Novel Progestin Signaling Molecules in the Brain: Distribution, Regulation and Molecular Mechanism of Action

University of Massachusetts Amherst ScholarWorks@UMass Amherst

Open Access Dissertations

5-13-2011

Karlie A. Intlekofer University of Massachusetts Amherst

Follow this and additional works at: https://scholarworks.umass.edu/open_access_dissertations

Part of the Molecular and Cellular Neuroscience Commons

Recommended Citation Intlekofer, Karlie A., "Novel Progestin Signaling Molecules in the Brain: Distribution, Regulation and Molecular Mechanism of Action" (2011). Open Access Dissertations. 366. https://scholarworks.umass.edu/open_access_dissertations/366

This Open Access Dissertation is brought to you for free and open access by ScholarWorks@UMass Amherst. It has been accepted for inclusion in Open Access Dissertations by an authorized administrator of ScholarWorks@UMass Amherst. For more information, please contact [email protected].

NOVEL PROGESTIN SIGNALING MOLECULES IN THE BRAIN: DISTRIBUTION, REGULATION AND MOLECULAR MECHANISM OF ACTION

A Dissertation Presented

KARLIE A. INTLEKOFER

Submitted to the Graduate School of the University of Massachusetts Amherst in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

May 2011

Neuroscience and Behavior Program

NOVEL PROGESTIN SIGNALING MOLECULES IN THE BRAIN: DISTRIBUTION, REGULATION AND MOLECULAR MECHANISM OF ACTION

A Dissertation Presented

KARLIE A. INTLEKOFER

Approved as to style and content by:

______Sandra L. Petersen, Chair

______John J. Peluso, Member

______Pablo E. Visconti, Member

______Rolf O. Karlstrom, Member

______Jerry Meyer, Department Head Neuroscience and Behavior Program

DEDICATION

To Mom, Dad, Dan, Adrien, Jay and my closest friends, for their love and support

ACKNOWLEDGMENTS

I would like to thank Dr. Sandy Petersen, who has served as a supportive mentor and guided me through the doctorate and publishing process. Sandy has provided invaluable insight into my work while allowing me to explore many different techniques and approaches. Her ability to provide a challenging and creative work environment have allowed me to grow as a researcher and as an individual.

I would like to thank my labmates, past and present, in the Petersen lab: Eser

Yilmaz, Sudha Krishnan, Leah Aggison, Evelyn Santos, Sarah Fadden, Jinyan Cao, Lan

Ji, Michael Cunningham, and Drs. Maristela Poletini, Paula Moura, Javier Del Pino and

Kay Son. I give special thanks to Ted Hudgens, who taught me important techniques and shared ideas and advice. I am also very thankful for Michael Cunningham, Paula Moura,

Leah Aggison and Emily Merchasin for their unwaning friendship and support.

I am very grateful to Dr. Thomas Zoeller and members of his laboratory. In particular, Dave Sharlin, Judy Brewer, Ruby Bansal and Stephanie Giera have provided helpful insights that have aided in producing this work. I also want to recognize fellow

NSB graduate students Bryan Olson, Carrie Mahoney, Patrick Taylor and Thalia Gilbert for helpful insight and support, as well as thought-provoking discussions and laughter.

I am thankful to Drs. John J. Peluso, Pablo Visconti and Rolf Karlstrom for their generous gift of time and expertise as committee members. I thank the Neuroscience and

Behavior Program for providing a diverse research environment and their help and support in completing this work. Finally, I thank SAPAI and all associated staff for their support in organizing and writing this document.

v ABSTRACT

NOVEL PROGESTIN SIGNALING MOLECULES IN THE BRAIN:

DISTRIBUTION, REGULATION AND MOLECULAR

MECHANISM OF ACTION

MAY 2011

KARLIE A. INTLEKOFER, BS. COLORADO STATE UNIVERSITY

Ph.D., UNIVERSITY OF MASSACHUSETTS AMHERST

Directed by: Professor Sandra L. Petersen

Progesterone regulates female reproduction in many ways, yet it is still unclear how signals are conveyed through nuclear and extranuclear receptors. The traditional notion was that progesterone binds classical progesterone receptors to alter gene transcription. This view has been challenged by the discovery of additional progesterone signaling molecules important for progesterone actions in non-neural cells. In granulosa cells, the progesterone receptor membrane component 1 (Pgrmc1) mediates progesterone effects by forming a receptor complex with binding partner, Serpine mRNA binding protein 1, but it is unknown whether these molecules function similarly in the brain. To begin to address these issues, I investigated the neural role of Pgrmc1 in female mouse brain, rat brain and in neural cells. By examining the neuroanatomical localization, hormonal regulation, and colocalization of Pgrmc1 within key neurons in the neural control of ovulation, Pgrmc1 emerged as a candidate signaling molecule likely to mediate progesterone functions. Furthermore, Pgrmc1 levels regulate the expression of several diverse genes and signaling pathways in neural cells. Taken together, these results demonstrate that Pgrmc1 function is likely to impact diverse neural functions.

vi TABLE OF CONTENTS

Page

ABSTRACT ...... vi

LIST OF TABLES ...... xiv

LIST OF FIGURES ...... xv

CHAPTER

1. PROGESTIN MECHANISM OF ACTION IN THE CNS ...... 1

1.1 Introduction ...... 1

1.2 Sources and Synthesis ...... 1

1.2.1 Progesterone Biosynthetic Pathway ...... 2

1.3 Effects of P 4 in the Central Nervous System ...... 4

1.3.1 Neuroprotection ...... 4

1.3.2 Reproductive Functions ...... 5

1.4 The Classical Progesterone Receptor (Pgr) ...... 7

1.5 Progesterone Receptor Membrane Component-1 (Pgrmc1) ...... 9

1.6 References ...... 13

2. DISTRIBUTION OF MRNAS ENCODING CLASSICAL PROGESTIN RECEPTOR, PROGESTERONE MEMBRANE COMPONENTS 1 AND 2, SERPINE MRNA BINDING PROTEIN 1, AND PROGESTIN AND ADIPOQ RECEPTOR FAMILY MEMBERS 7 AND 8 IN RAT FOREBRAIN ...... 24

2.1 Abstract ...... 24

2.2 Introduction ...... 25

2.3 Materials and Methods ...... 27

2.3.1 Animals and Tissue Preparation ...... 27

2.3.2 Probe Preparation ...... 28

vii 2.3.3 ISHH ...... 28

2.3.4 Validation of probe specificity...... 29

2.3.5 Data Analysis ...... 30

2.4 Results ...... 31

2.4.1 Probe Specificity ...... 31

2.4.2 Distribution of Pgrmc1, Serbp1, Pgrmc2, Paqr7, Paqr8 and

Pgr mRNAs ...... 31

2.4.3 Diencephalon ...... 31

2.4.4 Telencephalon ...... 32

2.5 Discussion ...... 33

2.6 List of Tables ...... 40

2.6.1 Sequences for Oligodeoxynucleotidyl Probes Used in ISHH

Studies ...... 40

2.6.2 Oligodeoxynucleotidyl Sequences for ISHH Validation

Studies ...... 41

2.6.3 Localization and Abundance of mRNA encoding Pgr,

Pgrmc1, Serbp1, Pgrmc2, Paqr7 and Paqr8 in Female Rat

Forebrain 1 ...... 41

2.7 List of Figures

2.7.1 Photomicrographs of ISHH...... 43

2.7.2 Photomicrographs of ISHH...... 44

2.7.3 Photomicrographs of ISHH...... 45

2.8 References ...... 46

viii 3. 17 Β-ESTRADIOL AND PROGESTERONE REGULATE PROGESTIN SIGNALING MOLECULES IN THE ANTEROVENTRAL PERIVENTRICULAR NUCLEUS, VENTROMEDIAL NUCLEUS AND SEXUALLY DIMORPHIC NUCLEUS OF THE PREOPTIC AREA IN RATS ...... 53

3.1 Abstract ...... 53

3.2 Introduction ...... 54

3.3 Materials and Methods ...... 57

3.3.1 Animals ...... 57

3.3.2 Tissue preparation ...... 57

3.3.3 RNA Isolation and QPCR ...... 58

3.3.4 Statistics ...... 59

3.4 Results ...... 59

3.4.1 QPCR Reaction Specificity...... 59

3.4.2 Esr1 and Pgr mRNA Levels ...... 59

3.4.3 Pgrmc1, Serbp1 and Pgrmc2 mRNA Levels ...... 60

3.4.4 Paqr7 and Paqr8 mRNA levels ...... 60

3.5 Discussion ...... 60

3.6 List of Tables ...... 64

3.6.1: Primers Used in QPCR Studies ...... 64

3.7 List of Figures ...... 64

3.7.1 Diagram of Brain Sections ...... 65

3.7.2 Esr1 and Pgr mRNA Levels ...... 66

3.7.3 Pgrmc1, Serbp1 and Pgrmc2 mRNA Levels ...... 67

3.7.4 Paqr7 and Paqr8 mRNA Levels ...... 68

3.8 References ...... 69

ix 4. DUAL-LABEL IN SITU HYBRIDIZATION REVEAL THAT PGRMC1 AND SERBP1 ARE COLOCALIZED WITHIN GABAERGIC NEURONS OF THE ANTEROVENTRAL PERIVENTRICULAR NUCLEUS OF THE FEMALE RAT ... 74

4.1 Abstract ...... 74

4.2 Introduction ...... 75

4.3. Materials and Methods ...... 76

4.3.1 Animals and Tissues ...... 76

4.3.2 Transcription Template Preparation ...... 77

4.3.3 Probe preparation ...... 78

4.3.4 In situ hybridization ...... 79

4.3.5 Signal detection ...... 80

4.3.6 Statistics ...... 81

4.4 Results ...... 82

4.4.1 AVPV GABA Neurons Contain Pgrmc1 mRNA ...... 82

4.4.2 AVPV GABA Neurons Contain Serbp1 mRNA ...... 82

4.4.3 Pgrmc1 and Serbp1 mRNA are Coexpressed by AVPV

Neurons ...... 82

4.5 Discussion ...... 82

4.6 List of Tables ...... 86

4.6.1 Primers Used in Template Production ...... 86

4.7 List of Figures ...... 87

4.7.1 Pgrmc1 and Serbp1 are Coexpressed by GABAergic AVPV

Neurons ...... 87

4.8 References ...... 88

x 5. PROGESTERONE RECEPTOR MEMBRANE COMPONENT 1 COREGULATES NOVEL GENE TARGETS NR4A1, SPNA1, TGM2 AND IFIT3 AND REGULATES BASAL STAT3 ACTIVATION IN NEURAL CELLS ...... 92

5.1 Abstract ...... 92

5.2 Introduction ...... 93

5.3 Materials and Methods ...... 94

5.3.1 Animals and Tissue Preparation ...... 94

5.3.2 Cells and Culturing Methods ...... 95

5.3.3 siRNA Experiments ...... 95

5.3.4 Microarray Gene Expression Profiling ...... 96

5.3.5 Pgrmc1 Construct...... 96

5.3.6 Dual-luciferase Assays ...... 97

5.3.7 Quantitative Reverse Transcriptase PCR (QPCR) ...... 98

5.3.8 Western Blot ...... 99

5.3.9 Janus Kinase (JAK) and Signal Transducer and Activator of

Transcription 3 (STAT3) Inhibition ...... 100

5.3.10 Oligodeoxynucleotidyl Probe Preparation ...... 100

5.3.11 In Situ Hybridization Histochemistry (ISHH) ...... 101

5.3.12 Statistics ...... 101

5.4 Results ...... 102

5.4.1 Pgrmc1 siRNA Experiments ...... 102

5.4.2 Identification of Novel Target Genes by Microarray Analyses ... 102

5.4.3 Validation of Microarray Findings by QPCR ...... 103

5.4.4 Transfection of Pgrmc1 Expression Construct ...... 103

xi 5.4.5 Pgrmc1 Levels Regulate STAT3 Activity ...... 104

5.4.6 STAT3 Inhibitor JSI-124 Alters Pgrmc1, Nr4a1 and IFIT3

mRNA Levels ...... 104

5.4.7 ISHH Studies Reveal That Pgrmc1, STAT3, and Nr4a1

Localize to the Hippocampus and Paraventricular Nucleus of

Mouse Brain ...... 104

5.5 Discussion ...... 105

5.6 List of Tables ...... 110

5.6.1 Primers Used in QPCR Studies...... 110

5.6.2 Sequences for Oligodeoxynucleotidyl Probes Used in ISHH

Studies ...... 111

5.6.3 Gene Set Enrichment Analysis ...... 112

5.7.1 List of Figures ...... 113

5.7.1 Pgrmc1 siRNA Decreased Levels of Pgrmc1 mRNA and

Protein ...... 113

5.7.2 Analyses of Microarray Data ...... 114

5.7.3 Validation of Microarray Findings by QPCR ...... 115

5.7.4 Pgrmc1 Construct Transfection Increased Pgrmc1 Expression ... 116

5.7.5 Pgrmc1 Depletion Stimulates STAT3 Activation ...... 117

5.7.6 Inhibition of JAK/STAT in N42 Cells ...... 118

5.7.7 Localization of Pgrmc1, Nr4a1 and STAT3 mRNA in Mouse

Brain ...... 119

xii 5.7.8 Cell-specific Nr4a1 ISHH Signal in the Paraventricular

Nucleus ...... 120

5.8 References ...... 121

6. CONCLUDING REMARKS ...... 140

6.1 Main Findings Concerning the Neural Roles of Pgrmc1 ...... 140

6.1.1 Pgrmc1 Roles in N42 Cells ...... 143

6.2 Future Directions ...... 144

6.3 Closing Remarks ...... 145

BIBLIOGRAPHY ...... 146

xiii

LIST OF TABLES

Figure ...... Page

2.6.1 Sequences for Oligodeoxynucleotidyl Probes Used in ISHH Studies ...... 40

2.6.2 Oligodeoxynucleotidyl Sequences for ISHH Validation Studies ...... 41

2.6.3 Localization and Abundance of mRNA Encoding Pgr, Pgrmc1, Serbp1,

Pgrmc2, Paqr7 and Paqr8 in Female Rat Forebrain ...... 41

3.6.1 Primers Used in QPCR Studies...... 64

4.6.1 Primers Used in Template Production ...... 86

5.6.1 Primers Used in QPCR Studies...... 110

5.6.2 Sequences for Oligodeoxynucleotidyl Probes Used in ISHH Studies ...... 111

5.6.3 Gene Set Enrichment Analysis ...... 112

6.6.3 Gene Set Enrichment Analysis ...... 112

xiv

LIST OF FIGURES

Figure Page

1.2.1 Progesterone Biosynthetic Pathway ...... 2

2.7.1 Photomicrographs of film autoradiograms of hybridized rat brain sections

to 33P-labeled oligodeoxynucleotidyl probes for (A) Pgrmc1, (B) Serbp1,

2.7.2 Rostral to caudal arrangement of photomicrographs of film autoradiograms

of hybridized rat forebrain sections to 33 P-labeled oligodeoxynucleotidyl probes

for (A) Pgrmc1, (B) Serbp1, (C) Pgrmc2, (D) Paqr7, (E) Paqr8 and (F) Pgr ...... 44

2.7.3 Rostral to caudal arrangement of photomicrographs of film

autoradiograms of hybridized rat forebrain sections to 33 P-labeled

oligodeoxynucleotidyl probes for (A) Pgrmc1, (B) Serbp1, (C) Pgrmc2,

(D) Paqr7, (E) Paqr8 and (F) Pgr ...... 45

3.7.1 Diagrams of brain sections containing the a) AVPV, b) SDN-POA

and c) VMNvl modified from the atlas of Swanson (1998)...... 65

3.7.2 Levels of mRNAs encoding Esr1 and Pgr in ovariectomized rats treated

with oil, E 2, P 4 or E 2+P 4...... 66

3.7.3 Levels of mRNAs encoding Pgrmc1, Pgrmc2 and Serbp1 in

ovariectomized rats treated with oil, E 2, P 4 or E 2+P 4...... 67

3.7.4 Levels of mRNAs encoding Paqr7 and Paqr8 in ovariectomized rats treated with oil, E 2, P 4 or E 2+P 4...... 68

4.7 Most GABAergic neurons (Gad-positive) of the adult female rat contain Pgrmc1 (A) and Serbp1 (B), and Pgrmc1 and Serbp1 are coexpressed within many of the same neurons (C) ...... 87

5.7.1 Pgrmc1 siRNA Decreased Levels of Pgrmc1 mRNA and Protein ...... 113

5.7.2 Analyses of Microarray Data ...... 114

5.7.3 Pgrmc1 co-regulates multiple gene targets in a P 4-independent manner ...... 115

5.7.4 QPCR was used to determine relative levels of mRNA in N42 cells transfected with empty vector (control) or Pgrmc1 construct ...... 116

5.7.5 Depletion of Pgrmc1 increased STAT3 activation ...... 117

5.7.6 Effects of JAK/STAT Inhibition for 8 h ...... 118

5.7.7 Film autoradiograms of mouse forebrain sections hybridized to to

33 P-labeled oligodeoxynucleotidyl probes for Pgrmc1, Nr4a1 and STAT3 ...... 119

5.7.8 Cell-specific Nr4a1 ISHH Signal in the Paraventricular Nucleus ...... 120

6.1.1 Results of studies using N42 cells, a hypothalamic cell line, indicate that Pgrmc1 regulates levels of mRNA encoding Tgm2, Spna1, Nr4a1 and IFIT3 ..... 143

xvi

CHAPTER 1

PROGESTIN MECHANISM OF ACTION IN THE CNS

1.1 Introduction

The term “progestins” refers to a class of steroid hormones first named for a role in maintaining pregnancy (Allen and Wintersteiner, 1934). Current research shows that progestins are critical for many aspects of female reproduction and also involved in diverse non-reproductive physiological processes. In addition, emerging data suggest that progestins act in the central nervous system and affect a wide range of neural functions, such as the neural control of ovulation, sexual behaviors and neuroprotection.

Despite the prominent role of progestins and the long history of research on this hormone, the mechanisms that underlie progestin cellular actions remain an area of active research. This chapter will review progestin mechanisms of action and focus on signaling molecules that may mediate the neural effects of progestin in females.

1.2 Sources and Synthesis

Progestins vary widely in their chemical structures, and may be classified into natural and synthetic types. The natural progestin, progesterone (P 4), is a hormone produced in the gonads, adrenal glands, and central nervous system. P4 is an intermediate in the production of mineralocorticoids, glucocorticoids, androgens and estrogens. The key reactions in P 4 biosynthesis can be viewed in Figure 1. Like other steroid hormones, the synthesis of P4 begins with cholesterol as a substrate. Cholesterol is transported from the outer to the inner mitochondrial membrane by the steroid acute regulatory protein (StAR) (Clark et al., 1994). StAR is activated by a phosphorylation event and this is regarded as the rate-limiting step in steroidogenesis. Once transported

to the inner mitochondrial Figure 1.2.1: Progesterone Biosynthetic Pathway membrane, a P450 side chain cleavage enzyme (P450 scc ) converts cholesterol to pregnenolone by removal of the

C-27 cholesterol side chain

(Juengel et al., 1995, Niswender,

2002). Through the actions of 3 β- hydroxysteroid dehydrogenase

(3 β-HSD), pregnenolone is converted to P4. While diverse cells are capable of P4 production, the stimulatory factors that drive this process are tissue-specific.

1.2.3 The Nervous System

The idea of neurosteroid production has been supported by studies for over 50 years. Some of the early studies on this topic showed that the central nervous systems contains factors necessary for steroidogenesis including cholesterol sulfate (Iwamori et al., 1976), aromatase (Denef et al., 1973), steroid-5α-reductase (Jaffe, 1969, Sholiton and Werk, 1969), steroid hydroxylases (Guiraud et al., 1979, Fishman et al., 1980), hydroxysteroid dehydrogenase and steroid dehydroxylases (Knapstein et al., 1968).

Another early study showed that pregnenolone levels remain elevated above plasma levels in the rat brain, even after gonadectomy and adrenalectomy (Corpechot et al.,

1981, Corpechot et al., 1983). Thus, early data suggested that progesterone is produced within the nervous system.

More recent evidence supports this concept. For example, P 4 can be produced by oligodendrocytes and neurons, though astrocytes are the main steroidogenic cells of the brain (Zwain and Yen, 1999). These brain cells contain enzymes required for P 4 synthesis (Karri et al., 2007), many of which are sensitive to 17 β-estradiol (E2). E 2 increases 3 β-HSD expression and activity in female rat hypothalamus (Micevych et al.,

2003). In astrocytes, E 2 activates protein kinases that mediate StAR phosphorylation, resulting in P4 production (Sinchak et al., 2003, Boulware et al., 2005, Micevych et al.,

2007). Although the stimuli for P 4 synthesis vary by tissue, most steroidogenic pathways require activation of phosphorylation cascades that activate StAR and other steroidogenic enzymes.

In the peripheral nervous system, similar mechanisms enable neurons and

Schwann cells to produce P 4. Schwann cells possess the enzymes necessary for synthesis of P 4 (Guennoun et al., 1997), and produce this steroid hormone following

neuronally-derived cues (Robert et al., 2001). These cues are not yet known, but neural

input to Schwann cells is necessary for P4 synthesis and maintain myelination (Chan et

al., 1998b). Following acute trauma, such as axonal injury, Schwann cells are

stimulated to increase P 4 production (Koenig et al., 1995). In turn, the P 4 provides neuroprotective benefits including decreased cell death and increased myelin repair

(Labombarda et al., 2006) Thus, P 4 biosynthesis in the nervous system may provide important neuroprotective effects that aid in myelin formation.

1.3 Effects of P 4 in the Central Nervous System

Although the effects of P 4 in the brain are diverse, much of the research focuses on two main topics: the important role of P 4 in neuroprotection and in female reproduction. The therapeutic potential of understanding P 4 actions is highlighted by

studies involving brain injury and age-related disease. Additionally, the role of P 4 in the

neural control of ovulation and feminine sex behaviors have been intensely studied in

the field of neuroendocrinology. A summary of these studies is provided in the

following sections.

1.3.1 Neuroprotection

Though the exact mechanisms are not yet clear, the findings of many studies

support the idea the therapeutic P 4 administration following traumatic brain injury,

stroke or spinal cord trauma improves recovery. For example, P 4 downregulates

inflammatory cascades and decreases proapoptotic gene expression when administered

following traumatic brain injury (He et al., 2004, Pettus et al., 2005, Guo et al., 2006,

O'Connor et al., 2007). Additionally, P 4 reduces edema through a protective and reparative effect on the blood brain barrier, a structure with cells especially vulnerable to damage (Wahl et al., 1993). Damage to this structure increases edema, and P 4 exerts protective effects by inhibiting ion transport and reducing free radical-induced damage of the blood brain barrier cells (Betz and Coester, 1990a, b, Hoffman et al., 1996).

Thus, P 4 may benefit and improve several components necessary for brain healing following trauma.

Many mechanisms of P 4 action have been proposed based on observations that

P4 treatment limits tissue damage and improves functional outcomes. Early on, studies

showed that P 4 metabolites activate GABA A receptors, thereby reducing excessive excitotoxicity (Kokate et al., 1994). The beneficial role of P 4 in recovery is likely to involve the classical P 4 receptor as demonstrated by studies using transgenic animals

(Jodhka et al., 2009). Although continuing work focuses on these mechanisms, the use of P4 as a therapeutic strategy has already been demonstrated in many animal studies

(Gibson et al., 2008). Such findings led to clinical research in human patients and showed P 4 administration in victims of traumatic brain injury lowers mortality and may

decrease disability levels (Wright et al., 2007). Further clinical studies are underway

and research continues to reveal the mechanisms through which P 4 benefits neuronal

survival.

1.3.2 Reproductive Functions

While the functions of P 4 are diverse, this hormone is primarily known for its role in female reproduction. Many P 4 effects, including the generation of luteinizing hormone (LH) surge that precedes ovulation, require the contribution of E 2. Ovarian follicles are stimulated to grow by follicle stimulating hormone each cycle, producing increasing levels of E2 that feed back onto cells of the hypothalamus and anterior pituitary. E 2 positive feedback results in peak E 2 levels that increase the firing rate of gonadotropin releasing hormone (GnRH) neurons (Christian et al., 2005). This process is likely to involve the preoptic area (POA), a region that contains the anteroventral periventricular nucleus (AVPV). Ablation studies (Wiegand et al., 1980, Ronnekleiv and Kelly, 1986) or estrogen deprivation (Petersen et al., 1989) in the AVPV blocks

LH surge, and neurons of the AVPV contain most of the E 2 receptors in the POA and provide E 2-sensitive input to GnRH neurons (Simonian et al., 1999, Ottem et al., 2004).

In the AVPV, E2 induces expression of the classical P 4 receptor (Pgr), (Simerly et al.,

1996, Hagihara et al., 1992, Shughrue et al., 1997), an induction required for the GnRH hyperactivation, LH surge release (Chappell and Levine, 2000) and ovulation. The ruptured follicle that remains forms a corpus luteum that produces additional P4. While circulating P 4 activates the Pgr, the ligand-independent activation of the Pgr by neural signals is thought to be also critical for the LH surge mechanism (Mani et al., 1994a,

Mani et al., 1996). Thus, the E 2-dependent Pgr induction and possibly ligand- independent activation of PR are crucial for the preovulatory LH surge.

While studies in ovariectomized rats show that E 2 treatment alone is sufficient for a blunted daily LH surge, P 4 treatment administration to E2-primed rats rapidly advances the onset of ovulation, and increases the magnitude and duration of the LH surge (Everett, 1948, Rothchild, 1965, DePaolo and Barraclough, 1979). Interestingly, intact animals do not exhibit significantly increased circulating P 4 levels preceding the

LH surge (Smith et al., 1975, Park and Ramirez, 1987). Pgr activation is required for

LH surge initiation, and may occur by ligand-independent manner through neural activity (Chappell et al., 2000). Another recent possibility is that hypothalamic P4

production activates E 2-induced Pgrs in the intact animal. This idea is supported by the

finding that LH surge levels are correlated with hypothalamic P 4 concentrations, an

observation that persists in animals that lack ovarian and adrenal sources of P 4

(Micevych et al., 2003, Micevych and Sinchak, 2008). Finally, the LH surge can be

blocked by hypothalamic administration of P 4 synthesis inhibitors (Snyder et al., 1984,

DePaolo, 1988, Hibbert et al., 1996). Together these data suggest that both the E2-

induction of Pgr and neuroprogesterone synthesis may be requisite steps in the LH

surge mechanism. Though many studies have investigated the role of P 4 in this process, the possibility that P 4 signaling molecules may mediate the rapid advancement and

amplification of the surge remains untested.

Beyond a role in the neural control of ovulation, P 4 is also implicated in the

coordinated facilitation of reproductive sex behaviors that accompany ovulation.

Following E 2-priming, P 4 activation of Pgr within the ventromedial nucleus of the

hypothalamus (VMN) induces lordosis, a stereotypical receptive posture (Whalen,

1974, Moguilewsky and Raynaud, 1979, Pfaff and Sakuma, 1979, Hoshina et al., 1994).

Similar to the LH surge mechanism, this P 4 effect requires to E 2-induction of the Pgr,

underscoring the important transcriptional role of E 2 (Parsons et al., 1980, Pollio et al.,

1993, Mani et al., 1994b, Ogawa et al., 1994). Interestingly, membrane-active P 4

metabolites and membrane impermeable P 4-BSA are also capable of facilitating

receptive behaviors in E 2-primed rats (Rodriguez-Manzo et al., 1986, Ke and Ramirez,

1987), suggesting that additional mechanisms of P 4 actions synchronize ovulation and

the expression of feminine sex behaviors. Rapid membrane-initiated P 4 signaling may be mediated through progestin signaling molecules, though this possibility has not yet been explored. While clues as to these behaviors continue to emerge, it is clear that Pgr induction is a critical component in the control of sex behavior.

1.4 The Classical Progesterone Receptor (Pgr)

Studies using Pgr knockout mice show that the classical Pgr mediates many P4 effects in reproductive tissues (Ismail et al., 2003). The Pgr gene is expressed as two protein isoforms, A and B, that have identical ligand- and DNA-binding domains. These isoforms only differ in that Pgr B has an additional 164 amino acids at

the C-terminus (Kastner et al., 1990). Results of studies in Pgr knockouts predict that each splice variant has distinct reproductive roles. For example, Pgr A knockouts are characterized by ovary and implantation defects, while Pgr B knockouts show proliferative defects in the mammary gland and uterus (Shyamala et al., 1998, Mulac-

Jericevic et al., 2000, Mulac-Jericevic et al., 2003). The ratio of A and B isoforms also appears to be important for normal growth and development, and disruption of this ratio is a common feature of human breast cancers (Mote et al., 2004). Though these studies address the roles of specific Pgr isoforms, the interpretation of such findings is complicated due to developmental differences and compensation inherent to body-wide gene targeting approaches.

Though Pgr is a member of the nuclear receptor superfamily of transcription

factors (Evans, 1988, Tsai et al., 1988), not all Pgr-dependent P 4 effects include

delayed-onset transcriptional events. Short latency Pgr-dependent effects have also

been observed (Meyerson, 1972, Kubli-Garfias and Whalen, 1977, Schumacher et al.,

1990), and they do not require Pgr DNA-binding activity. Specific examples include

findings that P 4 binds Pgrs to activate phospholipase C and kinase Cdk1 in enucleated

amphibian oocytes (Schuetz, 1977, Bayaa et al., 2000, Morrison et al., 2000). In

mammalian cell lines, P4 causes Pgr-dependent activation of p60-Src kinase within

minutes (Migliaccio et al., 1998), and also rapidly and transiently activates MAPK

signaling (Boonyaratanakornkit et al., 2001). Such findings prompted revision of the

traditional tenet of steroid hormone action (Truss and Beato, 1993), as the mechanism

of Pgr action extends beyond gene transcription.

Efforts to understand the extranuclear actions of Pgr have shown that polyproline motifs of the Pgr enable interactions with Src, a tyrosine kinase

(Boonyaratanakornkit et al., 2001). This interaction between Pgr and Src does not require Pgr-DNA binding nor transcription, suggesting that the Pgr plays dual roles in cell signaling and transcription that are distinct and separable (Edwards et al.,

2002). Although both Pgr isoforms have identical Src-interacting polyproline motifs, the A isoform is predominantly located in the nucleus and is not capable of activating

Src (Boonyaratanakornkit et al., 2007). Thus, it is likely that the ratio of Pgr isoforms, along with tissue-specific factors, contribute to nuclear and extra-nuclear P4 actions in the brain and reproductive tissues. Importantly, additional P 4 signaling molecules may impact Pgr function. These findings underscore the complexity of Pgr-dependent P4 signaling and suggest that multiple signaling mechanisms may mediate diverse P 4 actions.

1.5 Progesterone Receptor Membrane Component-1 (Pgrmc1)

Pgrmc1 is a progestin signaling molecule that was discovered in several unrelated biological contexts, resulting in interesting clues as to physiological functions, but also many synonyms (Losel et al., 2003, Min et al., 2004, Cahill, 2007). Pgrmc1 encodes a 28-kDa protein that is often isolated as a 56-kDa dimer, and contains a single

N-terminal membrane-spanning domain, a cytochrome b5-like or steroid/heme binding domain (Mifsud and Bateman, 2002). This protein has been localized to the plasma membrane (Peluso et al., 2006), endoplasmic reticulum (ER) (Falkenstein et al., 1998), and nucleus (Beausoleil et al., 2004). Pgrmc1 has been implicated in a wide array of physiological processes, leading to the publication of many reviews despite limited

understanding of its exact cellular roles (Craven, 2008, Guennoun et al., 2008,

Sakamoto et al., 2008, Rohe et al., 2009).

Among the first identified Pgrmc1 functions is a role in steroidogenesis, an idea supported by studies in several cell types that demonstrate associations with endoplasmic reticulum (ER) proteins (Laird et al., 1988, Nolte et al., 2000). In adrenal gland cells, Pgrmc1 may be required for activities of CYP21 and CYP11B1 (Min et al.,

2004), two cytochrome P450 enzymes that catalyze the 21-hydroxylation of P 4 and 18- hydroxylation of deoxycorticosterone, respectively (Barker et al., 1992). In yeast, the

Pgrmc1 homologue binds and activates CYP51A1, an enzyme that controls the rate of cholesterol synthesis (Hughes et al., 2007). Additionally, the same authors showed that

Pgrmc1 activates Erg5/CYP61A1, another P450 protein in the cholesterol synthesis pathway. In COS7 kidney cells, Pgrmc1 binds to insulin-induced gene and SREBP cleavage activating protein, two endoplasmic reticulum proteins critical for cholesterol homeostasis (Suchanek et al., 2005, Goldstein et al., 2006). Additional evidence that supports a role in cholesterol or steroid metabolism is that Pgrmc1 is found in cells of the zona fasciculata/reticularis (adrenal gland), Leydig cells and hepatocytes (Raza et al., 2001).

The brain is another location found to express Pgrmc1, and several studies have identified potential roles for Pgrmc1 in steroidogenesis within particular neurons.

scc Cerebellar Purkinje cells contain P450 , 3 β-HSD and StAR, and produce P 4 during

development that is correlated with Pgrmc1 expression (Ukena et al., 1998, Ukena et

al., 1999, Sakamoto et al., 2004). High levels of Pgrmc1 expression were detected in

the ER of these neurons during times of elevated P 4 production (Sakamoto et al., 2008).

P4 biosynthesis from Purkinje neurons is required for dendritic growth and synaptogenesis (Sakamoto et al., 2001), indicating that Pgrmc1 may be required for P 4- induced developmental processes.

Pgrmc1 expression in development is also elevated along the floor plate and notochord of developing murine brain, suggesting a role in axon guidance (Runko et al.,

1999). Indeed, one of Pgrmc1’s early synonyms is ventral midline antigen (VEMA).

Pgrmc1 expression shares a very close distribution pattern to molecules required for axon guidance at the midline in the developing spinal cord and optic chiasm (Ho et al.,

1994, Runko and Kaprielian, 2002). More support for a role in development is provided by work on the C. Elegans ortholog of Pgrmc1, vem-1. Animals treated with vem-1 siRNA and vem-1-null mutants are characterized by aberrant neuronal projections and midline neurons that fail to reach their ventral positions (Runko and

Kaprielian, 2004). Taken together, these findings on Pgrmc1’s role in axon guidance provide intriguing clues, but unequivocal evidence for this idea is lacking as research on this topic is very limited.

In the adult rat brain, very little is known regarding the function of Pgrmc1.

Localization studies lead to proposed roles of Pgrmc1 in water homeostasis and neuroendocrine functions (Krebs et al., 2000, Meffre et al., 2005). The actual cellular role of Pgrmc1 is much less clear, but one possibility is a role in P 4 signaling, as suggested by findings in ovarian cells. For example, Pgrmc1 mediates the antiapoptotic effects of P 4 in granulosa cells (Peluso et al., 2001). These rapid P 4 actions require that Pgrmc1 interact with a binding partner, Serpine1 mRNA binding protein 1

(Peluso et al., 2005), but whether this interaction persists in neural cells is not known.

The current state of research on Pgrmc1’s role in the brain poses many questions. Despite multiple links between P4 and Pgrmc1, it is not known if Pgrmc1 is required to mediate P4 actions in the brain. Furthermore, the neuroanatomical localization of Pgrmc1 in the brain is largely unknown, and the factors that induce

Pgrmc1 expression have not yet been identified. The expression of Pgrmc1 has only been reported in vasopressinergic (Meffre et al., 2005) and Purkinje cells (Sakamoto et al., 2004), neural phenotypes confined to distinct brain regions. To begin to address these questions, the following chapters report my research conducted to test the hypothesis that Pgrmc1 has important functions in the brain.

1.6 References

Allen WM, Wintersteiner O (1934) Crystalline progestin. Science 80:1990-1991.

Barker S, Laird SM, Ho MM, Vinson GP, Hinson JP (1992) Characterization of a rat adrenocortical inner zone-specific antigen and identification of its putative precursor. J Mol Endocrinol 9:95-102.

Bayaa M, Booth RA, Sheng Y, Liu XJ (2000) The classical progesterone receptor mediates Xenopus oocyte maturation through a nongenomic mechanism. Proc Natl Acad Sci U S A 97:12607-12612.

Beausoleil SA, Jedrychowski M, Schwartz D, Elias JE, Villen J, Li J, Cohn MA, Cantley LC, Gygi SP (2004) Large-scale characterization of HeLa cell nuclear phosphoproteins. Proc Natl Acad Sci U S A 101:12130-12135.

Betz AL, Coester HC (1990a) Effect of steroid therapy on ischaemic brain oedema and blood to brain sodium transport. Acta Neurochir Suppl (Wien) 51:256-258.

Betz AL, Coester HC (1990b) Effect of steroids on edema and sodium uptake of the brain during focal ischemia in rats. Stroke 21:1199-1204.

Boonyaratanakornkit V, McGowan E, Sherman L, Mancini MA, Cheskis BJ, Edwards DP (2007) The role of extranuclear signaling actions of progesterone receptor in mediating progesterone regulation of gene expression and the cell cycle. Mol Endocrinol 21:359-375.

Boonyaratanakornkit V, Scott MP, Ribon V, Sherman L, Anderson SM, Maller JL, Miller WT, Edwards DP (2001) Progesterone receptor contains a proline-rich motif that directly interacts with SH3 domains and activates c-Src family tyrosine kinases. Mol Cell 8:269-280.

Boulware MI, Weick JP, Becklund BR, Kuo SP, Groth RD, Mermelstein PG (2005) Estradiol activates group I and II metabotropic glutamate receptor signaling, leading to opposing influences on cAMP response element-binding protein. J Neurosci 25:5066-5078.

Cahill MA (2007) Progesterone receptor membrane component 1: an integrative review. J Steroid Biochem Mol Biol 105:16-36.

Chan JR, Phillips LJ, 2nd, Glaser M (1998) Glucocorticoids and progestins signal the initiation and enhance the rate of myelin formation. Proc Natl Acad Sci U S A 95:10459-10464.

Chappell PE, Lee J, Levine JE (2000) Stimulation of gonadotropin-releasing hormone surges by estrogen. II. Role of cyclic adenosine 3'5'-monophosphate. Endocrinology 141:1486-1492. 13

Chappell PE, Levine JE (2000) Stimulation of gonadotropin-releasing hormone surges by estrogen. I. Role of hypothalamic progesterone receptors. Endocrinology 141:1477-1485.

Christian CA, Mobley JL, Moenter SM (2005) Diurnal and estradiol-dependent changes in gonadotropin-releasing hormone neuron firing activity. Proc Natl Acad Sci U S A 102:15682-15687.

Clark BJ, Wells J, King SR, Stocco DM (1994) Purification, cloning, and expression of a novel LH-induced mitochondrial protein from the MA-10 mouse Leydig tumor cells: characterization of the steroidogenic acute regulatory (StAR) protein. J Biol Chem 269: 28314-28322.

Corpechot C, Robel P, Axelson M, Sjovall J, Baulieu EE (1981) Characterization and measurement of dehydroepiandrosterone sulfate in rat brain. Proc Natl Acad Sci U S A 78:4704-4707.

Corpechot C, Synguelakis M, Talha S, Axelson M, Sjovall J, Vihko R, Baulieu EE, Robel P (1983) Pregnenolone and its sulfate ester in the rat brain. Brain Res 270:119-125.

Craven RJ (2008) PGRMC1: a new biomarker for the estrogen receptor in breast cancer. Breast Cancer Res 10:113.

Crivello JF, Jefcoate CR (1980) Intracellular movement of cholesterol in rat adrenal cells. Kinetics and effects of inhibitors. J Biol Chem 255:8144-8151.

Denef C, Magnus C, McEwen BS (1973) Sex differences and hormonal control of testosterone metabolism in rat pituitary and brain. J Endocrinol 59:605-621.

DePaolo LV (1988) Attenuation of preovulatory gonadotrophin surges by epostane: a new inhibitor of 3 beta-hydroxysteroid dehydrogenase. J Endocrinol 118:59-68.

DePaolo LV, Barraclough CA (1979) Dose dependent effects of progesterone on the facilitation and inhibition of spontaneous gonadotropin surges in estrogen treated ovariectomized rats. Biol Reprod 21:1015-1023.

Edwards DP, Wardell SE, Boonyaratanakornkit V (2002) Progesterone receptor interacting coregulatory proteins and cross talk with cell signaling pathways. J Steroid Biochem Mol Biol 83:173-186.

Evans RM (1988) The steroid and thyroid hormone receptor superfamily. Science 240:889-895.

Everett JW (1948) Progesterone and estrogen in the experimental control of ovulation time and other features of the estrous cycle in the rat. Endocrinology 43:389- 405. 14

Falkenstein E, Schmieding K, Lange A, Meyer C, Gerdes D, Welsch U, Wehling M (1998) Localization of a putative progesterone membrane binding protein in porcine hepatocytes. Cell Mol Biol (Noisy-le-grand) 44:571-578.

Fishman J, Norton BI, Krey L (1980) 2-Hydroxylation of estrogens in the brain participates in the initiation of the preovulatory LH surge in the rat. Biochem Biophys Res Commun 93:471-477.

Gibson CL, Gray LJ, Bath PM, Murphy SP (2008) Progesterone for the treatment of experimental brain injury; a systematic review. Brain 131:318-328.

Goldstein JL, DeBose-Boyd RA, Brown MS (2006) Protein sensors for membrane sterols. Cell 124:35-46.

Guennoun R, Meffre D, Labombarda F, Gonzalez SL, Deniselle MC, Stein DG, De Nicola AF, Schumacher M (2008) The membrane-associated progesterone- binding protein 25-Dx: expression, cellular localization and up-regulation after brain and spinal cord injuries. Brain Res Rev 57:493-505.

Guennoun R, Schumacher M, Robert F, Delespierre B, Gouezou M, Eychenne B, Akwa Y, Robel P, Baulieu EE (1997) Neurosteroids: expression of functional 3beta- hydroxysteroid dehydrogenase by rat sensory neurons and Schwann cells. Eur J Neurosci 9:2236-2247.

Guiraud JM, Morfin R, Ducouret B, Samperez S, Jouan P (1979) Pituitary metabolism of 5alpha-androstane-3beta-17beta-diol: intense and rapid conversion into 5alpha-androstane-3beta,6alpha,17beta-triol and 5alpha-androstane- 3beta,7alpha, 17beta-triol. Steroids 34:241-248.

Guo Q, Sayeed I, Baronne LM, Hoffman SW, Guennoun R, Stein DG (2006) Progesterone administration modulates AQP4 expression and edema after traumatic brain injury in male rats. Exp Neurol 198:469-478.

He J, Evans CO, Hoffman SW, Oyesiku NM, Stein DG (2004) Progesterone and allopregnanolone reduce inflammatory cytokines after traumatic brain injury. Exp Neurol 189:404-412.

Hibbert ML, Stouffer RL, Wolf DP, Zelinski-Wooten MB (1996) Midcycle administration of a progesterone synthesis inhibitor prevents ovulation in primates. Proc Natl Acad Sci U S A 93:1897-1901.

Ho MM, Barker S, Vinson GP (1994) Distribution of the adrenocortical inner zone antigen. J Endocrinol 141:459-466.

Hoffman SW, Roof RL, Stein DG (1996) A reliable and sensitive enzyme immunoassay method for measuring 8-isoprostaglandin F2 alpha: a marker for lipid peroxidation after experimental brain injury. J Neurosci Methods 68:133-136. 15

Hoshina Y, Takeo T, Nakano K, Sato T, Sakuma Y (1994) Axon-sparing lesion of the preoptic area enhances receptivity and diminishes proceptivity among

Hughes AL, Powell DW, Bard M, Eckstein J, Barbuch R, Link AJ, Espenshade PJ (2007) Dap1/PGRMC1 binds and regulates cytochrome P450 enzymes. Cell Metab 5:143-149.

Ismail PM, Amato P, Soyal SM, DeMayo FJ, Conneely OM, O'Malley BW, Lydon JP (2003) Progesterone involvement in breast development and tumorigenesis--as revealed by progesterone receptor "knockout" and "knockin" mouse models. Steroids 68:779-787.

Iwamori M, Moser HW, Kishimoto Y (1976) Cholesterol sulfate in rat tissues. Tissue distribution, developmental change and brain subcellular localization. Biochim Biophys Acta 441:268-279.

Jaffe RB (1969) Testosterone metabolism in target tissues. Hypothalamic and pituitary tissues of the adult rat and human fetus, and the immature rat epiphysis. Steroids 14:483-498.

Jefcoate CR, DiBartolomeis MJ, Williams CA, McNamara BC (1987) ACTH regulation of cholesterol movement in isolated adrenal cells. J Steroid Biochem 27:721- 729.

Jodhka PK, Kaur P, Underwood W, Lydon JP, Singh M (2009) The differences in neuroprotective efficacy of progesterone and medroxyprogesterone acetate correlate with their effects on brain-derived neurotrophic factor expression. Endocrinology 150:3162-3168.

Juengel JL, Meberg BM, Turzillo AM, Nett TM, Niswender GD (1995) Hormonal regulation of messenger ribonucleic acid encoding steroidogenic acute regulatory protein in ovine corpora lutea. Endocrinology 136:5423-5429.

Karri S, Dertien JS, Stocco DM, Syapin PJ (2007) Steroidogenic acute regulatory protein expression and pregnenolone synthesis in rat astrocyte cultures. J Neuroendocrinol 19:860-869.

Kastner P, Krust A, Turcotte B, Stropp U, Tora L, Gronemeyer H, Chambon P (1990) Two distinct estrogen-regulated promoters generate transcripts encoding the two functionally different human progesterone receptor forms A and B. EMBO J 9:1603-1614.

Ke FC, Ramirez VD (1987) Membrane mechanism mediates progesterone stimulatory effect on LHRH release from superfused rat hypothalami in vitro. Neuroendocrinology 45:514-517.

Knapstein P, David A, Wu CH, Archer DF, Flickinger GL, Tochstone JC (1968) Metabolism of free and sulfoconjugated DHEA in brain tissue in vivo and in vitro. Steroids 11:885-896.

Koenig HL, Schumacher M, Ferzaz B, Thi AN, Ressouches A, Guennoun R, Jung- Testas I, Robel P, Akwa Y, Baulieu EE (1995) Progesterone synthesis and myelin formation by Schwann cells. Science 268:1500-1503.

Kokate TG, Svensson BE, Rogawski MA (1994) Anticonvulsant activity of neurosteroids: correlation with gamma-aminobutyric acid-evoked chloride current potentiation. J Pharmacol Exp Ther 270:1223-1229.

Krebs CJ, Jarvis ED, Chan J, Lydon JP, Ogawa S, Pfaff DW (2000) A membrane- associated progesterone-binding protein, 25-Dx, is regulated by progesterone in brain regions involved in female reproductive behaviors. Proc Natl Acad Sci U S A 97:12816-12821.

Kubli-Garfias C, Whalen RE (1977) Induction of lordosis behavior in female rats by intravenous administration of progestins. Horm Behav 9:380-386.

Labombarda F, Gonzalez S, Gonzalez Deniselle MC, Garay L, Guennoun R, Schumacher M, De Nicola AF (2006) Progesterone increases the expression of myelin basic protein and the number of cells showing NG2 immunostaining in the lesioned spinal cord. J Neurotrauma 23:181-192.

Laird SM, Vinson GP, Whitehouse BJ (1988) Monoclonal antibodies against rat adrenocortical cell antigens. Acta Endocrinol (Copenh) 119:420-426.

Losel RM, Falkenstein E, Feuring M, Schultz A, Tillmann HC, Rossol-Haseroth K, Wehling M (2003) Nongenomic steroid action: controversies, questions, and answers. Physiol Rev 83:965-1016.

Mani SK, Allen JM, Clark JH, Blaustein JD, O'Malley BW (1994a) Convergent pathways for steroid hormone- and neurotransmitter-induced rat sexual behavior. Science 265:1246-1249.

Mani SK, Allen JM, Lydon JP, Mulac-Jericevic B, Blaustein JD, DeMayo FJ, Conneely O, O'Malley BW (1996) Dopamine requires the unoccupied progesterone receptor to induce sexual behavior in mice. Mol Endocrinol 10:1728-1737.

Mani SK, Blaustein JD, Allen JM, Law SW, O'Malley BW, Clark JH (1994b) Inhibition of rat sexual behavior by antisense oligonucleotides to the progesterone receptor. Endocrinology 135:1409-1414.

Meffre D, Delespierre B, Gouezou M, Leclerc P, Vinson GP, Schumacher M, Stein DG, Guennoun R (2005) The membrane-associated progesterone-binding protein 25- Dx is expressed in brain regions involved in water homeostasis and is up- regulated after traumatic brain injury. J Neurochem 93:1314-1326.

Meyerson B (1972) Latency between intravenous injection of progestins and the appearance of estrous behavior in estrogen-treated ovariectomized rats. Horm Behav 3:1-9.

Micevych P, Sinchak K (2008) Synthesis and function of hypothalamic neuroprogesterone in reproduction. Endocrinology 149:2739-2742.

Micevych P, Sinchak K, Mills RH, Tao L, LaPolt P, Lu JK (2003) The luteinizing hormone surge is preceded by an estrogen-induced increase of hypothalamic progesterone in ovariectomized and adrenalectomized rats. Neuroendocrinology 78:29-35.

Micevych PE, Chaban V, Ogi J, Dewing P, Lu JK, Sinchak K (2007) Estradiol stimulates progesterone synthesis in hypothalamic astrocyte cultures. Endocrinology 148:782-789.

Mifsud W, Bateman A (2002) Membrane-bound progesterone receptors contain a cytochrome b5-like ligand-binding domain. Genome Biol 3:RESEARCH0068.

Migliaccio A, Piccolo D, Castoria G, Di Domenico M, Bilancio A, Lombardi M, Gong W, Beato M, Auricchio F (1998) Activation of the Src/p21ras/Erk pathway by progesterone receptor via cross-talk with estrogen receptor. EMBO J 17:2008- 2018.

Min L, Takemori H, Nonaka Y, Katoh Y, Doi J, Horike N, Osamu H, Raza FS, Vinson GP, Okamoto M (2004) Characterization of the adrenal-specific antigen IZA (inner zone antigen) and its role in the steroidogenesis. Mol Cell Endocrinol 215:143-148.

Moguilewsky M, Raynaud JP (1979) The relevance of hypothalamic and hyphophyseal progestin receptor regulation in the induction and inhibition of sexual behavior in the female rat. Endocrinology 105:516-522.

Morrison T, Waggoner L, Whitworth-Langley L, Stith BJ (2000) Nongenomic action of progesterone: activation of Xenopus oocyte phospholipase C through a plasma membrane-associated tyrosine kinase. Endocrinology 141:2145-2152.

Mote PA, Leary JA, Avery KA, Sandelin K, Chenevix-Trench G, Kirk JA, Clarke CL (2004) Germ-line mutations in BRCA1 or BRCA2 in the normal breast are associated with altered expression of estrogen-responsive proteins and the predominance of progesterone receptor A. Genes Chromosomes Cancer 39:236- 248. 18

Mulac-Jericevic B, Lydon JP, DeMayo FJ, Conneely OM (2003) Defective mammary gland morphogenesis in mice lacking the progesterone receptor B isoform. Proc Natl Acad Sci U S A 100:9744-9749.

Mulac-Jericevic B, Mullinax RA, DeMayo FJ, Lydon JP, Conneely OM (2000) Subgroup of reproductive functions of progesterone mediated by progesterone receptor-B isoform. Science 289:1751-1754.

Niswender GD (2002) Molecular control of luteal secretion of progesterone. Reproduction 123:333-339.

Nolte I, Jeckel D, Wieland FT, Sohn K (2000) Localization and topology of ratp28, a member of a novel family of putative steroid-binding proteins. Biochim Biophys Acta 1543:123-130.

O'Connor CA, Cernak I, Johnson F, Vink R (2007) Effects of progesterone on neurologic and morphologic outcome following diffuse traumatic brain injury in rats. Exp Neurol 205:145-153.

Ogawa S, Olazabal UE, Parhar IS, Pfaff DW (1994) Effects of intrahypothalamic administration of antisense DNA for progesterone receptor mRNA on reproductive behavior and progesterone receptor immunoreactivity in female rat. J Neurosci 14:1766-1774.

Ottem EN, Godwin JG, Krishnan S, Petersen SL (2004) Dual-phenotype GABA/glutamate neurons in adult preoptic area: sexual dimorphism and function. J Neurosci 24:8097-8105.

Park OK, Ramirez VD (1987) Circulating blood progesterone is pulsatile throughout the rat oestrous cycle. Acta Endocrinol (Copenh) 116:121-128.

Parsons B, MacLusky NJ, Krey L, Pfaff DW, McEwen BS (1980) The temporal relationship between estrogen-inducible progestin receptors in the female rat brain and the time course of estrogen activation of mating behavior. Endocrinology 107:774-779.

Peluso JJ, Fernandez G, Pappalardo A, White BA (2001) Characterization of a putative membrane receptor for progesterone in rat granulosa cells. Biol Reprod 65:94- 101.

Peluso JJ, Pappalardo A, Losel R, Wehling M (2005) Expression and function of PAIRBP1 within gonadotropin-primed immature rat ovaries: PAIRBP1 regulation of granulosa and luteal cell viability. Biol Reprod 73:261-270.

Peluso JJ, Pappalardo A, Losel R, Wehling M (2006) Progesterone membrane receptor component 1 expression in the immature rat ovary and its role in mediating progesterone's antiapoptotic action. Endocrinology 147:3133-3140. 19

Petersen SL, Cheuk C, Hartman RD, Barraclough CA (1989) Medial preoptic microimplants of the antiestrogen, keoxifene, affect luteinizing hormone- releasing hormone mRNA levels, median eminence luteinizing hormone- releasing hormone concentrations and luteinizing hormone release in ovariectomized, estrogen-treated rats. J Neuroendocrinol 1:279-283.

Pettus EH, Wright DW, Stein DG, Hoffman SW (2005) Progesterone treatment inhibits the inflammatory agents that accompany traumatic brain injury. Brain Res 1049:112-119.

Pfaff DW, Sakuma Y (1979) Facilitation of the lordosis reflex of female rats from the ventromedial nucleus of the hypothalamus. J Physiol 288:189-202.

Pollio G, Xue P, Zanisi M, Nicolin A, Maggi A (1993) Antisense oligonucleotide blocks progesterone-induced lordosis behavior in ovariectomized rats. Brain Res Mol Brain Res 19:135-139.

Raza FS, Takemori H, Tojo H, Okamoto M, Vinson GP (2001) Identification of the rat adrenal zona fasciculata/reticularis specific protein, inner zone antigen (IZAg), as the putative membrane progesterone receptor. Eur J Biochem 268:2141-2147.

Robert F, Guennoun R, Desarnaud F, Do-Thi A, Benmessahel Y, Baulieu EE, Schumacher M (2001) Synthesis of progesterone in Schwann cells: regulation by sensory neurons. Eur J Neurosci 13:916-924.

Rodriguez-Manzo G, Cruz ML, Beyer C (1986) Facilitation of lordosis behavior in ovariectomized estrogen-primed rats by medial preoptic implantation of 5 beta, 3 beta, pregnanolone: a ring A reduced progesterone metabolite. Physiol Behav 36:277-281.

Rohe HJ, Ahmed IS, Twist KE, Craven RJ (2009) PGRMC1 (progesterone receptor membrane component 1): a targetable protein with multiple functions in steroid signaling, P450 activation and drug binding. Pharmacol Ther 121:14-19.

Ronnekleiv OK, Kelly MJ (1986) Luteinizing hormone-releasing hormone neuronal system during the estrous cycle of the female rat: effects of surgically induced persistent estrus. Neuroendocrinology 43:564-576.

Rothchild I (1965) Interrelations between progesterone and the ovary, pituitary, and central nervous system in the control of ovulation and the regulation of progesterone secretion. Vitam Horm 23:210-327.

Runko E, Kaprielian Z (2002) Expression of Vema in the developing mouse spinal cord and optic chiasm. J Comp Neurol 451:289-299.

Runko E, Kaprielian Z (2004) Caenorhabditis elegans VEM-1, a novel membrane protein, regulates the guidance of ventral nerve cord-associated axons. J Neurosci 24:9015-9026.

Runko E, Wideman C, Kaprielian Z (1999) Cloning and expression of VEMA: a novel ventral midline antigen in the rat CNS. Mol Cell Neurosci 14:428-443.

Sakamoto H, Ukena K, Kawata M, Tsutsui K (2008) Expression, localization and possible actions of 25-Dx, a membraneassociated putative progesterone-binding protein, in the developing Purkinje cell of the cerebellum: a new insight into the biosynthesis, metabolism and multiple actions of progesterone as a neurosteroid. Cerebellum 7:18-25.

Sakamoto H, Ukena K, Takemori H, Okamoto M, Kawata M, Tsutsui K (2004) Expression and localization of 25-Dx, a membrane-associated putative progesterone-binding protein, in the developing Purkinje cell. Neuroscience 126:325-334.

Sakamoto H, Ukena K, Tsutsui K (2001) Effects of progesterone synthesized de novo in the developing Purkinje cell on its dendritic growth and synaptogenesis. J Neurosci 21:6221-6232.

Schuetz AW (1977) Induction of oocytic maturation and differentiation: mode of progesterone action. Ann N Y Acad Sci 286:408-420.

Schumacher M, Coirini H, Pfaff DW, McEwen BS (1990) Behavioral effects of progesterone associated with rapid modulation of oxytocin receptors. Science 250:691-694.

Sholiton LJ, Werk EE (1969) The less-polar metabolites produced by incubation of testosterone-4-14C with rat and bovine brain. Acta Endocrinol (Copenh) 61:641- 648.

Shughrue PJ, Lane MV, Merchenthaler I (1997) Regulation of progesterone receptor messenger ribonucleic acid in the rat medial preoptic nucleus by estrogenic and antiestrogenic compounds: an in situ hybridization study. Endocrinology 138:5476-5484.

Shyamala G, Yang X, Silberstein G, Barcellos-Hoff MH, Dale E (1998) Transgenic mice carrying an imbalance in the native ratio of A to B forms of progesterone receptor exhibit developmental abnormalities in mammary glands. Proc Natl Acad Sci U S A 95:696-701.

Simerly RB, Carr AM, Zee MC, Lorang D (1996) Ovarian steroid regulation of estrogen and progesterone receptor messenger ribonucleic acid in the anteroventral periventricular nucleus of the rat. J Neuroendocrinol 8:45-56.

Simonian SX, Spratt DP, Herbison AE (1999) Identification and characterization of estrogen receptor alpha-containing neurons projecting to the vicinity of the gonadotropin-releasing hormone perikarya in the rostral preoptic area of the rat. J Comp Neurol 411:346-358.

Sinchak K, Mills RH, Tao L, LaPolt P, Lu JK, Micevych P (2003) Estrogen induces de novo progesterone synthesis in astrocytes. Dev Neurosci 25:343-348.

Smith MS, Freeman ME, Neill JD (1975) The control of progesterone secretion during the estrous cycle and early pseudopregnancy in the rat: prolactin, gonadotropin and steroid levels associated with rescue of the corpus luteum of pseudopregnancy. Endocrinology 96:219-226.

Snyder BW, Beecham GD, Schane HP (1984) Inhibition of ovulation in rats with epostane, an inhibitor of 3 beta-hydroxysteroid dehydrogenase. Proc Soc Exp Biol Med 176:238-242.

Suchanek M, Radzikowska A, Thiele C (2005) Photo-leucine and photo-methionine allow identification of protein-protein interactions in living cells. Nat Methods 2:261-267.

Truss M, Beato M (1993) Steroid hormone receptors: interaction with deoxyribonucleic acid and transcription factors. Endocr Rev 14:459-479.

Tsai SY, Carlstedt-Duke J, Weigel NL, Dahlman K, Gustafsson JA, Tsai MJ, O'Malley BW (1988) Molecular interactions of steroid hormone receptor with its enhancer element: evidence for receptor dimer formation. Cell 55:361-369.

Ukena K, Kohchi C, Tsutsui K (1999) Expression and activity of 3beta-hydroxysteroid dehydrogenase/delta5-delta4-isomerase in the rat Purkinje neuron during neonatal life. Endocrinology 140:805-813.

Ukena K, Usui M, Kohchi C, Tsutsui K (1998) Cytochrome P450 side-chain cleavage enzyme in the cerebellar Purkinje neuron and its neonatal change in rats. Endocrinology 139:137-147.

Wahl M, Schilling L, Unterberg A, Baethmann A (1993) Mediators of vascular and parenchymal mechanisms in secondary brain damage. Acta Neurochir Suppl (Wien) 57:64-72.

Whalen RE (1974) Estrogen-progesterone induction of mating in female rats. Horm Behav 5:157-162.

Wiegand SJ, Terasawa E, Bridson WE, Goy RW (1980) Effects of discrete lesions of preoptic and suprachiasmatic structures in the female rat. Alterations in the feedback regulation of gonadotropin secretion. Neuroendocrinology 31:147-157.

Wright DW, Kellermann AL, Hertzberg VS, Clark PL, Frankel M, Goldstein FC, Salomone JP, Dent LL, Harris OA, Ander DS, Lowery DW, Patel MM, Denson DD, Gordon AB, Wald MM, Gupta S, Hoffman SW, Stein DG (2007) ProTECT: a randomized clinical trial of progesterone for acute traumatic brain injury. Ann Emerg Med 49:391-402, 402 e391-392.

Zwain IH, Yen SS (1999) Neurosteroidogenesis in astrocytes, oligodendrocytes, and neurons of cerebral cortex of rat brain. Endocrinology 140:3843-3852.

CHAPTER 2

DISTRIBUTION OF mRNAS ENCODING CLASSICAL PROGESTIN

RECEPTOR, PROGESTERONE MEMBRANE COMPONENTS 1 AND 2,

SERPINE MRNA BINDING PROTEIN 1, AND PROGESTIN AND ADIPOQ

RECEPTOR FAMILY MEMBERS 7 AND 8 IN RAT FOREBRAIN

2.1 Abstract

Several lines of evidence suggest the existence of multiple progestin receptors that may account for rapid and delayed effects of progesterone in the central nervous system. The delayed effects have been long attributed to activation of the classical progestin receptor (Pgr). Recent studies have discovered novel progestin signaling molecules that may be responsible for rapid effects, including progesterone receptor membrane component 1 (Pgrmc1), Pgrmc2, progestin and adipoQ receptor 7 (Paqr7) and Paqr8. The functions of these molecules have been investigated extensively in non- neural, but not in neural tissues, partly because it is unclear which are expressed in the brain and where they are expressed. To address these issues, we compared the distributions of mRNAs encoding Pgr, Pgrmc1, Pgrmc2, Paqr7 and Paqr8 using in situ hybridization (ISH) with radiolabeled oligodeoxynucleotidyl probes in forebrain tissues of estradiol-treated female rats. We also examined the distribution of serpine mRNA binding protein 1 (Serbp1), a putative binding partner of Pgrmc1. Analysis of adjacent brain sections showed that the highest expression of mRNAs encoding Pgr, Pgrmc1,

Pgrmc2 and Serbp1 was detected in several hypothalamic nuclei important for female reproduction. In contrast, expression patterns of Paqr7 and Paqr8 were low and

homogeneous in the hypothalamus, and more abundant in thalamic nuclei. The neuroanatomical distributions of these putative progestin signaling molecules suggest that Pgrmc1 and Pgrmc2 may play a role in neuroendocrine functions while Paqr7 and

Paqr8 are more likely to regulate sensory and cognitive functions.

2.2 Introduction

Progesterone (P 4) is widely recognized for its ability to regulate neural functions related to reproduction, but it also affects diverse processes such as cognition and neurogenesis (Berman et al., 1997, Giachino et al., 2003). The traditional tenet of P 4 action is that it binds the cognate progestin receptor (Pgr), and functions as a ligand- activated transcription factor to regulate gene expression. However, rapid non-genomic effects have also been reported (Meyerson, 1972, Parsons et al., 1980, Mani et al.,

1994b), and P 4 can act in the absence of Pgr (Frye et al., 2006). These data support the emerging concept that P4 actions in the brain may be through the classical Pgr and also through non-classical mechanisms.

Current research suggests that there are several possible candidates for

mediating the non-classical effects of P 4. One such protein is progesterone receptor

membrane component 1 (Pgrmc1), but it does not appear to function as a traditional

receptor because it requires a binding partner known as serpine mRNA binding protein

1 (Serbp1) (Peluso et al., 2005, 2006). Moreover, the structure of Pgrmc1 does not

share homology with either classical steroid receptors or G-coupled protein receptors

(Mifsud and Bateman, 2002). Nonetheless, Pgrmc1 mediates several important Pgr-

independent effects. For example, P 4 acts through Pgrmc1 to activate phosphoinositide-

dependent protein kinase 1 and phosphorylate Akt (Hand and Craven, 2003). In the

ovary, Pgrmc1 and Serbp1 form a receptor complex required for the antiapoptotic effects of P4 in granulosa cells (Peluso et al., 2006, Zhang et al., 2008). Pgrmc2 is a closely related isoform of Pgrmc1, differing mainly in its N-terminus, but there is virtually no information regarding Pgrmc2 function (Falkenstein et al., 1999, Peluso et al., 2005). Pgrmc1 has been localized to several brain regions (Krebs et al., 2000,

Sakamoto et al., 2004, Meffre et al., 2005), but no studies have systematically mapped its distribution and the role of this protein in the brain remains unknown. Likewise, no studies have mapped neural expression of Serbp1 or Pgrmc2 . Despite these limitations, several lines of evidence indicate that Pgrmc1/Serbp1, and possibly Pgrmc2, may be important for non-classical P4 actions in the brain.

Two other candidates for mediating the non-genomic effects of P 4 are progestin and adipoQ receptor 7 (Paqr7) and Paqr8. These are G-protein coupled receptors first discovered in spotted sea trout, and subsequently in mammalian tissues (Zhu et al.,

2003a, Zhu et al., 2003b). Although activation of these receptors by P 4 regulates cAMP levels and MAPK activity in fish (Hanna et al., 2006), there is some debate about whether they function as bona fide P4 receptors in mammals (Fernandes et al., 2008).

Recent reports detected Paqr7 and Paqr8 mRNAs in hypothalamic tissue of mice, but the exact anatomical localization is unknown (Sleiter et al., 2009). Collectively, these findings raise the possibility that Paqr7 and Paqr8 also mediate P 4 neural actions.

Although there is abundant evidence that these signaling molecules participate

in P 4 signaling, it is unclear which are important in the nervous system. Moreover,

while many neural functions are modulated by P 4, there is little information about which

functions require Pgr, non-nuclear receptors or both. One obstacle to resolving this

question is that neither the classical Pgr nor any of the non-classical P 4 receptor candidates have been systematically mapped in the brain. To address this issue, we used in situ hybridization histochemistry (ISHH) to map the expression of mRNAs encoding Pgr, Pgrmc1, Pgrmc2, Serbp1, Paqr7 and Paqr8. In these studies, we used female rats because of the important role P 4 plays in regulation of female-specific physiological functions.

2.3 Materials and Methods

2.3.1 Animals and Tissue Preparation

All protocols were approved by the Institutional Animal Care and Use

Committee of the University of Massachusetts and all animals were housed in accordance with the National Institutes of Health Guidelines for the Care and Use of

Laboratory Animals. Six adult female Sprague-Dawley rats (225-250 g; approximately

95 days of age; Harlan Sprague-Dawley, Madison WI) were individually housed in the

Animal Care Facility on a 14:10 light:dark cycle with food and water provided ad libitum . To achieve a similar hormonal milieu among rats, we ovariectomized them and implanted two Silastic capsules containing E2 (150 µg/ml 17 β-estradiol in sesame oil) a week later as described previously (Petersen and LaFlamme, 1997). Twenty-four hours later, we collected brains and rapidly froze and stored them at -80 °C until they were cryosectioned (Leica CM3000, Nussloch, Germany).

For three animals, 14-m coronal forebrain sections were obtained and thaw-

mounted onto gelatin-coated slides and stored at -80 °C until ISHH was performed.

The remaining three animals were used for RNA isolation in validation studies

described below. 27

2.3.2 Probe Preparation

In these studies, we used oligodeoxynucleotidyl probes of the same length and specific activity. Antisense oligodeoxynucleotide sequences used for end-tailing are provided in Table 2.6.1. Both sense and antisense sequences were produced by an automated DNA synthesizer and purified by reverse-phase HPLC by Integrated DNA

Technologies (Coralville, IA). Oligodeoxynucleotides were 3’-end labeled with [ α33 P]- dATP (PerkinElmer, Waltham, MA) using terminal deoxynucleotidyl transferase

(Roche, Indianapolis, IN) as described previously (Petersen et al., 1989). Incubation was halted by addition of TE (10mM Tris-HCL; pH 8.0, 1 mM EDTA), and the probe was purified by phenol-chloroform extraction and ethanol precipitation. The resulting pellet was washed with 70% ethanol and resuspended in 25 µl TE.

2.3.3 ISHH

The distribution pattern for each mRNA was determined in separate ISHH runs, and tissue sections were prehybridized as previously described (Ottem et al., 2004).

Radioisotopic probes (0.5 x 10 6 cpm) were applied directly to brain tissue in 20 µl hybridization buffer. This buffer contained 4XSSC (1XSSC = 0.15 M NaCl/0.015 M sodium citrate, pH 7.2), 50% (v/v) formamide, 10% (w/v) dextran sulfate, 250 µg/ml yeast tRNA, 1X Denhardt's solution, 500 µg/ml heparin sodium salt, 0.1% sodium pyrophosphate and 0.05 M dithiothreitol added freshly before use. Sections were covered with glass coverslips and hybridized overnight at 37 °C in humidified plastic boxes. Slides were removed from 37 °C and allowed to cool, and coverslips were floated off in 1XSSC. They were washed four times for 15 minutes each in 2XSSC-

50% formamide solution at 40 °C, followed by four washes, 15 minutes each, in 28

1XSSC. Finally, slides were rinsed in water and briefly dehydrated in 70% ethanol.

The slides were air-dried and apposed to Kodak BioMax MR film (Rochester, NY) for signal detection. In order to acquire optimum signal, autoradiograms were developed at

1, 3 and 6 weeks by an X-ray film processor and images were acquired using BioQuant

Imaging Software (Bio-Quant Inc, Nashville, TN,) and a CCD videocamera (QImaging

QICAM FAST color).

2.3.4 Validation of probe specificity

To determine the specificity of the hybridization signal, sense strand probes to each target of interest were hybridized to representative sections. To verify specificity of each antisense probe, subsets of adjacent slides were treated with RNAse A solution

(100 g/ml RNAse A in 0.5 M NaCl, 0.05 M EDTA and 0.01 M Tris-HCl) for one hour at 37 °C following prehybridization. An additional set of slides was used for Nissl staining in order to provide reference material for identification of specific brain regions.

Regardless of exposure time, Paqr7 and Paqr8 antisense probes produced diffuse and homogeneous signal, therefore multiple probes (Table 2.6.2) were used for each gene to verify signal specificity. To ensure specificity in regions that displayed low

ISHH signal for Paqr7, quantitative polymerase chain reaction (QPCR) was performed using cDNA derived from RNA of the diagonal band of Broca and striatum, regions with two different signal intensities. RNA was isolated from tissue punches using the

RNeasy Lipid Tissue Kit (Qiagen, Valencia, CA) and reverse transcribed into cDNA using Quantitect Reverse Transcription Kit (Qiagen) and manufacturer’s protocol.

Reactions were performed in a Stratagene Mx3000P instrument programmed as 29

follows: 95 °C, 10 min, and 40 cycles of 95 °C for 15 sec and 60 °C for 60 sec.

Reactions contained reagents from QuantiTect SYBR Green Kit and manufacturer’s

protocols were used (Roche Diagnostics, Indianapolis, IN). Specific primer sets were

obtained from Integrated DNA Technologies, and the forward and reverse primers used

to detect Paqr7 mRNA were 5’-TGCACCGCATCATAGTGTC-3’ and

5’-GATAGTCCAGCGTCACAGC-3’. Resulting cycle thresholds were normalized

using forward and reverse primers for beta-actin: 5’-GGGAAATCGTGCGTGACATT-

3’ and 5’- GCGGCAGTGGCCATCTC-3’. Samples with no cDNA were used as

negative controls. Products were resolved using 2% agarose gel electrophoresis.

2.3.5 Data Analysis

Neuroanatomic mapping of Pgrmc1, Pgrmc2, Paqr7, Paqr8, Serbp1 and Pgr was performed with the aid of a rat brain atlas (Swanson, 1998) and Nissl-stained adjacent sections. Relative levels of mRNA were determined by optical densitometric measurements of the autoradiographic signals across different brain regions. Results of this semiquantitative ISHH were obtained by digitizing all autoradiographic images and four ranges of density of labeling were used to determine relative intensities across brain regions and across probes. Signal strength intensity was determined using arbitrary optical density units and denoted by – (background; 0-51), + (low; 52-102), ++

(moderate; 103-153), +++ (154-204), and ++++ (highest signal intensity; 205-255).

Digitized images were imported into Adobe Photoshop 8.0 CS (Adobe Systems Inc.,

San Jose CA) and all figures were cropped to the same size for display.

For QPCR studies, relative levels of Paqr7 mRNA were analyzed using the 2-

Ct method (Livak and Schmittgen, 2001). 30

2.4 Results

2.4.1 Probe Specificity

We verified the specificity of the probes used in these studies in several ways.

All four oligodeoxynucleotidyl probes for each target produced the same labeling pattern. In addition, neither sense strand controls nor RNAse A-treated sections showed specific signal with the exception of the sense probe for Paqr7. Although Paqr7 sense strand control probes showed signal above background, the signal for antisense probes was abolished by tissue pretreatment with RNAse A (Fig. 2.7.1, D3). Moreover, QPCR detected a single band of expected size using primers to Paqr7. Consistent with our

ISHH findings, QPCR detected higher mRNA levels in the diagonal band of Broca than in the striatum (data not shown).

2.4.2 Distribution of Pgrmc1, Serbp1, Pgrmc2, Paqr7, Paqr8 and Pgr mRNAs

The neuroanatomical distributions of mRNAs encoding Pgrmc1, Serbp1,

Pgrmc2, Paqr7, Paqr8 and Pgr are presented in Table 2.6.3. The distributions of mRNAs encoding Pgrmc1, Pgrmc2 and Serbp1 overlapped extensively throughout the brain, and some of these regions displayed high levels of the classical Pgr, most notably in ventral structures. Paqr7 and Paqr8 mRNAs were not highly expressed in these structures, but showed expression patterns similar to one another. Unlike signals for probes to Pgrmc1, Pgrmc2, Serbp1 and Pgr, signals for Paqr7 and Paqr8 probes were characterized by diffuse labeling found predominantly in the thalamus.

2.4.3 Diencephalon

In the rostral diencephalon, high signal intensities for Pgrmc1 mRNA were detected in several olfactory nuclei as indicated in Fig. 2.7.1, A1. We found moderate

signal for mRNAs encoding Pgrmc1, Paqr7 and Paqr8 in the diagonal band of Broca

(Fig. 2.7.1; A1, D1 and E1, respectively). In the preoptic area (POA), the AVPV nucleus displayed very high levels of mRNAs encoding Pgrmc1 and Pgr (Fig. 2.7.2, A1 and F1). Serbp1 and Pgrmc2 also showed elevated signal intensities in this nucleus

(Fig. 2.7.2, B1 and C1). Although Paqr7 and Paqr8 mRNAs were found in the POA, clearly defined signal within the AVPV was not apparent (Fig. 2.7.2, D1 and E3). The bed nucleus of the stria terminalis contained dense labeling for Pgrmc1, Serbp1 and Pgr

(Fig. 2.7.2, A2, B2 and F2). Moderate levels of mRNAs encoding Pgrmc1 and Paqr8 were found in the rostral portion of the lateral septal nucleus (Fig. 2.7.2, A1 and E1).

The paraventricular nucleus (PVN) and supraoptic nucleus (SON) showed abundant labeling for Pgrmc1, Serbp1, and Pgrmc2 (Fig. 2.7.2, A3, B3 and C3). High signal for probes encoding these mRNAs was also detected in the zona incerta, ventromedial nucleus (VMH) and arcuate nucleus (Arc), a finding consistent with the distribution of Pgr (Fig. 2.7.3, A1, B1, C1 and F1). The reunions nucleus of the thalamus showed moderate levels of mRNAs encoding Pgrmc1, Serbp1, Pgrmc2 and

Pgr mRNAs (Fig. 2.7.3, A1, B1, C1 and F1). In contrast, probes for these mRNAs showed low levels of signal intensity in the ventromedial thalamic nuclei while those encoding Paqr7 and Paqr8 were somewhat prominent (Fig. 2.7.3, column 1). The anterodorsal and anteroventral thalamic nuclei displayed similarly elevated levels of

Serbp1 and Paqr8 gene expression (Fig. 2.7.3, B1 and E1).

2.4.4 Telencephalon

The hippocampus showed intense hybridization signals for Pgrmc1, Serbp1,

Pgrmc2 and Pgr probes as shown in Fig. 2.7.3, columns 1 and 2. Within this region,

signal intensities were highest in the CA2 and CA3 for all four mRNAs. In the dentate gyrus, stronger signal was detected for mRNAs encoding Pgrmc1, Serbp1 and Pgrmc2

(Fig. 2.7.3, A2, B2 and C2) than for those encoding Pgr (Fig. 2.7.3, F2). Paqr8 displayed low to moderate signal intensity within the hippocampus (Fig. 2.7.3, E2). In contrast, mRNAs encoding Paqr7 were undetectable in CA1, CA2, CA3 and dentate gyrus (Fig. 2.7.3, D1 and D2).

In the cortex, moderate levels of mRNAs were observed for Pgrmc1, Serbp1,

Pgrmc2, Paqr8 and Pgr as shown in column 2 of Fig. 2.7.1. High signal intensity was detected in cortical regions for Pgrmc1, Serbp1 and Pgr mRNA (Fig. 2.7.3, row A, B and F). The medial amygdala showed moderate expression of Pgrmc1 , Serbp1 , Pgrmc2 and Pgr (Fig. 2.7.3, columns 1 and 2). Alternatively, Paqr7 and Paqr8 signals in the amygdala were low overall (Fig. 2.7.3, D2 and E2)

The highest levels of mRNAs encoding Pgrmc1, Serbp1 and Pgr in the caudal

forebrain were detected in the periaqueductal gray (PAG) (Fig. 2.7.3, A3, B3 and F3).

Pgrmc2 mRNA levels were moderately high within this region (Fig. 2.7.3, C3), but

Paqr7 and Paqr8 mRNAs were very low (Fig. 2.7.3, D3 and E3). Interestingly, Paqr8

mRNA levels were highest in the nucleus of the oculomotor tract (Fig. 2. 7.3, E3).

Finally, within the substantia nigra and interpeduncular nucleus, we detected

moderately high levels of mRNAs encoding Pgrmc1, Serbp1 and Pgr (Fig. 2.7.3, A3,

B3 and F3).

2.5 Discussion

Collectively, these neuroanatomical mapping data provide important clues as to functions of putative progestin signaling molecules. The high levels of Pgrmc1 and

Pgrmc2 mRNAs within virtually all hypothalamic nuclei suggest that these molecules are likely candidates for mediating rapid neuroendocrine effects. Moreover, signals for

Pgrmc1 and Pgrmc2 mRNAs were strongest in regions that also contained Pgr and regulate reproductive functions, consistent with the idea that these functions require both rapid and delayed actions of P 4. Pgrmc1 and Serbp1 mRNAs displayed strongly overlapping distribution patterns supporting the idea that these molecules interact to form a functional receptor (Peluso et al., 2004). Our data indicate that Paqr7 and Paqr8 may be important in sensory relay systems and other less well understood P 4 functions regulated by thalamic and cortical brain regions. Our findings suggest that P 4 may act through a number of signaling molecules to influence a much broader array of physiological effects than previously recognized.

The specific neural mechanisms underlying the role of Pgrmc1 have not yet been delineated, but the distinctive and overlapping patterns of Pgrmc1 and Serbp1 mRNAs suggest that these molecules may interact in neurons as they do in other cells.

In granulosa cells, P 4 activation of the Pgrmc1/Serbp1 complex stimulates

phosphorylation cascades through activation of protein kinase G (Peluso et al., 2007).

Protein kinase G can activate additional kinases such as phosphoinositide 3-kinase,

resulting in phosphorylation of Akt (Kandel and Hay, 1999, Brazil and Hemmings,

2001). The rapid phosphorylation of Akt in response to P 4 has been observed in cells

from cortex and hippocampus (Singh, 2001, Hwang et al., 2009), and our study shows

that both brain regions contain Pgrmc1 and Serbp1. Taken together, these observations

suggest that phosphorylation events initiated by P 4 may involve the Pgrmc1/Serbp1

complex.

Brain regions rich in Pgrmc1 and Serbp1, as well as Pgrmc2 and Pgr, include the

AVPV, medial preoptic (MPN), Arc and suprachiasmatic nuclei (SCN). These findings are in agreement with previous immunocytochemical and ISHH studies of Pgr and

Pgrmc1 (Parsons et al., 1982, Krebs et al., 2000, Curran-Rauhut and Petersen, 2002,

Meffre et al., 2005). Each of these nuclei contribute to the timing and magnitude of the preovulatory luteinizing hormone (LH) surge, a process in which P 4 exerts rapid and delayed effects. For example, estrogen induction of the LH surge requires Pgr expression in the AVPV/MPN (Chappell and Levine, 2000), and P 4 rapidly advances and augments the LH surge in estradiol-primed female rats (Krey et al., 1973, DePaolo and Barraclough, 1979, Levine and Ramirez, 1980). Our findings that the AVPV/MPN displayed high levels of Pgrmc1, Serbp1 and Pgrmc2 support the idea that these signaling molecules mediate rapid P 4 effects in the LH surge mechanism. P 4 also rapidly represses basal LH levels, and this action may involve the Arc (Banks and

Freeman, 1978, Goodman et al., 1981, Richter et al., 2005), where Pgrmc1, Pgrmc2 and

Serbp1 mRNA levels were also high. Finally, levels of these mRNAs were elevated in the SCN, and while not directly linked to reproduction, this nucleus sends projections to the AVPV and is critical for the temporal regulation of the LH surge (Paxinos and

Watson, 1982, Watts and Swanson, 1987, de la Iglesia et al., 1995). Although the rapid effects of P 4 on LH surge release may be mediated by membrane-associated Pgr

(Hammes and Levin, 2007), the current observations suggest that Pgrmc1, Pgrmc2 and

Serbp1 may also play a role.

We found high levels of mRNAs encoding Pgrmc1, Pgrmc2, Serbp1 and Pgr in the VMH and in PAG, brain regions important for P 4-dependent female sex behaviors

(Pfaff and Sakuma, 1979, Rubin and Barfield, 1983). This confirms a previous report of Pgrmc1 in the VMH (Krebs et al., 2000). Rat copulatory behavior requires activation of the Pgr within the VMH (Pollio et al., 1993, Ogawa et al., 1994), a nucleus that sends projections to many brain regions including the PAG (Saper et al., 1976). In the PAG,

P4 rapidly elicits female sexual receptivity (Gorski, 1974, Wise et al., 1981), an effect originally attributed to Pgr expression in this region. However, work in Pgr-null mice shows that sexual receptivity can be rapidly induced by midbrain injection of P 4, indicating a role for other signaling mechanisms (Beyer et al., 1988, Frye and Vongher,

1999). One such mechanism involves P 4 metabolism to allopregnanolone, a molecule that induces feminine sex behaviors when injected into the midbrain (Beyer et al., 1988,

Pfaff et al., 1994). The present work suggests another possibility, namely that Pgrmc1 contributes to elicitation of sexual receptivity by mediating rapid P 4 signaling through phosphorylation events as described above. Alternatively, Pgrmc1 may influence sex behavior through actions on neurosteroid production in the midbrain, a process that may be required for feminine sex behavior (Akesson et al., 1988, Frye et al., 2007).

Consistent with this idea, Pgrmc1 interacts with key regulators of cholesterol homeostasis (Suchanek et al., 2005) and enhances steroidogenesis in diverse cell types

(Laird et al., 1988, Min et al., 2004).

The present study identified high levels of Pgrmc1, Pgrmc2 and Serbp1 mRNAs in regions not directly linked to reproduction. For example, we confirmed previous findings that Pgrmc1 is expressed in the PVN and SON (Krebs et al., 2000, Meffre et al., 2005), and extend these findings to show that Pgrmc2 and Serbp1 mRNAs were also found in these nuclei. The physiological significance of these findings are unclear, but

Meffre et al. found that Pgrmc1 protein was expressed specifically within vasopressinergic neurons of the PVN and SON, suggesting that Pgrmc1 may play a role in regulation of water and ion homeostasis (Meffre et al., 2005). We also found

Pgrmc1, Pgrmc2 and Serbp1 mRNAs in CA1, CA2, CA3 and dentate gyrus. These findings may be relevant to the observation that P4 enhances hippocampal-dependent cognitive performance (Hoshina et al., 1994, Sandstrom and Williams, 2001). Our data also compliment previous findings of Pgrmc1 and Pgrmc2 mRNAs in neuroprogenitor cells derived from adult hippocampus (Liu et al., 2009). In these cells, the authors showed that P4 induces neurogenesis through Pgrmc1-dependent phosphorylation cascades that do not require Pgr. These findings suggest that non-genomic signaling events involving Pgrmc1, and possibly Pgrmc2 and Serbp1, underlie P 4 actions in diverse neural functions.

Neither Paqr7 nor Paqr8 genes were strongly expressed in neural regions that control gonadotropin release and contain abundant Pgrmc1 mRNA. This was somewhat surprising because these genes are colocalized in other parts of the reproductive system.

For example, Paqr7, Paqr8 and Pgrmc1 have been detected in cells of the ovary, uterus, and placenta in rats, sheep, and humans (Zhu et al., 2003a, Cai and Stocco, 2005, Peluso et al., 2006, Zhang et al., 2008, Ashley et al., 2009). Moreover, in the rat corpus luteum, the expression of each of these genes changes during pregnancy, and the patterns of change for Paqr7 and Pgrmc1 expression are strikingly similar (Cai and

Stocco, 2005). In contrast to Pgrmc1, neither Paqr7 nor Paqr8 mRNA levels are found at levels much above background in AVPV/MPN. However, the AVPV provides afferent projections to GnRH neurons and results of recent studies show that Paqr7 and

Paqr8 are functional in GT1-7 immortalized GnRH neurons (Sleiter et al., 2009). Thus, it is possible that Paqr7 and Paqr8 impact the neural control of reproduction, but through GnRH neurons scattered in the rostral preoptic area that also receive signals from Pgrmc1-containing neurons of the AVPV.

Though we did not find strong evidence for Paqr7 or Paqr8 gene expression in neuroendocrine nuclei, their expression was high in thalamic and cortical brain regions suggesting that these may participate in less well-studied actions of P 4. The thalamus is known primarily as a sensory relay system but few studies have examined P 4 actions within this brain region. However, P 4 binding occurs in the lateral septal nucleus of the thalamus (Shughrue et al., 1992) where we found high levels of mRNA encoding Paqr8.

This is important because present and previous studies have found that the Pgr is absent in this brain region (Parsons et al., 1982). P 4 binding within the lateral septum

decreases anxiety and depression-like behaviors (Pesold and Treit, 1992, Estrada-

Camarena et al., 2002), and these effects have been presumed to be mediated by P 4

metabolites acting on GABA A receptors (Majewska et al., 1986). Similarly, GABA A

receptors are implicated in the neuroprotective effects of P 4 in the cortex, a region in

which we observed high levels of Paqr7, Paqr8 and Pgr mRNAs. In light of the present

findings, it is also possible that Paqr8 mediates P 4 actions in the lateral septum and

cortex. This idea is supported by findings that in the cortex, maximal neuroprotective

effects of P 4 require activation of MAPK and phosphoinositide 3-kinase pathways

(Kaur et al., 2007), suggesting a role for membrane-initiated P 4 signaling, possibly

involving Paqr7 and Paqr8.

In summary, we found that genes encoding Pgrmc1, Serbp1, Pgrmc2 and Pgr, but not Paqr7 and Paqr8, were highly expressed in many preoptic and hypothalamic nuclei and their projection sites. In contrast, Paqr7 and Paqr8 mRNA levels were most robust in thalamic nuclei and cortex. In view of these neuroanatomical findings, it is tempting to speculate that Pgrmc1 and Pgrmc2 control neuroendocrine functions, while

Paqr7 and Paqr8 regulate affect and cognition. Additionally, the extensive overlap of

Pgrmc1, Pgrmc2 and the classical Pgr mRNAs raise the intriguing possibility that these molecules interact within the same cells to regulate rapid and delayed P 4 effects in the brain. However, there were some regions in which Pgrmc1 and Pgrmc2 may exert effects independently of the Pgr. Together, these data provide anatomical information that will be important for determining the functional roles of these novel P 4 signaling molecules.

2.6.1: Sequences for Oligodeoxynucleotidyl Probes Used in ISHH Studies

NCBI Gene AS to and Accession # Oligodeoxynucleotide Sequences 5’- 3’ bases Pgrmc1 1354- TGTAGTTCCAACCCAATTACCAGGTGTGTGAGAGTTACTGTGTGTGG NM_021766 1305 Pgrmc2 667- CAAAGTTCAGTCCTGTTTACTGTGATCCTTGGTGTCCTCCTCGTCTGT NM_001008374 619 Serbp1 1274- AAGGAACCAGTGTTGTATTATGGCATCCAGTTAGGCCAGAGCGGGGAA NM_145086 1227 Paqr7 888- ATAGTCCAGCGTCACAGCTTCTAGCTGGGCTAAAGTGCACAGCACC NM_001034081 843 1112- Paqr8 GCCAGCCCCGCTGGTACCACTTGACAGATCTTCCGCATAACTGGATA NM_001014099 1065 Pgr 2375- CACATGGTAAGGCACAGCGAGTAGAATGACAACTCCTTCATCCTCTG NM_022847 2328

2.6.2: Oligodeoxynucleotidyl Sequences for ISHH Validation Studies

NCBI Gene Name Antisense and Accession # Oligodeoxynucleotide sequences 5’- 3’ to bases:

GGTACACGGCCACACCCACATAGTCCAAGAAGAAGAAGCTGTAATGC 445-398

Paqr7 GGGGCCAACGGGCGTGCAGAGGCTTATAGATGGCTCCCCGAGCCTGA 934-887 NM_001034081

CAGGCTGGACAGCAGGTGGCTGAACTTCTGGGCTACTGCCATCGCCAT 48-1

TTCTGGGACGGTGCATGGCATCTTGGGAAGCCCTTCTTCCAGAATCTT 570-523

Paqr8 NM_001014099 GAGCCAGGCCGGTGGTGAGTTTGAGGCCAGCCTGCTCTATAGAGTGAG 238-191

GTGAGCCAAGGCGCTGCCATACTGGTAGACACTGACCCCGACGTAGTC 486-439

2.6.3: Localization and Abundance of mRNA encoding Pgr, Pgrmc1,

Serbp1, Pgrmc2, Paqr7 and Paqr8 in Female Rat Forebrain 1

2.7.1 Photomicrographs of ISHH

Figure 2.7.1: Photomicrographs of film autoradiograms of hybridized rat brain sections to 33 P-labeled oligodeoxynucleotidyl probes for (A) Pgrmc1, (B) Serbp1, (C) Pgrmc2, (D) Paqr7, (E) Paqr8 and (F) Pgr. For Pgrmc1, Serbp1, Pgrmc2, Paqr8 and Pgr, the sense (S) strand probe is shown in the third image of each series. For Paqr7, the section was hybridized to the antisense probe and then treated with RNAse A. Scale bar = 200 m. 43

2.7.2 Photomicrographs of ISHH

Figure 2.7.2: Rostral to caudal arrangement of photomicrographs of film autoradiograms of hybridized rat forebrain sections to 33 P-labeled oligodeoxynucleotidyl probes for (A) Pgrmc1, (B) Serbp1, (C) Pgrmc2, (D) Paqr7, (E) Paqr8 and (F) Pgr. Scale bar = 200 µm.

2.7.3 Photomicrographs of ISHH

Figure 2.7.3: Rostral to caudal arrangement of photomicrographs of film autoradiograms of hybridized rat forebrain sections to 33 P-labeled oligodeoxynucleotidyl probes for (A) Pgrmc1, (B) Serbp1, (C) Pgrmc2, (D) Paqr7, (E) Paqr8 and (F) Pgr. Scale bar = 200 µm.

2.8 References

Akesson, T. R., Simerly, R. B. and Micevych, P. E., 1988. Estrogen-concentrating hypothalamic and limbic neurons project to the medial preoptic nucleus. Brain Res. 451, 381-385.

Ashley, R. L., Arreguin-Arevalo, J. A. and Nett, T. M., 2009. Binding characteristics of the ovine membrane progesterone receptor alpha and expression of the receptor during the estrous cycle. Reprod Biol Endocrinol. 7, 42.

Banks, J. A. and Freeman, M. E., 1978. The temporal requirement of progesterone on proestrus for extinction of the estrogen-induced daily signal controlling luteinizing hormone release in the rat. Endocrinology. 102, 426-432.

Berman, K. F., Schmidt, P. J., Rubinow, D. R., Danaceau, M. A., Van Horn, J. D., Esposito, G., Ostrem, J. L. and Weinberger, D. R., 1997. Modulation of cognition-specific cortical activity by gonadal steroids: a positron-emission tomography study in women. Proc Natl Acad Sci U S A. 94, 8836-8841.

Beyer, C., Gonzalez-Mariscal, G., Eguibar, J. R. and Gomora, P., 1988. Lordosis facilitation in estrogen primed rats by intrabrain injection of pregnanes. Pharmacol Biochem Behav. 31, 919-926.

Brazil, D. P. and Hemmings, B. A., 2001. Ten years of protein kinase B signalling: a hard Akt to follow. Trends Biochem Sci. 26, 657-664.

Cai, Z. and Stocco, C., 2005. Expression and regulation of progestin membrane receptors in the rat corpus luteum. Endocrinology. 146, 5522-5532.

Chappell, P. E. and Levine, J. E., 2000. Stimulation of gonadotropin-releasing hormone surges by estrogen. I. Role of hypothalamic progesterone receptors. Endocrinology. 141, 1477-1485.

Curran-Rauhut, M. A. and Petersen, S. L., 2002. The distribution of progestin receptor mRNA in rat brainstem. Brain Res Gene Expr Patterns. 1, 151-157. de la Iglesia, H. O., Blaustein, J. D. and Bittman, E. L., 1995. The suprachiasmatic area in the female hamster projects to neurons containing estrogen receptors and GnRH. Neuroreport. 6, 1715-1722.

DePaolo, L. V. and Barraclough, C. A., 1979. Dose dependent effects of progesterone on the facilitation and inhibition of spontaneous gonadotropin surges in estrogen treated ovariectomized rats. Biol Reprod. 21, 1015-1023.

Estrada-Camarena, E., Contreras, C. M., Saavedra, M., Luna-Baltazar, I. and Lopez- Rubalcava, C., 2002. Participation of the lateral septal nuclei (LSN) in the antidepressant-like actions of progesterone in the forced swimming test (FST). Behav Brain Res. 134, 175-183.

Falkenstein, E., Heck, M., Gerdes, D., Grube, D., Christ, M., Weigel, M., Buddhikot, M., Meizel, S. and Wehling, M., 1999. Specific progesterone binding to a membrane protein and related nongenomic effects on Ca2+-fluxes in sperm. Endocrinology. 140, 5999-6002.

Fernandes, M. S., Brosens, J. J. and Gellersen, B., 2008. Honey, we need to talk about the membrane progestin receptors. Steroids. 73, 942-952.

Frye, C. A., Paris, J. J. and Rhodes, M. E., 2007. Engaging in paced mating, but neither exploratory, anti-anxiety, nor social behavior, increases 5alpha-reduced progestin concentrations in midbrain, hippocampus, striatum, and cortex. Reproduction. 133, 663-674.

Frye, C. A., Sumida, K., Lydon, J. P., O'Malley, B. W. and Pfaff, D. W., 2006. Mid- aged and aged wild-type and progestin receptor knockout (PRKO) mice demonstrate rapid progesterone and 3alpha,5alpha-THP-facilitated lordosis. Psychopharmacology (Berl). 185, 423-432.

Frye, C. A. and Vongher, J. M., 1999. Progesterone has rapid and membrane effects in the facilitation of female mouse sexual behavior. Brain Res. 815, 259-269.

Giachino, C., Galbiati, M., Fasolo, A., Peretto, P. and Melcangi, R., 2003. Neurogenesis in the subependymal layer of the adult rat: a role for neuroactive derivatives of progesterone. Ann N Y Acad Sci. 1007, 335-339.

Goodman, R. L., Bittman, E. L., Foster, D. L. and Karsch, F. J., 1981. The endocrine basis of the synergistic suppression of luteinizing hormone by estradiol and progesterone. Endocrinology. 109, 1414-1417.

Gorski, R. A., 1974. The neuroendocrine regulation of sexual behavior. Adv Psychobiol. 2, 1-58.

Hand, R. A. and Craven, R. J., 2003. Hpr6.6 protein mediates cell death from oxidative damage in MCF-7 human breast cancer cells. J Cell Biochem. 90, 534-547.

Hanna, R., Pang, Y., Thomas, P. and Zhu, Y., 2006. Cell-surface expression, progestin binding, and rapid nongenomic signaling of zebrafish membrane progestin receptors alpha and beta in transfected cells. J Endocrinol. 190, 247-260.

Hoshina, Y., Takeo, T., Nakano, K., Sato, T. and Sakuma, Y., 1994. Axon-sparing lesion of the preoptic area enhances receptivity and diminishes proceptivity among components of female rat sexual behavior. Behav Brain Res. 61, 197- 204.

Hwang, J. Y., Duncan, R. S., Madry, C., Singh, M. and Koulen, P., 2009. Progesterone potentiates calcium release through IP3 receptors by an Akt-mediated mechanism in hippocampal neurons. Cell Calcium. 45, 233-242.

Kandel, E. S. and Hay, N., 1999. The regulation and activities of the multifunctional serine/threonine kinase Akt/PKB. Exp Cell Res. 253, 210-229.

Kaur, P., Jodhka, P. K., Underwood, W. A., Bowles, C. A., de Fiebre, N. C., de Fiebre, C. M. and Singh, M., 2007. Progesterone increases brain-derived neuroptrophic factor expression and protects against glutamate toxicity in a mitogen-activated protein kinase- and phosphoinositide-3 kinase-dependent manner in cerebral cortical explants. J Neurosci Res. 85, 2441-2449.

Krebs, C. J., Jarvis, E. D., Chan, J., Lydon, J. P., Ogawa, S. and Pfaff, D. W., 2000. A membrane-associated progesterone-binding protein, 25-Dx, is regulated by progesterone in brain regions involved in female reproductive behaviors. Proc Natl Acad Sci U S A. 97, 12816-12821.

Krey, L. C., Tyrey, L. and Everett, J. W., 1973. The estrogen-induced advance in the cyclic LH surge in the rat: dependency on ovarian progesterone secretion. Endocrinology. 93, 385-390.

Liu L, Wang J, Zhao L, Nilsen J, McClure K, Wong K, Brinton RD. 2009. Progesterone increases rat neural progenitor cell cycle gene expression and proliferation via extracellularly regulated kinase and progesterone receptor membrane components 1 and 2. Endocrinology 150(7):3186-3196.

Laird, S. M., Vinson, G. P. and Whitehouse, B. J., 1988. Monoclonal antibodies against rat adrenocortical cell antigens. Acta Endocrinol (Copenh). 119, 420-426.

Levine, J. E. and Ramirez, V. D., 1980. In vivo release of luteinizing hormone-releasing hormone estimated with push-pull cannulae from the mediobasal hypothalami of ovariectomized, steroid-primed rats. Endocrinology. 107, 1782-1790.

Majewska, M. D., Harrison, N. L., Schwartz, R. D., Barker, J. L. and Paul, S. M., 1986. Steroid hormone metabolites are barbiturate-like modulators of the GABA receptor. Science. 232, 1004-1007.

Mani, S. K., Blaustein, J. D., Allen, J. M., Law, S. W., O'Malley, B. W. and Clark, J. H., 1994. Inhibition of rat sexual behavior by antisense oligonucleotides to the progesterone receptor. Endocrinology. 135, 1409-1414.

Meffre, D., Delespierre, B., Gouezou, M., Leclerc, P., Vinson, G. P., Schumacher, M., Stein, D. G. and Guennoun, R., 2005. The membrane-associated progesterone- binding protein 25-Dx is expressed in brain regions involved in water

Meyerson, B., 1972. Latency between intravenous injection of progestins and the appearance of estrous behavior in estrogen-treated ovariectomized rats. Horm Behav. 3, 1-9.

Mifsud, W. and Bateman, A., 2002. Membrane-bound progesterone receptors contain a cytochrome b5-like ligand-binding domain. Genome Biol. 3, RESEARCH0068.

Min, L., Takemori, H., Nonaka, Y., Katoh, Y., Doi, J., Horike, N., Osamu, H., Raza, F. S., Vinson, G. P. and Okamoto, M., 2004. Characterization of the adrenal- specific antigen IZA (inner zone antigen) and its role in the steroidogenesis. Mol Cell Endocrinol. 215, 143-148.

Ogawa, S., Olazabal, U. E., Parhar, I. S. and Pfaff, D. W., 1994. Effects of intrahypothalamic administration of antisense DNA for progesterone receptor mRNA on reproductive behavior and progesterone receptor immunoreactivity in female rat. J Neurosci. 14, 1766-1774.

Ottem, E. N., Godwin, J. G., Krishnan, S. and Petersen, S. L., 2004. Dual-phenotype GABA/glutamate neurons in adult preoptic area: sexual dimorphism and function. J Neurosci. 24, 8097-8105.

Parsons, B., MacLusky, N. J., Krey, L., Pfaff, D. W. and McEwen, B. S., 1980. The temporal relationship between estrogen-inducible progestin receptors in the female rat brain and the time course of estrogen activation of mating behavior. Endocrinology. 107, 774-779.

Parsons, B., Rainbow, T. C., MacLusky, N. J. and McEwen, B. S., 1982. Progestin receptor levels in rat hypothalamic and limbic nuclei. J Neurosci. 2, 1446-1452.

Paxinos, G. and Watson, C., 1982. The Rat Brain in Stereotaxic Coordinates. New York.

Peluso, J. J., Liu, X., Gawkowska, A. and Johnston-MacAnanny, E., 2009. Progesterone activates a progesterone receptor membrane component 1-dependent mechanism that promotes human granulosa/luteal cell survival but not progesterone secretion. J Clin Endocrinol Metab. 94, 2644-2649.

Peluso, J. J., Liu, X. and Romak, J., 2007. Progesterone maintains basal intracellular adenosine triphosphate levels and viability of spontaneously immortalized granulosa cells by promoting an interaction between 14-3-3sigma and ATP synthase beta/precursor through a protein kinase G-dependent mechanism. Endocrinology. 148, 2037-2044.

Peluso, J. J., Pappalardo, A., Fernandez, G. and Wu, C. A., 2004. Involvement of an unnamed protein, RDA288, in the mechanism through which progesterone mediates its antiapoptotic action in spontaneously immortalized granulosa cells. Endocrinology. 145, 3014-3022.

Peluso, J. J., Pappalardo, A., Losel, R. and Wehling, M., 2005. Expression and function of PAIRBP1 within gonadotropin-primed immature rat ovaries: PAIRBP1 regulation of granulosa and luteal cell viability. Biol Reprod. 73, 261-270.

Peluso, J. J., Pappalardo, A., Losel, R. and Wehling, M., 2006. Progesterone membrane receptor component 1 expression in the immature rat ovary and its role in mediating progesterone's antiapoptotic action. Endocrinology. 147, 3133-3140.

Pesold, C. and Treit, D., 1992. Excitotoxic lesions of the septum produce anxiolytic effects in the elevated plus-maze and the shock-probe burying tests. Physiol Behav. 52, 37-47.

Petersen, S. L., Cheuk, C., Hartman, R. D. and Barraclough, C. A., 1989. Medial preoptic microimplants of the antiestrogen, keoxifene, affect luteinizing hormone-releasing hormone mRNA levels, median eminence luteinizing hormone-releasing hormone concentrations and luteinizing hormone release in ovariectomized, estrogen-treated rats. J Neuroendocrinol. 1, 279-283.

Petersen, S. L. and LaFlamme, K. D., 1997. Progesterone increases levels of mu-opioid receptor mRNA in the preoptic area and arcuate nucleus of ovariectomized, estradiol-treated female rats. Brain Res Mol Brain Res. 52, 32-37.

Pfaff, D. W. and Sakuma, Y., 1979. Facilitation of the lordosis reflex of female rats from the ventromedial nucleus of the hypothalamus. J Physiol. 288, 189-202.

Pfaff, D. W., Schwartz-Giblin, S., McCarthy, M. M. and Kow, L. M., 1994. Cellular and molecular mechanisms of female reproductive behaviors. In: The physiology of reproduction. Knobil E, Neil E, eds, pp 107-220.

Pollio, G., Xue, P., Zanisi, M., Nicolin, A. and Maggi, A., 1993. Antisense oligonucleotide blocks progesterone-induced lordosis behavior in ovariectomized rats. Brain Res Mol Brain Res. 19, 135-139.

Richter, T. A., Robinson, J. E., Lozano, J. M. and Evans, N. P., 2005. Progesterone can block the preovulatory gonadotropin-releasing hormone/luteinising hormone surge in the ewe by a direct inhibitory action on oestradiol-responsive cells within the hypothalamus. J Neuroendocrinol. 17, 161-169.

Rubin, B. S. and Barfield, R. J., 1983. Progesterone in the ventromedial hypothalamus facilitates estrous behavior in ovariectomized, estrogen-primed rats. Endocrinology. 113, 797-804.

Sakamoto, H., Ukena, K., Takemori, H., Okamoto, M., Kawata, M. and Tsutsui, K., 2004. Expression and localization of 25-Dx, a membrane-associated putative progesterone-binding protein, in the developing Purkinje cell. Neuroscience. 126, 325-334.

Sandstrom, N. J. and Williams, C. L., 2001. Memory retention is modulated by acute estradiol and progesterone replacement. Behav Neurosci. 115, 384-393.

Saper, C. B., Swanson, L. W. and Cowan, W. M., 1976. The efferent connections of the ventromedial nucleus of the hypothalamus of the rat. J Comp Neurol. 169, 409- 442.

Shughrue, P. J., Bushnell, C. D. and Dorsa, D. M., 1992. Estrogen receptor messenger ribonucleic acid in female rat brain during the estrous cycle: a comparison with ovariectomized females and intact males. Endocrinology. 131, 381-388.

Singh, M., 2001. Ovarian hormones elicit phosphorylation of Akt and extracellular- signal regulated kinase in explants of the cerebral cortex. Endocrine. 14, 407- 415.

Sleiter, N., Pang, Y., Park, C., Horton, T. H., Dong, J., Thomas, P. and Levine, J. E., 2009. Progesterone receptor A (PRA) and PRB-independent effects of progesterone on gonadotropin-releasing hormone release. Endocrinology. 150, 3833-3844.

Suchanek, M., Radzikowska, A. and Thiele, C., 2005. Photo-leucine and photo- methionine allow identification of protein-protein interactions in living cells. Nat Methods. 2, 261-267.

Swanson, L. W., 1998. Brain maps: structure of the rat brain: a laboratory guide with printed and electronic templates for data, models, and schematics. Elsevier. Second edition.

Watts, A. G. and Swanson, L. W., 1987. Efferent projections of the suprachiasmatic nucleus: II. Studies using retrograde transport of fluorescent dyes and simultaneous peptide immunohistochemistry in the rat. J Comp Neurol. 258, 230-252.

Zhang, L., Kanda, Y., Roberts, D. J., Ecker, J. L., Losel, R., Wehling, M., Peluso, J. J. and Pru, J. K., 2008. Expression of progesterone receptor membrane component 1 and its partner serpine 1 mRNA binding protein in uterine and placental tissues of the mouse and human. Mol Cell Endocrinol. 287, 81-89.

Zhu, Y., Bond, J. and Thomas, P., 2003a. Identification, classification, and partial characterization of genes in humans and other vertebrates homologous to a fish membrane progestin receptor. Proc Natl Acad Sci U S A. 100, 2237-2242.

Zhu, Y., Rice, C. D., Pang, Y., Pace, M. and Thomas, P., 2003b. Cloning, expression, and characterization of a membrane progestin receptor and evidence it is an intermediary in meiotic maturation of fish oocytes. Proc Natl Acad Sci U S A. 100, 2231-2236.

CHAPTER 3

17 Β-ESTRADIOL AND PROGESTERONE REGULATE

PROGESTIN SIGNALING MOLECULES IN THE ANTEROVENTRAL

PERIVENTRICULAR NUCLEUS, VENTROMEDIAL NUCLEUS AND

SEXUALLY DIMORPHIC NUCLEUS OF THE PREOPTIC AREA IN RATS

3.1 Abstract

Recent work identified novel progestin signaling molecules, including progesterone receptor membrane component 1 (Pgrmc1), Pgrmc2, serpine mRNA binding protein 1 (Serbp1), progestin and adiponectin receptors 7 (Paqr7) and Paqr8.

These molecules mediate rapid progesterone (P 4) effects in non-neural tissue and we recently mapped their expression in the brain. Many rapid effects of P 4 require 17 β- estradiol (E 2) and P 4 priming; therefore, we examined the effects of ovarian hormones on the expression of these non-classical progestin signaling molecules. We focused specifically on the anteroventral periventricular nucleus (AVPV), the sexually dimorphic nucleus of the preoptic area (SDN-POA) and the ventrolateral portion of the ventromedial nucleus (VMNvl). These brain nuclei are important for female reproduction. Ovariectomized adult female rats were implanted with capsules containing sesame oil or E 2, and injected 48 hours later with sesame oil or P 4. Brains were collected eight hours later and RNA was isolated from the AVPV, SDN-POA and

VMNvl. We assessed the effects of ovarian hormones on mRNA levels using quantitative polymerase chain reaction (QPCR). In the AVPV, Serbp1 mRNA levels were increased by P 4 in the presence of E 2, and Paqr8 was downregulated by P 4 alone.

In the SDN-POA, combined E 2 and P 4 increased Pgrmc1 and Serbp1 mRNA levels, and

E2 alone increased Paqr8 mRNA levels. Finally, in the VMNvl, P 4 increased mRNA

levels encoding Pgrmc1, Pgrmc2 and Serbp1, and the combination of E 2 and P 4

increased Pgrmc1 and Serbp1 mRNA levels. Paqr7 was not regulated by E 2 or P 4 in any

brain region examined. In summary, we showed that ovarian hormones regulate novel

progestin signaling molecules in brain regions important for the neuroendocrine control

of reproduction.

3.2 Introduction

P4 signaling in the female brain regulates several facets of reproduction

including the neural control of ovulation and the expression of feminine sex behaviors.

The molecular mechanisms underlying these P 4 actions have been primarily attributed

to activation of the progestin receptor (Pgr), a ligand-dependent transcription factor.

This classical model of steroid hormone action has been revised to include rapid non-

genomic effects of Pgr activation on diverse signaling systems, such as MAPK and c-

Src pathways (Richer et al., 1998, Boonyaratanakornkit et al., 2001). However, this

model may still be incomplete because many cells that lack Pgr retain rapid P 4-elicited

responses (Ehring et al., 1998, Bar et al., 2000, Frye et al., 2006). These findings may

be explained by recent discoveries of novel progestin signaling molecules that mediate

diverse responses to P 4 in non-neural tissues (Falkenstein et al., 1999, Zhu et al., 2003b,

Peluso et al., 2004).

We recently mapped the expression of several of these progestin signaling

molecules in the rat forebrain (Intlekofer and Petersen, 2010). Genes encoding Pgrmc1,

Pgrmc2 and Serbp1 were particularly abundant in neuroendocrine nuclei important for

female reproduction. We confirmed and extended findings on the distribution pattern of

Pgrmc1 (Krebs et al., 2000, Sakamoto et al., 2004, Meffre et al., 2005), and showed that the pattern overlaps closely with that of its binding partner, Serbp1, and Pgrmc1 homologue, Pgrmc2. Few studies have examined the role of these molecules in neural function, but Pgrmc1 and Serbp1 have been implicated in the rapid effects of P 4 observed in ovarian cells and sperm (Correia et al., 2007, Peluso et al., 2009). While

Pgrmc2 has not been studied in the context of rapid P 4 signaling, it may mediate P 4 actions in the ovary (Nilsson et al., 2006). Together these findings suggest that Pgrmc1,

Pgrmc2 and Serbp1 may mediate non-classical P 4 signaling in the brain as in other

tissues.

Other P 4 signaling molecules include Paqr7 and Paqr8, G-protein-like receptors that bind P 4 and regulate cAMP levels in several fish species (Zhu et al., 2003a, Zhu et al., 2003b, Hanna et al., 2006). Although controversy surrounds their role in mammalian cells (Fernandes et al., 2008), mRNAs encoding Paqr7 and Paqr8 have been detected in mammalian reproductive tissues (Zhu et al., 2003a). Our recent work showed that Paqr7 and Paqr8 gene expression is present in the hypothalamus (Intlekofer and Petersen, in press), though expression appears lower compared with that of Pgrmc1,

Pgrmc2 and Serbp1. Other evidence suggests that Paqr7 and Paqr8 mediate P 4 signaling and couple to inhibitory G proteins in immortalized gonadotropin-releasing hormone (GnRH) neurons (Sleiter et al., 2009). Despite these significant advances, neither the regulation nor the functions of Paqr7 and Paqr8 in the brain are known.

In the female rodent, many of the rapid P 4 signaling events require 17 β-estradiol

(E 2) activation of estrogen receptor 1 (Esr1) (Edwards, 2005). This is partially due to

E2 induction of Pgr (Kastner et al., 1990), a nuclear transcription factor that also

activates rapid intracellular kinase cascades (Leonhardt et al., 2003). In regions of high

Esr1 expression, such E 2-induced effects result in greater P 4-sensitivity. For example, in the preoptic area (POA) and ventromedial nucleus (VMN) of the hypothalamus, E 2

exposure lowers cell signaling activation thresholds for P 4, resulting in greater P 4-

sensitivity (Balasubramanian et al., 2008). In view of our recent findings that Pgrmc1,

Pgrmc2, Serbp1, Paqr7 and Paqr8 are found in regions that contain Esr1 and Pgr, it is

possible that E 2 and/or P 4 regulation of these molecules may be important in non-

classical P 4 signaling. This idea is supported by findings that Pgrmc1 expression is

regulated by P 4 in E 2-primed rats (Krebs et al., 2000), uterine levels of Pgrmc2

mRNA vary across the estrus cycle (Zhang et al., 2008) and Paqr7 and Paqr8 ovarian

expression is regulated by E 2 (Karteris et al., 2006). It is unclear whether Pgrmc1 is

regulated by steroids in brain regions other than the VMN, and no studies have tested

the effects of ovarian steroids on Pgrmc2, Serbp1, Paqr7 and Paqr8 in the brain.

To address these issues, we examined the effects of E 2, P 4 and the combination

of E 2 and P 4 (E 2+P 4) on levels of mRNA encoding Pgrmc1, Pgrmc2, Serbp1, Paqr7 and

Paqr8. We focused specifically on the AVPV, the sexually dimorphic nucleus of the

POA (SDN-POA) and the ventrolateral portion of the VMN (VMNvl). These nuclei

have abundant expression of Esr1 and Pgr , are sexually dimorphic and are important for

female reproduction (Dugger et al., 2007, Sakuma, 2009). In addition, we recently

found expression of Pgrmc1, Pgrmc2, Serbp1, Paqr7 and Paqr8 in these nuclei

(Intlekofer and Petersen, in press). We now report that ovarian steroid hormones

regulate these putative progestin signaling molecules, and do so in a region-specific

manner.

3.3 Materials and Methods

3.3.1 Animals

All protocols and post-operative care were approved by the Institutional Animal

Care and Use Committee of the University of Massachusetts, and animals were housed in accordance with the National Institutes of Health Guidelines for the Care and Use of

Laboratory Animals. Twenty-eight adult female Sprague-Dawley rats (200-250 g,

Harlan, Madison, WI) were housed individually on a 14:10 light:dark cycle with food and water provided ad libitum . Animals were anesthetized with isofluorane and bilateral ovariectomies were performed through very small (5-mm) flank incisions that minimized tissue trauma. I observed animals for respiratory distress and bleeding for 6 h postoperatively and examined again at 12, 24 and 48 h to ensure that they were freely moving and had no significant weight loss. One week later (Day 0), animals were implanted s.c. with Silastic capsules (Dow Corning, Midland, MI; 1.57 mm, o.d., 3.8 mm; 30 mm length) containing either sesame oil vehicle or E 2 (150 g/ml 17 β-estradiol in sesame oil) as described previously (Petersen and LaFlamme, 1997). At 0900 H on

Day 2, animals were injected s.c. with either sesame oil vehicle or 50 mg P 4. Eight

hours later, animals were anesthetized with CO 2 and brains were rapidly frozen on

powdered dry ice, wrapped in Parafilm (American Can Co., Greenwich, CT) and stored

at -80 C.

3.3.2 Tissue preparation

Coronal cryosections that contained the AVPV, SDN-POA and VMNvl were

acquired using a Leica CM3000 cryostat (Nussloch, Germany). These sections were

taken from the rostral AVPV (bregma -0.02 mm), SDN-POA (bregma -0.4 mm) and

VMNvl (bregma -0.20 mm) (Swanson, 1998). I obtained tissue punches from these sections using a 1.0-mm diameter Harris Uni-Core™ tissue needle (Ted Pella Inc.,

Redding, CA) from a single 300-m section as illustrated in Fig. 3.7.1, and used this

tissue for quantitative polymerase chain reaction (QPCR).

3.3.3 RNA Isolation and QPCR

RNA was isolated from tissue punches using the RNeasy kit (Qiagen, Valencia,

CA) and reverse transcribed with the QuantiTect Reverse Transcription Kit (Qiagen),

using manufacturer’s protocol. QPCR was performed in a Stratagene Mx3000P

thermocycler (Agilent Technologies, Wilmington, DE) programmed as follows: 95 C,

10 min; 40 cycles of 95 C for 15 sec; and 60 C for 60 sec. Reactions contained reagents

from QuantiTect SYBR Green Kit, following manufacturer’s protocol (Roche

Diagnostics, Indianapolis, IN). Specific primer sets were obtained from Integrated

DNA Technologies (Coralville, Iowa), and sequences are listed in Table 3.6. The

efficiency of each primer set was validated over a range of cDNA concentrations and

samples with no cDNA were included as negative controls. Primer specificity was

verified using melting curve analyses and confirmation of a single fluorescence peak in

each QPCR reaction. Melting curve analyses were performed by heating samples to 95

C for two min, 55 C for 15 sec, and recording fluorescence measurements during

incremental increases of 0.5 C for 80 cycles. Primer specificity was also validated

using 2% agarose gel electrophoresis to verify single products following the QPCR

reaction. Fluorescence measurements were detected using MxPro™ QPCR analysis

software (Agilent Technologies). I verified that levels of mRNA encoding β-actin did not differ among treatments; therefore, I used it as an internal control (primers as

indicated in Table 3.6.1). The Ct method was used to analyze the data (Livak and

Schmittgen, 2001).

3.3.4 Statistics

All data are expressed as mean ± SEM. Effects of E 2, P 4 and E 2+P 4 on mRNA levels were detected using a one-way ANOVA, followed by pair-wise comparisons using t-tests with Bonferroni correction .

3.4 Results

3.4.1 QPCR Reaction Specificity

First, melting curve analyses verified a single peak of fluorescence, and the size of each product was confirmed by gel electrophoresis. In addition, the PCR amplification efficiency calculated from the standard curve was between 96-100% for all primer sets used. Consistent with our previous in situ hybridization findings

(Intlekofer and Petersen, in press), QPCR verified that the genes of interest were expressed in the AVPV, SDN-POA and VMNvl.

3.4.2 Esr1 and Pgr mRNA Levels

In ovariectomized adult rats, exposure to E 2 reduced Esr1 mRNA levels in the

AVPV, SDN-POA and VMNvl (Fig. 3.7.2 a, b and c, respectively). P4 administration significantly decreased Esr1 mRNA levels in the AVPV (Fig. 3.7.2a), but not in the

SDN-POA (Fig. 3.7.2b) or VMNvl (Fig. 3.7.2c). In all three areas examined, E 2+P 4 reduced levels of mRNAs encoding Esr1 (Fig. 3.7.2a, b and c). E 2 markedly increased levels of mRNA encoding Pgr in all brain regions examined (Fig. 3.7. 2d, e and f), and in the AVPV and SDN-POA, E 2+P 4 increased Pgr mRNA levels.

3.4.3 Pgrmc1, Serbp1 and Pgrmc2 mRNA Levels

In the AVPV, mRNA levels of the homologues Pgrmc1 and Pgrmc2 were unaltered by treatment with E 2, P 4 or E 2+P 4 (Fig. 3.7.3a and d). Within the SDN-POA,

Pgrmc1 and Pgrmc2 levels were not significantly affected by E 2 or P 4 alone, but E 2+P 4 increased Pgrmc1 (Fig. 3.7.3b) and decreased Pgrmc2 mRNA levels (Fig. 3.7.3e). In the VMNvl, P 4 increased Pgrmc2 mRNA levels (Fig. 3.7.3f).

Levels of mRNA encoding Pgrmc1 and its binding partner, Serbp1, were increased by P 4 or E 2+P 4 in the VMNvl (Fig. 3.7.3c and i). In the SDN-POA, only

E2+P 4 increased Pgrmc1 and Serbp1 mRNA levels (Fig. 3.7.3b and h). In the AVPV,

E2+P 4 increased Serbp1 (Fig. 3.7.3g), but not Pgrmc1 mRNA levels (Fig. 3.7.3a).

3.4.4 Paqr7 and Paqr8 mRNA levels

Ovarian steroids did not regulate Paqr7 mRNA levels in any brain region examined (Fig. 3.7.4a, b and c). In contrast, Paqr8 mRNA levels were repressed by treatment with P 4 in the AVPV (Fig. 3.7.4d), increased by E 2 in the SDN-POA (Fig.

3.7.4e), but not altered in the VMNvl (Fig. 3.7.4f).

3.5 Discussion

These results are the first to show that E 2 and P 4 regulate non-classical progestin signaling molecules in the AVPV, SDN-POA and VMNvl. Significantly, E 2+P 4 increased Serbp1 mRNA levels in all brain regions examined, but increased expression of its putative binding partners, Pgrmc1 and Pgrmc2, in a region-specific manner.

These findings are consistent with the idea that Serbp1 availability is the key factor determining P 4 responsiveness of Pgrmc1 complexes (Peluso et al., 2004). Ovarian steroid regulation of Paqr8 also varied by brain region; however, the closely-related

Paqr7 was not regulated in any region examined. Together these findings support the hypothesis that Pgrmc1, Pgrmc2, Serbp1 and Paqr8 mediate rapid P 4 signaling within neuroendocrine nuclei important for female reproduction.

Our findings that E 2 decreased Esr1 and increased Pgr in the AVPV and VMNvl

are similar to results of previous studies (Lauber et al., 1990, Simerly and Young,

1991). We now report that the same pattern exists in the SDN-POA. Interestingly, in

the VMNvl, P 4 abrogated the effects of E 2 on Pgr mRNA levels. Although this was not seen in other brain regions examined herein, P 4 blocks E 2 induction of Pgr in non-neural

cells (Kraus and Katzenellenbogen, 1993).

We found that E 2+P 4 increased Pgrmc1 mRNA levels in the SDN-POA but not

the AVPV; however, in both regions Serbp1 expression was increased, and this may be

sufficient for rapid P 4 effects. This idea is supported by findings that P 4 responses

mediated by the Pgrmc1/Serbp1 complex depend upon Serbp1 levels in non-neural cells

(Peluso et al., 2005). Interestingly, E 2+P4 increased Pgrmc2 mRNA levels in the

AVPV, though no studies have tested whether Serbp1 binds Pgrmc2 to form a

functional complex. These mechanisms are of particular interest as the AVPV is

required for induction of the preovulatory luteinizing hormone surge (Wiegand et al.,

1980, Ronnekleiv and Kelly, 1986, Petersen et al., 1995, Chappell and Levine, 2000).

The AVPV and SDN-POA have dense projections to GnRH neurons (Simonian et al.,

1999), and show abundant Pgrmc1, Pgrmc2 and Serbp1 mRNA levels (Intlekofer and

Petersen, 2011). Thus, further studies are warranted to determine whether these

signaling molecules mediate rapid P 4 effects in the AVPV and SDN-POA.

P4 and E 2+P 4 increased Pgrmc1 and Serbp1 mRNA levels in the VMNvl, a region in which P 4 facilitates lordosis (Pfaff and Sakuma, 1979, Pfaff et al., 1994, Frye and Vongher, 1999, Frye, 2001). These rapid P 4 effects are partially due to activation of cGMP-dependent protein kinase (DeBold and Frye, 1994, Lydon et al., 1995). This is especially interesting because Pgrmc1 is involved in P 4 induction of cGMP-dependent protein kinase (Peluso and Pappalardo, 2004), and the C-terminus of Pgrmc1 contains several putative kinase binding sites (Cahill, 2007). Other researchers examining the entire VMN also found that Pgrmc1 was regulated by ovarian steroids; however, in that study E 2 alone increased Pgrmc1 mRNA levels (Krebs et al., 2000). Factors that may explain these differences include dosage, duration of treatment, and region examined.

Overall, these findings suggest a link between Pgrmc1/ Serbp1 and the rapid facilitation of feminine sex behavior.

Our findings are the first to show that ovarian steroids regulate Paqr8 mRNA levels in the brain. Similar to studies in myometrial cells, we found that E 2 increased both Paqr8 and Pgr mRNA levels in the SDN-POA. These results are interesting in light of evidence that Paqr8 cross-talks with Pgr through coupling to inhibitory G- proteins and decreasing Pgr transactivation (Karteris et al., 2006). In contrast to Paqr8, ovarian steroid exposure did not alter Paqr7 mRNA levels in any brain region examined. In other reproductive tissues, E 2 and P 4 also have variable effects on these signaling molecules (Cai and Stocco, 2005, Fernandes et al., 2005). Thus, despite their structural similarities, Paqr7 and Paqr8 may be regulated differently by ovarian steroids

and may have functionally distinct roles.

Though reproductive functions coordinated by ovarian hormones have been studied extensively, the underlying molecular events are unclear. The present studies identified several steroid-inducible progestin signaling molecules that may mediate rapid P 4 actions in the neuroendocrine control of reproduction. The functional relevance and specific role(s) of these novel signaling molecules will be the topic of future research.

3.6.1: Primers Used in QPCR Studies

NCBI Gene Name Antisense Amplicon Primer sequences 5’- 3’ and Refseq ID# to bases (bp)

Actb GGGAAATCGTGCGTGACATT 698 – 717 76 NM_031144 GCGGCAGTGGCCATCTC 773 – 757

Esr1 AGTGAAGCCTCAATGATGGG 1236 – 1255 146 NM_012689 ATCTCCAACCAGGCACACTC 1381 – 1362

Pgr GGTGGAGGTCGTACAAGCAT 2261 – 2280 214 NM_022847 AGGCCTTCCAAAGGAATTGT 2474 – 2455

Pgrmc1 CTGCCGAACTAAGGCGATAC 321 – 340 247 NM_021766 TCCCAGTCATTCAGGGTCTC 567 – 548

Pgrmc2 AGCAGCTGCGCCAGTACGAC 306 – 325 139 NM_001008374 GAGGCGTCCCTGCCAGCAAA 444 – 425

Serbp1 GAAACACCCGAAGGTGAAGA 789 – 808 190 NM_145086 TTTTCCATTGTCCATCAGCA 978 – 959

Paqr7 GTGCACCGCATCATAGTGTC 661 – 680 230 NM_001034081 TGATAGTCCAGCGTCACAGC 890 – 871

Paqr8 CTGCAGCCTCTTGGCCCACC 825 – 844 179 NM_001014099 CAGCCGCCGGCAGGAAGAAA 1003 – 984

3.7.1 Diagram of Brain Sections

Figure 3.7.1: Diagrams of brain sections containing the a) AVPV, b) SDN-POA and c) VMNvl modified from the atlas of Swanson (1998). Circles indicate regions from which tissue was excised for analysis. OC, optic chiasm; 3V, third ventricle; AC, anterior commissure.

3.7.2 Esr1 and Pgr mRNA Levels

Figure 3.7.2: Levels of mRNAs encoding Esr1 and Pgr in ovariectomized rats treated with oil, E 2, P 4 or E 2+P 4. Esr1 mRNA levels in the AVPV (a), SDN-POA (b) and VMNvl (c), and Pgr mRNA levels in the AVPV (d), SDN-POA (e) and VMNvl (f) were determined by QPCR. Bars = means ± SEM. a Significantly different from oil-treated controls; b significantly different from E 2-treated animals; c significantly different from P 4-treated animals; values considered significantly different if p < 0.05 in post-hoc analyses. One-way ANOVA results: a) F(3,22) = 4.72 1, p < 0.010; b) F(3,20) = 11.81, p < 0.0002; c) F(3,20) = 8.14, p < 0.001; d) F(3,20) = 20.83, p < 0.0001; e) F(3,20) = 17.14, p < 0.0001; f) F(3,20) = 41.49, p < 0.0001.

3.7.3 Pgrmc1, Serbp1 and Pgrmc2 mRNA Levels

Figure 3.7.3: Levels of mRNAs encoding Pgrmc1, Pgrmc2 and Serbp1 in ovariectomized rats treated with oil, E 2, P 4 or E 2+P 4. Pgrmc1 mRNA levels in the AVPV (a), SDN-POA (b) and VMNvl (c), Pgrmc2 mRNA levels in the AVPV (d), SDN-POA (e) and VMNvl (f), and Serbp1 mRNA levels in the AVPV (g), SDN- POA (h) and VMNvl (i) were determined by QPCR. Bars = means ± SEM. a Significantly different from oil-treated controls; b significantly different from E 2- treated animals; c significantly different from P 4-treated animals; values considered significantly different if p < 0.05 in post-hoc analyses. One-way ANOVA results: a) F(3,22) = 2.32, p < 0.103; b) F(3,20) = 8.56, p < 0. 0.001; c) F(3,22) = 28.59, p < 0.0001; d) F(3,22) = 21.79, p < 0.0001; e) F(3,22) = 6.56, p < 0.002; f) F(3,22) = 21.13, p < 0.0001; g) F(3,22) = 4.65, p < 0.01; h) F(3,22) = 4.55, p < 0.01; i) F(3,22) = 6.16, p < 0.003.

3.7.4 Paqr7 and Paqr8 mRNA Levels

Figure 3.7.4: Levels of mRNAs encoding Paqr7 and Paqr8 in ovariectomized rats treated with oil, E 2, P 4 or E 2+P 4. Paqr7 mRNA levels in the AVPV (a), SDN-POA (b) and VMNvl (c), and Paqr8 mRNA levels in the AVPV (d), SDN-POA (e) and VMNvl (f) were determined by QPCR. Bars = means ± SEM. a Significantly different from oil-treated controls; b significantly different from E 2-treated animals; c significantly different from P 4-treated animals; values considered significantly different if p < 0.05 in post-hoc analyses. One-way ANOVA results: a) F(3,22) = 0.65, p < 0.59; b) F(3,22) = 0.037, p < 0.99; c) F(3,20) = 3.67, p < 0.03; d) F(3,22) = 10.39, p < 0.0002; e) F(3,22) = 33.87, p < 0.0001; f) F(3,20) = 1.35, p < 0.29.

3.8 References

Balasubramanian, B., Portillo, W., Reyna, A., Chen, J. Z., Moore, A. N., Dash, P. K. and Mani, S. K., 2008. Nonclassical mechanisms of progesterone action in the brain: II. Role of calmodulin-dependent protein kinase II in progesterone- mediated signaling in the hypothalamus of female rats. Endocrinology. 149, 5518-5526.

Bar, J., Lahav, J., Hod, M., Ben-Rafael, Z., Weinberger, I. and Brosens, J., 2000. Regulation of platelet aggregation and adenosine triphosphate release in vitro by 17beta-estradiol and medroxyprogesterone acetate in postmenopausal women. Thromb Haemost. 84, 695-700.

Boonyaratanakornkit, V., Scott, M. P., Ribon, V., Sherman, L., Anderson, S. M., Maller, J. L., Miller, W. T. and Edwards, D. P., 2001. Progesterone receptor contains a proline-rich motif that directly interacts with SH3 domains and activates c-Src family tyrosine kinases. Mol Cell. 8, 269-280.

Cahill, M. A., 2007. Progesterone receptor membrane component 1: an integrative review. J Steroid Biochem Mol Biol. 105, 16-36.

Cai, Z. and Stocco, C., 2005. Expression and regulation of progestin membrane receptors in the rat corpus luteum. Endocrinology. 146, 5522-5532.

Chappell, P. E. and Levine, J. E., 2000. Stimulation of gonadotropin-releasing hormone surges by estrogen. I. Role of hypothalamic progesterone receptors. Endocrinology. 141, 1477-1485.

Correia, J. N., Conner, S. J. and Kirkman-Brown, J. C., 2007. Non-genomic steroid actions in human spermatozoa. "Persistent tickling from a laden environment". Semin Reprod Med. 25, 208-219.

DeBold, J. F. and Frye, C. A., 1994. Genomic and non-genomic actions of progesterone in the control of female hamster sexual behavior. Horm Behav. 28, 445-453.

Dugger, B. N., Morris, J. A., Jordan, C. L. and Breedlove, S. M., 2007. Androgen receptors are required for full masculinization of the ventromedial hypothalamus (VMH) in rats. Horm Behav. 51, 195-201.

Edwards, D. P., 2005. Regulation of signal transduction pathways by estrogen and progesterone. Annu Rev Physiol. 67, 335-376.

Ehring, G. R., Kerschbaum, H. H., Eder, C., Neben, A. L., Fanger, C. M., Khoury, R. M., Negulescu, P. A. and Cahalan, M. D., 1998. A nongenomic mechanism for progesterone-mediated immunosuppression: inhibition of K+ channels, Ca2+ signaling, and gene expression in T lymphocytes. J Exp Med. 188, 1593-1602.

Fernandes, M. S., Brosens, J. J. and Gellersen, B., 2008. Honey, we need to talk about the membrane progestin receptors. Steroids. 73, 942-952.

Fernandes, M. S., Pierron, V., Michalovich, D., Astle, S., Thornton, S., Peltoketo, H., Lam, E. W., Gellersen, B., Huhtaniemi, I., Allen, J. and Brosens, J. J., 2005. Regulated expression of putative membrane progestin receptor homologues in human endometrium and gestational tissues. J Endocrinol. 187, 89-101.

Frye, C. A., 2001. The role of neurosteroids and non-genomic effects of progestins and androgens in mediating sexual receptivity of rodents. Brain Res Brain Res Rev. 37, 201-222.

Frye, C. A. and Vongher, J. M., 1999. Progesterone has rapid and membrane effects in the facilitation of female mouse sexual behavior. Brain Res. 815, 259-269.

Intlekofer, K. A. and Petersen, S. L., submitted. Distribution of mRNAs encoding classical progestin receptor, progesterone membrane components 1 and 2, serpine mRNA binding protein 1, and progestin and adipoQ receptor family members 7 and 8 in rat forebrain. Neuroscience

Karteris, E., Zervou, S., Pang, Y., Dong, J., Hillhouse, E. W., Randeva, H. S. and Thomas, P., 2006. Progesterone signaling in human myometrium through two novel membrane G protein-coupled receptors: potential role in functional progesterone withdrawal at term. Mol Endocrinol. 20, 1519-1534.

Kastner, P., Krust, A., Turcotte, B., Stropp, U., Tora, L., Gronemeyer, H. and Chambon, P., 1990. Two distinct estrogen-regulated promoters generate transcripts encoding the two functionally different human progesterone receptor forms A and B. Embo J. 9, 1603-1614.

Kraus, W. L. and Katzenellenbogen, B. S., 1993. Regulation of progesterone receptor gene expression and growth in the rat uterus: modulation of estrogen actions by progesterone and sex steroid hormone antagonists. Endocrinology. 132, 2371- 2379.

Lauber, A. H., Romano, G. J., Mobbs, C. V. and Pfaff, D. W., 1990. Estradiol Regulation of Estrogen Receptor Messenger Ribonucleic Acid in Rat Mediobasal Hypothalamus: An in situ Hybridization Study. J Neuroendocrinol. 2, 605-611.

Leonhardt, S. A., Boonyaratanakornkit, V. and Edwards, D. P., 2003. Progesterone receptor transcription and non-transcription signaling mechanisms. Steroids. 68, 761-770.

Livak, K. J. and Schmittgen, T. D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, 402-408.

Lydon, J. P., DeMayo, F. J., Funk, C. R., Mani, S. K., Hughes, A. R., Montgomery, C. A., Jr., Shyamala, G., Conneely, O. M. and O'Malley, B. W., 1995. Mice lacking progesterone receptor exhibit pleiotropic reproductive abnormalities. Genes Dev. 9, 2266-2278.

Nilsson, E. E., Stanfield, J. and Skinner, M. K., 2006. Interactions between progesterone and tumor necrosis factor-alpha in the regulation of primordial follicle assembly. Reproduction. 132, 877-886.

Peluso, J. J. and Pappalardo, A., 2004. Progesterone regulates granulosa cell viability through a protein kinase G-dependent mechanism that may involve 14-3- 3sigma. Biol Reprod. 71, 1870-1878.

Petersen, S. L., McCrone, S., Keller, M. and Shores, S., 1995. Effects of estrogen and progesterone on luteinizing hormone-releasing hormone messenger ribonucleic acid levels: consideration of temporal and neuroanatomical variables. Endocrinology. 136, 3604-3610.

Pfaff, D. W. and Sakuma, Y., 1979. Deficit in the lordosis reflex of female rats caused by lesions in the ventromedial nucleus of the hypothalamus. J Physiol. 288, 203- 210.

Richer, J. K., Lange, C. A., Manning, N. G., Owen, G., Powell, R. and Horwitz, K. B., 1998. Convergence of progesterone with growth factor and cytokine signaling in breast cancer. Progesterone receptors regulate signal transducers and activators of transcription expression and activity. J Biol Chem. 273, 31317-31326.

Ronnekleiv, O. K. and Kelly, M. J., 1986. Luteinizing hormone-releasing hormone neuronal system during the estrous cycle of the female rat: effects of surgically induced persistent estrus. Neuroendocrinology. 43, 564-576.

Sakuma, Y., 2009. Gonadal steroid action and brain sex differentiation in the rat. J Neuroendocrinol. 21, 410-414.

Simerly, R. B. and Young, B. J., 1991. Regulation of estrogen receptor messenger ribonucleic acid in rat hypothalamus by sex steroid hormones. Mol Endocrinol. 5, 424-432.

Simonian, S. X., Spratt, D. P. and Herbison, A. E., 1999. Identification and characterization of estrogen receptor alpha-containing neurons projecting to the vicinity of the gonadotropin-releasing hormone perikarya in the rostral preoptic area of the rat. J Comp Neurol. 411, 346-358.

Swanson, L. W., 1998. Brain maps: structure of the rat brain: a laboratory guide with printed and electronic templates for data, models, and schematics. Elsevier. Second edition.

Wiegand, S. J., Terasawa, E., Bridson, W. E. and Goy, R. W., 1980. Effects of discrete lesions of preoptic and suprachiasmatic structures in the female rat. Alterations in the feedback regulation of gonadotropin secretion. Neuroendocrinology. 31, 147-157.

CHAPTER 4

DUAL-LABEL IN SITU HYBRIDIZATION REVEAL THAT PGRMC1 AND

SERBP1 ARE COLOCALIZED WITHIN GABAERGIC NEURONS OF THE

ANTEROVENTRAL PERIVENTRICULAR NUCLEUS OF THE FEMALE RAT

4.1 Abstract

The neural control of ovulation requires generation of the gonadotropin releasing hormone (GnRH) and luteinizing hormone (LH) surges by 17 β-estradiol (E 2) and progesterone (P 4). While the majority of research in this field concerns the essential role of E 2, the role of P 4 in the preovulatory surge is less understood.

Numerous studies in rats have shown that P 4 controls the timing and amplification of the LH surge. While the exact neurobiological mechanisms that underlie these actions remain unclear, they are likely to occur through P 4 action in the preoptic area and hypothalamus, brain regions with abundant classical progesterone receptors (Pgr). We recently found that these regions also express high levels of progesterone signaling molecules, including Progesterone Receptor Membrane Component 1 (Pgrmc1) and

Serpine mRNA Binding Protein 1 (Serbp1), indicating that these additional molecules may subserve progesterone actions in the preovulatory surge. To begin to test this idea, we used dual-label in situ hybridization to determine whether these progesterone signaling molecules are colocalized in neurons critical for the LH surge mechanism.

We now report that the majority of neurons important for the neural control of ovulation contain Pgrmc1 and Serbp1 mRNA, and both signaling molecules are colocalized in the same neurons. Together, these findings indicate that progesterone actions in regulation of the LH surge may involve progesterone signaling molecules, Pgrmc1 and Serbp1.

In line with this idea, Pgr is abundantly expressed in the hypothalamus, but we and others have recently found progesterone signaling molecules in hypothalamic regions known to be important for generation of the LH surge.

4.2 Introduction

Although the regulation of the luteinizing hormone (LH) surge by 17 β-estradiol

(E 2) and progesterone (P 4) has been studied extensively, the molecular actions of these

steroid hormones continue to emerge. In the neural control of the preovulatory surge,

hormonal status is conveyed to gonadotropin releasing hormone (GnRH) neurons by

neural projections that originate in the anteroventral periventricular nucleus (AVPV)

(Simonian et al., 1999, Ottem et al., 2004). Previous findings show that these important

AVPV neurons are dual-phenotype GABA/glutamate neurons (Ottem et al., 2004), and

contain abundant E2 and P4 receptors (Simerly et al., 1990{Shughrue, 1997 #1045).

While E2 is a requisite hormone for the onset of the GnRH and LH surges, P 4 regulates more subtle aspects of the surge including the timing and amplification (Everett, 1948,

Rothchild, 1965, DePaolo and Barraclough, 1979), though P 4 actions in this capacity are

not well understood. New insights into P 4 mechanism of action have identified novel

signaling molecules that may be involved in modulating the LH surge. In support of

this idea, we recently reported that the AVPV contains progesterone receptor membrane

component-1 (Pgrmc1) and binding partner Serpine mRNA binding protein 1 (Serbp1)

(Intlekofer and Petersen, 2010). Thus, P 4 signaling molecules in the AVPV may

mediate important P 4 effects in the neural control of the preovulatory LH surge.

Pgrmc1 and Serbp1 are binding partners that mediate P 4 actions in other tissues

(Peluso et al., 2004, Peluso et al., 2008), but it is unclear whether they could play a

similar role in dual-phenotype neurons. While this possibility has not yet been explored, several lines of evidence support the idea that P 4 signaling molecules such as

Pgrmc1 and Serbp1 could mediate P 4 actions in regulation of the surge. For example, membrane bindings sites for P 4 have been identified in the hypothalamus (Ke and

Ramirez, 1990), and P 4 exerts rapid Pgr-independent effects (Frye and Vongher, 2001,

Sleiter et al., 2009). Given the important role of GABA/glutamate neurons of the

AVPV, and high expression of hormone receptors in the AVPV region, it is possible

that additional P 4 signaling molecules account for the effects of P 4 on LH surge release.

To address this issue, we used dual-label in situ hybridization histochemistry (ISHH) to determine whether AVPV GABA/glutamate neurons contain Pgrmc1 and Serbp1 and whether these signaling molecules are coexpressed by AVPV neurons.

4.3. Materials and Methods

4.3.1 Animals and Tissues

All animals were housed in accordance with the National Institutes of Health

Guidelines for the Care and Use of Laboratory Animals and all protocols were approved by the Institutional Animal Care and Use Committee of the University of

Massachusetts. We used brains from six adult female Sprague-Dawley rats (200-225 g,

Harlan, Madison, WI). Animals were housed on a 14:10 light:dark cycle with free access to food and water, and ovariectomized under isofluorane anesthesia. A week later, the rats received s.c. implants of Silastic capsules (Dow Corning, Midland, MI;

1.57 mm, o.d., 3.8 mm; 30 mm length) containing E 2 (150 µg/ml in sesame oil) as previously described (Petersen et al., 1995). After two days, rat brains were collected at

1500 h and rapidly frozen on powdered dry ice. Brains were cryosectioned (Leica

CM3000, Nussloch, Germany) at 14 m through the rostral preoptic area, a brain region

that contains the AVPV. Sections were thaw-mounted onto gelatin-coated slides, dried

briefly at 42 ᵒ C on a slide warmer, and stored at -80 ᵒ C until prehybridization.

4.3.2 Transcription Template Preparation

PCR-generated transcription templates for rat Pgrmc1 and Serbp1 were

produced using rat cDNA and GoTaq® Green Master Mix and manufacturer’s protocol

(Promega, Madison, WI). Specific primer sets were obtained from Integrated DNA

Technologies (Coralville, IA) and sequences are listed in Table 4.6.1. Reactions were

performed in an Eppendorf Thermocycler (Hauppauge, NY) programmed as follows: 95

°C, 10 min, 40 cycles of 95 °C for 15 sec and 60 °C for 60 sec. PCR products were purified by gel electrophoresis and extracted using GenElute™ Agarose Spin-Columns and manufacturer’s protocol (Sigma-Aldrich, St. Louis, MO). The resulting cDNA fragments were inserted into vectors using the TOPO-TA® cloning kit (Invitrogen,

Carlsbad, CA). One Shot Mach1 T1-phage resistant E.Coli (Invitrogen) were transformed with plasmids containing the cDNA fragments and plasmids were isolated with the QIAfilter Plasmid Mini kit (Qiagen). The identity and direction of each insert was confirmed by sequencing provided by Genewiz (South Plainfield, NJ.)

For detection of GABAergic cells, cDNA templates for Gad1 and 2 were produced as described previously (Hays et al., 2002). Primers used to generate templates for Pgr, Gad1 and Gad2 are specified in Table 4.6. To produce template for rat GnRH cRNA probes, I linearized a modified pSP65 plasmid containing a 330-bp cDNA fragment (provided by Dr. John Adelman, Vollum Institute, Portland, OR). This fragment corresponds to exons I-IV of mRNA encoding GnRH (Adelman et al., 1986). 77

Plasmids were linearized using restriction sites present within the vector and restriction enzymes (Promega). Linearized templates were extracted with phenol/chloroform, precipitated with 0.4 M NaCl 2 and ethanol and stored in 10 mM

Tris and 1 mM EDTA (TE; pH 8.0) at -20 C until they could be used for transcription of cRNA probes.

4.3.3 Probe preparation

The cDNA templates were transcribed as described previously (Petersen et al.,

1993) and all enzymes were provided by Promega. Briefly, I used a DNA SpeedVac

(Savant, Farmingdale, NY) to dry 120 pmol (12 µM final concentration) of 35 S-UTP

(PerkinElmer, Boston, MA). To generate radiolabeled probes for Pgrmc1 and Serbp1, I added the following in a total volume of 10 l: 0.5 mM linearized template, 1X transcription buffer, 10 mM dithiothreitol (DTT), 20 U RNAsin, 3 M UTP, 0.5 mM

each ATP, CTP, and GTP and 10 U RNA polymerase. Each reaction was incubated for

30 min at 37 ◦ C, then a second 10 U RNA polymerase aliquot was added, mixed and

incubated for 30 min at 37 ◦ C. Deoxyribonuclease I (20 U) was added to each reaction

to degrade the DNA template in the presence of 20 U RNAsin. The transcription

reaction volume was adjusted to 100 µl by addition of TE, 0.4 M NaCl 2 and 0.5 µl

tRNA. I extracted cRNA probes with phenol-chloroform, removed unincorporated

nucleotides by ethanol precipitation and resuspended them in 100 µl TE.

GABAergic cells were detected using a mixture of digoxigenin-labeled cRNA

probes encoding Gad1 and 2 and prepared as previously described (Hays et al., 2002). I

also generated digoxigenin-labeled probes to detect GnRH neurons as described

previously (Sannella and Petersen, 1997). For both Gad and Serbp1 detection, I 78

produced digoxygenin-labeled probes using 1 µg linearized cDNA template, 1X transcription buffer, 500 µM each ATP, CTP and GTP, 50 µM UTP, 10 mM DTT and

20 U RNA polymerase in the presence of 250 µM digoxigenin-11-UTP (Roche,

Molecular Biochemicals, Indianapolis, IN). The mixture was incubated at 37 ◦ C for 1 h and then an additional 20 U RNA polymerase aliquot was added and incubation continued for another hour. I eliminated the DNA template using 20 U deoxyribonuclease I in the presence of 20 U RNasin. The reaction volume was adjusted to 100 µl by the addition of nuclease-free water, precipitated twice with 0.4 M NaCl2 and ethanol, and then resuspended in 100 µl TE.

4.3.4 In situ hybridization

Tissue sections were prehybridized as previously described (Ottem et al., 2004).

Nonisotopic and radiolabeled cRNA probes were added to hybridization buffer

consisting of 50 % formamide, 1XSSC, 20 % dextran sulfate, 1X Denhardt's solution

(0.02 % Ficoll-400, 0.02 % bovine serum albumin, 0.02 % polyvinylpyrrolidone-40),

500 µg/ml yeast tRNA, 500 µg/ml heparin sodium salt, 0.1 % sodium pyrophosphate

and freshly prepared 400 mM DTT was added before use. Twenty µl of hybridization

buffer containing cRNA probes (1.0 x 10 6 cpm radioisotopic probe and 1 l

digoxigenin-labeled probe) was applied to each tissue section and covered with glass

coverslips, and then sections were incubated for 16 h at 52 C. Additionally,

representative sections were hybridized to radiolabeled sense probes for Pgrmc1 and

Serbp1 in order to verify specificity. Specificity of probes for Gad 1 and 2 were

determined previously (Ottem et al., 2004).

4.3.5 Signal detection

Posthybridization was performed on an orbital or lateral shaker at room temperature unless otherwise specified. Coverslips were removed and the slides were washed as follows: 50 % (v/v) formamide/2XSSC for 40 min at 52 C; 2XSSC for 20 min; RNase buffer (0.5 M NaCl, 10 mM Tris; and 1 mm EDTA; pH 8.0) containing 25

µg/ml RNAse A (Roche) for 30 min at 37 C; 2XSSC for 10 min; 50% (v/v) formamide/2XSSC for 20 min; and 2XSSC for 10 min. Next, I processed slides for immunocytochemical detection of digoxigenin.

Nonspecific binding was blocked by placing tissue sections in a solution containing 0.5% w/v blocking reagent (Roche) in maleate buffer (100 mM maleic acid,

150 mM NaCl; pH 7.5) and 0.3 % Triton X-100 for 1 h. Slides were washed twice for 5 min in 0.1 M Tris-HCl and 0.15 M NaCl (TN) and then incubated at 4 ◦ C in 0.2 % w/v blocking reagent (Roche) and anti-digoxygenin antisera conjugated to horseradish peroxidase (Roche; 1:150) using probe clips (Midwest Scientific, PC200) without shaking. After 48 h, probe clips were removed and slides were washed in maleate buffer, TN, and TN with 0.05% TritonX; Sigma-Aldrich (TNT) for 5 min each. Slides were transferred to plastic mailers containing biotinylated tyramide from a Renaissance

TSA-indirect ISH Kit (Perkin-Elmer; 1:250) in TNT for 10 min. Sections were washed in TNT three times for 3 min each and then incubated in ABC Elite (Vectastain ABC

Kit, Vector Laboratories, Burlingame, CA) reagent for 30 min at 37 ◦ C using probe clips

and manufacturer’s protocol. Probe clips were removed and slides washed 3 times, 3

min each in TNT. Digoxigenin signal was visualized using TNT containing 1 mM

diaminobenzidine (Sigma D5905) and 0.1 mM hydrogen peroxide. After specific signal

appeared, this reaction was halted by rinsing slides in 0.1 M Tris (pH 7.6) for 3 min followed by a brief rinse in water. Finally slides were dehydrated for 3 min in 70 % ethanol and air-dried.

I detected radioisotopic probe signal autoradiographically using NTB emulsion

(Kodak, Rochester, NY) and manufacturer’s protocol. Slides were later developed at

14◦ C using Kodak Dektol developer and Kodak fixer. After a rinse in water, I air-dried the slides and dipped them briefly in xylenes prior to coverslipping with Cytoseal 60™ mounting medium (Richard-Allan Scientific, Kalamzoo, MI). Images were acquired

using a CCD videocamera (QImaging QICAM FAST color) and BioQuant Imaging

Software (Nashville, TN).

4.3.6 Statistics

In order to analyze dual-label ISHH studies, I used four to six AVPV sections

from each animal and determined the mean number of GAD-positive neurons

containing Pgrmc1 and the mean number containing Serbp1 mRNA. This value was

used to determine the percentage of GAD-positive neurons that contained specific

signal for Pgrmc1 or Serbp1. Similarly, percentages of Serbp1-positive neurons that

contained specific Pgrmc1 signal were also determined. Signal was considered specific

if the digoxigenin-labeled neurons contained four-times more 35 S-labeled probe signal

than background. The grand means of each group were acquired from the means of

individual animals.

4.4 Results

4.4.1 AVPV GABA Neurons Contain Pgrmc1 mRNA

Results of the dual-label ISHH studies showed that in E2-primed ovariectomized female rats, AVPV neurons that were GAD-positive (as determined using digoxigenin- labeled cRNA probes for GAD1 and 2) contain Pgrmc1 mRNA (Figure 4.6.1a).

Quantification studies determined that virtually all GABAergic neurons contain Pgrmc1 mRNA (Figure 4.6.1d).

4.4.2 AVPV GABA Neurons Contain Serbp1 mRNA

In the AVPV, neurons that contained GAD mRNA also contained Serbp1 mRNA (Figure 4.6.1b). Serbp1 mRNA was specifically detected in approximately 86% of GAD-positive neurons in ovariectomized E 2-primed rats (Figure 4.6.1d).

4.4.3 Pgrmc1 and Serbp1 mRNA are Coexpressed by AVPV Neurons

Dual-labeling experiments revealed that Pgrmc1 and Serbp1 mRNA are present within the same neurons in the AVPV of ovariectomized E 2-primed female rats (Figure

4.6.1c). Pgrmc1 (detected using a radioactively-labeled probe) was specifically expressed by approximately 94% of Serbp1+ neurons in ovariectomized E 2-primed rats

(Figure 4.6.1d). A small percentage of AVPV neurons that were Serbp1+ did not contain detectable levels of Pgrmc1 signal.

4.5 Discussion

The present findings are the first to show that AVPV cells contain mRNA encoding both Pgrmc1 and binding partner Serbp1. Moreover, nearly all expression of these two genes was within GABAergic neurons (as determined by using GAD as a marker of GABAergic neurons). Given the importance of these GABAergic neurons in

relaying hormonal cues to GnRH neurons, our findings indicate that P 4 may exert diverse actions through Pgrmc1 and Serbp1 in timing and amplifying the LH surge.

The finding that Pgrmc1 and Serbp1 mRNAs are contained within the same AVPV neurons lends support to the notion that these binding partners form a functional receptor complex to mediate P 4 actions in AVPV neurons as they do in granulosa cells

(Peluso et al., 2004, Peluso et al., 2006). Taken together, these data indicate that

Pgrmc1 and Serbp1 actions as P 4 signaling molecules may be important in the neural control of ovulation.

The neural expression of Pgrmc1 and Serbp1 within GABAergic AVPV neurons is intriguing as these neurons are critical for regulation of LH surge release. Ample evidence supports the idea that GABA release from AVPV efferents restrains GnRH firing and the onset of the surge. For example, GABA release within the vicinity of

GnRH cell bodies increases in the morning but falls before the afternoon onset of the

LH surge (Robinson et al., 1991, Jarry et al., 1995). In the AVPV, levels of Gad1 mRNA (marker of GABAergic neuronal activiation), as well as the amount of vesicular

GABA transporter in synapses on GnRH neurons (Ottem et al., 2004) rise, then fall just before LH surge release. These changes parallel those of GABA release into the preoptic area on the day of the surge (Jarry et al., 1995) and a decline in GABA is required for LH surge release (Herbison and Dyer, 1991, Seltzer and Donoso, 1992).

GnRH neurons express GABA A receptors (Petersen et al., 2003), and GABA A activation hyperpolarizes GnRH neurons (Herbison, 1998, Han et al., 2002). Together, these findings highlight the importance of AVPV GABergic neurons and underscore the importance of this subset of neurons as a nodal point conveying hormonal status to

GnRH neurons. Thus, the present finding that P 4 signaling molecules are present on the vast majority of GABAergic neurons suggests that they may influence the regulatory input of AVPV dual-phenotype neurons to GnRH cell bodies.

The exact role of P 4 in the LH surge release is an issue that has been difficult to resolve as E 2 alone is sufficient to increase GnRH levels in the neural control of the LH surge (Rothfeld et al., 1989, Rosie et al., 1990). Therefore, our understanding on this topic is centered on the observation that P 4 coordinates the timing of the onset as well as increasing the magnitude of the LH surge (Everett, 1948, Rothchild, 1965, DePaolo and

Barraclough, 1979). This positive-feedback action is largely attributed to E 2-induced

Pgr activation (Chappell and Levine, 2000), a highly induced gene in the estrogen receptor-rich AVPV (Simerly et al., 1990, Shughrue et al., 1997). Our current findings suggest another alternative, namely that P 4 activation of Pgrmc1 and Serbp1 may

contribute to the regulatory functions of P 4 on LH surge magnitude and timing. While

further research concerning this possibility is warranted, evidence from other cells

support the concept that Pgrmc1 and Serbp1 may mediate P4 signaling in AVPV

neurons.

Our finding that Pgrmc1 and Serbp1 are coexpressed within the same cells is in

line with the idea that both are required for P 4 actions. Current research on these

binding partners shows that depletion of Pgrmc1 or Serbp1 limits the ability of P 4 to

maintain cell viability in granulosa cells (Peluso et al., 2004, Peluso et al., 2008).

3 Additional studies have shown that Pgrmc1overexpression increases [ H]-P4 binding

and P 4-responsiveness (Peluso et al., 2006), indicating that Pgrmc1 mediates P 4 actions.

This idea appears to hold for some neural cells, as a recent study reports that Pgrmc1 is

required for the proliferative effect of P 4 on hippocampal neuroprogenitor cells (Liu et al., 2009). Although the roles of Pgrmc1 and Serbp1 in mediating neural responses to

P4 remains unknown, our present findings raise the possibility that may be important in the AVPV for P 4-dependent amplification of LH surge release.

4.6.1: Primers Used in Template Production

NCBI Gene Antisense Amplicon Name and Primer sequences 5’- 3’ to bases: (bp) Accession #

GATCCTAATACTACCAACCTGC 231 – 253 rat Gad1 537 NM_017007 ACCAGCTCTCTACTGGTTTGGA 746 – 767

CGTGACCTCGCGGGCCGCCA 257 – 276 rat Gad2 688 NM_012563 TTCTCTCAAGAAGGGAGCTGCA 923 – 944

GCCTTGGGGATCGGAACAGACA 945 – 966 rat Gad2 825 NM_012563 ATGGTCATCTCAAACCCTGCA 1749 – 1769

TCCAGAGATCATGGCTGC 88 – 105 rat Pgrmc1 678 NM_021766 CATGTTGTAAAGACAGACTGG 765 – 745

CAACCGATTCGACCAGCTAT 107 – 126 rat Serbp1 702 NM_145086 TCTTCACCTTCGGGTGTTTC 808 – 789

4.7.1 Pgrmc1 and Serbp1 are Coexpressed by GABAergic AVPV Neurons

Figure 4.7.1: Most GABAergic neurons (Gad-positive) of the adult female rat contain Pgrmc1 (A) and Serbp1 (B), and Pgrmc1 and Serbp1 are coexpressed within many of the same neurons (C). Dual-label ISHH used 35 S-labeled cRNA probes (black grain) and digoxigenin-labeled cRNA probes (brown stain) and adult female rat brain sections containing the AVPV. Photomicrographs were produced using probes 35 S-labeled for Pgrmc1 (A, C) and Serbp1 (B), in combination with digoxigenin-labeled GAD (marker of GABAergic neurons) (A, B), and Serbp1 (C). Quantification of colocalization experiments is shown in D. Scale bar = 50 µm.

4.8 References

Adelman JP, Mason AJ, Hayflick JS, Seeburg PH (1986) Isolation of the gene and hypothalamic cDNA for the common precursor of gonadotropin-releasing hormone and prolactin release-inhibiting factor in human and rat. Proc Natl Acad Sci U S A 83:179-183.

Bailey JD, Centers A, Jennes L (2006) Expression of AMPA receptor subunits (GluR1- GluR4) in gonadotrophin-releasing hormone neurones of young and middle- aged persistently oestrous rats during the steroid-induced luteinising hormone surge. J Neuroendocrinol 18:1-12.

Chappell PE, Levine JE (2000) Stimulation of gonadotropin-releasing hormone surges by estrogen. I. Role of hypothalamic progesterone receptors. Endocrinology 141:1477-1485.

Curran-Rauhut MA, Petersen SL (2002) Regulation of glutamic acid decarboxylase 65 and 67 gene expression by ovarian steroids: identification of two functionally distinct populations of GABA neurones in the preoptic area. J Neuroendocrinol 14:310-317.

Everett JW (1948) Progesterone and estrogen in the experimental control of ovulation time and other features of the estrous cycle in the rat. Endocrinology 43:389- 405.

Frye CA, Vongher JM (2001) Progesterone and 3alpha,5alpha-THP enhance sexual receptivity in mice. Behav Neurosci 115:1118-1128.

Goodman RL, Bittman EL, Foster DL, Karsch FJ (1981) The endocrine basis of the synergistic suppression of luteinizing hormone by estradiol and progesterone. Endocrinology 109:1414-1417.

Han SK, Abraham IM, Herbison AE (2002) Effect of GABA on GnRH neurons switches from depolarization to hyperpolarization at puberty in the female mouse. Endocrinology 143:1459-1466.

Hays LE, Carpenter CD, Petersen SL (2002) Evidence that GABAergic neurons in the preoptic area of the rat brain are targets of 2,3,7,8-tetrachlorodibenzo-p-dioxin during development. Environ Health Perspect 110 Suppl 3:369-376.

Herbison AE (1998) Multimodal influence of estrogen upon gonadotropin-releasing hormone neurons. Endocr Rev 19:302-330. 88

Herbison AE, Dyer RG (1991) Effect on luteinizing hormone secretion of GABA receptor modulation in the medial preoptic area at the time of proestrous luteinizing hormone surge. Neuroendocrinology 53:317-320.

Hisano S (2003) Vesicular glutamate transporters in the brain. Anat Sci Int 78:191-204.

Intlekofer KA, Petersen SL (2011) Distribution of mRNAs encoding classical progestin receptor, progesterone membrane components 1 and 2, serpine mRNA binding protein 1, and progestin and ADIPOQ receptor family members 7 and 8 in rat forebrain. Neuroscience 172:55-65.

Jarry H, Leonhardt S, Schwarze T, Wuttke W (1995) Preoptic rather than mediobasal hypothalamic amino acid neurotransmitter release regulates GnRH secretion during the estrogen-induced LH surge in the ovariectomized rat. Neuroendocrinology 62:479-486.

Ke FC, Ramirez VD (1990) Binding of progesterone to nerve cell membranes of rat brain using progesterone conjugated to 125I-bovine serum albumin as a ligand. J Neurochem 54:467-472.

Kiss J, Kocsis K, Csaki A, Halasz B (2003) Evidence for vesicular glutamate transporter synapses onto gonadotropin-releasing hormone and other neurons in the rat medial preoptic area. Eur J Neurosci 18:3267-3278.

Leipheimer RE, Bona-Gallo A, Gallo RV (1984) The influence of progesterone and estradiol on the acute changes in pulsatile luteinizing hormone release induced by ovariectomy on diestrus day 1 in the rat. Endocrinology 114:1605-1612.

Liu L, Wang J, Zhao L, Nilsen J, McClure K, Wong K, Brinton RD (2009) Progesterone increases rat neural progenitor cell cycle gene expression and proliferation via extracellularly regulated kinase and progesterone receptor membrane components 1 and 2. Endocrinology 150:3186-3196.

Nippoldt TB, Reame NE, Kelch RP, Marshall JC (1989) The roles of estradiol and progesterone in decreasing luteinizing hormone pulse frequency in the luteal phase of the menstrual cycle. J Clin Endocrinol Metab 69:67-76.

Ottem EN, Godwin JG, Krishnan S, Petersen SL (2004) Dual-phenotype GABA/glutamate neurons in adult preoptic area: sexual dimorphism and function. J Neurosci 24:8097-8105.

Ottem EN, Godwin JG, Petersen SL (2002) Glutamatergic signaling through the N- methyl-D-aspartate receptor directly activates medial subpopulations of luteinizing hormone-releasing hormone (LHRH) neurons, but does not appear to mediate the effects of estradiol on LHRH gene expression. Endocrinology 143:4837-4845.

Peluso JJ, Pappalardo A, Fernandez G, Wu CA (2004) Involvement of an unnamed protein, RDA288, in the mechanism through which progesterone mediates its antiapoptotic action in spontaneously immortalized granulosa cells. Endocrinology 145:3014-3022.

Peluso JJ, Romak J, Liu X (2008) Progesterone receptor membrane component-1 (PGRMC1) is the mediator of progesterone's antiapoptotic action in spontaneously immortalized granulosa cells as revealed by PGRMC1 small interfering ribonucleic acid treatment and functional analysis of PGRMC1 mutations. Endocrinology 149:534-543.

Petersen SL, Keller ML, Carder SA, McCrone S (1993) Differential effects of estrogen and progesterone on levels of POMC mRNA levels in the arcuate nucleus: relationship to the timing of LH surge release. J Neuroendocrinol 5:643-648.

Petersen SL, McCrone S, Keller M, Shores S (1995) Effects of estrogen and progesterone on luteinizing hormone-releasing hormone messenger ribonucleic acid levels: consideration of temporal and neuroanatomical variables. Endocrinology 136:3604-3610.

Petersen SL, Ottem EN, Carpenter CD (2003) Direct and indirect regulation of gonadotropin-releasing hormone neurons by estradiol. Biol Reprod 69:1771- 1778.

Robinson JE, Kendrick KM, Lambart CE (1991) Changes in the release of gamma- aminobutyric Acid and catecholamines in the preoptic/septal area prior to and during the preovulatory surge of luteinizing hormone in the ewe. J Neuroendocrinol 3:393-399.

Rosie R, Thomson E, Fink G (1990) Oestrogen positive feedback stimulates the synthesis of LHRH mRNA in neurones of the rostral diencephalon of the rat. J Endocrinol 124:285-289.

Rothfeld J, Hejtmancik JF, Conn PM, Pfaff DW (1989) In situ hybridization for LHRH mRNA following estrogen treatment. Brain Res Mol Brain Res 6:121-125.

Sannella MI, Petersen SL (1997) Dual label in situ hybridization studies provide evidence that luteinizing hormone-releasing hormone neurons do not synthesize messenger ribonucleic acid for mu, kappa, or delta opiate receptors. Endocrinology 138:1667-1672.

Seltzer AM, Donoso AO (1992) Restraining action of GABA on estradiol-induced LH surge in the rat: GABA activity in brain nuclei and effects of GABA mimetics in the medial preoptic nucleus. Neuroendocrinology 55:28-34.

Simerly RB, Chang C, Muramatsu M, Swanson LW (1990) Distribution of androgen and estrogen receptor mRNA-containing cells in the rat brain: an in situ hybridization study. J Comp Neurol 294:76-95.

Sleiter N, Pang Y, Park C, Horton TH, Dong J, Thomas P, Levine JE (2009) Progesterone receptor A (PRA) and PRB-independent effects of progesterone on gonadotropin-releasing hormone release. Endocrinology 150:3833-3844.

Spergel DJ, Kruth U, Hanley DF, Sprengel R, Seeburg PH (1999) GABA- and glutamate-activated channels in green fluorescent protein-tagged gonadotropin- releasing hormone neurons in transgenic mice. J Neurosci 19:2037-2050.

CHAPTER 5

PROGESTERONE RECEPTOR MEMBRANE COMPONENT 1

COREGULATES NOVEL GENE TARGETS NR4A1, SPNA1, TGM2 AND IFIT3

AND REGULATES BASAL STAT3 ACTIVATION IN NEURAL CELLS

5.1 Abstract

Progesterone receptor membrane component 1 (Pgrmc1) is a signaling molecule important for progesterone actions in reproductive tissues. While much of the research regarding Pgrmc1 function has been conducted in ovarian cells, we and others have recently found high levels of Pgrmc1 expression in the brain, particularly in the rat hypothalamus. In these studies, we extend the anatomical localization to mouse brain and found high levels of Pgrmc1 mRNA in hypothalamic nuclei, yet the roles of

Pgrmc1 in neural cells is not yet clear. At the cellular level, Pgrmc1 has been localized to the nucleus, suggesting a role in transcription. In order to investigate this possibility, we used whole-genome microarrays to examine the effects of Pgrmc1 levels on gene expression in a hypothalamic cell line. We report that Pgrmc1 co-regulates several gene targets, including nuclear receptor subfamily 4 group A member 1 (Nr4a1), interferon- induced protein with tetratricopeptide repeats 3 (IFIT3), spectrin alpha 1 (Spna1) and transglutaminase 2 (Tgm2). Given the role of Pgrmc1 in signaling pathways of diverse tissues, we used pathway analysis software on our microarray data to determine if

Pgrmc1regulates signaling pathways in neural cells. We found that Pgrmc1 regulates basal levels of STAT3 activation in a manner that may explain Pgrmc1 coregulation of several target genes. Thus, we propose a novel role of Pgrmc1 in neural cells in regulation of STAT3 pathways and in regulating novel target genes.

5.2 Introduction

The observation that progesterone exerts rapid effects in diverse tissues has led the discovery of several novel signaling molecules. Among these molecules,

Progesterone Receptor Membrane Component 1 (Pgrmc1) has been implicated in a wide array of physiological functions. For example, Pgrmc1 is required for the apoptotic actions of progesterone (P 4) in granulosa cells (Peluso et al., 2006, Peluso et al., 2008). In adrenal cells, Pgrmc1 mediates steroid biosynthesis and metabolism through interactions with enzymes in the biosynthetic pathway (Laird et al., 1988, Min et al., 2004, Hughes et al., 2007). Finally, in sperm cells, Pgrmc1 is implicated in the

P4-induced calcium influx that precedes the acrosome reaction (Buddhikot et al., 1999,

Falkenstein et al., 1999). Together, these data indicate that Pgrmc1 may regulate divergent effects depending on the tissue type.

While Pgrmc1 has been most studied in non-neural tissues, high levels of

Pgrmc1 have also been found in the brain, indicating that Pgrmc1 may play an important role in neural functions (Krebs et al., 2000, Intlekofer and Petersen, 2011).

Pgrmc1 expression is also found in vasopressinergic neurons of the paraventricular nucleus (Meffre et al., 2005), a finding that may point to a role in water homeostasis.

Though these studies yield clues as to the potential roles of Pgrmc1, the specific neural actions of Pgrmc1 have not been identified.

At the cellular level, evidence suggests that Pgrmc1regulates diverse signaling pathways and transcriptional events, though the cellular actions of Pgrmc1are likely to vary depending on the cell type. In breast cancer cells, Pgrmc1 activates Akt and I κB through phosphorylation (Hand and Craven, 2003) while in hippocampal neural

progenitor cells, Pgrmc1 is required for ERK pathway activation (Liu et al., 2009).

Pgrmc1 may also alter transcription of target genes as supported by evidence that

Pgrmc1 localizes to the nucleus (Beausoleil et al., 2004, Peluso et al., 2006) and may regulate cell proliferation and pro-survival genes (Liu et al., 2009, Peluso et al., 2010).

Despite this wide range of clues, virtually nothing is known regarding Pgrmc1- dependent signaling pathways and gene targets in hypothalamic neural cells, where

Pgrmc1 expression levels are especially abundant. In order to address this issue, we used a hypothalamic cell line and Pgrmc1 small interfering RNA (siRNA) to knock down Pgrmc1 expression, and identified novel gene candidates and Pgrmc1-dependent signaling pathways using microarray analyses.

5.3 Materials and Methods

5.3.1 Animals and Tissue Preparation

All animals were housed in accordance with the National Institutes of Health

Guidelines for the Care and Use of Laboratory Animals and all protocols were approved by the Institutional Animal Car and Use Committee of the University of Massachusetts.

Three adult female C57Bl/6 mice (21-22 g; Jackson Labs; Bar Harbor, ME) were communally housed in the Animal Care Facility with food and water provided ad libitum on a 14:10 light:dark cycle. Animals were ovariectomized under isofluorane anesthesia, allowed to recover for one week, and then injected s.c. with 10 µM 17 β- estradiol dissolved in 100 µl sesame oil to ensure a similar hormonal milieu among animals. After 8 h, brains were collected and rapidly frozen on powdered dry ice and stored at -80 ᵒ C until they were cryosectioned (Leica CM3000, Nussloch, Germany).

14-µm coronal sections through the region containing the hypothalamus were thaw-

mounted onto gelatin-coated slides and prehybridized as previously described (Ottem et al., 2004).

5.3.2 Cells and Culturing Methods

We used N42 cells, an immortalized hypothalamic neuronal cell line (Cellutions

Biosystems, Inc.; Burlington, Ontario, Canada). Cells were maintained at 37 ᵒ C and

5% CO 2 in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10%

(v/v) Hyclone fetal bovine serum (FBS; Thermo Fisher Scientific, Rockford, IL), 100

U/ml penicillin, 100 mg/ml streptomycin, and 2 mM L-glutamine (PS-Gln; GIBCO-

BRL; Gaithersburg, MA). Once seeded cells were reached approximately 70% confluence, they were rinsed with phosphate buffered saline (PBS) and media was replaced with phenol red-free DMEM with 10% charcoal-stripped FBS and PS-Gln.

After 24 h, cells were transfected using siRNA or expression vectors as described below.

5.3.3 siRNA Experiments

N42 cells were transfected with 2 M negative control or Pgrmc1 siRNA (Cat no. GS53328 and SI03650318, SABiosciences; Frederick, MD), using HiPerfect

Transfection Reagent according to the manufacturer’s protocol (Qiagen, Valencia, CA).

After 16 h, cells were treated with P 4 (10 µM) for an additional 8 h prior to harvesting

RNA. The P 4 treatment did not alter Pgrmc1 levels (Figure 5.8.3a), a finding also shown in granulosa cells (Peluso et al., 2010). Total RNA was isolated using TRIzol reagent (Invitrogen; Carlsbad, CA) and Qiagen lipid easy kit (Qiagen) and manufacturer’s protocols.

5.3.4 Microarray Gene Expression Profiling

RNA from N42 cell siRNA experiments was used for Mouse Genome 430 2.0

Gene Chip assay (Affymetrix; Palo Alto, CA) performed by the Keck Microarray

Institute at Yale University. RNA quality was assessed using an Agilent 2100

Bioanalyzer and RNA 6000 Nano LabChips (Agilent Technologies, Palo Alto, CA).

After data retrieval from the Keck Microarray Institute, Ingenuity Pathway Analysis and

Pathway Studio (Ariadne; Rockville, MD) were employed to determine differences in gene expression that may differ among treatment groups. To determine possible signaling pathways differentially affected by Pgrmc1 siRNA treatments, I used Pathway

Studio, which utilizes the ResNet database based on the assumption that functionally related genes are co-transcribed. I used Pathway Studio’s Gene Set Enrichment

Analysis to identify candidate signaling pathways in which a higher number of pathway entities were significantly different between scramble and Pgrmc1 siRNA-transfected samples.

5.3.5 Pgrmc1 Construct

N42 cells were transiently transfected using a pcDNA3.3 TOPO TA vector

(Invitrogen; Carlsbad, CA) containing Pgrmc1 and using manufacturer’s protocol. To generate the Pgrmc1 product, primers were obtained from Integrated DNA

Technologies (Coralville, IA) and PCR reagents (Promega; Madison, WI). The coding portion of the mouse Pgrmc1 sequence was produced using PCR primers: 5’-

TCATGGCTGCCGAGGATGT-3’ and 5’-TTATACATTCATTCTTCCGAGC-3’ corresponding to sequence 61-650 and included a stop signal (as denoted by underline).

Gel-purified PCR products were cloned into the pcDNA™ 3.3-Topo® TA Cloning Kit

using manufacturer’s protocol (Invitrogen). Transformants were analyzed for incorporation and orientation of the product using primers provided by manufacturer and sequencing. I linearized the plasmid construct using Pvu I prior to transfection into

N42 cells, and purified the linearized construct by phenol-chloroform extraction and ethanol precipitation. The empty vector or Pgrmc1 expression construct was transfected into N42 cells using SuperFect and manufacturer’s protocol (Qiagen) and the resulting increase in Pgrmc1 RNA and protein was confirmed by QPCR and western blot (Figure

5.8.6).

5.3.6 Dual-luciferase Assays

The transcriptional activity of STAT3 was measured using dual-luciferase assays following transfection of N42 cells with Cignal™ STAT3 reporter construct

(Cat. no CCS-9028L; SABiosciences). In addition to STAT3-responsive elements upstream of the firefly luciferase construct, a Renilla luciferase construct was included in the same construct as an internal control for transfection efficiency normalization.

To optimize transfection conditions, positive and negative control plasmids and manufacturer’s protocol were used (SABiosciences). Combined transfection with siRNA was performed in order to determine the effect of Pgrmc1 knockdown on

STAT3 activity in N42 cells. Renilla and firefly luciferase activities in cell lysates were assayed using the Dual Luciferase reporter system (Promega) and measured on a

Fluostar Optima Luminometer (BMG; Durham, NC). Experiments were performed in triplicate and results are presented in Figure 5.8.5a.

5.3.7 Quantitative Reverse Transcriptase PCR (QPCR)

QPCR was used to verify that Pgrmc1 was knocked down by treatment with

Pgrmc1 siRNA compared to scramble siRNA controls, and in order to validate outcomes of our microarray study. Genes were chosen for validation based on their high and low levels of expression in N42 cells treated with scramble or Pgrmc1 siRNA in the presence of P 4. N42 RNA samples were generated using the identical treatment paradigm as described above for the original microarray experiment. RNA was reverse transcribed into cDNA using QuantiTect Reverse Transcriptase Kit (Roche Diagnostics,

Indianapolis, IN) and manufacturer’s protocol, which included a genomic DNA degradation step. Primers were obtained from SABiosciences for nuclear receptor subfamily 4 group A member 1 (Nr4a1 ; 24496A), interferon-induced protein with tetratricopeptide repeats 3 (IFIT3; 06008A), transglutaminase 2 (Tgm2; 40872E) and spectrin alpha 1 (Spna1; 32969A) and manufacturer’s protocol. Primers for Pgrmc1 and β-actin were obtained from Integrated DNA Technologies (Coralville, IA) and are listed in Table 5.7.1. Reactions contained reagents from QuantiTect SYBR Green Kit, following manufacturer’s protocol (Roche Diagnostics, Indianapolis, IN). These reactions were carried out using a Stratagene MX3000P thermocycler (Agilent

Technologies, Wilmington, DE) and the following parameters: 95 ᵒ C for 10 min, and

40 cycles of 95 ᵒ C for 30 sec, 55 ᵒ C for 30 sec and 72 ᵒ C for 30 sec. MxPro™ QPCR analysis software (Agilent Technologies) was used to obtain fluorescence measurements. Threshold cycle readings were used to calculate the relative amounts of target genes by normalizing them to the signal of β-actin after validating that β-actin mRNA levels did not differ among treatments. Primer specificity was also validated

using 2% agarose gel electrophoresis to verify single products following the QPCR reaction.

5.3.8 Western Blot

Protein was isolated from N42 cells lysates using radioimmunoprecipitation assay buffer (Boston BioProducts, Worcester, MA) containing 1% protease inhibitor cocktail (Calbiochem, San Diego, CA) and manufacturer’s protocol. Protein concentrations were assessed using Pierce bicinchoninic acid protein assay (Thermo

Fisher Scientific). Ten-µg of protein per lane was electrophoresed on 4–15% Tris–HCl

SDS-PAGE gradient gels (Biorad; Hercules, CA) and was transferred electrophoretically to Immobilon-P membranes (Millipore; Billerica, MA.) Membranes were blocked in 5% skimmed dry milk in Tris-buffered saline plus 0.05% Tween-20

(TBST; pH 7.4) for 1 h at room temperature on an orbital shaker, and then incubated overnight at 4 ᵒ C with anti-Pgrmc1 antibody (1:1000; Proteintech Group, Chicago, IL) in TBST. Membranes were washed in TBST for 30 min, followed by horseradish peroxidase-conjugated secondary antibody (anti-rabbit 1:10,000; Abcam, Cambridge,

MA) for 1 h, and developed using Chemiluminescence HRP Substrate (Millipore).

Blots were apposed to BioMax MR film (Kodak; Rochester, NY), and band intensities were quantified from developed films using densitometric software (GeneTools ver.

3.07 SynGene; Cambridge, England). Blots were re-probed with anti-β-actin (1:2000;

Abcam) and anti-mouse antisera (1: 2000; Abcam) to provide protein loading controls.

5.3.9 Janus Kinase (JAK) and Signal Transducer and Activator of Transcription 3

(STAT3) Inhibition

To determine whether activation of Jak2/STAT3 signaling pathway was upstream of Pgrmc1 siRNA effects on gene targets, N42 cells were treated with DMSO vehicle control or 10 nM JSI-124 (cat. no. C4493; Sigma). JSI-124 is a cell-permeable compound that specifically inhibits Jak2 and STAT3 by suppressing their phosphorylation status (Sun et al., 2005, Shi et al., 2006). JSI-124 exposure decreases

STAT3 DNA binding and STAT3-mediated gene expression, yet has no effect on the activity of Src, Akt, ERK, or JNK pathways (Blaskovich et al., 2003). The dose of 10 nM was selected based on preliminary reports of JSI-124 effective doses in other cell lines, and a dose-response of N42 cell viability following 24 h exposure to vehicle,

1x10 -6 M, 1x10 -5 M, 1x10 -4 M and 1x10 -3 M JSI-124. A trypan blue exclusion assay was used to assess cell viability as previously described (Mishell and Shiigi, 1980) and cell phenotype changes were also recorded (Figure 5.8.4a).

5.3.10 Oligodeoxynucleotidyl Probe Preparation

Sense and antisense oligodeoxynucleotidyl probes were obtained from

Integrated DNA Technologies (Coralville, IA) as listed in Table 1. Using terminal deoxynucleotidyl transferase (Roche, Indianapolis, IN), sequences were 3 ′-end labeled

with [ α33P]-dATP (PerkinElmer, Waltham, MA) as described previously (Petersen et

al., 1989). I purified the probe by phenol-chloroform extraction and ethanol

precipitation and washed the pellet with 70% ethanol before suspending the probe in 25

l TE (10 mM Tris-HCl; pH 8.0, 1 mM EDTA).

100

5.3.11 In Situ Hybridization Histochemistry (ISHH)

To determine the relative localization of Pgrmc1 and validated gene targets, radioisotopic probes (0.5×10 6 cpm) were applied to prehybridized brain sections in 20

l hybridization buffer. This buffer contained 4×SSC (1×SSC=0.15 M NaCl/0.015 M sodium citrate, pH 7.2), 50% (v/v) formamide, 10% (w/v) dextran sulfate, 250 g/ml

yeast tRNA, 1× Denhardt's solution, 500 g/ml heparin sodium salt, 0.1% sodium pyrophosphate and 0.05 M dithiothreitol added freshly before use. After covering sections with glass coverslips, slides were hybridized for 16 h at 37 °C in humidified plastic boxes. Slides were removed from 37 °C and coverslips were floated off in

1×SSC. Sections were washed four times for 15 min each in 2×SSC-50% formamide solution at 40 °C, followed by four washes, 15 min each, in 1×SSC. All sections were rinsed in double-distilled water, dehydrated briefly in 70% ethanol, and air-dried. For signal detection, slides were apposed to BioMax MR film (Kodak) and autoradiograms were developed by an X-ray film processor. I then used NTB2 emulsion and standard autoradiographical procedures to visualize probes for Nr4a1 (Kodak; 10 d exposure) and counterstained brain sections using thionin in order to determine whether Nr4a1 signal was confined to cell bodies. All images were acquired using BioQuant Imaging

Software (Bio-Quant Inc., Nashville, TN, USA) and a CCD videocamera (QImaging

QICAM FAST color, Surrey, BC, Canada).

5.3.12 Statistics

Data is expressed as means ± SEM and all data shown is the result of at least three replicates of three or more independent runs for each assay. Treatment effects were evaluated using one-way ANOVA, except for validation of QPCR studies using

101

siRNA and P 4 treatments which required two-way ANOVA. Bonferroni t-tests were used for post hoc analyses of treatment effects. For QPCR studies, Ct values from duplicates of each sample were normalized to those of β-actin and analyzed using the

∆∆ Ct method (Livak and Schmittgen, 2001) and treatment effects were evaluated using two-way ANOVA. Dual luciferase experiments were analyzed by unpaired t tests.

5.4 Results

5.4.1 Pgrmc1 siRNA Experiments

Pgrmc1 expression was depleted by treatment with 2 µM Pgrmc1 siRNA compared to scramble siRNA controls as determined by QPCR (Fig. 5.8.1a) and western blotting (Fig. 5.8.b). Knockdown of Pgrmc1 was significant at 16 h post- transfection with siRNA, and persisted at 24 h (Fig 5.8.1a). Following optimization of the siRNA transfection protocol, RNA was prepared for microarray analyses and validation studies.

5.4.2 Identification of Novel Target Genes by Microarray Analyses

Genes identified using Affymetrix whole-genome microarrays are displayed using a heat map and fold change analyses (Fig. 5.8.2a). To generate fold changes between scramble (control) and Pgrmc1 siRNA-transfected groups, the mean expression values of samples transfected with Pgrmc1 siRNA were log 2 transformed and normalized to those of the control group. The raw expression values of gene expression among groups were used to run gene set enrichment analysis in order to provide a ranking of predicted canonical pathways that differ when Pgrmc1 expression was decreased by the use of Pgrmc1 siRNA (Table 5.7.3). The top-ranked pathway was

IL6R and STAT3 signaling and is displayed in Figure 5.8.2b with relative expression

102

data between scramble (control) and Pgrmc1 siRNA-transfected groups as indicated

(Fig. 5.8.2a).

5.4.3 Validation of Microarray Findings by QPCR

Several gene candidates differentially expressed following Pgrmc1 depletion were validated by QPCR in N42 cells. In these experiments, N42 cells were also exposed to 8 h of 10 nM P 4, and levels of Pgrmc1 mRNA were validated to be decreased by transfection with Pgrmc1 siRNA compared to scramble (controls)

(Fig.5.8.3a). Pgrmc1 depletion decreased levels of mRNA encoding pro-survival genes

Tgm2 (Fig.5.8.3b) and Spna1 (Fig.5.8.3.c). Additional gene candidates were selected and validated to be increased by Pgrmc1 depletion, including genes implicated in apoptotic pathways including Nr4a1 (Fig. 5.8.3d) and IFIT3 (Fig. 5.8.3.e). Regulation of Pgrmc1 and all gene targets was P 4-independent at the dose tested.

5.4.4 Transfection of Pgrmc1 Expression Construct

To determine if Pgrmc1 levels resulted in the changes to mRNA levels as shown in siRNA depletion studies, Pgrmc1 expression constructs were used to increase

Pgrmc1 expression in N42 cells. Transfection of empty vector control or Pgrmc1 expression constructs into N42 cells increased levels of Pgrmc1 mRNA (Fig. 5.8.4a) and protein (Fig. 5.8.4b). In these experiments, Pgrmc1 over-expression causes similar increases in levels of mRNA encoding Tgm2 (Fig. 5.8.4c) and Spna1 (Fig. 5.8.4d).

Over-expression of Pgrmc1 appeared to decrease Nr4a1 levels (Fig. 5.8.4.e), and had no effect on IFIT3 mRNA (Fig 5.8.4.f).

103

5.4.5 Pgrmc1 Levels Regulate STAT3 Activity

In accordance with pathway candidates identified by microarray analyses, the relative activity of STAT3 was investigated using a STAT3 reporter construct. Dual- luciferase assays were performed on N42 cells cotransfected with a STAT3 reporter and scramble (control) or Pgrmc1 siRNAs. After 24 h of transfection, cells treated with

Pgrmc1 siRNA showed increased STAT3 activation relative to scramble siRNA controls, (Fig. 5.8.5).

5.4.6 STAT3 Inhibitor JSI-124 Alters Pgrmc1, Nr4a1 and IFIT3 mRNA Levels

Treatment of N42 cells with doses of JSI-124 resulted in rounding of the cells and cell death as determined by trypan blue exclusion assay (Fig. 5.8.6a), therefore a dose of 10 nM was chosen as to minimize changes in cell morphology and viability.

Treatment of N42 cells with JSI-124 for 8 h decreased Pgrmc1 mRNA levels compared to vehicle controls (Fig.5.8.6a). This treatment had no effect on levels of mRNA encoding Tgm2 (Fig. 5.8.6c) or Spna1 (Fig 5.8.6d), but increased Nr4a1 mRNA levels

(Fig. 5.8.6e) and decreased IFIT3 mRNA levels (Fig.5.8.6f).

5.4.7 ISHH Studies Reveal That Pgrmc1, STAT3, and Nr4a1 Localize to the

Hippocampus and Paraventricular Nucleus of Mouse Brain

ISHH studies were performed in order to determine the anatomical localization of Pgrmc1 and whether Pgrmc1-coregulated genes identified in N42 cells were present in the same brain regions. Pgrmc1 signal was especially abundant in neuroendocrine nuclei including the medial preoptic area (Fig 5.8.7g), suprachiasmatic nucleus (Fig.

5.8.7j), paraventricular nucleus (Fig. 5.8.7m) and hippocampus (Fig. 5.8.7p). Nr4a1 signal was high in the cortex and rostral striatum (Fig. 5.8.7 e, h, k), and very strong in

104

the paraventricular nucleus (Fig. 5.8.7n) and hippocampus (Fig.5.8.6q). STAT3 ISHH signal was very diffuse but appeared to overlap the expression of Nr4a1 and Pgrmc1 in the paraventricular nucleus (Fig. 5.8.7o) and hippocampus (Fig. 5.8.7r). ISHH signal for STAT3 and Nr4a1 in the paraventricular nucleus have been reported previously

(Parkes et al., 1993, Hubschle et al., 2001). The specificity of the Nr4a1 ISHH signal in the paraventricular nucleus was further confirmed by autoradiographical detection using emulsion as shown in Figure 5.8.8a. Specific ISHH signal IFIT3, Spna1, and Tgm2 was not detected (data not shown).

5.5 Discussion

We found that Pgrmc1 levels regulate basal levels of mRNA encoding several novel gene targets in neural cells, including Spna1, Tgm2, Nr4a1 and IFIT3, indicating a novel role of Pgrmc1 in regulating diverse genes in neural cells. While mRNA levels of Tgm2 and Spna1 closely matched those of Pgrmc1, levels of Nr4a1 and IFIT3 were increased following Pgrmc1 depletion, suggesting that Pgrmc1 exerts repressive effects on gene expression. Our novel findings that Pgrmc1 regulates STAT3 activation indicate that Pgrmc1 levels may regulate basal activation of pathways critical for cell proliferation. Finally, the results of our ISHH studies show that Pgrmc1, Nr4a1 and

STAT3 mRNA signal is enriched in the hippocampus and paraventricular nucleus, in line with the idea that Pgrmc1 levels may regulate Nr4a1 abundance and STAT3 activation in vivo. Interestingly, the effects of Pgrmc1 depletion on Tgm2, Spna1,

Nr4a1 and IFIT3 were P 4-independent, suggesting that Pgrmc1 exerts important functions at the cellular level even in the absence of P4. Taken together, our findings provide a novel role of Pgrmc1 in regulating basal levels of novel gene targets and

105

STAT3 signaling, and indicate that Pgrmc1 may function as a pro-survival factor that regulates cell maintenance and proliferation.

Our results demonstrate that Pgrmc1 levels regulate levels of several genes involved in cell cycle progression and proliferation, which may provide insight into the role of this molecule in mitotic neurons rather than in adults. While this was not the original intention of the study, the validated gene targets are relevant to pro-survival functions in developing neural cells. For example, Pgrmc1 repression decreased levels of Spna1, a gene known for maintenance of cytoskeletal structures and for the regulation of plasma membrane components (Beck and Nelson, 1996). Spna1 is a molecule found in all major cell types of the brain and interacts with proteins important for synaptic function (Krebs et al., 1987, Sikorski et al., 1991, Clark et al., 1994). This ubiquitous expression in brain cells is a possible reason for why specific ISHH Spna1 signal was not detected in this study, but as the genes identified point to roles in cell maintenance and proliferation, it is possible that the effect of Pgrmc1 on Spna1 levels is more pertinent to studies in the developing nervous system.

In addition to coregulation of Spna1, we found that Pgrmc1 levels appeared to dictate Tgm2 mRNA abundance, which is interesting because Tgm2 is heavily implicated in cell survival. Tgm2 levels are carefully controlled as this multifunctional enzyme regulates cell viability by controlling protein scaffold cross-linking and stabilizing integrin (Lorand and Graham, 2003, Janiak et al., 2006). Although we and others did not detect specific localization of Tgm2 mRNA by ISHH mouse brain (data not shown), Tgm2 is present in the brain as identified by QPCR and enzymatic activity assays (Gilad and Varon, 1985, Bailey et al., 2004). Much like Pgrmc1, Tgm2

106

expression is sharply increased by traumatic brain injury (Gilad et al., 1985, Tolentino et al., 2002, Labombarda et al., 2003, Guennoun et al., 2008), indicating that these genes may be required for recovery processes. Importantly, Tgm2 is also important for neural development, in line with the idea that it may play important roles in actively- dividing cells (Spiteri et al., 2007).

We found that Pgrmc1 depletion increased levels of Nr4a1 and IFIT3 mRNA, which may indicate a repressive role of Pgrmc1 on transcription of these genes and support the notion that Pgrmc1 is important for cell viability. Both Nr4a1 and IFIT3 mediate apoptosis (Chan et al., 1998a, Chintharlapalli et al., 2005, Stawowczyk et al.,

2010); therefore, Pgrmc1 repressive effects on their expression may represent a pro- survival function. These genes have distinct functions in other cells that may yield clues as to their neural roles. Pgrmc1 regulation of Nr4a1 is especially interesting as both genes regulate aspects of P4 metabolism, though they have not been previously linked. Specifically, Nr4a1 is a member of the nuclear receptor superfamily that acts as a transcription factor and induces expression of 20-α-HSD, an enzyme that decreases progesterone levels. While a steroid metabolism role is suggested by studies on Nr4a1 in adult cells, in mitotic cells, Nr4a1 is specifically expressed during the G0/G1 cell cycle re-entry phase (Hazel et al., 1988). Although less is known regarding the function of IFIT3, it is induced by immunogenic stimuli and is STAT-dependent (Wang and

Campbell, 2005), in line with our finding that STAT3 inhibition decreases IFIT3 mRNA levels. IFIT3 expression is difficult to localize to the brain without immunogenic stimuli (Wacher et al., 2007) , a possible reason for why specific IFIT3

RNA signal was not detectable in our ISHH studies (data not shown). Thus, Pgrmc1’s

107

repressive effect on levels of Nr4a1 and IFIT3 are consistent with pro-survival functions in neural cells.

Our finding that Pgrmc1 regulates STAT3 signaling also supports a role of

Pgrmc1 in cell cycle progression, but this conclusion is likely dependent on cell-type.

Studies using cell lines show that STAT3 pathway activation is important for cell cycle progression, and this pathway is also important in mediating immune responses, differentiation and apoptosis (Nakajima et al., 1996, Fukada et al., 1998). By inhibiting

STAT activation using JSI-124, we were able to see a decrease in mRNAs encoding

Pgrmc1 and IFIT3. In the case of IFIT3, this was a predicted result as IFIT3 has been shown to be increased coordinately with JAK/STAT signaling (Darnell, 1998). The observed increase in Nr4a1 may be a compensatory rise in response to declining

Pgrmc1 levels. The observed decreases in levels of Pgrmc1 mRNA suggest that

Pgrmc1 levels and STAT signaling are coordinately regulated and useful indicators of cell proliferation in vitro. Indeed, this idea may be more relevant for actively-dividing

cells rather than for post-mitotic neurons.

Although STAT3 signaling correlates to cell proliferation, STAT3 signaling is

integral to a host of physiological effects depending on the tissue. Importantly, neural

STAT3 signaling is important for mediating leptin actions in hypothalamic nuclei to

control body weight (Hubschle et al., 2001). Thus, our findings of high Pgrmc1 and

STAT3 ISHH signal in the paraventricular nucleus may reflect a role in regulating basal

responses to leptin. The overlap of these with Nr4a1 expression is also interesting as

Nr4a1 is induced by stress. Taken together, the role of Pgrmc1 appears to be important

108

for restraining STAT activity, and may be relevant to STAT signaling in the brain, though this possibility must be tempered by future research.

In conclusion, neural expression of Pgrmc1 may be relevant for a host of cell processes, including regulation of STAT pathway activation and the expression of several gene targets. Indeed, our present work contributes to a growing body of evidence that STAT3 pathways are tightly regulated by many diverse cellular factors.

Extensive work in the field of JAK/STAT signaling shows that STAT3 signaling is also constrained by a large family of diverse proteins (Lufei et al., 2003; Zhange et al., 2003;

Wormald and Hilton, 2004). Our findings suggest novel cross-talk signaling between

Pgrmc1 and STAT3 signaling and suggest that novel gene targets, including Spna1,

Tgm2, Nr4a1, and IFIT3, may be important Pgrmc1 targets in mitotic neurons. Given the relevance of STAT signaling in the paraventricular nucleus, a brain region in which we identified high levels of Pgrmc1 and Nr4a1, a potential role of Pgrmc1 may also be implicated involving stress and body weight homeostasis.

109

5.6.1: Primers Used in QPCR Studies

NCBI Gene Antisense Amplicon Name and Primer sequences 5’- 3’ to bases (bp) Refseq ID

Actb GGCTGTATTCCGCCTCCATCG 163 – 182 154 NM_007393 CCAGTTGGTAACAATGCCATG 316 – 296

Pgrmc1 TCCATGTCTGCATGTGGACACTCT 1247 – 1270 198 NM_016783 ACCTGTTCCTGCCCTGTAATTCCT 1444 – 1421

110

5.6.2: Sequences for Oligodeoxynucleotidyl Probes Used in ISHH Studies

Anti- NCBI sense Gene and Oligodeoxynucleotide Sequences 5’- 3’ to Refseq ID bases

1070- Pgrmc1 TGGGCTTGTTTTAGAATACAGCATGGCTACACGCTGATCCTTCTTCAT NM_016783 1023

1996- STAT3 TCACAAGGTCGATGATATTGTCTAGCCAGACCCAGAAGGAGAAGCCCT NM_213659 1949

151- Nr4a1 TCGTTGCTGGTGTTCCATATTGAGCTTGAATACAGGGCATCTCCAGCC NM_010444 104

1678- IFIT3 GTGCTCTGTCTGCTTTAAGCTCCATTCCCTACATGATTAGTAATGAGG NM_010501 1631

97- Spna1 TGTCCAGTCCACTTCAAATAGGAATGTCAGAAATGTGAATGTGGCAAA NM_011465 50

3129- Tgm2 TTAGCGACCAGCGTGGATATTTAAGGCTCGTTCTGTGAAATCTAGTCT NM_009373 3082

111

5.6.3: Gene Set Enrichment Analysis

Pathways Identified Using Microarray Data: Scramble versus Pgrmc1 siRNA

Rank Pathway Name p-value

1 IL6R and STAT3 Signaling 0.019 2 Gonadotrope Cell Activation 0.026 3 Urokinase receptor and STAT Signaling 0.040 4 IFNAR and STAT Signaling 0.041 5 CNTFR and STAT3 Signaling 0.045

112

5.7.1 Pgrmc1 siRNA Decreased Levels of Pgrmc1 mRNA and Protein

B C

Figure 5.7.1: Pgrmc1 siRNA Decreased Levels of Pgrmc1 mRNA and Protein. N42 cells transfected with either scramble (control) or Pgrmc1 siRNA had decreased levels of Pgrmc1 mRNA at 16 and 24 h post-transfection as determined by QRTPCR (A). Treatment with Pgrmc1 siRNA for 24 h decreased Pgrmc1 protein as determined by western blot (B) to approximately 50% that of scramble siRNA controls (C). ** p ≤ 0.01.

113

5.7.2 Analyses of Microarray Data

A B

Figure 5.7.2: Analyses of Microarray Data. Heat map representation of a subset of differentially expressed genes in N42 cells following transfection with scramble (control) or Pgrmc1 siRNA (A). Gene Set Enrichment Analysis identified the IL6R and STAT signaling pathway as a candidate pathway affected by Pgrmc1 siRNA transfection relative to scramble (control) (B). Shading of pathway entities indicates the relative gene expression of scramble (control) versus Pgrmc1 siRNA- transfected N42 cells. As illustrated, Pgrmc1 siRNA modestly increased all pathway members relative to scramble siRNA.

114

5.7.3 Validation of Microarray Findings by QPCR

Figure 5.7.3: Pgrmc1 co-regulates multiple gene targets in a P 4-independent manner. N42 cells transfected with scramble (control) or Pgrmc1 siRNA were treated with vehicle control (Veh) or 10 nM P 4. Pgrmc1 siRNA transfection depleted Pgrmc1 mRNA levels to 50% that of controls (A). Pgrmc1 co-regulated mRNA levels of Tgm2 (B) and Spna1 (C). Pgrmc1 depletion increased levels of Nr4a1 (D) and IFIT3 (E) in a P 4-independent manner. *** = p ≤ 0.001

115

5.7.4 Pgrmc1 Construct Transfection Increased Pgrmc1 Expression

Figure 5.7.4: QPCR was used to determine relative levels of mRNA in N42 cells transfected with empty vector (control) or Pgrmc1 construct. Pgrmc1 mRNA (A) and protein (B) levels were increased by transfection with a Pgrmc1 construct compared to controls. * = p ≤ 0.05. Pgrmc1 co-regulated mRNA levels of Tgm2 (C) and Spna1 (D). Pgrmc1 overexpression decreased levels of Nr4a1 (E) but had no effect on levels of mRNA encoding IfitT3 (F). * = p≤ .05; ** = p≤ .01; *** = p≤ .001.

116

5.7.5 Pgrmc1 Depletion Stimulates STAT3 Activation

Figure 5.7.5: Depletion of Pgrmc1 increased STAT3 activation. (A) N42 cells were cotransfected with a STAT3-luciferase reporter and either scramble (white bar) or Pgrmc1 (black bar) siRNA for 24 h prior to assaying luciferase activities. The STAT3 construct contained multiple STAT3-responsive elements upstream of luciferase and an internal Renilla reporter for normalization, and relative luciferase activity of cell lysates is shown. ** = p ≤ 0.01.

117

5.7.6 Inhibition of JAK/STAT in N42 Cells

Figure 5.7.6: Effects of JAK/STAT Inhibition for 8 h. N42 cells exposed to varying doses of JSI-124 exhibit cell rounding and cell death as determined by phenotypic and trypan blue exclusion assays (A). Exposure to 10 nM JSI-124 for 8 h reduced levels of Pgrmc1 mRNA (B), had no effect on levels of mRNA encoding Tgm2 (C) or Spna1 (D), modestly increased Nr4a1 mRNA levels (E), and reduced IFIT3 mRNA levels (F). * = p≤ .05; ** = p≤ .01; *** = p≤ .001. 118

5.7.7 Localization of Pgrmc1, Nr4a1 and STAT3 mRNA in Mouse Brain

Figure 5.7.7: Film autoradiograms of sections hybridized to 33 P-labeled oligodeoxynucleotidyl probes for Pgrmc1, Nr4a1 and STAT3. Representative sections hybridized to sense strand probes are shown in the row one (A, B and C), and antisense probes were used all other sections shown. Black arrows show high signal intensities in the paraventricular nucleus for Pgrmc1 (M), Nr4a1 (N) and STAT3 (O) and the hippocampus for Pgrmc1 (P), Nr4a1 (Q) and STAT3 (R). Scale bar = 350 µm .

119

5.7.8 Cell-specific Nr4a1 ISHH Signal in the Paraventricular Nucleus

Figure 5.7.8: Cell-specific Nr4a1 ISHH Signal in the Paraventricular Nucleus. Nr4a1 ISHH signal is highly specific for cells of the paraventricular nucleus as indicated by silver grains ( 33 P-labeled oligodeoxynucleotidyl probes antisense for Nr4a1). The black arrows indicate silver grain signal. Scale bar = 30 µm; 3V = Third ventricle.

120

5.8 References

Akesson TR, Simerly RB, Micevych PE (1988) Estrogen-concentrating hypothalamic and limbic neurons project to the medial preoptic nucleus. Brain Res 451:381- 385.

Allen WM, Wintersteiner O (1934) Crystalline progestin. Science 80:1990-1991.

Ashley RL, Arreguin-Arevalo JA, Nett TM (2009) Binding characteristics of the ovine membrane progesterone receptor alpha and expression of the receptor during the estrous cycle. Reprod Biol Endocrinol 7:42.

Bailey CD, Graham RM, Nanda N, Davies PJ, Johnson GV (2004) Validity of mouse models for the study of tissue transglutaminase in neurodegenerative diseases. Mol Cell Neurosci 25:493-503.

Banks JA, Freeman ME (1978) The temporal requirement of progesterone on proestrus for extinction of the estrogen-induced daily signal controlling luteinizing hormone release in the rat. Endocrinology 102:426-432.

Barker S, Laird SM, Ho MM, Vinson GP, Hinson JP (1992) Characterization of a rat adrenocortical inner zone-specific antigen and identification of its putative precursor. J Mol Endocrinol 9:95-102.

Bayaa M, Booth RA, Sheng Y, Liu XJ (2000) The classical progesterone receptor mediates Xenopus oocyte maturation through a nongenomic mechanism. Proc Natl Acad Sci U S A 97:12607-12612.

Beck KA, Nelson WJ (1996) The spectrin-based membrane skeleton as a membrane protein-sorting machine. Am J Physiol 270:C1263-1270.

Berman KF, Schmidt PJ, Rubinow DR, Danaceau MA, Van Horn JD, Esposito G, Ostrem JL, Weinberger DR (1997) Modulation of cognition-specific cortical activity by gonadal steroids: a positron-emission tomography study in women. Proc Natl Acad Sci U S A 94:8836-8841.

121

Betz AL, Coester HC (1990a) Effect of steroid therapy on ischaemic brain oedema and blood to brain sodium transport. Acta Neurochir Suppl (Wien) 51:256-258.

Betz AL, Coester HC (1990b) Effect of steroids on edema and sodium uptake of the brain during focal ischemia in rats. Stroke 21:1199-1204.

Beyer C, Gonzalez-Mariscal G, Eguibar JR, Gomora P (1988) Lordosis facilitation in estrogen primed rats by intrabrain injection of pregnanes. Pharmacol Biochem Behav 31:919-926.

Blaskovich MA, Sun J, Cantor A, Turkson J, Jove R, Sebti SM (2003) Discovery of JSI-124 (cucurbitacin I), a selective Janus kinase/signal transducer and activator of transcription 3 signaling pathway inhibitor with potent antitumor activity against human and murine cancer cells in mice. Cancer Res 63:1270-1279.

Brazil DP, Hemmings BA (2001) Ten years of protein kinase B signalling: a hard Akt to follow. Trends Biochem Sci 26:657-664.

Buddhikot M, Falkenstein E, Wehling M, Meizel S (1999) Recognition of a human sperm surface protein involved in the progesterone-initiated acrosome reaction by antisera against an endomembrane progesterone binding protein from porcine liver. Mol Cell Endocrinol 158:187-193.

Cahill MA (2007) Progesterone receptor membrane component 1: an integrative review. J Steroid Biochem Mol Biol 105:16-36.

Cai Z, Stocco C (2005) Expression and regulation of progestin membrane receptors in the rat corpus luteum. Endocrinology 146:5522-5532.

Chan FK, Chen A, Winoto A (1998a) Thymic expression of the transcription factor Nur77 rescues the T cell but not the B cell abnormality of gld/gld mice. J Immunol 161:4252-4256. 122

Chan JR, Phillips LJ, 2nd, Glaser M (1998b) Glucocorticoids and progestins signal the initiation and enhance the rate of myelin formation. Proc Natl Acad Sci U S A 95:10459-10464.

Chappell PE, Lee J, Levine JE (2000) Stimulation of gonadotropin-releasing hormone surges by estrogen. II. Role of cyclic adenosine 3'5'-monophosphate. Endocrinology 141:1486-1492.

Chappell PE, Levine JE (2000) Stimulation of gonadotropin-releasing hormone surges by estrogen. I. Role of hypothalamic progesterone receptors. Endocrinology 141:1477-1485.

Chintharlapalli S, Burghardt R, Papineni S, Ramaiah S, Yoon K, Safe S (2005) Activation of Nur77 by selected 1,1-Bis(3'-indolyl)-1-(p-substituted phenyl)methanes induces apoptosis through nuclear pathways. J Biol Chem 280:24903-24914.

Christian CA, Mobley JL, Moenter SM (2005) Diurnal and estradiol-dependent changes in gonadotropin-releasing hormone neuron firing activity. Proc Natl Acad Sci U S A 102:15682-15687.

Clark MB, Ma Y, Bloom ML, Barker JE, Zagon IS, Zimmer WE, Goodman SR (1994) Brain alpha erythroid spectrin: identification, compartmentalization, and beta spectrin associations. Brain Res 663:223-236.

Corpechot C, Robel P, Axelson M, Sjovall J, Baulieu EE (1981) Characterization and measurement of dehydroepiandrosterone sulfate in rat brain. Proc Natl Acad Sci U S A 78:4704-4707.

Corpechot C, Synguelakis M, Talha S, Axelson M, Sjovall J, Vihko R, Baulieu EE, Robel P (1983) Pregnenolone and its sulfate ester in the rat brain. Brain Res 270:119-125.

Craven RJ (2008) PGRMC1: a new biomarker for the estrogen receptor in breast cancer. Breast Cancer Res 10:113.

Crivello JF, Jefcoate CR (1980) Intracellular movement of cholesterol in rat adrenal cells. Kinetics and effects of inhibitors. J Biol Chem 255:8144-8151.

Curran-Rauhut MA, Petersen SL (2002) The distribution of progestin receptor mRNA in rat brainstem. Brain Res Gene Expr Patterns 1:151-157.

Darnell JE, Jr. (1998) Studies of IFN-induced transcriptional activation uncover the Jak- Stat pathway. J Interferon Cytokine Res 18:549-554.

123

de la Iglesia HO, Blaustein JD, Bittman EL (1995) The suprachiasmatic area in the female hamster projects to neurons containing estrogen receptors and GnRH. Neuroreport 6:1715-1722.

Denef C, Magnus C, McEwen BS (1973) Sex differences and hormonal control of testosterone metabolism in rat pituitary and brain. J Endocrinol 59:605-621.

DePaolo LV (1988) Attenuation of preovulatory gonadotrophin surges by epostane: a new inhibitor of 3 beta-hydroxysteroid dehydrogenase. J Endocrinol 118:59-68.

Edwards DP, Wardell SE, Boonyaratanakornkit V (2002) Progesterone receptor interacting coregulatory proteins and cross talk with cell signaling pathways. J Steroid Biochem Mol Biol 83:173-186.

Estrada-Camarena E, Contreras CM, Saavedra M, Luna-Baltazar I, Lopez-Rubalcava C (2002) Participation of the lateral septal nuclei (LSN) in the antidepressant-like actions of progesterone in the forced swimming test (FST). Behav Brain Res 134:175-183.

Evans RM (1988) The steroid and thyroid hormone receptor superfamily. Science 240:889-895.

Everett JW (1948) Progesterone and estrogen in the experimental control of ovulation time and other features of the estrous cycle in the rat. Endocrinology 43:389- 405.

Falkenstein E, Heck M, Gerdes D, Grube D, Christ M, Weigel M, Buddhikot M, Meizel S, Wehling M (1999) Specific progesterone binding to a membrane protein and related nongenomic effects on Ca2+-fluxes in sperm. Endocrinology 140:5999- 6002.

Fernandes MS, Brosens JJ, Gellersen B (2008) Honey, we need to talk about the membrane progestin receptors. Steroids 73:942-952.

Fishman J, Norton BI, Krey L (1980) 2-Hydroxylation of estrogens in the brain participates in the initiation of the preovulatory LH surge in the rat. Biochem Biophys Res Commun 93:471-477.

124

Frye CA, Paris JJ, Rhodes ME (2007) Engaging in paced mating, but neither exploratory, anti-anxiety, nor social behavior, increases 5alpha-reduced progestin concentrations in midbrain, hippocampus, striatum, and cortex. Reproduction 133:663-674.

Frye CA, Sumida K, Lydon JP, O'Malley BW, Pfaff DW (2006) Mid-aged and aged wild-type and progestin receptor knockout (PRKO) mice demonstrate rapid progesterone and 3alpha,5alpha-THP-facilitated lordosis. Psychopharmacology (Berl) 185:423-432.

Frye CA, Vongher JM (1999) Progesterone has rapid and membrane effects in the facilitation of female mouse sexual behavior. Brain Res 815:259-269.

Frye CA, Vongher JM (2001) Progesterone and 3alpha,5alpha-THP enhance sexual receptivity in mice. Behav Neurosci 115:1118-1128.

Fukada T, Ohtani T, Yoshida Y, Shirogane T, Nishida K, Nakajima K, Hibi M, Hirano T (1998) STAT3 orchestrates contradictory signals in cytokine-induced G1 to S cell-cycle transition. EMBO J 17:6670-6677.

Giachino C, Galbiati M, Fasolo A, Peretto P, Melcangi R (2003) Neurogenesis in the subependymal layer of the adult rat: a role for neuroactive derivatives of progesterone. Ann N Y Acad Sci 1007:335-339.

Gibson CL, Gray LJ, Bath PM, Murphy SP (2008) Progesterone for the treatment of experimental brain injury; a systematic review. Brain 131:318-328.

Gilad GM, Varon LE (1985) Transglutaminase activity in rat brain: characterization, distribution, and changes with age. J Neurochem 45:1522-1526.

Gilad GM, Varon LE, Gilad VH (1985) Calcium-dependent transglutaminase of rat sympathetic ganglion in development and after nerve injury. J Neurochem 44:1385-1390.

Goldstein JL, DeBose-Boyd RA, Brown MS (2006) Protein sensors for membrane sterols. Cell 124:35-46.

Goodman RL, Bittman EL, Foster DL, Karsch FJ (1981) The endocrine basis of the synergistic suppression of luteinizing hormone by estradiol and progesterone. Endocrinology 109:1414-1417.

Gorski RA (1974) The neuroendocrine regulation of sexual behavior. Adv Psychobiol 2:1-58.

125

Guo Q, Sayeed I, Baronne LM, Hoffman SW, Guennoun R, Stein DG (2006) Progesterone administration modulates AQP4 expression and edema after traumatic brain injury in male rats. Exp Neurol 198:469-478.

Han SK, Abraham IM, Herbison AE (2002) Effect of GABA on GnRH neurons switches from depolarization to hyperpolarization at puberty in the female mouse. Endocrinology 143:1459-1466.

Hand RA, Craven RJ (2003) Hpr6.6 protein mediates cell death from oxidative damage in MCF-7 human breast cancer cells. J Cell Biochem 90:534-547.

Hanna R, Pang Y, Thomas P, Zhu Y (2006) Cell-surface expression, progestin binding, and rapid nongenomic signaling of zebrafish membrane progestin receptors alpha and beta in transfected cells. J Endocrinol 190:247-260.

He J, Evans CO, Hoffman SW, Oyesiku NM, Stein DG (2004) Progesterone and allopregnanolone reduce inflammatory cytokines after traumatic brain injury. Exp Neurol 189:404-412.

Herbison AE (1998) Multimodal influence of estrogen upon gonadotropin-releasing hormone neurons. Endocr Rev 19:302-330.

126

Hibbert ML, Stouffer RL, Wolf DP, Zelinski-Wooten MB (1996) Midcycle administration of a progesterone synthesis inhibitor prevents ovulation in primates. Proc Natl Acad Sci U S A 93:1897-1901.

Ho MM, Barker S, Vinson GP (1994) Distribution of the adrenocortical inner zone antigen. J Endocrinol 141:459-466.

Hoshina Y, Takeo T, Nakano K, Sato T, Sakuma Y (1994) Axon-sparing lesion of the preoptic area enhances receptivity and diminishes proceptivity among components of female rat sexual behavior. Behav Brain Res 61:197-204.

Hubschle T, Thom E, Watson A, Roth J, Klaus S, Meyerhof W (2001) Leptin-induced nuclear translocation of STAT3 immunoreactivity in hypothalamic nuclei involved in body weight regulation. J Neurosci 21:2413-2424.

Hughes AL, Powell DW, Bard M, Eckstein J, Barbuch R, Link AJ, Espenshade PJ (2007) Dap1/PGRMC1 binds and regulates cytochrome P450 enzymes. Cell Metab 5:143-149.

Hwang JY, Duncan RS, Madry C, Singh M, Koulen P (2009) Progesterone potentiates calcium release through IP3 receptors by an Akt-mediated mechanism in hippocampal neurons. Cell Calcium 45:233-242.

Intlekofer KA, Petersen SL (2010) Distribution of mRNAs encoding classical progestin receptor, progesterone membrane components 1 and 2, serpine mRNA binding protein 1, and progestin and ADIPOQ receptor family members 7 and 8 in rat forebrain. Neuroscience.

Iwamori M, Moser HW, Kishimoto Y (1976) Cholesterol sulfate in rat tissues. Tissue distribution, developmental change and brain subcellular localization. Biochim Biophys Acta 441:268-279.

127

Jaffe RB (1969) Testosterone metabolism in target tissues. Hypothalamic and pituitary tissues of the adult rat and human fetus, and the immature rat epiphysis. Steroids 14:483-498.

Janiak A, Zemskov EA, Belkin AM (2006) Cell surface transglutaminase promotes RhoA activation via integrin clustering and suppression of the Src- p190RhoGAP signaling pathway. Mol Biol Cell 17:1606-1619.

Jefcoate CR, DiBartolomeis MJ, Williams CA, McNamara BC (1987) ACTH regulation of cholesterol movement in isolated adrenal cells. J Steroid Biochem 27:721- 729.

Kandel ES, Hay N (1999) The regulation and activities of the multifunctional serine/threonine kinase Akt/PKB. Exp Cell Res 253:210-229.

Karri S, Dertien JS, Stocco DM, Syapin PJ (2007) Steroidogenic acute regulatory protein expression and pregnenolone synthesis in rat astrocyte cultures. J Neuroendocrinol 19:860-869.

Kaur P, Jodhka PK, Underwood WA, Bowles CA, de Fiebre NC, de Fiebre CM, Singh M (2007) Progesterone increases brain-derived neuroptrophic factor expression and protects against glutamate toxicity in a mitogen-activated protein kinase- and phosphoinositide-3 kinase-dependent manner in cerebral cortical explants. J Neurosci Res 85:2441-2449.

Ke FC, Ramirez VD (1987) Membrane mechanism mediates progesterone stimulatory effect on LHRH release from superfused rat hypothalami in vitro. Neuroendocrinology 45:514-517. 128

Ke FC, Ramirez VD (1990) Binding of progesterone to nerve cell membranes of rat brain using progesterone conjugated to 125I-bovine serum albumin as a ligand. J Neurochem 54:467-472.

Knapstein P, David A, Wu CH, Archer DF, Flickinger GL, Tochstone JC (1968) Metabolism of free and sulfoconjugated DHEA in brain tissue in vivo and in vitro. Steroids 11:885-896.

Kokate TG, Svensson BE, Rogawski MA (1994) Anticonvulsant activity of neurosteroids: correlation with gamma-aminobutyric acid-evoked chloride current potentiation. J Pharmacol Exp Ther 270:1223-1229.

Krebs KE, Prouty SM, Zagon IS, Goodman SR (1987) Structural and functional relationship of red blood cell protein 4.1 to synapsin I. Am J Physiol 253:C500- 505.

Krey LC, Tyrey L, Everett JW (1973) The estrogen-induced advance in the cyclic LH surge in the rat: dependency on ovarian progesterone secretion. Endocrinology 93:385-390.

Kubli-Garfias C, Whalen RE (1977) Induction of lordosis behavior in female rats by intravenous administration of progestins. Horm Behav 9:380-386.

Labombarda F, Gonzalez SL, Deniselle MC, Vinson GP, Schumacher M, De Nicola AF, Guennoun R (2003) Effects of injury and progesterone treatment on progesterone receptor and progesterone binding protein 25-Dx expression in the rat spinal cord. J Neurochem 87:902-913.

Laird SM, Vinson GP, Whitehouse BJ (1988) Monoclonal antibodies against rat adrenocortical cell antigens. Acta Endocrinol (Copenh) 119:420-426.

129

Levine JE, Ramirez VD (1980) In vivo release of luteinizing hormone-releasing hormone estimated with push-pull cannulae from the mediobasal hypothalami of ovariectomized, steroid-primed rats. Endocrinology 107:1782-1790.

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real- time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402- 408.

Lorand L, Graham RM (2003) Transglutaminases: crosslinking enzymes with pleiotropic functions. Nat Rev Mol Cell Biol 4:140-156.

Losel RM, Falkenstein E, Feuring M, Schultz A, Tillmann HC, Rossol-Haseroth K, Wehling M (2003) Nongenomic steroid action: controversies, questions, and answers. Physiol Rev 83:965-1016.

Majewska MD, Harrison NL, Schwartz RD, Barker JL, Paul SM (1986) Steroid hormone metabolites are barbiturate-like modulators of the GABA receptor. Science 232:1004-1007.

Mani SK, Allen JM, Clark JH, Blaustein JD, O'Malley BW (1994a) Convergent pathways for steroid hormone- and neurotransmitter-induced rat sexual behavior. Science 265:1246-1249.

Mani SK, Blaustein JD, Allen JM, Law SW, O'Malley BW, Clark JH (1994b) Inhibition of rat sexual behavior by antisense oligonucleotides to the progesterone receptor. Endocrinology 135:1409-1414.

Meyerson B (1972) Latency between intravenous injection of progestins and the appearance of estrous behavior in estrogen-treated ovariectomized rats. Horm Behav 3:1-9.

Micevych P, Sinchak K (2008) Synthesis and function of hypothalamic neuroprogesterone in reproduction. Endocrinology 149:2739-2742. 130

Micevych PE, Chaban V, Ogi J, Dewing P, Lu JK, Sinchak K (2007) Estradiol stimulates progesterone synthesis in hypothalamic astrocyte cultures. Endocrinology 148:782-789.

Mifsud W, Bateman A (2002) Membrane-bound progesterone receptors contain a cytochrome b5-like ligand-binding domain. Genome Biol 3:RESEARCH0068.

Mishell BB, Shiigi SM (1980) Selected Methods in Cellular Immunology. Freeman and Co San Franscisco:16-19.

Mulac-Jericevic B, Lydon JP, DeMayo FJ, Conneely OM (2003) Defective mammary gland morphogenesis in mice lacking the progesterone receptor B isoform. Proc Natl Acad Sci U S A 100:9744-9749.

Mulac-Jericevic B, Mullinax RA, DeMayo FJ, Lydon JP, Conneely OM (2000) Subgroup of reproductive functions of progesterone mediated by progesterone receptor-B isoform. Science 289:1751-1754.

131

Nakajima K, Yamanaka Y, Nakae K, Kojima H, Ichiba M, Kiuchi N, Kitaoka T, Fukada T, Hibi M, Hirano T (1996) A central role for Stat3 in IL-6-induced regulation of growth and differentiation in M1 leukemia cells. EMBO J 15:3651-3658.

Niswender GD (2002) Molecular control of luteal secretion of progesterone. Reproduction 123:333-339.

Nolte I, Jeckel D, Wieland FT, Sohn K (2000) Localization and topology of ratp28, a member of a novel family of putative steroid-binding proteins. Biochim Biophys Acta 1543:123-130.

O'Connor CA, Cernak I, Johnson F, Vink R (2007) Effects of progesterone on neurologic and morphologic outcome following diffuse traumatic brain injury in rats. Exp Neurol 205:145-153.

Ottem EN, Godwin JG, Krishnan S, Petersen SL (2004) Dual-phenotype GABA/glutamate neurons in adult preoptic area: sexual dimorphism and function. J Neurosci 24:8097-8105.

Park OK, Ramirez VD (1987) Circulating blood progesterone is pulsatile throughout the rat oestrous cycle. Acta Endocrinol (Copenh) 116:121-128.

Parkes D, Rivest S, Lee S, Rivier C, Vale W (1993) Corticotropin-releasing factor activates c-fos, NGFI-B, and corticotropin-releasing factor gene expression within the paraventricular nucleus of the rat hypothalamus. Mol Endocrinol 7:1357-1367.

Parsons B, Rainbow TC, MacLusky NJ, McEwen BS (1982) Progestin receptor levels in rat hypothalamic and limbic nuclei. J Neurosci 2:1446-1452.

Paxinos G, Watson C (1982) The Rat Brain in Stereotaxic Coordinates. New York.

Peluso JJ, Fernandez G, Pappalardo A, White BA (2001) Characterization of a putative membrane receptor for progesterone in rat granulosa cells. Biol Reprod 65:94- 101.

132

Peluso JJ, Liu X, Gawkowska A, Lodde V, Wu CA (2010) Progesterone inhibits apoptosis in part by PGRMC1-regulated gene expression. Mol Cell Endocrinol 320:153-161.

Peluso JJ, Liu X, Romak J (2007) Progesterone maintains basal intracellular adenosine triphosphate levels and viability of spontaneously immortalized granulosa cells by promoting an interaction between 14-3-3sigma and ATP synthase beta/precursor through a protein kinase G-dependent mechanism. Endocrinology 148:2037-2044.

Pesold C, Treit D (1992) Excitotoxic lesions of the septum produce anxiolytic effects in the elevated plus-maze and the shock-probe burying tests. Physiol Behav 52:37- 47.

Petersen SL, LaFlamme KD (1997) Progesterone increases levels of mu-opioid receptor mRNA in the preoptic area and arcuate nucleus of ovariectomized, estradiol- treated female rats. Brain Res Mol Brain Res 52:32-37.

133

Petersen SL, Ottem EN, Carpenter CD (2003) Direct and indirect regulation of gonadotropin-releasing hormone neurons by estradiol. Biol Reprod 69:1771- 1778.

Pettus EH, Wright DW, Stein DG, Hoffman SW (2005) Progesterone treatment inhibits the inflammatory agents that accompany traumatic brain injury. Brain Res 1049:112-119.

Pfaff DW, Sakuma Y (1979) Facilitation of the lordosis reflex of female rats from the ventromedial nucleus of the hypothalamus. J Physiol 288:189-202.

Pfaff DW, Schwartz-Giblin S, McCarthy MM, Kow LM (1994) Cellular and molecular mechanisms of female reproductive behaviors. In: The physiology of reproduction. Knobil E, Neil E, eds:pp 107-220.

Pollio G, Xue P, Zanisi M, Nicolin A, Maggi A (1993) Antisense oligonucleotide blocks progesterone-induced lordosis behavior in ovariectomized rats. Brain Res Mol Brain Res 19:135-139.

Richter TA, Robinson JE, Lozano JM, Evans NP (2005) Progesterone can block the preovulatory gonadotropin-releasing hormone/luteinising hormone surge in the ewe by a direct inhibitory action on oestradiol-responsive cells within the hypothalamus. J Neuroendocrinol 17:161-169.

Robert F, Guennoun R, Desarnaud F, Do-Thi A, Benmessahel Y, Baulieu EE, Schumacher M (2001) Synthesis of progesterone in Schwann cells: regulation by sensory neurons. Eur J Neurosci 13:916-924.

134

Rosie R, Thomson E, Fink G (1990) Oestrogen positive feedback stimulates the synthesis of LHRH mRNA in neurones of the rostral diencephalon of the rat. J Endocrinol 124:285-289.

Rothfeld J, Hejtmancik JF, Conn PM, Pfaff DW (1989) In situ hybridization for LHRH mRNA following estrogen treatment. Brain Res Mol Brain Res 6:121-125.

Rubin BS, Barfield RJ (1983) Progesterone in the ventromedial hypothalamus facilitates estrous behavior in ovariectomized, estrogen-primed rats. Endocrinology 113:797-804.

Runko E, Kaprielian Z (2002) Expression of Vema in the developing mouse spinal cord and optic chiasm. J Comp Neurol 451:289-299.

Runko E, Kaprielian Z (2004) Caenorhabditis elegans VEM-1, a novel membrane protein, regulates the guidance of ventral nerve cord-associated axons. J Neurosci 24:9015-9026.

Runko E, Wideman C, Kaprielian Z (1999) Cloning and expression of VEMA: a novel ventral midline antigen in the rat CNS. Mol Cell Neurosci 14:428-443.

Sakamoto H, Ukena K, Tsutsui K (2001) Effects of progesterone synthesized de novo in the developing Purkinje cell on its dendritic growth and synaptogenesis. J Neurosci 21:6221-6232. 135

Sandstrom NJ, Williams CL (2001) Memory retention is modulated by acute estradiol and progesterone replacement. Behav Neurosci 115:384-393.

Saper CB, Swanson LW, Cowan WM (1976) The efferent connections of the ventromedial nucleus of the hypothalamus of the rat. J Comp Neurol 169:409- 442.

Schuetz AW (1977) Induction of oocytic maturation and differentiation: mode of progesterone action. Ann N Y Acad Sci 286:408-420.

Schumacher M, Coirini H, Pfaff DW, McEwen BS (1990) Behavioral effects of progesterone associated with rapid modulation of oxytocin receptors. Science 250:691-694.

Shi X, Franko B, Frantz C, Amin HM, Lai R (2006) JSI-124 (cucurbitacin I) inhibits Janus kinase-3/signal transducer and activator of transcription-3 signalling, downregulates nucleophosmin-anaplastic lymphoma kinase (ALK), and induces apoptosis in ALK-positive anaplastic large cell lymphoma cells. Br J Haematol 135:26-32.

Sholiton LJ, Werk EE (1969) The less-polar metabolites produced by incubation of testosterone-4-14C with rat and bovine brain. Acta Endocrinol (Copenh) 61:641- 648.

Shughrue PJ, Bushnell CD, Dorsa DM (1992) Estrogen receptor messenger ribonucleic acid in female rat brain during the estrous cycle: a comparison with ovariectomized females and intact males. Endocrinology 131:381-388.

136

Sikorski AF, Terlecki G, Zagon IS, Goodman SR (1991) Synapsin I-mediated interaction of brain spectrin with synaptic vesicles. J Cell Biol 114:313-318.

Simerly RB, Chang C, Muramatsu M, Swanson LW (1990) Distribution of androgen and estrogen receptor mRNA-containing cells in the rat brain: an in situ hybridization study. J Comp Neurol 294:76-95.

Sinchak K, Mills RH, Tao L, LaPolt P, Lu JK, Micevych P (2003) Estrogen induces de novo progesterone synthesis in astrocytes. Dev Neurosci 25:343-348.

Singh M (2001) Ovarian hormones elicit phosphorylation of Akt and extracellular- signal regulated kinase in explants of the cerebral cortex. Endocrine 14:407-415.

Snyder BW, Beecham GD, Schane HP (1984) Inhibition of ovulation in rats with epostane, an inhibitor of 3 beta-hydroxysteroid dehydrogenase. Proc Soc Exp Biol Med 176:238-242.

Stawowczyk M, Van Scoy S, Kumar KP, Reich NC (2010) The interferon stimulated gene 54 promotes apoptosis. J Biol Chem.

Suchanek M, Radzikowska A, Thiele C (2005) Photo-leucine and photo-methionine allow identification of protein-protein interactions in living cells. Nat Methods 2:261-267.

Sun J, Blaskovich MA, Jove R, Livingston SK, Coppola D, Sebti SM (2005) Cucurbitacin Q: a selective STAT3 activation inhibitor with potent antitumor activity. Oncogene 24:3236-3245.

137

Swanson LW (1998) Brain maps: structure of the rat brain: a laboratory guide with printed and electronic templates for data, models, and schematics. Elsevier Second edition.

Tolentino PJ, DeFord SM, Notterpek L, Glenn CC, Pike BR, Wang KK, Hayes RL (2002) Up-regulation of tissue-type transglutaminase after traumatic brain injury. J Neurochem 80:579-588.

Truss M, Beato M (1993) Steroid hormone receptors: interaction with deoxyribonucleic acid and transcription factors. Endocr Rev 14:459-479.

Ukena K, Kohchi C, Tsutsui K (1999) Expression and activity of 3beta-hydroxysteroid dehydrogenase/delta5-delta4-isomerase in the rat Purkinje neuron during neonatal life. Endocrinology 140:805-813.

Ukena K, Usui M, Kohchi C, Tsutsui K (1998) Cytochrome P450 side-chain cleavage enzyme in the cerebellar Purkinje neuron and its neonatal change in rats. Endocrinology 139:137-147.

Wacher C, Muller M, Hofer MJ, Getts DR, Zabaras R, Ousman SS, Terenzi F, Sen GC, King NJ, Campbell IL (2007) Coordinated regulation and widespread cellular expression of interferon-stimulated genes (ISG) ISG-49, ISG-54, and ISG-56 in the central nervous system after infection with distinct viruses. J Virol 81:860- 871.

Wahl M, Schilling L, Unterberg A, Baethmann A (1993) Mediators of vascular and parenchymal mechanisms in secondary brain damage. Acta Neurochir Suppl (Wien) 57:64-72.

Wang J, Campbell IL (2005) Innate STAT1-dependent genomic response of neurons to the antiviral cytokine alpha interferon. J Virol 79:8295-8302.

Watts AG, Swanson LW (1987) Efferent projections of the suprachiasmatic nucleus: II. Studies using retrograde transport of fluorescent dyes and simultaneous peptide immunohistochemistry in the rat. J Comp Neurol 258:230-252.

Whalen RE (1974) Estrogen-progesterone induction of mating in female rats. Horm Behav 5:157-162.

138

Wise PM, Camp-Grossman P, Barraclough CA (1981) Effects of estradiol and progesterone on plasma gonadotropins, prolactin, and LHRH in specific brain areas of ovariectomized rats. Biol Reprod 24:820-830.

Zhang L, Kanda Y, Roberts DJ, Ecker JL, Losel R, Wehling M, Peluso JJ, Pru JK (2008) Expression of progesterone receptor membrane component 1 and its partner serpine 1 mRNA binding protein in uterine and placental tissues of the mouse and human. Mol Cell Endocrinol 287:81-89.

Zhu Y, Bond J, Thomas P (2003a) Identification, classification, and partial characterization of genes in humans and other vertebrates homologous to a fish membrane progestin receptor. Proc Natl Acad Sci U S A 100:2237-2242.

Zhu Y, Rice CD, Pang Y, Pace M, Thomas P (2003b) Cloning, expression, and characterization of a membrane progestin receptor and evidence it is an intermediary in meiotic maturation of fish oocytes. Proc Natl Acad Sci U S A 100:2231-2236.

Zwain IH, Yen SS (1999) Neurosteroidogenesis in astrocytes, oligodendrocytes, and neurons of cerebral cortex of rat brain. Endocrinology 140:3843-3852.

139

CHAPTER 6

CONCLUDING REMARKS

6.1 Main Findings Concerning the Neural Roles of Pgrmc1

The series of studies presented herein provide significant new insight into the neural roles of Pgrmc1. According to my working premise, I have identified factors that implicate Pgrmc1 in the context of neural function. As a molecule primarily studied in ovarian cells, Pgrmc1 has now emerged as a P 4 candidate signaling molecule in the brain. As the first to map and compare the anatomical distributions of Pgrmc1,

Pgrmc2, Serbp1, Paqr7 and Paqr8, my findings are consistent with the idea that these signaling molecules may regulate neuroendocrine functions. Moreover, these studies strengthened the concept that Pgrmc1 interacts with Serpb1 in many brain nuclei as they were shown to display strikingly similar distributions through much of the forebrain.

Furthermore, based on the overlapping distributions of the classical Pgr with Pgrmc1, my work provides the first indication that P4 may influence neural functions through multiple signaling molecules.

In further support of reproductive roles of Pgrmc1, I examined the regulation of mRNA levels by ovarian hormones and found that these are regulated in a nuclei- specific manner. As these specific neuroendocrine brain regions control diverse reproductive functions, the finding that Pgrmc1 expression responded to ovarian hormones depending on brain region is consistent with its ability to mediate diverse responses depending on cell type. In further support of important neural functions, the pattern of regulation of binding partners Pgrmc1 and Serbp1 was nearly identical in several nuclei examined, suggesting that they may work together to mediate P 4 effects.

140

Comparisons of gene expression patterns were facilitated by examining the regulation of Paqr7, Paqr8, the classical estrogen receptor α (Esr1) and Pgr. My finding that patterns of regulation for Pgrmc1 and Pgr overlap in some regions suggests that these P4 signaling molecules may act together, but their overlapping distribution were not complete. The presence of Pgrmc1 in Pgr-deficient hypothalamic nuclei may point to an independent role of Pgrmc1 in the neuroendocrine effects of P 4.

Key findings from our studies using dual-label in situ hybridization are the first to show that GABAergic AVPV neurons contain abundant Pgrmc1 and Serbp1. Given the indispensable role of these neurons in the preovulatory LH surge, these findings indicate that Pgrmc1 may be important in the neural control of ovulation. In addition to their presence in GABAergic neurons, Pgrmc1 was specifically found within Serbp1- containing neurons, which emphasizes the likelihood that these molecules function together as part of a P 4 –receptor complex as demonstrated in other cell types.

The cellular roles of Pgrmc1 were investigated using a hypothalamic neural cell line, and my results demonstrated that Pgrmc1 levels dictate the expression of several genes. By validating microarray findings, I found that Pgrmc1 coregulated several novel genes targets, including Tgm2 and Spna1. Given that these genes have important anti-apoptotic actions, it is likely that regulation of these genes is important for cell viability. In light of these data, I propose a critical action of Pgrmc1 in mediating pro- survival functions through transcriptional regulation of levels of several target genes. In further support of this notion, Pgrmc1 levels also had a reciprocal effect on levels of mRNA encoding Nr4a1 and IFIT3, gene targets involved in apoptotic signaling (Liu et al., 1994, Guenterberg et al., 2010). In further pro-survival functions, I found evidence

141

that Pgrmc1 affects basal STAT3 activation levels. Interestingly, STAT inhibition decreased Pgrmc1 levels as well, suggesting cross-talk between Pgrmc1- and STAT3- dependent pathways.

Interestingly, levels of Pgrmc1-coexpressed genes were not sensitive to P 4 in our hypothalamic cell line, demonstrating that Pgrmc1 exerts P 4-independent effects on gene expression. While it is possible that Pgrmc1 exerts these important effects in differentiated neurons, instead Pgrmc1 actions may be different in mitotic cells such as our hypothalamic cell line. Although we found that the paraventricular nucleus contains high levels of Pgrmc1 and specific expression of STAT3 and Nr4a1, the role of the gene targets identified suggests that Pgrmc1 may affect cell viability. Furthermore, this idea could be more relevant in mitotic cells during development than in differentiated adult neurons of the hypothalamus.

These novel insights into Pgrmc1 function expand the potential roles of this signaling molecule, and have raised important possibilities as to Pgrmc1 roles in nuclei that rely upon STAT3 activation for neurobehavioral outcomes. Moreover, by identifying novel gene targets sensitive to Pgrmc1 levels in a neural cell line, this work indicates a P4-independent role of Pgrmc1 that may impact the developing brain.

Taken together, the work presented here links Pgrmc1 to cell signaling cascades and gene targets important for neural function, suggesting that Pgrmc1 may be important for a broad array of pro-survival actions in neurons.

In further support of Pgrmc1 as a pro-survival gene, Pgrmc1 levels are overexpressed by cancerous cells (Rohe et al., 2009, Peluso et al., 2008). In fact,

Pgrmc1 levels have been proposed to promote tumorigenesis (Ahmed et al., 2010) and

142

increases basal activation of I κb (Hand and Craven, 2003), an inhibitor of NF κB signaling tha t regulates cell viability (Baeuerle and Baltimore, 1988). While further studies are warranted to determine the specific cellular mechanisms, Pg rmc1 appears to promote survival in mitotic cells (Peluso et al., 2008). This idea is also supported by my findings that Pgrmc1 regulates novel genes previously found to impact cell viability , includi ng Tgm2, Spna1, Nr4a1 and I FIT3. An illustration including my findings concerning the cellular roles of Pgrmc1 is provided in Figure 6.2.1.

6.1.1 Pgrmc1 Roles in N42 Cells

Figure 6.1.1: Results of studies using N42 cells, a hypothalamic cell line , indicate that Pgrmc1 regulates levels of mRNA encoding Tgm2, Spna1, Nr4a1 and I FIT3. Pgrmc1 inhibited STAT3 activity as determined by experiments using a STAT3 reporter. JSI-124 is a STAT3 inhibitor that prevents phosphory lation of STAT3 pathway members. Treatment of N42 cells with JSI -124 resulted in decreased levels of mRNA encoding Pgrmc1 and I FIT3 (a STAT3-dependent gene). Taken together, these findi ngs suggest potential cross -talk between Pgrmc1 and STAT3 signaling signaling pathways that may culminate in alterations to gene expression.

143

6.2 Future Directions

While the anatomical localization studies and AVPV GABAergic expression of

Pgrmc1 strongly imply a role in reproduction, an understanding of Pgrmc1 function will be greatly aided by the use of specific antagonists. A putative Pgrmc1 ligand known as

AG-205 has been identified using the Arabidopsis thaliana homolog of Pgrmc1

(Yoshitani et al., 2005). This aromatic compound was used in further studies in breast cancer cells, and it appears to bind Pgrmc1 and inhibit cell viability and cell cycle progression in a Pgrmc1-dependent manner (Ahmed et al., 2010). While the specificity of AG-205 to Pgrmc1 requires further validation, this molecule may be used in future studies to investigate the neural role of Pgrmc1.

Additional work using transgenic animals will greatly aid our understanding of

Pgrmc1 function. A role in important aspects of neural development has been suggested by several studies (Sakamoto et al., 2004, Runko et al., 1999), so the use of tissue-specific conditional knockouts may be better suited to investigate the role of

Pgrmc1 in specific neural subpopulations. Despite our findings that GABAergic AVPV neurons express Pgrmc1, this subpopulation is a difficult target due to ubiquitous expression of GABA in many brain regions; therefore, a future possibility may be to target kisspeptin neurons. These neurons are found as a very discrete population in the medial AVPV along the third ventricle, and are critical for the LH surge mechanism in the mouse (Gottsch et al., 2004). Another possibility may be a Pgrmc1 knockout within neurons expressing steroidogenic factor-1, which would deplete Pgrmc1 expression primarily within neurons of the ventromedial nucleus. This idea may be another possibility worthy of future studies, particularly if feminine sex behaviors were

144

examined. Taken together, the characterization, regulation, and specific expression of

Pgrmc1 in neurons important for control of reproduction provides an exciting opportunity for future studies using transgenic mice.

6.3 Closing Remarks

While the neural role of Pgrmc1 remains unclear, the full spectrum of research on this molecule reflects diverse implications of Pgrmc1 function. Based on its expression in a wide range of tissues, Pgrmc1 is likely to be important for a variety of physiological processes. In virtually all cell lines tested, Pgrmc1 exerts pro-survival actions, suggesting that this molecule is required for cell proliferation and viability. As a highly expressed gene in terminally differentiated neurons, Pgrmc1 may exert additional effect such as mediating P 4 signaling or metabolism. The present work also suggests that Pgrmc1 levels may modulate signaling cascades in adult neurons. Thus, the results provided advance our understanding of Pgrmc1 in the context of neural function and yield new potential avenues of study for this molecule.

145

BIBLIOGRAPHY

Ahmed IS, Rohe HJ, Twist KE, Mattingly MN, Craven RJ (2010) Progesterone receptor membrane component 1 (Pgrmc1): a heme-1 domain protein that promotes tumorigenesis and is inhibited by a small molecule. J Pharmacol Exp Ther: 333: 564-573.

Akesson TR, Simerly RB, Micevych PE (1988) Estrogen-concentrating hypothalamic and limbic neurons project to the medial preoptic nucleus. Brain Res 451:381- 385.

Allen WM, Wintersteiner O (1934) Crystalline progestin. Science 80:1990-1991.

Baeuerle PA, Baltimore D (1998) I κB: a specific inhibitor of the NF-κB transcription factor. Science, 242, 540-546.

Bailey CD, Graham RM, Nanda N, Davies PJ, Johnson GV (2004) Validity of mouse models for the study of tissue transglutaminase in neurodegenerative diseases. Mol Cell Neurosci 25:493-503.

Balasubramanian B, Portillo W, Reyna A, Chen JZ, Moore AN, Dash PK, Mani SK (2008) Nonclassical mechanisms of progesterone action in the brain: II. Role of calmodulin-dependent protein kinase II in progesterone-mediated signaling in the hypothalamus of female rats. Endocrinology 149:5518-5526.

146

Bar J, Lahav J, Hod M, Ben-Rafael Z, Weinberger I, Brosens J (2000) Regulation of platelet aggregation and adenosine triphosphate release in vitro by 17beta- estradiol and medroxyprogesterone acetate in postmenopausal women. Thromb Haemost 84:695-700.

Barker S, Laird SM, Ho MM, Vinson GP, Hinson JP (1992) Characterization of a rat adrenocortical inner zone-specific antigen and identification of its putative precursor. J Mol Endocrinol 9:95-102.

Bayaa M, Booth RA, Sheng Y, Liu XJ (2000) The classical progesterone receptor mediates Xenopus oocyte maturation through a nongenomic mechanism. Proc Natl Acad Sci U S A 97:12607-12612.

Beck KA, Nelson WJ (1996) The spectrin-based membrane skeleton as a membrane protein-sorting machine. Am J Physiol 270:C1263-1270.

Betz AL, Coester HC (1990a) Effect of steroid therapy on ischaemic brain oedema and blood to brain sodium transport. Acta Neurochir Suppl (Wien) 51:256-258.

Betz AL, Coester HC (1990b) Effect of steroids on edema and sodium uptake of the brain during focal ischemia in rats. Stroke 21:1199-1204.

Beyer C, Gonzalez-Mariscal G, Eguibar JR, Gomora P (1988) Lordosis facilitation in estrogen primed rats by intrabrain injection of pregnanes. Pharmacol Biochem Behav 31:919-926.

147

Brazil DP, Hemmings BA (2001) Ten years of protein kinase B signalling: a hard Akt to follow. Trends Biochem Sci 26:657-664.

Cahill MA (2007) Progesterone receptor membrane component 1: an integrative review. J Steroid Biochem Mol Biol 105:16-36.

Cai Z, Stocco C (2005) Expression and regulation of progestin membrane receptors in the rat corpus luteum. Endocrinology 146:5522-5532.

Chan FK, Chen A, Winoto A (1998a) Thymic expression of the transcription factor Nur77 rescues the T cell but not the B cell abnormality of gld/gld mice. J Immunol 161:4252-4256.

Chan JR, Phillips LJ, 2nd, Glaser M (1998b) Glucocorticoids and progestins signal the initiation and enhance the rate of myelin formation. Proc Natl Acad Sci U S A 95:10459-10464.

Chappell PE, Lee J, Levine JE (2000) Stimulation of gonadotropin-releasing hormone surges by estrogen. II. Role of cyclic adenosine 3'5'-monophosphate. Endocrinology 141:1486-1492.

Chappell PE, Levine JE (2000) Stimulation of gonadotropin-releasing hormone surges by estrogen. I. Role of hypothalamic progesterone receptors. Endocrinology 141:1477-1485.

148

Christian CA, Mobley JL, Moenter SM (2005) Diurnal and estradiol-dependent changes in gonadotropin-releasing hormone neuron firing activity. Proc Natl Acad Sci U S A 102:15682-15687.

Corpechot C, Robel P, Axelson M, Sjovall J, Baulieu EE (1981) Characterization and measurement of dehydroepiandrosterone sulfate in rat brain. Proc Natl Acad Sci U S A 78:4704-4707.

Corpechot C, Synguelakis M, Talha S, Axelson M, Sjovall J, Vihko R, Baulieu EE, Robel P (1983) Pregnenolone and its sulfate ester in the rat brain. Brain Res 270:119-125.

Correia JN, Conner SJ, Kirkman-Brown JC (2007) Non-genomic steroid actions in human spermatozoa. "Persistent tickling from a laden environment". Semin Reprod Med 25:208-219.

Craven RJ (2008) PGRMC1: a new biomarker for the estrogen receptor in breast cancer. Breast Cancer Res 10:113.

Crudden G, Chitti RE, Craven RJ (2006) Hpr6 (heme-1 domain protein) regulates the susceptibility of cancer cells to chemotherapeutic drugs. J Pharmacol Exp Ther 316:448-455.

Crivello JF, Jefcoate CR (1980) Intracellular movement of cholesterol in rat adrenal cells. Kinetics and effects of inhibitors. J Biol Chem 255:8144-8151.

Curran-Rauhut MA, Petersen SL (2002a) The distribution of progestin receptor mRNA in rat brainstem. Brain Res Gene Expr Patterns 1:151-157.

Curran-Rauhut MA, Petersen SL (2002b) Regulation of glutamic acid decarboxylase 65 and 67 gene expression by ovarian steroids: identification of two functionally distinct populations of GABA neurones in the preoptic area. J Neuroendocrinol 14:310-317.

Darnell JE, Jr. (1998) Studies of IFN-induced transcriptional activation uncover the Jak- Stat pathway. J Interferon Cytokine Res 18:549-554. de la Iglesia HO, Blaustein JD, Bittman EL (1995) The suprachiasmatic area in the female hamster projects to neurons containing estrogen receptors and GnRH. Neuroreport 6:1715-1722.

DeBold JF, Frye CA (1994) Genomic and non-genomic actions of progesterone in the control of female hamster sexual behavior. Horm Behav 28:445-453. 149

Denef C, Magnus C, McEwen BS (1973) Sex differences and hormonal control of testosterone metabolism in rat pituitary and brain. J Endocrinol 59:605-621.

DePaolo LV (1988) Attenuation of preovulatory gonadotrophin surges by epostane: a new inhibitor of 3 beta-hydroxysteroid dehydrogenase. J Endocrinol 118:59-68.

Dugger BN, Morris JA, Jordan CL, Breedlove SM (2007) Androgen receptors are required for full masculinization of the ventromedial hypothalamus (VMH) in rats. Horm Behav 51:195-201.

Edwards DP (2005) Regulation of signal transduction pathways by estrogen and progesterone. Annu Rev Physiol 67:335-376.

Edwards DP, Wardell SE, Boonyaratanakornkit V (2002) Progesterone receptor interacting coregulatory proteins and cross talk with cell signaling pathways. J Steroid Biochem Mol Biol 83:173-186.

Ehring GR, Kerschbaum HH, Eder C, Neben AL, Fanger CM, Khoury RM, Negulescu PA, Cahalan MD (1998) A nongenomic mechanism for progesterone-mediated immunosuppression: inhibition of K+ channels, Ca2+ signaling, and gene expression in T lymphocytes. J Exp Med 188:1593-1602.

Evans RM (1988) The steroid and thyroid hormone receptor superfamily. Science 240:889-895.

Everett JW (1948) Progesterone and estrogen in the experimental control of ovulation time and other features of the estrous cycle in the rat. Endocrinology 43:389- 405.

150

Fernandes MS, Brosens JJ, Gellersen B (2008) Honey, we need to talk about the membrane progestin receptors. Steroids 73:942-952.

Fernandes MS, Pierron V, Michalovich D, Astle S, Thornton S, Peltoketo H, Lam EW, Gellersen B, Huhtaniemi I, Allen J, Brosens JJ (2005) Regulated expression of putative membrane progestin receptor homologues in human endometrium and gestational tissues. J Endocrinol 187:89-101.

Fishman J, Norton BI, Krey L (1980) 2-Hydroxylation of estrogens in the brain participates in the initiation of the preovulatory LH surge in the rat. Biochem Biophys Res Commun 93:471-477.

Frye CA (2001) The role of neurosteroids and non-genomic effects of progestins and androgens in mediating sexual receptivity of rodents. Brain Res Brain Res Rev 37:201-222.

Frye CA, Vongher JM (1999) Progesterone has rapid and membrane effects in the facilitation of female mouse sexual behavior. Brain Res 815:259-269.

Frye CA, Vongher JM (2001) Progesterone and 3alpha,5alpha-THP enhance sexual receptivity in mice. Behav Neurosci 115:1118-1128.

Ghosh K, Thompson AM, Goldbeck RA, Shi X, Whitman S Oh E, Zhiwu Z, Vulpe C, Holman TR (2005) Spectroscopic and biochemical characterization of heme binding to yeast Dap1p and mouse PGRMC1p. Biochemistry 44:16729-16736

Gibson CL, Gray LJ, Bath PM, Murphy SP (2008) Progesterone for the treatment of experimental brain injury; a systematic review. Brain 131:318-328.

151

Gilad GM, Varon LE (1985) Transglutaminase activity in rat brain: characterization, distribution, and changes with age. J Neurochem 45:1522-1526.

Gilad GM, Varon LE, Gilad VH (1985) Calcium-dependent transglutaminase of rat sympathetic ganglion in development and after nerve injury. J Neurochem 44:1385-1390.

Goldstein JL, DeBose-Boyd RA, Brown MS (2006) Protein sensors for membrane sterols. Cell 124:35-46.

Goodman RL, Bittman EL, Foster DL, Karsch FJ (1981) The endocrine basis of the synergistic suppression of luteinizing hormone by estradiol and progesterone. Endocrinology 109:1414-1417.

Gorski RA (1974) The neuroendocrine regulation of sexual behavior. Adv Psychobiol 2:1-58.

Gottsch ML, Cunningham MJ, Smith JT, Popa SM, Acohido BV, Crowley WF, Seminara S, Clifton DK, Steiner RA (2004) A role for kisspeptins in the regulation of gonadotropin secretion in the mouse. Endocrinology 145: 4073- 4077.

Guenterberg KD, Grignol VP, Raig ET, Zimmerer JM, Chan AN, Blaskovits FM, Young GS, Nuovo GJ, Mundy BL, Lesinski GB, Carson III WE (2010) Interleukin-29 binds to melanoma cells inducing Jak-STAT signal transduction and apoptosis. Molecular Cancer Therapy 9:510-515.

Guo Q, Sayeed I, Baronne LM, Hoffman SW, Guennoun R, Stein DG (2006) Progesterone administration modulates AQP4 expression and edema after traumatic brain injury in male rats. Exp Neurol 198:469-478.

152

Han SK, Abraham IM, Herbison AE (2002) Effect of GABA on GnRH neurons switches from depolarization to hyperpolarization at puberty in the female mouse. Endocrinology 143:1459-1466.

Hand RA, Craven RJ (2003) Hpr6.6 protein mediates cell death from oxidative damage in MCF-7 human breast cancer cells. J Cell Biochem 90:534-547.

Hazel TG, Nathans D, Lau LF (1988) A gene inducible by serum growth factors encodes a member of the steroid and thyroid hormone receptor superfamily. Proc Natl Acad Sci 85: 8444-8448

He J, Evans CO, Hoffman SW, Oyesiku NM, Stein DG (2004) Progesterone and allopregnanolone reduce inflammatory cytokines after traumatic brain injury. Exp Neurol 189:404-412.

Herbison AE (1998) Multimodal influence of estrogen upon gonadotropin-releasing hormone neurons. Endocr Rev 19:302-330.

Hibbert ML, Stouffer RL, Wolf DP, Zelinski-Wooten MB (1996) Midcycle administration of a progesterone synthesis inhibitor prevents ovulation in primates. Proc Natl Acad Sci U S A 93:1897-1901.

Hisano S (2003) Vesicular glutamate transporters in the brain. Anat Sci Int 78:191-204.

Ho MM, Barker S, Vinson GP (1994) Distribution of the adrenocortical inner zone antigen. J Endocrinol 141:459-466.

153

Hughes AL, Powell DW, Bard M, Eckstein J, Barbuch R, Link AJ, Espenshade PJ (2007) Dap1/PGRMC1 binds and regulates cytochrome P450 enzymes. Cell Metab 5:143-149.

Hwang JY, Duncan RS, Madry C, Singh M, Koulen P (2009) Progesterone potentiates calcium release through IP3 receptors by an Akt-mediated mechanism in hippocampal neurons. Cell Calcium 45:233-242.

Intlekofer KA, Petersen SL (2010) 17beta-Estradiol and Progesterone Regulate Multiple Progestin Signaling Molecules in the Anteroventral Periventricular Nucleus, Ventromedial Nucleus and Sexually Dimorphic Nucleus of the Preoptic Area in Female Rats. Neuroscience.

Iwamori M, Moser HW, Kishimoto Y (1976) Cholesterol sulfate in rat tissues. Tissue distribution, developmental change and brain subcellular localization. Biochim Biophys Acta 441:268-279.

Jaffe RB (1969) Testosterone metabolism in target tissues. Hypothalamic and pituitary tissues of the adult rat and human fetus, and the immature rat epiphysis. Steroids 14:483-498.

Jefcoate CR, DiBartolomeis MJ, Williams CA, McNamara BC (1987) ACTH regulation of cholesterol movement in isolated adrenal cells. J Steroid Biochem 27:721- 729. 154

Kandel ES, Hay N (1999) The regulation and activities of the multifunctional serine/threonine kinase Akt/PKB. Exp Cell Res 253:210-229.

Karri S, Dertien JS, Stocco DM, Syapin PJ (2007) Steroidogenic acute regulatory protein expression and pregnenolone synthesis in rat astrocyte cultures. J Neuroendocrinol 19:860-869.

Karteris E, Zervou S, Pang Y, Dong J, Hillhouse EW, Randeva HS, Thomas P (2006) Progesterone signaling in human myometrium through two novel membrane G protein-coupled receptors: potential role in functional progesterone withdrawal at term. Mol Endocrinol 20:1519-1534.

Ke FC, Ramirez VD (1987) Membrane mechanism mediates progesterone stimulatory effect on LHRH release from superfused rat hypothalami in vitro. Neuroendocrinology 45:514-517.

Ke FC, Ramirez VD (1990) Binding of progesterone to nerve cell membranes of rat brain using progesterone conjugated to 125I-bovine serum albumin as a ligand. J Neurochem 54:467-472.

155

Kimura I, Nakayama Y, Yamauchi H, Konishi M, Miyake A, Mori M, Ohta M, Itoh N, Fujimoto M (2008) Neurotrophic activity of neudesin, a novel extracellular heme-binding protein, is dependent on the binding of heme to its cytochrome b5-like heme/steroid-binding domain. J Biol Chem 285:4323-4331.

Knapstein P, David A, Wu CH, Archer DF, Flickinger GL, Tochstone JC (1968) Metabolism of free and sulfoconjugated DHEA in brain tissue in vivo and in vitro. Steroids 11:885-896.

Kokate TG, Svensson BE, Rogawski MA (1994) Anticonvulsant activity of neurosteroids: correlation with gamma-aminobutyric acid-evoked chloride current potentiation. J Pharmacol Exp Ther 270:1223-1229.

Kraus WL, Katzenellenbogen BS (1993) Regulation of progesterone receptor gene expression and growth in the rat uterus: modulation of estrogen actions by progesterone and sex steroid hormone antagonists. Endocrinology 132:2371- 2379.

Krebs KE, Prouty SM, Zagon IS, Goodman SR (1987) Structural and functional relationship of red blood cell protein 4.1 to synapsin I. Am J Physiol 253:C500- 505.

Krey LC, Tyrey L, Everett JW (1973) The estrogen-induced advance in the cyclic LH surge in the rat: dependency on ovarian progesterone secretion. Endocrinology 93:385-390.

Kubli-Garfias C, Whalen RE (1977) Induction of lordosis behavior in female rats by intravenous administration of progestins. Horm Behav 9:380-386.

Laird SM, Vinson GP, Whitehouse BJ (1988) Monoclonal antibodies against rat adrenocortical cell antigens. Acta Endocrinol (Copenh) 119:420-426.

Lauber AH, Romano GJ, Mobbs CV, Pfaff DW (1990) Estradiol Regulation of Estrogen Receptor Messenger Ribonucleic Acid in Rat Mediobasal Hypothalamus: An in situ Hybridization Study. J Neuroendocrinol 2:605-611.

Leonhardt SA, Boonyaratanakornkit V, Edwards DP (2003) Progesterone receptor transcription and non-transcription signaling mechanisms. Steroids 68:761-770.

Liu Z, Smith SW, Mclaughlin KA, Schwartz LM, Osborne BA (1994) Apoptotic signals delivered through the T-cell receptor of a T-cell hybrid require the immediate- early gene Nur77. Nature 367:281-284.

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real- time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402- 408.

Lorand L, Graham RM (2003) Transglutaminases: crosslinking enzymes with pleiotropic functions. Nat Rev Mol Cell Biol 4:140-156.

Losel RM, Falkenstein E, Feuring M, Schultz A, Tillmann HC, Rossol-Haseroth K, Wehling M (2003) Nongenomic steroid action: controversies, questions, and answers. Physiol Rev 83:965-1016.

Lufei C, Ma J, Huang G, Zhang T, Novotny-Diermayr V, Ong CT, Cao X (2003) GRIM-19, a death-regulatory gene product, suppresses Stat3 activity via functional interaction. EMBO J 22:1325-1335.

Lydon JP, DeMayo FJ, Funk CR, Mani SK, Hughes AR, Montgomery CA, Jr., Shyamala G, Conneely OM, O'Malley BW (1995) Mice lacking progesterone receptor exhibit pleiotropic reproductive abnormalities. Genes Dev 9:2266- 2278.

157

Majewska MD, Harrison NL, Schwartz RD, Barker JL, Paul SM (1986) Steroid hormone metabolites are barbiturate-like modulators of the GABA receptor. Science 232:1004-1007.

Mani SK, Allen JM, Clark JH, Blaustein JD, O'Malley BW (1994a) Convergent pathways for steroid hormone- and neurotransmitter-induced rat sexual behavior. Science 265:1246-1249.

Mani SK, Blaustein JD, Allen JM, Law SW, O'Malley BW, Clark JH (1994b) Inhibition of rat sexual behavior by antisense oligonucleotides to the progesterone receptor. Endocrinology 135:1409-1414.

Meyerson B (1972) Latency between intravenous injection of progestins and the appearance of estrous behavior in estrogen-treated ovariectomized rats. Horm Behav 3:1-9.

Micevych P, Sinchak K (2008) Synthesis and function of hypothalamic neuroprogesterone in reproduction. Endocrinology 149:2739-2742.

Micevych PE, Chaban V, Ogi J, Dewing P, Lu JK, Sinchak K (2007) Estradiol stimulates progesterone synthesis in hypothalamic astrocyte cultures. Endocrinology 148:782-789.

Mifsud W, Bateman A (2002) Membrane-bound progesterone receptors contain a cytochrome b5-like ligand-binding domain. Genome Biol 3:RESEARCH0068.

158

Mishell BB, Shiigi SM (1980) Selected Methods in Cellular Immunology. Freeman and Co San Franscisco:16-19.

Mulac-Jericevic B, Lydon JP, DeMayo FJ, Conneely OM (2003) Defective mammary gland morphogenesis in mice lacking the progesterone receptor B isoform. Proc Natl Acad Sci U S A 100:9744-9749.

Mulac-Jericevic B, Mullinax RA, DeMayo FJ, Lydon JP, Conneely OM (2000) Subgroup of reproductive functions of progesterone mediated by progesterone receptor-B isoform. Science 289:1751-1754.

Nilsson EE, Stanfield J, Skinner MK (2006) Interactions between progesterone and tumor necrosis factor-alpha in the regulation of primordial follicle assembly. Reproduction 132:877-886.

Niswender GD (2002) Molecular control of luteal secretion of progesterone. Reproduction 123:333-339.

159

Nolte I, Jeckel D, Wieland FT, Sohn K (2000) Localization and topology of ratp28, a member of a novel family of putative steroid-binding proteins. Biochim Biophys Acta 1543:123-130.

O'Connor CA, Cernak I, Johnson F, Vink R (2007) Effects of progesterone on neurologic and morphologic outcome following diffuse traumatic brain injury in rats. Exp Neurol 205:145-153.

Ottem EN, Godwin JG, Krishnan S, Petersen SL (2004) Dual-phenotype GABA/glutamate neurons in adult preoptic area: sexual dimorphism and function. J Neurosci 24:8097-8105.

Park OK, Ramirez VD (1987) Circulating blood progesterone is pulsatile throughout the rat oestrous cycle. Acta Endocrinol (Copenh) 116:121-128.

Parsons B, Rainbow TC, MacLusky NJ, McEwen BS (1982) Progestin receptor levels in rat hypothalamic and limbic nuclei. J Neurosci 2:1446-1452.

Paxinos G, Watson C (1982) The Rat Brain in Stereotaxic Coordinates. New York.

Peluso JJ, Fernandez G, Pappalardo A, White BA (2001) Characterization of a putative membrane receptor for progesterone in rat granulosa cells. Biol Reprod 65:94- 101.

160

Peluso JJ, Liu X, Gawkowska A, Johnston-MacAnanny E (2009) Progesterone activates a progesterone receptor membrane component 1-dependent mechanism that promotes human granulosa/luteal cell survival but not progesterone secretion. J Clin Endocrinol Metab 94:2644-2649.

Peluso JJ, Liu X, Gawkowska A, Lodde V, Wu CA (2010) Progesterone inhibits apoptosis in part by PGRMC1-regulated gene expression. Mol Cell Endocrinol 320:153-161.

Peluso JJ, Pappalardo A (2004) Progesterone regulates granulosa cell viability through a protein kinase G-dependent mechanism that may involve 14-3-3sigma. Biol Reprod 71:1870-1878.

Pesold C, Treit D (1992) Excitotoxic lesions of the septum produce anxiolytic effects in the elevated plus-maze and the shock-probe burying tests. Physiol Behav 52:37- 47.

161

Petersen SL, Ottem EN, Carpenter CD (2003) Direct and indirect regulation of gonadotropin-releasing hormone neurons by estradiol. Biol Reprod 69:1771- 1778.

Pettus EH, Wright DW, Stein DG, Hoffman SW (2005) Progesterone treatment inhibits the inflammatory agents that accompany traumatic brain injury. Brain Res 1049:112-119.

Pfaff DW, Sakuma Y (1979a) Deficit in the lordosis reflex of female rats caused by lesions in the ventromedial nucleus of the hypothalamus. J Physiol 288:203-210.

Pfaff DW, Sakuma Y (1979b) Facilitation of the lordosis reflex of female rats from the ventromedial nucleus of the hypothalamus. J Physiol 288:189-202.

Pfaff DW, Schwartz-Giblin S, McCarthy MM, Kow LM (1994) Cellular and molecular mechanisms of female reproductive behaviors. In: The physiology of reproduction. Knobil E, Neil E, eds:pp 107-220.

Pollio G, Xue P, Zanisi M, Nicolin A, Maggi A (1993) Antisense oligonucleotide blocks progesterone-induced lordosis behavior in ovariectomized rats. Brain Res Mol Brain Res 19:135-139.

162

Richer JK, Lange CA, Manning NG, Owen G, Powell R, Horwitz KB (1998) Convergence of progesterone with growth factor and cytokine signaling in breast cancer. Progesterone receptors regulate signal transducers and activators of transcription expression and activity. J Biol Chem 273:31317-31326.

Robert F, Guennoun R, Desarnaud F, Do-Thi A, Benmessahel Y, Baulieu EE, Schumacher M (2001) Synthesis of progesterone in Schwann cells: regulation by sensory neurons. Eur J Neurosci 13:916-924.

Rosie R, Thomson E, Fink G (1990) Oestrogen positive feedback stimulates the synthesis of LHRH mRNA in neurones of the rostral diencephalon of the rat. J Endocrinol 124:285-289.

Rothfeld J, Hejtmancik JF, Conn PM, Pfaff DW (1989) In situ hybridization for LHRH mRNA following estrogen treatment. Brain Res Mol Brain Res 6:121-125.

Rubin BS, Barfield RJ (1983) Progesterone in the ventromedial hypothalamus facilitates estrous behavior in ovariectomized, estrogen-primed rats. Endocrinology 113:797-804.

163

Runko E, Kaprielian Z (2002) Expression of Vema in the developing mouse spinal cord and optic chiasm. J Comp Neurol 451:289-299.

Runko E, Kaprielian Z (2004) Caenorhabditis elegans VEM-1, a novel membrane protein, regulates the guidance of ventral nerve cord-associated axons. J Neurosci 24:9015-9026.

Runko E, Wideman C, Kaprielian Z (1999) Cloning and expression of VEMA: a novel ventral midline antigen in the rat CNS. Mol Cell Neurosci 14:428-443.

Sakamoto H, Ukena K, Tsutsui K (2001) Effects of progesterone synthesized de novo in the developing Purkinje cell on its dendritic growth and synaptogenesis. J Neurosci 21:6221-6232.

Sakuma Y (2009) Gonadal steroid action and brain sex differentiation in the rat. J Neuroendocrinol 21:410-414.

Sandstrom NJ, Williams CL (2001) Memory retention is modulated by acute estradiol and progesterone replacement. Behav Neurosci 115:384-393.

Saper CB, Swanson LW, Cowan WM (1976) The efferent connections of the ventromedial nucleus of the hypothalamus of the rat. J Comp Neurol 169:409- 442.

Schenkman JB, Jansson I (2003) The many roles of cytochrome b5. Pharmacol Ther. 97: 139-52.

Schuetz AW (1977) Induction of oocytic maturation and differentiation: mode of progesterone action. Ann N Y Acad Sci 286:408-420.

164

Schumacher M, Coirini H, Pfaff DW, McEwen BS (1990) Behavioral effects of progesterone associated with rapid modulation of oxytocin receptors. Science 250:691-694.

Sholiton LJ, Werk EE (1969) The less-polar metabolites produced by incubation of testosterone-4-14C with rat and bovine brain. Acta Endocrinol (Copenh) 61:641- 648.

Sikorski AF, Terlecki G, Zagon IS, Goodman SR (1991) Synapsin I-mediated interaction of brain spectrin with synaptic vesicles. J Cell Biol 114:313-318.

Simerly RB, Chang C, Muramatsu M, Swanson LW (1990) Distribution of androgen and estrogen receptor mRNA-containing cells in the rat brain: an in situ hybridization study. J Comp Neurol 294:76-95.

Simerly RB, Young BJ (1991) Regulation of estrogen receptor messenger ribonucleic acid in rat hypothalamus by sex steroid hormones. Mol Endocrinol 5:424-432.

165

Sinchak K, Mills RH, Tao L, LaPolt P, Lu JK, Micevych P (2003) Estrogen induces de novo progesterone synthesis in astrocytes. Dev Neurosci 25:343-348.

Singh M (2001) Ovarian hormones elicit phosphorylation of Akt and extracellular- signal regulated kinase in explants of the cerebral cortex. Endocrine 14:407-415.

Snyder BW, Beecham GD, Schane HP (1984) Inhibition of ovulation in rats with epostane, an inhibitor of 3 beta-hydroxysteroid dehydrogenase. Proc Soc Exp Biol Med 176:238-242.

Spiteri E, Konopka G, Coppola G, Bomar J, Oldham M, Ou J, Vernes SC, Fisher SE, Ren B, Geschwind DH (2007) Identification of the transcriptional targets of FOXP2, a gene linked to speech and language, in developing human brain. The American Journal of Human Genetics 81:1144-1157.

Stawowczyk M, Van Scoy S, Kumar KP, Reich NC (2010) The interferon stimulated gene 54 promotes apoptosis. J Biol Chem.

Suchanek M, Radzikowska A, Thiele C (2005) Photo-leucine and photo-methionine allow identification of protein-protein interactions in living cells. Nat Methods 2:261-267.

Sun J, Blaskovich MA, Jove R, Livingston SK, Coppola D, Sebti SM (2005) Cucurbitacin Q: a selective STAT3 activation inhibitor with potent antitumor activity. Oncogene 24:3236-3245.

Swanson LW (1998) Brain maps: structure of the rat brain: a laboratory guide with printed and electronic templates for data, models, and schematics. Elsevier Second edition. 166

Tolentino PJ, DeFord SM, Notterpek L, Glenn CC, Pike BR, Wang KK, Hayes RL (2002) Up-regulation of tissue-type transglutaminase after traumatic brain injury. J Neurochem 80:579-588.

Truss M, Beato M (1993) Steroid hormone receptors: interaction with deoxyribonucleic acid and transcription factors. Endocr Rev 14:459-479.

Ukena K, Kohchi C, Tsutsui K (1999) Expression and activity of 3beta-hydroxysteroid dehydrogenase/delta5-delta4-isomerase in the rat Purkinje neuron during neonatal life. Endocrinology 140:805-813.

Ukena K, Usui M, Kohchi C, Tsutsui K (1998) Cytochrome P450 side-chain cleavage enzyme in the cerebellar Purkinje neuron and its neonatal change in rats. Endocrinology 139:137-147.

Wahl M, Schilling L, Unterberg A, Baethmann A (1993) Mediators of vascular and parenchymal mechanisms in secondary brain damage. Acta Neurochir Suppl (Wien) 57:64-72.

Wang J, Campbell IL (2005) Innate STAT1-dependent genomic response of neurons to the antiviral cytokine alpha interferon. J Virol 79:8295-8302.

Whalen RE (1974) Estrogen-progesterone induction of mating in female rats. Horm Behav 5:157-162.

167

Yoshitani N, Satou K, Saito K, Suzuki S, Hatanaka H, Seki M, Shinozaki K, Hirota H< Yokoyama S (2005) A structure-based strategy for discovery of small ligands binding to functionally unknown proteins: combination of in silico screening and surface plasmon resonance measurements. Proteomics 5: 1472-1480

Zwain IH, Yen SS (1999) Neurosteroidogenesis in astrocytes, oligodendrocytes, and neurons of cerebral cortex of rat brain. Endocrinology 140:3843-3852.

168