated mEPSC responses 436 KI approach (3,49-52). The KI approach was 387 amplitude was also significantly decreased in 437 preferred because it generates models 388 Itm2bD rats (Figure 5A, D, E, G). Also in this 438 genetically faithful to human diseases and 389 case, the reduction is gene-dosage dependent 439 make no preconceived assumption about 390 (Itm2bw/w vs. Itm2bD/w, P=0.0016; Itm2bw/w vs. 440 pathogenic mechanisms (except the unbiased 391 Itm2bD/D, P=0.0005). Decay time of mEPSC 441 genetic one). We have recently extended our 392 was not significantly affected in Itm2bD rats 442 KI modeling of familial and sporadic forms of 393 compared to littermate controls (Figure 5A, 443 AD and AD-related disorders to rats 394 F, G). 444 (38,42,44,53,54), because the rat is better 395 Since mEPSCs AMPAR-mediated 445 suited for behavioral tests and other 396 responses are reduced in amplitude, we 446 procedures that are important when studying 397 measured the AMPA/NMDA ratio in evoked 447 neurodegenerative diseases. In addition, gene- 398 responses. Consistent with the hypothesis that 448 expression differences suggest that rats may 399 the Danish Itm2b mutation impairs AMPAR- 449 be advantageous model of neurodegenerative 400 mediated responses, the AMPA/NMDA ratio 450 diseases over mice. Alternative spicing of 401 was reduced in Danish KI rats (Figure 5H). 451 Mapt (12-15), which forms NFTs and is 402 This difference was statistically different 452 mutated in Frontotemporal Dementia (16-23), 403 only between Itm2bw/w and Itm2bD/D rats, with 453 leads to expression of tau isoforms with three 404 Itm2bD/w rats showing an intermedia 454 or four microtubule binding domains (3R and 405 phenotype. 455 4R, respectively). Adult human and rat brains 406 Finally, we examined the effect of the 456 express both 3R and 4R tau isoforms (24): in 407 pathogenic Danish mutation on paired-pulse 457 contrast, adult mouse brains express only 4R 408 facilitation (PPF). PPF is a form of short-term 458 tau (25), suggesting that the rat may be a 409 synaptic plasticity that is in part determined 459 better model organism for dementias with 410 by changes in Pr of glutamatergic synaptic 460 tauopathy. 411 vesicles (48)(41). Facilitation at both 50ms 461 To explore early dysfunctions that may 412 and 200ms interstimulus interval (ISI), was 462 underlie initial mechanisms leading to 413 significantly increased in Itm2bD/D (Figure 463 dementia, we studied young KI rats carrying 414 5I). Even in this case the changes were gene- 464 the Itm2bD Familial Danish dementia 415 dosage-dependent (50ms ISI: Itm2bw/w vs. 465 mutation. Consistent with the findings in 416 Itm2bD/D, P<0.0001; Itm2bD/w vs. Itm2bD/D, 466 Itm2bD/D mouse KIs (41), we found that Bri2- 417 P=0.0031; 200ms ISI: Itm2bw/w vs. Itm2bD/D, 467 ADan maturation is altered and accumulates 418 P=0.0205). Interestingly, also an increase in 468 in Itm2bD/D primary neurons (Figure 2). 419 PPF is consistent with a decrease in Pr, just 469 Analysis of APP metabolism in peri- 420 like a decrease in mEPSC frequency. Overall, 470 adolescent Itm2bD Ki rats (Figure 3 and 4) 421 our data indicate that the pathogenic Danish 471 only showed subtle but significant changes in 422 Itm2b mutation alters glutamatergic synaptic 472 Aβ42 and Aβ43 steady-state levels, which 423 transmission at excitatory hippocampal SC– 473 were slightly increased and decreased, 424 CA3>CA1 synapses in peri-adolescent KI 474 respectively (Figure 3).

5 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.24.449787; this version posted June 24, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Danish dementia and excitatory transmission

475 We have previously shown that the 526 Use Committee (IACUC) at Rutgers (IACUC, 476 Danish and British ITM2b mutations lead to 527 protocol number PROTO201702513). 477 reduced glutamatergic neurotransmitter 528 Generation of rats expressing the Danish 478 release and AMPAR-mediated responses in 529 Itm2b mutation (Itm2D rats). The rat Itm2b 479 adult Itm2bB and Itm2bD mice (41). These 530 gene (GenBank accession number: 480 reductions are like those seen in adult Itm2b 531 NM_001006963.1; Ensembl: 481 knock-out mice (41,47). Interestingly, we 532 ENSRNOG00000016271) is located on rat 482 detected identical, gene dosage-dependent, 533 15. It comprises 6 exons, with 483 pre-and post-synaptic glutamatergic 534 ATP start codon in exon 1 and TGA stop 484 transmission changes in the SC pathway of 535 codon in exon 6. The FDD mutation 485 peri-adolescent Itm2bD rats (Figure 5). More 536 (TTTAATTTGTTCTTGAACAGTCAAGAA 486 specifically, the frequency of mEPSC and the 537 AAACATTAT) KI site in oligo donor was 487 PPF are significantly decreased and 538 introduced into exon 6, which is the target site 488 increased, respectively, in Itm2bD rats, 539 by homology-directed repair. A silent 489 suggesting a pre-synaptic reduction of the Pr 540 mutation (GTG to GTC) was also introduced 490 of glutamatergic synaptic vesicles. In 541 to prevent the binding and re-cutting of the 491 addition, mEPSCs amplitude and the 542 sequence by Cas9 after homology-directed 492 AMPA/NMDA ratio were both decreased in 543 repair. The detailed procedures are reported in 493 Itm2bD rats, suggesting a post-synaptic 544 the Supporting Information file. 494 reduction of AMPAR-mediated responses. 545 Standard RNA-Seq analysis- Total brain 495 Collectively, these data together with our 546 RNA from 21 days old Itm2bD/D and Itm2bww/ 496 previously published observations, indicate 547 rats (2 male and 2 females per each genotype) 497 that the synaptic transmission alteration 548 was extracted with RNeasy RNA Isolation kit 498 caused by Danish mutation occur early in 549 (Qiagen). Standard RNA-Seq procedures and 499 life, and are neither species nor gene-editing 550 data analysis was performed by Genewiz 500 technology-specific. These studies underlie 551 following proprietary methods 501 the potential relevance of our studies to 552 (https://cdn2.hubspot.net/hubfs/3478602/NG 502 functional changes caused by the pathogenic 553 S/RNA-Seq/GENEWIZ_RNA- 503 ITM2b mutations in humans. 554 Seq_Technical_Specifications_US.pdf). 504 Given the functional and pathological 555 Student’s t-test was used for all analyses, with 505 interaction between APP and BRI2 (26-36), it 556 data presented as mean ± SD. 506 is possible that the presence of human Aβ in 557 Rats brain proteins preparation, Western 507 the rat model may lead to an earlier 558 blots and ELISA- These procedures were 508 manifestation of synaptic plasticity deficit in 559 performed as previously described (42,54). 509 rat as compared to mice, which express 560 Briefly, rats were anesthetized with 510 rodent Aβ. Moreover, the evidence that both 561 isoflurane and perfused via intracardiac 511 APP and BRI2 tune excitatory synaptic 562 catheterization with ice-cold PBS. Brains 512 transmission, and that these functions are 563 were extracted and homogenized with a 513 altered by pathogenic mutations in both APP 564 glass-teflon homogenizer in 250 mM 514 and BRI2 (37,41,47,55-57) suggest that early 565 Sucrose, 20 mM Tris-base pH 7.4, 1 mM 515 alterations in glutamatergic transmission may 566 EDTA, 1mM EGTA plus protease and 516 underlie initial pathogenic mechanisms in 567 phosphatase inhibitors (ThermoScientific). 517 dementia. Future studies will be needed to 568 All steps were carried out on ice. 518 test these hypotheses. 569 Homogenates were solubilized with 1% NP- 519 570 40 for 30 min rotating and spun at 20,000 g 520 EXPERIMENTAL PROCEDURES 571 for 10 minutes. Supernatants were collected 521 Rats and ethics statement- Rats were 572 and protein content was quantified by 522 handled according to the NIH Ethical 573 Bradford. 523 Guidelines for Treatment of Laboratory 574 For Western blot analyses, proteins were 524 Animals. The procedures were described and 575 diluted with PBS and LDS Sample buffer- 525 approved by the Institutional Animal Care and 576 10% β-mercaptoethanol (Invitrogen

6 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.24.449787; this version posted June 24, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Danish dementia and excitatory transmission

577 NP0007) and 4.5M urea to 1µg/µl, loaded on 627 Primary hippocampal neuron culture- Rat 578 a 4-12% Bis-Tris polyacrylamide gel 628 hippocampal neurons were prepared from 579 (Biorad 3450125), and transferred onto 629 Itm2bw/w and Itm2bD/D post-natal day 1 pups. 580 nitrocellulose at 25V for 7min using the 630 Briefly, after removal of meninges, the 581 Trans-blot Turbo system (Biorad). Blotting 631 hippocampi were collected in HBSS without 582 efficiency was visualized by red Ponceau 632 magnesium and calcium, 1mM sodium 583 staining on membranes. For Dot-blot 633 pyruvate, 0.1%glucose, 10mM HEPES. 584 analysis 2.5 μg of material was directly 634 Hippocampi were dissected into single cell by 585 spotted with a p20 pipette on a nitrocellulose 635 trituration followed by 15 minutes incubation 586 membrane. Dot membrane was also 636 at 37°C in 0.25% trypsin. Cells were 587 visualized by red Ponceau after it was totally 637 subsequently treated with 0.1% DNAse 588 dried. Membranes were blocked in 5%-milk 638 (Sigma, dn25) in plating media (BME, 10% 589 (Biorad 1706404) for 30 minutes and 639 FBS, 0.09% Glucose, 1mM Sodium Pyruvate, 590 washed in PBS/Tween20-0.05%. Primary 640 2mM Glutamine, 1x Pen/Strep). Cells were 591 antibodies were applied dilution in blocking 641 filtered through a Falcon 70µm nylon cell 592 solution (Thermo 37573). The following 642 strainer and were plated in Poly L lysine 593 antibodies were used: Polyclonal anti-Bri2 643 pretreated 12-well-plate (300,000 cells/well) 594 serum test bleeds provided by Cell Signaling 644 in Neurobasal media, 1x B-27, 2mM 595 Technology was used at 1:500 with 645 glutamine, 1x Pen/Strep. Half of the culture 596 overnight shaking at 4℃. APP-Y188 646 media was changed every 2 days. 597 (Abcam32136), Oligomer Aβ A11 (shared 647 Pharmacological treatment and sample 598 by Rakez Kayed’s Lab), LC3A (CST 4599) 648 preparation- After 9 days in culture, primary 599 and LC3B (CST 2775) were used at 1:1000 649 neurons were treated with 50µM Chloroquine 600 with same other condition. Secondary 650 (Cell signaling, 14774s) or PBS (Veh) for 18 601 antibodies [either anti-mouse (Southern 651 hours. After treatment, cells were washed with 602 Biotech 1031-05) or a 1:1 mix of anti-rabbit 652 PBS and lysed in RIPA buffer with 603 (Southern Biotech, OB405005) and anti- 653 protease/phosphatase inhibitor for 15 minutes 604 rabbit (Cell Signaling, 7074)], were diluted 654 on ice. Lysed cells were centrifuged at full 605 1:1000 in 5% milk and used against either 655 speed for 15 minutes. Cell lysates were 606 mouse or rabbit primary antibodies for 1 656 quantified and analyzed by Western blot as 607 hour at RT, with shaking. Membranes were 657 described earlier for brain lysates. 608 washed with PBS/Tween20-0.05% (3 times, 658 Electrophysiological recording- These 609 10 minutes each time), developed with West 659 procedures were performed as previously 610 Dura ECL reagent (Thermo, PI34076) and 660 described (44). Briefly, rats were anesthetized 611 visualized on a ChemiDoc MP Imaging 661 with isoflurane and perfused intracardially 612 System (Biorad). Signal intensity was 662 with an ice-cold cutting solution containing (in 613 quantified with Image Lab software 663 mM) 120 choline chloride, 2.6 KCl, 26 NaH 614 (Biorad). Data were analyzed using Prism 664 CO3, 1.25 NaH2PO4, 0.5 CaCl2, 7 MgCl2, 1.3 615 software and represented as mean ± SD. 665 ascorbic acid, 15 glucose, prebubbled with 616 For analysis of human Aβ peptides and 666 95% O2/5% CO2 for 15 min. The brains were 617 sAPPa/sAPPb, brain lysates were diluted at 667 rapidly removed from the skull and coronal 618 4µg/µl. Aβ38, Aβ40, and Aβ42 were 668 brain slices containing the hippocampal 619 measured with V-PLEX Plus Aβ Peptide 669 formation (350μm thick) were prepared in the 620 Panel 1 6E10 (K15200G, Meso Scale 670 ice-cold cutting solution bubbled with 95% 621 Discovery) and sAPPa/sAPPb were 671 O2/5% CO2 using Vibratome VT1200S (Leica 622 measured with sAPPα/sAPPβ (K15120E, 672 Microsystems) and then incubated in an 623 Meso Scale Discovery). Plates were read on 673 interface chamber in ACSF containing (in 624 a MESO QuickPlex SQ 120. Aβ43 was 674 mM): 126 NaCl, 3 KCl, 1.2 NaH2PO4; 1.3 625 quantified using the IBL human Aβ43 Assay 675 MgCl2, 2.4 CaCl2, 26 NaHCO3, and 10 glucose 626 Kit #27710. 676 (at pH 7.3), bubbled with 95% O2 and 5% CO2

7 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.24.449787; this version posted June 24, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Danish dementia and excitatory transmission

677 at 30°C for 1hr and then kept at room 727 of 5μM NBQX to block AMPAR. Mini 678 temperature. The hemi-slices were transferred 728 EPSCs were recorded by maintaining neurons 679 to a recording chamber perfused with ACSF at 729 at -70 mV with ACSF containing action 680 a flow rate of ~2ml/min using a peristaltic 730 potentials blocker (1μM TTX) and GABA-A 681 pump. Experiments were performed at 28.0 ± 731 receptors inhibitors (15μM bicuculline 682 0.1°C. 732 methiodide). mEPSCs were recorded for ~10 683 Whole-cell recordings in the voltage- 733 mins. Data were collected with Axopatch 684 clamp mode(-70 mv) were made with patch 734 700B amplifiers and analyzed with 685 pipettes containing (in mM): 132.5 Cs- 735 pCLAMP10 software (Molecular Devices). 686 gluconate, 17.5 CsCl, 2 MgCl2, 0.5 EGTA, 10 736 mEPSCs are analyzed using mini–Analysis 687 HEPES, 4 ATP, and 5 QX-314, with pH 737 Program. 688 adjusted to 7.3 by CsOH. Patch pipettes 738 Statistics- All the experiments mentioned 689 (resistance, 8–10 MΩ) were pulled from 1.5 739 in the paper were analyzed by one-way 690 mm thin-walled borosilicate glass (Sutter 740 ANOVA or two-way ANOVA as indicated. 691 Instruments, Novato, CA) on a horizontal 741 Data showing statistical significance by one- 692 puller (model P-97; Sutter Instruments, 742 way ANOVA or two-way ANOVA were 693 Novato, CA). Basal synaptic responses were 743 subsequently analyzed by either Tukey's 694 evoked at 0.05 Hz by electrical stimulation of 744 multiple comparisons test or Sidak's multiple 695 the Schaffer collateral afferents using 745 comparisons. All statistical analyses were 696 concentric bipolar electrodes. CA1 neurons 746 performed using Prism 9 (GraphPad) software. 697 were viewed under upright microscopy (FN-1, 747 698 Nikon Instruments, Melville, NY) and 748 Acknowledgement- All authors read and 699 recorded with Axopatch-700B amplifier 749 approved the final manuscript. 700 (Molecular Devices, San Jose, CA). Data were 750 Declarations-The datasets used and/or 701 low-pass filtered at 2 kHz and acquired at 5– 751 analyzed during the current study are available 702 10 kHz. The series resistance (Rs) was 752 from the corresponding author on reasonable 703 consistently monitored during recording in 753 request. 704 case of reseal of ruptured membrane. Cells 754 Conflicts of interest-The authors declare 705 with Rs >20 MΩ or with Rs deviated by >20% 755 that they have no competing interests. 706 from initial values were excluded from 756 Author Contributions- LD generated the 707 analysis. Excitatory postsynaptic currents 757 animals; KAN set up breeding and genotyped 708 (EPSCs) were recorded in ACSF containing 758 animals; TY performed the biochemical and 709 the GABA-A receptors inhibitor bicuculline 759 molecular experiments; WY performed the 710 methiodide (15μM). The stimulation intensity 760 electrophysiology experiments; All authors 711 was adjusted to evoke EPSCs that were 40% 761 designed the experiments; LD and TY wrote 712 of the maximal evoked amplitudes (“test 762 the paper. 713 intensity”). 5–10 min after membrane rupture, 763 L.D. was funded by the NIH/NIA 714 EPSCs were recorded for 7 minutes at a test 764 R01AG063407, RF1AG064821, 715 stimulation intensity that produced currents of 765 1R01AG033007 716 ~40% maximum. For recording of paired- 766 717 pulse ratio (PPR), paired-pulse stimuli with 767 References 718 50ms or 200ms inter-pulse interval were 768 1. Tamayev, R., Matsuda, S., Fa, M., 719 given. The PPR was calculated as the ratio of 769 Arancio, O., and D'Adamio, L. 720 the second EPSC amplitude to the first. For 770 (2010) Danish dementia mice 721 recording of AMPA/NMDA ratio, the 771 722 membrane potential was firstly held at-70 mV suggest that loss of function and 723 to record only AMPAR current for 20 sweeps 772 not the amyloid cascade causes 724 with 20s intervals. Then the membrane 773 synaptic plasticity and memory 725 potential was turned to +40 mV to record 774 deficits. Proc Natl Acad Sci U S A 726 NMDAR current for 20 sweeps with perfusion 775 107, 20822-20827

8 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.24.449787; this version posted June 24, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Danish dementia and excitatory transmission

776 2. Tamayev, R., Giliberto, L., Li, W., 819 10. Leuzy, A., Zimmer, E. R., Heurling, 777 d'Abramo, C., Arancio, O., Vidal, 820 K., Rosa-Neto, P., and Gauthier, S. 778 R., and D'Adamio, L. (2010) 821 (2014) Use of amyloid PET across 779 Memory deficits due to familial 822 the spectrum of Alzheimer's 780 British dementia BRI2 mutation 823 disease: clinical utility and 781 are caused by loss of BRI2 function 824 associated ethical issues. Amyloid 782 rather than . J Neurosci 825 21, 143-148 783 30, 14915-14924 826 11. Zimmer, E. R., Leuzy, A., Gauthier, 784 3. Giliberto, L., Matsuda, S., Vidal, R., 827 S., and Rosa-Neto, P. (2014) 785 and D'Adamio, L. (2009) 828 Developments in Tau PET Imaging. 786 Generation and initial 829 Can J Neurol Sci 41, 547-553 787 characterization of FDD knock in 830 12. Andreadis, A. (2005) Tau gene 788 mice. PLoS One 4, e7900 831 alternative splicing: expression 789 4. Deacon, R. M. (2006) Housing, 832 patterns, regulation and 790 husbandry and handling of rodents 833 modulation of function in normal 791 for behavioral experiments. Nat 834 brain and neurodegenerative 792 Protoc 1, 936-946 835 diseases. Biochim Biophys Acta 793 5. Whishaw, I. Q., Metz, G. A., Kolb, 836 1739, 91-103 794 B., and Pellis, S. M. (2001) 837 13. Janke, C., Beck, M., Stahl, T., 795 Accelerated nervous system 838 Holzer, M., Brauer, K., Bigl, V., and 796 development contributes to 839 Arendt, T. (1999) Phylogenetic 797 behavioral efficiency in the 840 diversity of the expression of the 798 : a behavioral 841 microtubule-associated protein 799 review and theoretical proposal. 842 tau: implications for 800 Dev Psychobiol 39, 151-170 843 neurodegenerative disorders. 801 6. Kepecs, A., Uchida, N., Zariwala, H. 844 Brain Res Mol Brain Res 68, 119- 802 A., and Mainen, Z. F. (2008) Neural 845 128 803 correlates, computation and 846 14. Hong, M., Zhukareva, V., 804 behavioural impact of decision 847 Vogelsberg-Ragaglia, V., Wszolek, 805 confidence. Nature 455, 227-231 848 Z., Reed, L., Miller, B. I., 806 7. Foote, A. L., and Crystal, J. D. 849 Geschwind, D. H., Bird, T. D., 807 (2007) Metacognition in the rat. 850 McKeel, D., Goate, A., Morris, J. C., 808 Curr Biol 17, 551-555 851 Wilhelmsen, K. C., Schellenberg, G. 809 8. Bartelle, B. B., Barandov, A., and 852 D., Trojanowski, J. Q., and Lee, V. 810 Jasanoff, A. (2016) Molecular 853 M. (1998) Mutation-specific 811 fMRI. J Neurosci 36, 4139-4148 854 functional impairments in distinct 812 9. Zimmer, E. R., Leuzy, A., Bhat, V., 855 tau isoforms of hereditary FTDP- 813 Gauthier, S., and Rosa-Neto, P. 856 17. Science 282, 1914-1917 814 (2014) In vivo tracking of tau 857 15. Roberson, E. D., Scearce-Levie, K., 815 pathology using positron emission 858 Palop, J. J., Yan, F., Cheng, I. H., 816 tomography (PET) molecular 859 Wu, T., Gerstein, H., Yu, G. Q., and 817 imaging in small animals. Transl 860 Mucke, L. (2007) Reducing 818 Neurodegener 3, 6 861 endogenous tau ameliorates 862 -induced deficits in an

9 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.24.449787; this version posted June 24, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Danish dementia and excitatory transmission

863 Alzheimer's disease mouse model. 907 Schofield, P. W., Brodaty, H., 864 Science 316, 750-754 908 Martins, R. N., Kwok, J. B., and 865 16. Spillantini, M. G., and Goedert, M. 909 Schofield, P. R. (2003) Mutations 866 (1998) Tau protein pathology in 910 in the tau gene that cause an 867 neurodegenerative diseases. 911 increase in three repeat tau and 868 Trends Neurosci 21, 428-433 912 frontotemporal dementia. Brain 869 17. Goedert, M., Crowther, R. A., and 913 126, 814-826 870 Spillantini, M. G. (1998) Tau 914 21. Yasuda, M., Takamatsu, J., 871 mutations cause frontotemporal 915 D'Souza, I., Crowther, R. A., 872 dementias. Neuron 21, 955-958 916 Kawamata, T., Hasegawa, M., 873 18. Grundke-Iqbal, I., Iqbal, K., Tung, Y. 917 Hasegawa, H., Spillantini, M. G., 874 C., Quinlan, M., Wisniewski, H. M., 918 Tanimukai, S., Poorkaj, P., Varani, 875 and Binder, L. I. (1986) Abnormal 919 L., Varani, G., Iwatsubo, T., 876 phosphorylation of the 920 Goedert, M., Schellenberg, D. G., 877 microtubule-associated protein 921 and Tanaka, C. (2000) A novel 878 tau (tau) in Alzheimer cytoskeletal 922 mutation at position +12 in the 879 pathology. Proc Natl Acad Sci U S A 923 intron following exon 10 of the tau 880 83, 4913-4917 924 gene in familial frontotemporal 881 19. Hutton, M., Lendon, C. L., Rizzu, P., 925 dementia (FTD-Kumamoto). Ann 882 Baker, M., Froelich, S., Houlden, 926 Neurol 47, 422-429 883 H., Pickering-Brown, S., 927 22. Kowalska, A., Hasegawa, M., 884 Chakraverty, S., Isaacs, A., Grover, 928 Miyamoto, K., Akiguchi, I., 885 A., Hackett, J., Adamson, J., 929 Ikemoto, A., Takahashi, K., Araki, 886 Lincoln, S., Dickson, D., Davies, P., 930 W., and Tabira, T. (2002) A novel 887 Petersen, R. C., Stevens, M., de 931 mutation at position +11 in the 888 Graaff, E., Wauters, E., van Baren, 932 intron following exon 10 of the tau 889 J., Hillebrand, M., Joosse, M., 933 gene in FTDP-17. J Appl Genet 43, 890 Kwon, J. M., Nowotny, P., Che, L. 934 535-543 891 K., Norton, J., Morris, J. C., Reed, L. 935 23. Grover, A., England, E., Baker, M., 892 A., Trojanowski, J., Basun, H., 936 Sahara, N., Adamson, J., Granger, 893 Lannfelt, L., Neystat, M., Fahn, S., 937 B., Houlden, H., Passant, U., Yen, S. 894 Dark, F., Tannenberg, T., Dodd, P. 938 H., DeTure, M., and Hutton, M. 895 R., Hayward, N., Kwok, J. B., 939 (2003) A novel tau mutation in 896 Schofield, P. R., Andreadis, A., 940 exon 9 (1260V) causes a four- 897 Snowden, J., Craufurd, D., Neary, 941 repeat tauopathy. Exp Neurol 184, 898 D., Owen, F., Oostra, B. A., Hardy, 942 131-140 899 J., Goate, A., van Swieten, J., 943 24. Hanes, J., Zilka, N., Bartkova, M., 900 Mann, D., Lynch, T., and Heutink, 944 Caletkova, M., Dobrota, D., and 901 P. (1998) Association of missense 945 Novak, M. (2009) Rat tau 902 and 5'-splice-site mutations in tau 946 proteome consists of six tau 903 with the inherited dementia FTDP- 947 isoforms: implication for animal 904 17. Nature 393, 702-705 948 models of human tauopathies. J 905 20. Stanford, P. M., Shepherd, C. E., 949 Neurochem 108, 1167-1176 906 Halliday, G. M., Brooks, W. S.,

10 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.24.449787; this version posted June 24, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Danish dementia and excitatory transmission

950 25. McMillan, P., Korvatska, E., 993 30. Matsuda, S., Tamayev, R., and 951 Poorkaj, P., Evstafjeva, Z., 994 D'Adamio, L. (2011) Increased 952 Robinson, L., Greenup, L., 995 AβPP processing in familial Danish 953 Leverenz, J., Schellenberg, G. D., 996 dementia patients. J Alzheimers 954 and D'Souza, I. (2008) Tau isoform 997 Dis 27, 385-391 955 regulation is region- and cell- 998 31. Tamayev, R., Matsuda, S., 956 specific in mouse brain. J Comp 999 Giliberto, L., Arancio, O., and 957 Neurol 511, 788-803 1000 D'Adamio, L. (2011) APP 958 26. Matsuda, S., Giliberto, L., 1001 heterozygosity averts memory 959 Matsuda, Y., Davies, P., McGowan, 1002 deficit in knockin mice expressing 960 E., Pickford, F., Ghiso, J., 1003 the Danish dementia BRI2 mutant. 961 Frangione, B., and D'Adamio, L. 1004 EMBO J 30, 2501-2509 962 (2005) The familial dementia BRI2 1005 32. Tamayev, R., and D'Adamio, L. 963 gene binds the Alzheimer gene 1006 (2012) Inhibition of γ-secretase 964 amyloid-beta precursor protein 1007 worsens memory deficits in a 965 and inhibits amyloid-beta 1008 genetically congruous mouse 966 production. J Biol Chem 280, 1009 model of Danish dementia. Mol 967 28912-28916 1010 Neurodegener 7, 19 968 27. Fotinopoulou, A., Tsachaki, M., 1011 33. Tamayev, R., and D'Adamio, L. 969 Vlavaki, M., Poulopoulos, A., 1012 (2012) Memory deficits of British 970 Rostagno, A., Frangione, B., Ghiso, 1013 dementia knock-in mice are 971 J., and Efthimiopoulos, S. (2005) 1014 prevented by Aβ-precursor protein 972 BRI2 interacts with amyloid 1015 haploinsufficiency. J Neurosci 32, 973 precursor protein (APP) and 1016 5481-5485 974 regulates amyloid beta (Abeta) 1017 34. Tamayev, R., Matsuda, S., Arancio, 975 production. J Biol Chem 280, 1018 O., and D'Adamio, L. (2012) β- but 976 30768-30772 1019 not γ-secretase proteolysis of APP 977 28. Matsuda, S., Giliberto, L., 1020 causes synaptic and memory 978 Matsuda, Y., McGowan, E. M., and 1021 deficits in a mouse model of 979 D'Adamio, L. (2008) BRI2 inhibits 1022 dementia. EMBO Mol Med 4, 171- 980 amyloid beta-peptide precursor 1023 179 981 protein processing by interfering 1024 35. Lombino, F., Biundo, F., Tamayev, 982 with the docking of secretases to 1025 R., Arancio, O., and D'Adamio, L. 983 the substrate. J Neurosci 28, 8668- 1026 (2013) An intracellular threonine 984 8676 1027 of amyloid-β precursor protein 985 29. Matsuda, S., Matsuda, Y., Snapp, 1028 mediates synaptic plasticity 986 E. L., and D'Adamio, L. (2011) 1029 deficits and memory loss. PLoS 987 Maturation of BRI2 generates a 1030 One 8, e57120 988 specific inhibitor that reduces APP 1031 36. Biundo, F., Ishiwari, K., Del Prete, 989 processing at the plasma 1032 D., and D'Adamio, L. (2016) 990 membrane and in endocytic 1033 Deletion of the γ-secretase 991 vesicles. Neurobiol Aging 32, 1400- 1034 subunits Aph1B/C impairs memory 992 1408 1035 and worsens the deficits of knock- 1036 in mice modeling the Alzheimer-

11 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.24.449787; this version posted June 24, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Danish dementia and excitatory transmission

1037 like familial Danish dementia. 1080 43. Ren, S., Breuillaud, L., Yao, W., Yin, 1038 Oncotarget 7, 11923-11944 1081 T., Norris, K. A., Zehntner, S. P., 1039 37. Tambini, M. D., Yao, W., and 1082 and D'Adamio, L. (2020) TNF-α- 1040 D'Adamio, L. (2019) Facilitation of 1083 mediated reduction in inhibitory 1041 glutamate, but not GABA, release 1084 neurotransmission precedes 1042 in Familial Alzheimer's APP mutant 1085 sporadic Alzheimer's disease 1043 Knock-in rats with increased β- 1086 pathology in young. J Biol Chem 1044 cleavage of APP. Aging Cell 18, 1087 44. Ren, S., Yao, W., Tambini, M. D., 1045 e13033 1088 Yin, T., Norris, K. A., and D'Adamio, 1046 38. Tambini, M. D., Norris, K. A., and 1089 L. (2020) Microglia TREM2 R47H 1047 D'Adamio, L. (2020) Opposite 1090 Alzheimer-linked variant enhances 1048 changes in APP processing and 1091 excitatory transmission and 1049 human Aβ levels in rats carrying 1092 reduces LTP via increased TNF-α 1050 either a protective or a pathogenic 1093 levels. Elife 9 1051 APP mutation. Elife 9 1094 45. Shankar, G. M., Li, S., Mehta, T. H., 1052 39. Vidal, R., Revesz, T., Rostagno, A., 1095 Garcia-Munoz, A., Shepardson, N. 1053 Kim, E., Holton, J. L., Bek, T., 1096 E., Smith, I., Brett, F. M., Farrell, 1054 Bojsen-Møller, M., Braendgaard, 1097 M. A., Rowan, M. J., Lemere, C. A., 1055 H., Plant, G., Ghiso, J., and 1098 Regan, C. M., Walsh, D. M., 1056 Frangione, B. (2000) A decamer 1099 Sabatini, B. L., and Selkoe, D. J. 1057 duplication in the 3' region of the 1100 (2008) Amyloid-beta protein 1058 BRI gene originates an amyloid 1101 dimers isolated directly from 1059 peptide that is associated with 1102 Alzheimer's brains impair synaptic 1060 dementia in a Danish kindred. Proc 1103 plasticity and memory. Nat Med 1061 Natl Acad Sci U S A 97, 4920-4925 1104 14, 837-842 1062 40. Choi, S. I., Vidal, R., Frangione, B., 1105 46. Kayed, R., Head, E., Thompson, J. 1063 and Levy, E. (2004) Axonal 1106 L., McIntire, T. M., Milton, S. C., 1064 transport of British and Danish 1107 Cotman, C. W., and Glabe, C. G. 1065 amyloid peptides via secretory 1108 (2003) Common structure of 1066 vesicles. FASEB J 18, 373-375 1109 soluble amyloid oligomers implies 1067 41. Yin, T., Yao, W., Lemenze, A. D., 1110 common mechanism of 1068 and D'Adamio, L. (2020) Danish 1111 pathogenesis. Science 300, 486- 1069 and British dementia ITM2b/BRI2 1112 489 1070 mutations reduce BRI2 protein 1113 47. Yao, W., Yin, T., Tambini, M. D., 1071 stability and impair glutamatergic 1114 and D'Adamio, L. (2019) The 1072 synaptic transmission. J Biol Chem 1115 Familial dementia gene 1073 42. Tambini, M. D., and D'Adamio, L. 1116 ITM2b/BRI2 facilitates glutamate 1074 (2020) Trem2 Splicing and 1117 transmission via both presynaptic 1075 Expression are Preserved in a 1118 and postsynaptic mechanisms. Sci 1076 Human Abeta-producing, Rat 1119 Rep 9, 4862 1077 Knock-in Model of Trem2-R47H 1120 48. Zucker, R. S., and Regehr, W. G. 1078 Alzheimer's Risk Variant. Sci Rep 1121 (2002) Short-term synaptic 1079 10, 4122 1122 plasticity. Annu Rev Physiol 64, 1123 355-405

12 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.24.449787; this version posted June 24, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Danish dementia and excitatory transmission

1124 49. Barbagallo, A. P., Wang, Z., Zheng, 1158 54. Tambini, M. D., and D'Adamio, L. 1125 H., and D'Adamio, L. (2011) The 1159 (2020) Knock-in rats with 1126 intracellular threonine of amyloid 1160 homozygous PSEN1 L435F Alzheimer 1127 precursor protein that is essential 1161 mutation are viable and show 1128 for docking of Pin1 is dispensable 1162 selective γ-secretase activity loss 1129 for developmental function. PLoS 1163 causing low Aβ40/42 and high 1130 One 6, e18006 1164 Aβ43. J Biol Chem 295, 7442-7451 1131 50. Barbagallo, A. P., Wang, Z., Zheng, 1165 55. Yao, W., Tambini, M. D., Liu, X., 1132 H., and D'Adamio, L. (2011) A 1166 and D'Adamio, L. (2019) Tuning of 1133 single tyrosine residue in the 1167 Glutamate, But Not GABA, Release 1134 amyloid precursor protein 1168 by an Intrasynaptic Vesicle APP 1135 intracellular domain is essential for 1169 Domain Whose Function Can Be 1136 developmental function. J Biol 1170 Modulated by β- or α-Secretase 1137 Chem 286, 8717-8721 1171 Cleavage. J Neurosci 39, 6992- 1138 51. Barbagallo, A. P., Weldon, R., 1172 7005 1139 Tamayev, R., Zhou, D., Giliberto, L., 1173 56. Fanutza, T., Del Prete, D., Ford, M. 1140 Foreman, O., and D'Adamio, L. 1174 J., Castillo, P. E., and D'Adamio, L. 1141 (2010) Tyr(682) in the intracellular 1175 (2015) APP and APLP2 interact 1142 domain of APP regulates 1176 with the synaptic release 1143 amyloidogenic APP processing in 1177 machinery and facilitate 1144 vivo. PLoS One 5, e15503 1178 transmitter release at 1145 52. Garringer, H. J., Murrell, J., 1179 hippocampal synapses. Elife 4, 1146 D'Adamio, L., Ghetti, B., and Vidal, 1180 e09743 1147 R. (2010) Modeling familial British 1181 57. Del Prete, D., Lombino, F., Liu, X., 1148 and Danish dementia. Brain Struct 1182 and D'Adamio, L. (2014) APP is 1149 Funct 214, 235-244 1183 cleaved by Bace1 in pre-synaptic 1150 53. Ren, S., Breuillaud, L., Yao, W., Yin, 1184 vesicles and establishes a pre- 1151 T., Norris, K. A., Zehntner, S. P., 1185 synaptic interactome, via its 1152 and D'Adamio, L. (2020) TNF-α- 1186 intracellular domain, with 1153 mediated reduction in inhibitory 1187 molecular complexes that regulate 1154 neurotransmission precedes 1188 pre-synaptic vesicles functions. 1155 sporadic Alzheimer's disease 1189 PLoS One 9, e108576 1156 pathology in young Trem2 R47H 1190 1157 rats. J Biol Chem 296, 100089 1191 1192

13 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.24.449787; this version posted June 24, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Danish dementia and excitatory transmission

1193 Figure legends

1194 1195 Figure 1. Characterization of Itm2bD KI rats. (A) Sequences of the COOH-terminus of Bri2-23 (WT) 1196 and Bri2-ADan (Danish). (B) PCR amplification and sequencing of the Itm2b gene exon 6 from Itm2bw/w 1197 and Itm2bD/D rats shows that the Danish mutation was correctly inserted in the Itm2b exon 6 of Itm2bD/D 1198 rats. This mutation causes the predicted frameshift in the BRI2 sequence generating a precursor protein 11 1199 amino acids larger-than-normal coding for the Bri2-ADan mutant protein (partial DNA sequences of WT 1200 and Danish exon 6 are shown. Inserted nucleotides are highlighted in black, and the amino-acid sequences 1201 are indicated above -for the Danish mutant allele- and below -for the WT allele- the DNA sequences). 1202 (C) Levels of Itm2b mRNA in brains of 21 days old Itm2bw/w and Itm2bD/D rats were determined by 1203 Standard-RNAseq analysis. No significant differences between Itm2bw/w and Itm2bD/D rats were evident. 1204 Data are represented as mean ± SD. Data were analyzed by Student’s t-test. N=4 rats per genotype. 1205

14 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.24.449787; this version posted June 24, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Danish dementia and excitatory transmission

1206 1207 Figure 2. Distinct degradation pathways of Bri2-23 and Bri2-ADan in Itm2bw/w and Itm2bD/D 1208 primary neurons. WB analysis of Bri2 (A) and LC3A/B (B) from primary hippocampal neurons isolated 1209 from Itm2bw/w and Itm2bD/D P1 pups treated with 50µM chloroquine for 18h. (C) Quantification of 1210 LC3A/B and Bri2 levels. Data are represented as mean ± SD and analyzed by ordinary two-way ANOVA 1211 followed by post-hoc Sidak's multiple comparisons test when ANOVA showed significant differences. 1212 ANOVA summary: LC3A: Finteraction (1,20)=37.36, P<0.0001, Ftreatment (1,20)=353.5, P<0.0001, Fgenotype w/w 1213 (1,20)=36.16, P<0.0001. Post-hoc Sidak's multiple comparisons test: Itm2b : vehicle (veh) vs Chloroquine D/D 1214 (Chlor), P<0.0001****, Itm2b : veh vs Chlor, P<0.0001****. LC3B: Finteraction (1,20)=8.11, P<0.01, Ftreatment w/w 1215 (1,20)=26.75, P<0.0001, Fgenotype (1,20)=8.283, P<0.01, post-hoc Sidak's multiple comparisons test: Itm2b : D/D 1216 veh vs Chlor, P=0.2185, Itm2b : veh vs Chlor, P<0.0001****. ImBri2: Finteraction (1,20)=272.2, P<0.0001, 1217 Ftreatment (1,20)=354.3, P<0.0001****, Fgenotype (1,20)=1966, P<0.0001****, post-hoc Sidak's multiple 1218 comparisons test: Itm2bw/w: veh vs Chlor, P=0.5229, Itm2bD/D: veh vs Chlor, P<0.0001****. No 1219 treatment: Itm2bw/w vs Itm2bD/D, P<0.0001****. Chlor treatment: Itm2bw/w vs Itm2bD/D, P<0.0001****. 1220 mBri2: Finteraction (1,20)=207.4, P<0.0001, Ftreatment (1,20)=186.9, P<0.0001, Fgenotype (1,20)=228.5, P<0.0001, post- 1221 hoc Sidak's multiple comparisons test: Itm2bw/w: veh vs Chlor, P<0.0001****, Itm2bD/D: veh vs Chlor, 1222 P=0.9966. No treatment: Itm2bw/w vs Itm2bD/D, P=0.9969 ns. Chlor treatment: Itm2bw/w vs Itm2bD/D, 1223 P<0.0001****. imBri2/mBri2 Ratio: Finteraction (1,20)=108.3, P<0.0001, Ftreatment (1,20)=104.2, P<0.0001, Fgenotype w/w 1224 (1,20)=627.1, P<0.0001, post-hoc Sidak's multiple comparisons test: Itm2b : veh vs Chlor, P>0.9999, 1225 Itm2bD/D: veh vs Chlor, , P<0.0001****. No treatment: Itm2bw/w vs Itm2bD/D, P<0.0001****, Chlor 1226 treatment: Itm2bw/w vs Itm2bD/D, P<0.0001****. 1227

15 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.24.449787; this version posted June 24, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Danish dementia and excitatory transmission

1228 1229 Figure 3. APP metabolite levels in Itm2bD KI rats. Data are represented as mean ± SD and were 1230 analyzed by ordinary one-way ANOVA followed by post-hoc Tukey's multiple comparisons test when 1231 ANOVA showed statistically significant differences. We analyzed 8 weeks old rats, and 5 female and 5 1232 male rats per genotype. (A) Levels of full-length APP, αCTF, and βCTF, were determined by Western 1233 analysis of brain lysate of Itm2bD/D, Itm2bD/w and Itm2bw/w male and female rats. (B) Quantitation of 1234 Western blots. Signal intensity of APP metabolites were normalized to red ponceau staining of 1235 nitrocellulose membranes. ANOVA summary: mAPP, F(2, 27) = 0.7931, P=0.4627; imAPP, F(2, 27) = 1.367,

1236 P=0.2720; a-CTF, F(2, 27) = 0.6075, P=0.5520; b-CTF, F(2, 27) = 1.614, P=0.2177). (C) Levels of sAPPα, 1237 sAPPβ, Aβ38, Aβ40, Aβ42 and Aβ43 were determined by ELISA of brain lysate from the same Itm2bD/D, D/w w/w 1238 Itm2b and Itm2b male and female rats. [ANOVA summary: sAPPα, F(2, 27) = 0.1084, P=0.8977; 1239 sAPPβ, F(2, 27) = 0.7666, P=0.4744; Aβ38, F(2, 27) = 0.1121, P=0.8943; Aβ40, F(2, 27) = 2.030, P=0.1509; w/w D/w 1240 Aβ42, F(2, 27) = 4.764, P=0.0169 (post-hoc Tukey's multiple comparisons test: Itm2b vs Itm2b , w/w D/D D/w D/D 1241 P=0.6966, Itm2b vs Itm2b , P=0.0159*; Itm2b vs Itm2b , P=0.0948); Aβ43, F(2, 26) = 2.654, w/w 1242 P=0.0893; Aβ42/Aβ40, F(2, 27) = 4.074, P=0.0284 (post-hoc Tukey's multiple comparisons test: Itm2b vs D/w w/w D/D D/w D/D 1243 Itm2b , P=0.8326, Itm2b vs Itm2b , P=0.0301*; Itm2b vs Itm2b , P=0.1022); Aβ43/Aβ40, F(2, 26) 1244 = 4.031, P=0.0299 (post-hoc Tukey's multiple comparisons test: Itm2bw/w vs Itm2bD/w, P=0.0802, Itm2bw/w D/D D/w D/D 1245 vs Itm2b , P=0.0347*; Itm2b vs Itm2b , P=0.9137); Aβ43/Aβ42, F(2, 26) = 3.281, P=0.0558]. 1246 P<0.05*; P<0.01**; P<0.001***; P<0.0001****. 1247

16 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.24.449787; this version posted June 24, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Danish dementia and excitatory transmission

1248 1249 Figure 4. Levels of human Aβ oligomeric species in the brain of peri-adolescent Itm2bD/D, Itm2bD/w 1250 and Itm2bw/w male and female rats. (A) We analyzed material from the same rats analyzed in Figure 3. 1251 Quantitation of dot-blots using the oligomer-specific antibody A11. Before immunoblot analysis, 1252 membranes were stained with Ponceau red. Quantitative analysis of A11 blot was normalized to the 1253 Ponceau red quantitative analysis. Data are represented as mean ± SD and were analyzed by ordinary one- 1254 way ANOVA followed by post-hoc Tukey's multiple comparisons test when ANOVA showed 1255 statistically significant differences. ANOVA summary: F(2, 27) = 4.593, P=0.0192*; post-hoc Tukey's 1256 multiple comparisons test: Itm2bw/w vs Itm2bD/w, P=0.6406, Itm2bw/w vs Itm2bD/D, P=0.1195; Itm2bD/w vs 1257 Itm2bD/D, P=0.0170*. 1258

17 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.24.449787; this version posted June 24, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Danish dementia and excitatory transmission

1259 1260 Figure 5. Glutamatergic synaptic transmission is reduced at hippocampal SC–CA3>CA1 1261 synapses of Itm2bD KI rats. Data are represented as mean ± SD and were analyzed by ordinary one-way 1262 ANOVA followed by post-hoc Tukey's multiple comparisons test when ANOVA showed significant 1263 differences. We uswd thw following animals: Itm2bw/w N=11 (4M/6, 3F/5, indicating that 6 recordings 1264 were obtained from the 4 males and 5 recordings from the 3 females ), Itm2bD/w N=15 (3M/7,4F/8), 1265 Itm2bD/D N=10(3M/5,3F/5). (A) Representative recording traces of mEPSC at SC–CA3>CA1 synapses. 1266 (B) The Danish mutation causes a significant decrease in mEPSC frequency [ANOVA summary, F(2, 33) = 1267 20.66, P<0.0001****; post-hoc Tukey's multiple comparisons test: Itm2bw/w vs Itm2bD/w, P=0.003**, 1268 Itm2bw/w vs Itm2bD/D, P<0.0001****; Itm2bD/w vs Itm2bD/D, P=0.0051**]. (C) Cumulative probability of 1269 AMPAR-mediated mEPSC frequency inter event intervals. (D) [ANOVA summary, F(2, 33) = 10.78, 1270 P=0.0002***; post-hoc Tukey's multiple comparisons test: Itm2bw/w vs Itm2bD/w, P=0.0016**; Itm2bw/w vs 1271 Itm2bD/D, P=0.0005***; Itm2bD/w vs Itm2bD/D, P=0.6691]. (E) Cumulative probability of AMPAR- 1272 mediated mEPSC amplitude. (F) In contrast, decay time of mEPSC was not significantly changed D/D D/w w/w 1273 [ANOVA summary, F(2, 33) = 1.292, P=0.2882]. (G) Average mEPSC of Itm2b , Itm2b and Itm2b D/D 1274 rats. (H) AMPA/NMDA ratio is significantly decreased in Itm2b rats [ANOVA summary, F(2, 16) = 1275 8.417, P=0.0032**; post-hoc Tukey's multiple comparisons test: Itm2bw/w vs Itm2bD/w, P=0.2393; Itm2bw/w 1276 vs Itm2bD/D, P=0.0023**; Itm2bD/w vs Itm2bD/D, P=0.0818]. Representative traces are shown on top of the 1277 graph (traces are averaged from 20 sweeps). Animals used: Itm2bw/w N=7 (4M/4,3F/3), Itm2bD/w N=6 1278 (3M/3,3F/3), Itm2bD/D N=6 (3M/3,3F/3). (I) Average PPF at 50ms (left panel) and 200ms (right panel) 1279 Inter stimulus Interval (ISI) shows that PPF is increased in Itm2bD/D rats ISI [50ms ISI PPF ANOVA w/w 1280 summary: F(2, 60) = 11.89, P<0.0001****; post-hoc Tukey's multiple comparisons test: Itm2b vs 1281 Itm2bD/w, P=0.2315; Itm2bw/w vs Itm2bD/D, P<0.0001****; Itm2bD/w vs Itm2bD/D, P=0.0031**. 200ms ISI w/w 1282 PPF ANOVA summary: F(2, 64) = 3.802, P=0.0275*; post-hoc Tukey's multiple comparisons test: Itm2b 1283 vs Itm2bD/w, P=0.4504; Itm2bw/w vs Itm2bD/D, P=0.0205*; Itm2bD/w vs Itm2bD/D, P=0.2462]. Representative 1284 traces are shown on top of the panels. P<0.05*; P<0.01**; P<0.001***; P<0.0001****. Animals used: 1285 Itm2bw/w N=18 (4M/10,3F/8), Itm2bD/w N=20 (3M/10,4F/10), Itm2bD/D N=17 (3M/8,3F/9). 1286

18