Functional investigation of plant specific long coiled-coil proteins,
PAMP INDUCED COILED-COIL (PICC) and PICC-LIKE (PICL)
in Arabidopsis thaliana
Dissertation
Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University
By
Sowmya Venkatakrishnan
Graduate Program in Plant Cellular and Molecular Biology
The Ohio State University
2012
Dissertation Committee:
Dr. Iris Meier, Advisor
Dr. Jyan-Chyun Jang
Dr. Patrice Hamel
Dr. Rebecca Lamb
Copyright by
Sowmya Venkatakrishnan
2012
ABSTRACT
Increasing evidence from animal and yeast systems demonstrates the importance of long coiled-coil proteins in a variety of cellular processes. Yet, functional knowledge about long coiled-coil proteins in plants is sparse. In this study I present the functional characterization of a family of two plant-specific long coiled-coil proteins, PAMP INDUCED COILED-COIL (PICC) and PICC-LIKE (PICL) in Arabidopsis. I employed an in-depth multi-dimensional approach using cell and molecular biology, biochemistry, reverse genetics, and in silico analyses to gain insight into their function. PICC and PICL are anchored to the membranes of the endoplasmic reticulum by a C-terminal transmembrane domain and a short tail domain, via a tail-anchoring mechanism. PICC expression is induced by bacterial pathogen associated molecular patterns (PAMPs) and loss of function mutants of PICC are compromised in PAMP triggered immunity (PTI), which is the primary layer of defense against pathogens in plants. PICL is neither induced by PAMPs nor involved in PTI, suggesting functional diversification of these paralogous genes. However, PICC and PICL appear to play a role in post-germination growth response to the plant abiotic stress hormone abscissic acid (ABA). Next, using yeast two-hybrid and membrane yeast two-hybrid library screens, I identified a TETRATRICOPEPTIDE PROTEIN (TP) and GLUTAMYL t-RNA SYNTHETASE (GluRS) as putative interacting partners for PICC and PICL, respectively. They can now form the nodes for expanding the PICC and PICL interaction networks. The data presented here provide the first evidence for the involvement of a plant long coiled-coil protein in a plant defense response. Orthologs of PICC and PICL are present in agronomically important crops such as rice and sorghum and can thus be explored towards the goal of developing disease resistant crops.
ii
I dedicate this dissertation to my dear parents, for their selfless love
and endless support
iii
ACKNOWLEDGEMENTS
I am forever grateful and thankful to my advisor, Dr. Iris Meier, for giving me this wonderful opportunity to work in her lab. Without her continuous support and guidance, this work would not have been possible. Her encouragement and motivation has helped me throughout my graduate study.
I convey my sincere thanks to Dr. David Mackey, our collaborator, for his help in designing and executing the experiments involving plant pathogens. I deeply value his guidance and expertise that helped a great deal in shaping up this work.
I am thankful to my committee members, Dr. Rebecca Lamb, Dr. Patrice Hamel and Dr. Jyan-Chyun Jang, for their valuable input throughout the course of my work.
I convey my thanks to Dr. William Jenson for being such a wonderful teacher. I am grateful to have had the opportunity to work as his teaching assistant.
I express my sincere thanks to Matteo Citarelli for helping us generate the sequence alignments and phylogenetic tree figures in Chapter 2.
All the past lab-members all through the years: Annkatrin Rose, Siva Muthuswamy, Jelena Brkljacic, Xianfeng Xu, Qiao Zhao, Shalaka Patel, Pascal Haberey, Heather Wang and Syliva He have been very helpful. I am thankful to them for their support.
My current lab-mates Joanna Boruc, Xiao Zhou, Dongfeng Ding, Alex Tough and Mintu Desai have been very supportive during the most challenging phase of my graduate study. I am grateful to them for bringing fun, laughter and great science into the lab. I would like to particularly thank our lab research assistant Alex Tough for his help with the library screens. He also continued helping me with my research until the very last minute.
The past and present members of our talented undergraduate work force, Senthan Mahendrarasa, Brett Burdo, Lee Soo Kim, and Hua Fan have been very helpful, doing all the preparatory work. I am thankful to them for their assistance.
A special thank you to Xueqing Geng and Ahmed Afzal, for helping me with the experiments involving plant pathogens and for their valuable discussions. They took time to help me amidst their busy lab work, for which I am very grateful. I would also like to thank Anju Gangadharan for helpful discussions.
I convey my thanks to Chris Defraia for his help with the q-RT experiments and statistical analysis. My thanks to Rosario Barbieri and Mohammed Karamoko for helping me with yeast-based experiments.
iv
I thank the greenhouse staff Joan Leonard, Emily Horn and Joe Takayama for their enormous help in maintaining the growth chambers. My special thanks to Joan Leonard for helping me grow disease-free plants.
I express my many thanks to our technical staff Eduardo Acosta for the microscopes and incubators in Jennings Hall and to our past and present administrative staff, Denise Blackburn-Smith, Jill Hartman, Rene Reese and Laurel Shannon for helping me in various ways.
I acknowledge all the rabbits and mice whose lives have been sacrificed to generate antibodies for my research work. I also acknowledge all the living organisms for serving as models and tools for my study.
I thank my friends Srilakshmi Makkena, Sachin Teotia, Sara Cline, Thushani Rodrigo- Peiris, Gireesha Mohannath and Stephane Gabilly for their helpful discussions and support.
My friends from the satchitanand group, Sachin, Siva, Chandraprabha aunty, Deepali, Nitya, Mahesh, Jennifer, Joshua, Paras, Geethi, Nishanthi and Maathangi have enriched my life with invaluable philosophical discussions. I am thankful to them for all the heart- warming discussions.
I thank my batch-mate and friend through all ups and downs of graduate school, Nirodhini Siriwardhana, for all the fun and science we shared during all these years.
I express my sincere thanks to my friend and lab-mate for five years, Siva Muthuswamy for his tremendous support and encouragement. A special thank you to my friends from my undergraduate study in India, Srividya Madhabushi and Sathish Sathiyanesan for their support and friendship.
I am very thankful for the tremendous support my family has offered. My parent- in- laws have been very helpful and supportive all the time. Their encouraging words and sound advice has helped me immensely. A special thank you to Rohini and Prasanna for all the support and motivation.
I am forever grateful and thankful to my parents for everything they have done. Without their love, encouragement, belief, and support, none of this would have been possible. A special thank you to my dear brother Sriram for his support and belief in me.
My heart-felt thanks to my dear husband Vijay, who has been there for me, supporting, guiding, encouraging and helping me in every way. He has been my pillar of strength and my source of happiness.
Lastly, I am very thankful to The Ohio State University for this wonderful educational and intellectual experience.
v
VITA
1998-2003 ...... B.E. (Hons.) Electrical and Electronics M.Sc. (Hons.) Biological Sciences, Birla Institute of Technology and Sciences, Pilani, India 2004-2006 ...... Graduate Teaching Associate, Department of Plant Cellular and Molecular Biology, The Ohio State University, U.S.A 2006-Present ...... Graduate Research Associate, Department of Plant Cellular and Molecular Biology, The Ohio State University, U.S.A
PUBLICATIONS
Xu XM, Rose A, Muthuswamy S, Jeong SY, Venkatakrishnan S, et al. (2007) NUCLEAR
PORE ANCHOR, the Arabidopsis Homolog of Tpr/Mlp1/Mlp2/Megator, Is Involved in mRNA Export and SUMO Homeostasis and Affects Diverse Aspects of Plant
Development. The Plant Cell Online 19: 1537-1548.
FIELDS OF STUDY
Major Field: Plant Cellular and Molecular Biology
vi
TABLE OF CONTENTS
ABSTRACT ...... ii
Vita ...... vi Publications ...... vi Fields of Study ...... vi
List of Tables ...... ix
List of Figures ...... x
CHAPTER 1 ...... 1 1.1 Classification of plant pathogens ...... 2 1.2 Overview of plant immune responses ...... 3 1.3 PAMPs and PAMP receptors ...... 4 1.4 Initiation of PTI signaling ...... 8 1.5 PTI signaling ...... 9 1.6 Stem cell-mediated immunity...... 16 1.7 A role for the endomembrane systems in plant immunity ...... 17 1.8 Organelle movement during immune response ...... 23 1.9 Effector triggered Immunity ...... 24 1.10 Hormonal cross talk in plant immune response ...... 25
CHAPTER 2 ...... 35 2.1 INTRODUCTION ...... 36 2.2 RESULTS ...... 41 2.3 DISCUSSION ...... 53 2.4 MATERIALS AND METHODS ...... 64
CHAPTER 3 ...... 106 3.1 INTRODUCTION ...... 107 3.2 RESULTS ...... 110 3.3 DISCUSSION ...... 118 3.4 MATERIALS AND METHODS ...... 124 vii
APPENDIX ...... 146 A.1 INTRODUCTION ...... 147 A.2 RESULTS AND DISCUSSION ...... 148 A.3 MATERIAL AND METHODS...... 151 A.4 SEQUENCES OF THE PREY cDNA ...... 159
BIBLIOGRAPHY ...... 162
viii
LIST OF TABLES
Table 2.1 Primers used for cloning ...... 101
Table 2.2 Primers used for genotyping ...... 104
Table 2.3 Primers used for real-time PCR ...... 105
Table 3.1 Putative interactors for PICL identified by yeast two-hybrid library screen .... 139
Table 3.2 Putative interactors for PICL identified by MYTH library screen ...... 140
Table 3.3 Putative interactors for PICC identified by MYTH library screen ...... 141
Table 3.4 List of Primers ...... 144
Table A.1 Putative NUA interacting partners...... 156
Table A.2 List of Primers……………………………………………………………………. .157
ix
LIST OF FIGURES
Figure 1.1 Overview of the plant immune response ...... 30
Figure 1.2 A schematic representation of initiation of PTI signaling ...... 31
Figure 1.3 A schematic representation of various components of PTI signaling ...... 32
Figure 1.4 The role of ABA in pre-invasive immunity ...... 33
Figure 1.5 Cross talk between ABA and SA in immune response ...... 34
Figure 2.1 Sequence alignment and protein structure of PICC and PICL...... 74
Figure 2.2 Multiple sequence alignment of PICC, PICL and their orthologs in vascular plants ...... 78
Figure 2.3 Phylogenetic tree of PICC, PICL and their orthologs in vascular plants ...... 85
Figure 2.4 PICL and PICC are associated with the ER by their C-terminal transmembrane domain ...... 86
Figure 2.5 PICL and PICC N-termini face the cytoplasm ...... 88
Figure 2.6 PICC forms homodimers ...... 89
Figure 2.7 PICC and PICL promoters have partially overlapping patterns of activity...... 90
Figure 2.8 T-DNA insertion alleles of PICL and PICC ...... 92
Figure 2.9 picl-1, picc-1, picc2, and picc-1;picl-1 are hypersensitive to ABA at the post- germination growth stage ...... 94
Figure 2.10 PICC expression is induced by flg22 ...... 95
x
Figure 2.11 Time course of PICC induction ...... 96
Figure 2.12 picc-1 and picc-1;picl-1 Arabidopsis plants are more susceptible to avirulent bacteria hrcC...... 97
Figure 2.13 Generation of reactive oxygen species is not compromised in picc-1 ...... 98
Figure 2.14 PAMP induced expression changes are not altered in picc-1...... 99
Figure 3.1 A graphical representation of the yeast two-hybrid system...... 130
Figure 3.2 A graphical representation of the MYTH (split-ubiquitin) system ...... 131
Figure 3.3 Immunoblot showing expression of the bait PICLTDF in the yeast strain
PJ69-4A...... 132
Figure 3.4 PICL interacts with GluRS in a co-immunoprecipitation assay ...... 133
Figure 3.5 RFP-GluRS is localized in the cytoplasm ...... 134
Figure 3.6 PICC and PICL are suitable baits for library screening using the MYTH (split- ubiquitin) system as determined by the NubG/NubI control test ...... 135
Figure 3.7 TP interacts with PICC and PICL ...... 137
Figure 3.8 TP is located in the cytoplasm ...... 138
Figure A.1 NUA self interacts and interacts with ESD4 in yeast two-hybrid assays ..... 153
Figure A.2 Expression of the N-terminal coiled-coil fragment of NUA in the yeast strain
PJ69-4A...... 155
xi
CHAPTER 1
The Plant Immune System – Where Action Expresses Priority1
1 “Action expresses priority” – Mahatma Gandhi
1
Plant health is of utmost importance to mankind. Most living organisms depend, directly or indirectly, upon plants for energy. In their environment, plants encounter numerous interactions with other organisms. Though some interactions are beneficial, interactions with pathogenic organisms are harmful to the plant. Understanding plants’ defense capabilities is essential to maintaining healthy crops for productive yields. Over the past two decades, the molecular mechanisms of many crucial defense mechanisms in plants have been unraveled. More recently, the importance of plant cell biology in orchestrating defense has been recognized. Similarly, the crosstalk between defense and plant hormone pathways is a novel and emerging theme. Here, an overview of plant defense mechanisms is followed by a discussion of the functional relevance for defense of cellular organization and hormone regulation.
1.1 Classification of plant pathogens
Broadly, plant pathogens are classified as biotrophic, nectrotrophic or hemibiotrophic.
Biotrophic pathogens depend on nutrition from living plant cells and establish a close association with the host. The fungi Blumeria graminis, Erysiphe orontii and Erysiphe cichoracearum are among the well-studied biotrophic plant pathogens. Necrotrophic pathogens extract nutrition from dead plant tissue. Botrytis cinerea and Alternaria brassicicola are necrotophic fungi that kill the host cells at very early stages of infection.
Hemibiotrophs follow a biotrophic life style usually during an early phase of their life cycle and then behave as necrotrophs, feeding on dead cells during another phase of their life cycle. The apoplastic colonizing bacteria Pseudomonas syringae and
Xanthomonas campestris pv vesicatoria, though defined as biotrophs by some, are best
2 classified as hemibiotrophs (Collmer et al., 2009; Glazebrook, 2005b). Colletotrichum graminicola, responsible for anthracnose disease, and Phytophthora infestans that causes potato late blight are some examples of hemibiotrophic fungal and oomycete pathogens (Oliver and Ipcho, 2004).
The plants’ defense against biotrophs eventually leads to localized programmed cell death to confine infection; however, this cell death sets the stage for infection by necrotrophs (Spoel et al., 2007). The molecular mechanisms distinguishing biotrophy from necrotrophy is not clearly defined (Glazebrook, 2005a; Spoel and Dong, 2008).
Most of the studies (unless mentioned) discussed in this chapter come from investigations of interactions between the hemibiotrophic pathogen Pseudomonas syringae with the model plant Arabidopsis thaliana.
1.2 Overview of plant immune responses
Plants have a highly sensitive system for perceiving pathogen attack, which consists of multiple layers. The first layer consists of the recognition of pathogen associated molecular patterns (PAMPs) or microbe associated molecular patterns (MAMPs) (Boller and Felix, 2009). Pattern recognition receptors (PRRs), present on the surface of the plant cells, detect the presence of PAMPs and initiate the first layer of defense called
PAMP triggered immunity (PTI). Pathogens counteract PTI by secreting type III effector proteins (T3E) into the host plant cytoplasm through a type III protein secretion system
(T3SS) (Collmer et al., 2000). T3Es target various components of the plant immune system, resulting in the suppression of immunity. In turn, intracellular nucleotide binding leucine rich repeat (NB-LRR) resistance (R) proteins recognize T3Es and respond by eliciting effector triggered immunity (ETI).
3 The immune response generated during ETI is very similar to PTI but ETI responses are more prolonged with higher amplitudes and robustness than PTI (Tsuda and Katagiri,
2010). T3Es target components of both PTI and ETI to overcome plant defense responses (Figure 1.1). A successful infection involves the suppression of both PTI and
ETI resulting in large-scale cell death or necrosis. In contrast, successful disease resistance leads to a hypersensitive response (HR) causing localized cell death surrounding the infection site and restricting spread of the infection. The aim of this chapter is to discuss various components of the plant immune response with focus on cellular processes involved in the most fundamental defense mechanism, PTI.
1.3 PAMPs and PAMP receptors
PAMPs are molecular patterns on the pathogen that are essential for its survival (Boller and Felix, 2009). They are conserved across a broad range of microorganisms. They are perceived by PRRs which activate innate defense signaling, thus conferring resistance against a broad range of microorganisms. In the following sections, different types of
PAMPs and PRR receptors will be discussed.
Flagellin
Flagellin is the building block of the flagellar filament and is essential for motility of the bacteria. Most plants recognize the bacterial flagellin as a PAMP elicitor. flg22 is the most conserved N-terminal 22 amino acid peptide of bacterial flagellin that is sufficient to induce PTI in most plant species. An exception is rice, where flg22 has been shown to trigger only a weak PTI compared to full length flagellin (Felix et al., 1999; Takai et al.,
2008). flg22 is recognized by the pattern recognition receptor FLS2 in Arabidopsis. FLS2 was identified in a genetic screen for mutants that are insensitive to flg22-induced
4 growth inhibition (Gomez-Gomez and Boller, 2000). FLS2 has an extracellular LRR domain, a transmembrane domain and a cytoplasmic serine/threonine kinase domain
(Gomez-Gomez and Boller, 2000).
EF-Tu
The search for other potential elicitors revealed elongation factor-Tu (EF-Tu), the most abundant protein in bacteria, as another generic bacterial PAMP (Kunze et al., 2004).
The study identified EF-Tu as the main factor in crude bacterial extracts that was capable of eliciting resistance in FLS2 mutant plants (Kunze et al., 2004). The study also showed that the conserved N-terminal, N-acetylated 18 amino acid peptide of Ef-Tu, elf18, is sufficient for eliciting PTI signaling in Arabidopsis. However, plants outside the
Brassicacae family are unresponsive to EF-Tu (Kunze et al., 2004), suggesting that the
EF-Tu signaling pathway is restricted to this group of plants.
The EF-Tu receptor (EFR) was identified in a screen for elf18 insensitivity in T-DNA insertion lines the disrupted genes encoding various receptor-like kinases (RLKs) similar to FLS2 (Zipfel et al., 2006). The EFR gene encodes a protein with an extracellular LRR domain, a single transmembrane domain and a cytosolic serine/threonine kinase domain
(Zipfel et al., 2006). Interestingly, deletion of EFR also renders Arabidopsis more susceptible to Agrobacterium tumefaciens T-DNA transformation, indicating a role for
PAMP receptors in limiting Agrobacterium infection.
Ax21
Ax21, a protein hypothesized to be associated with quorum sensing, was identified recently as a PAMP of various strains of gram-negative bacteria Xanthomonas oryzae
5 pv. oryzae (Xoo) (Lee et al., 2009). Xoo is responsible for the bacterial blight disease of rice (Shen and Ronald, 2002). Ax21, secreted by Xoo, is a 194- amino acid protein (Lee et al., 2009). Similar to flg22 and elf18, a 17-amino-acid epitope of Ax21, including a sulfated threonine, is sufficient for elicitating defense signaling in rice (Lee et al., 2009).
Ax21 is recognized by the rice PRR XA21 (Song et al., 1995) XA21 belongs to the same class of plant receptor kinases as FLS2 and EFR. Ax21-derived peptides are also recognized by Arabidopsis FLS2, which opens up the possibility of multi-ligand recognition by these receptors, conferring even broader disease resistance (Danna et al., 2011).
Chitin
Chitin, a -1,4-linked polymer of N-acetylglucosamine, is a component of fungal cell walls and insect and crustacean exoskeletons. Plants produce chitinases that degrade fungal cell walls to release short chitin fragments called chitooligosaccharides (Hamel and Beaudoin, 2010). These chitooligosaccharides are well-known elicitors of defense in several plant systems (Hamel and Beaudoin, 2010; Shibuya and Minami, 2001). A
LysM (lysine motif) receptor-like kinase, chitin elicitor receptor kinase (CERK1) - also called LysM-RLK1 – is important for chitin perception in Arabidopsis (Miya et al., 2007;
Wan et al., 2008). A more recent study in Arabidopsis has shown that CERK1 directly binds to chitin, leading to phosphorylation of CERK1, and that this phosphorylation is essential for signaling in plant innate immunity (Petutschnig et al., 2010). In addition,
CERK1 is also implicated in perceiving yet unidentified bacterial PAMPs, because cerk1 mutants have been found to be more susceptible to bacterial infection and CERK1 has been shown to be targeted for degradation by the bacterial effector protein AvrptoB
(Gimenez-Ibanez et al., 2009). The CERK1 ortholog in rice has also been studied and
6 has been shown to be important for chitin perception, acting in a complex with a plasma membrane glycoprotein CEBiP (chitin elicitor binding protein) to elicit defense signaling
(Kaku et al., 2006; Shimizu et al., 2010).
PAMPs with unidentified receptors
In spite of an increase in the understanding of PAMP perception, many PAMPs have yet unidentified receptors. Bacterial cold shock proteins, bacterial secreted superoxide dismutase, lipooligosaccharides of gram-negative bacteria, arachidonic acid from oomycetes and peptidoglycans, which are the building blocks of the bacterial cell wall, are some of the examples of PAMPs that have been found to function as potent elicitors of defense in plants but whose receptors remain unidentified (Boller and Felix, 2009).
DAMPs
Fungal pathogens secrete lytic enzymes, endopolygalacturonidases (PGs), which degrade the plant cell wall to break the structural barrier. The degraded fragments of the plant cell wall, oligogalacturonides (OGs), act as Damage Associated Molecular Patterns
(DAMPs) eliciting a defense response through a pathway also activated by PAMPs such as flg22 (Ferrari et al., 2007). Recently, using a chimeric receptor approach, Wall
Associated Kinase 1 (WAK1) was identified as a receptor for OGs (Brutus et al., 2010).
The same study showed that overexpression of WAK1 increased resistance against the fungal pathogen Botrytis cinerea (Brutus et al., 2010).
AtPep1, an endogenous peptide elicitor, is a DAMP that was identified in Arabidopsis extracts (Huffaker et al., 2006). It is derived from its precursor PROPEP1, which is induced by wounding, Methyl Jasmonate (MeJa) and by AtPep1 itself (Huffaker et al.,
7 2006). AtPep1 belongs to a family of peptides (AtPep1-6) that all function as DAMPs
(Huffaker et al., 2006). Recent studies have identified a LRR receptor, PEPR1, for
AtPEP1 in Arabidopsis (Yamaguchi et al., 2006).
1.4 Initiation of PTI signaling
Activation of PRRs - FLS2 and BAK1
BAK1 (BRI-1 associated kinase) was identified as a component of early PTI signaling in a search for LRR-RLKs that play a role in innate immunity using a reverse genetics approach where T-DNA insertion mutants of various Arabidopsis LRR-RLKs were analyzed for response to flagellin (Chinchilla et al., 2007). At the same time, another group also identified BAK1 to be involved in PTI using an immunoprecipitation approach
(Heese et al., 2007). These studies showed that BAK1 associates with FLS2 in a ligand
(flagellin) dependent manner to activate FLS2 and initiate immediate downstream signaling events after flagellin perception by FLS2 (Chinchilla et al., 2007; Heese et al.,
2007). BAK1 has also been shown to be important for PTI signaling in response to activation by PAMPs other than flagellin such as EF-Tu, LPS, HrpZ, bacterial cold shock proteins and the oomycete elicitor INF1 (Chinchilla et al., 2007; Heese et al., 2007; Shan et al., 2008a). BAK1 has previously been shown to be involved in plant development by associating with and activating the brassinolide hormone receptor BRI-1 after hormone perception (Belkhadir and Chory, 2006; Li et al., 2002). However, BAK1 function in innate immunity is independent of its function in brassinolide signal transduction
(Chinchilla et al., 2007).
Following signal perception and receptor activation at the plasma membrane, downstream signaling events that transmit the signal from the membrane into the cell
8 are important for the immune response. BOTRYTIS-INDUCED KINASE 1 (BIK1) is a receptor-like cytoplasmic kinase (RLCK) which was first identified by its induction by
Bortyris infection. It has been recently shown to function downstream of flagellin perception and FLS2 activation by transmitting the signal from the FLS2/BAK1 receptor complex (Lu et al., 2010; Veronese et al., 2006). BIK1 is phosphorylated by the
FLS2/BAK1 complex and, in turn, BIK1 trans-phosphorylates the FLS2/BAK1 complex to enhance the signaling. The enhanced signaling leads to more phosphorylation of BIK1 and possibly other substrates, eventually leading to a release of fully activated BIK1 from the FLS2/BAK1 complex to activate intracellular signaling (Figure 1.2). BIK1 has been shown to be important for the immune response to nectrotrophic fungi and
Pseudomonas strains (Veronese et al., 2006). Complex genetic interactions between
BIK1 and ethylene have been recently identified to play a central role in plant immune response (Laluk et al., 2011).
1.5 PTI signaling
Ion fluxes
Calcium is a well-known second messenger for transducing signals in response to pathogens in both plants and animals (Ma and Berkowitz, 2007). Ion flux across the plasma membrane resulting in an increase in intracellular calcium levels has been observed immediately after PAMP recognition in plants (Gust et al., 2007; Ma and
Berkowitz, 2007). Cyclic nucleotide gated ion channels (CNGCs) are involved in cyctosolic calcium influx following PAMP perception (Ma and Berkowitz, 2007; Wei,
2011). A recent electrophysical study has demonstrated the requirement for active
FLS2/BAK1 and EFR/BAK1 complex formation at the membrane to induce cytosolic
Ca2+ influx after flg22 and elf18 perception (Jeworutzki et al., 2010). Another recent
9 study showed that activation of a DAMP receptor AtPEPR1 is essential for cytocolic calcium increase via the plasma membrane calcium transporter CNGC2 (Qi et al., 2010).
This evidence demonstrates that calcium influx into the cytoplasm from extracellular and intracellular resources occurs at a very early step, immediately after receptor activation.
Calcium-dependent protein kinases (CDPKs) function as calcium sensors transmitting calcium-dependent signals for transcriptional reprogramming following PAMP perception
(Boudsocq et al., 2010). Specific CDPKs have been shown to activate some of the flg22 early responsive genes, supporting their role in PTI (Boudsocq et al., 2010). Evidence also indicates that CDPKs could function directly by regulating the activity of transcription factors rather than regulating their expression (Boudsocq et al., 2010; Zhu et al., 2007).
Oxidative burst
The rapid production of Reactive Oxygen Species (ROS), termed the “oxidative burst”, following pathogen recognition has long been known to be a hallmark of successful pathogen recognition and activation of defense responses (Lamb and Dixon, 1997).
Infection by avirulent pathogens elicits biphasic ROS accumulation with a transient but robust first phase that occurs immediately after interaction followed by a more sustained, higher amplitude second phase that correlates with establishment of resistance (Lamb and Dixon, 1997). However, only the first transient ROS accumulation has been observed after infection by virulent pathogens, suggesting that the first phase of ROS production is a general response to recognition of pathogens. Consistent with this, bacterial and fungal PAMPs have been shown to trigger ROS accumulation in the apoplast (Felix et al., 1999; Kaku et al., 2006).
10 The NADPH oxidase, localized at the plasma membrane, is the main source of pathogen-induced apoplastic ROS production in plants (Torres and Dangl, 2005). In
Arabidopsis, the enzymatic subunit of NADPH oxidase is encoded by a family of 10
Respiratory burst oxidase homolog (Rboh) genes (Torres and Dangl, 2005). A MAPK phosphorylation cascade has been shown to be important in regulating ROS production by NADPH oxidase (Asai et al., 2008). Conversely, ROS can also activate MAPK cascade forming a feedback circuit (Kovtun et al., 2000).
Many functions of ROS in response to pathogens have been identified. The best characterized role for ROS is in the establishment of the hypersensitive response (HR), which is a landmark for resistance against avirulent pathogens (Mur et al., 2008). ROS plays an important role in amplifying salicylic acid (SA) signaling, contributing to the establishment of systemic acquired resistance (SAR), which is essential for immunity during secondary infections (Durrant and Dong, 2004; Shirasu et al., 1997).
ROS also contributes to the strengthening of physical barriers to infection by cross- linking cell wall glycoproteins (Bradley et al., 1992; Lamb and Dixon, 1997). ROS production also causes changes in the cellular redox potential, leading to the activation of transcription factors necessary for expression of defense related genes (Mou et al.,
2003). Taken together, ROS production following PAMP perception and its role as a signaling molecule in activating defense gene responses indicate an essential function for ROS in establishing PTI.
MAPK signaling
Mitogen activated protein kinase (MAPK) signaling pathways are conserved phosphorelay cascades that transmit signals from extracellular stimuli into the eukaryotic
11 cell. The pathways regulate a variety of processes such as development, response to biotic and abiotic stimuli and programmed cell death. A basic MAPK module consists of a stimulus-activated MAPK kinase kinase (MAPKKK or MEKK), which phosphorylates a
MAPK kinase (MKK or MEK), which in turn phosphorylates a MAP kinase (MAPK or
MPK), which regulates activation of transcription factors leading to global transcriptional reprogramming (Fiil et al., 2009; Pitzschke et al., 2009).
In plants, the MAPK cascades involving the partially redundant MAPK3/6 and MAPK4 have been implicated in development as well as biotic and abiotic stress responses
(Andreasson and Ellis, 2010; CristinaRodriguez et al., 2010). The role of MAPK3/6 and
MAPK4 in the plant immune response has been extensively studied. MAPK3, MAPK4 and MAPK6 are rapidly and transiently activated by PAMPs (Asai et al., 2002; Droillard et al., 2004). MAPK3 and MAPK6, acting through the through the MKK9-MAPK3/6 cascade, have been shown to be essential for production of Camalexin, an antimicrobial product that restricts growth of the fungal pathogen Botyris cinerea in Arabidopsis (Ren et al., 2008). The MKK9-MAPK3/6 cascade also promotes essential signaling of the plant hormone ethylene by stabilizing the transcription factor EIN3 in the nucleus (Yoo et al., 2008). In the cytoplasm, MAPK3 and MAPK6 have been shown to positively regulate ethylene production by stabilizing the enzyme ACC synthase (ACS), required for ethylene biosynthesis in response to B. cinerea infection (Han et al., 2010; Liu and
Zhang, 2004). However, it is thought that another MKK, not MKK9, may participate in this function. While MAPK3 and MAPK6 positively regulate the immune response,
MAPK4 has been shown to negatively regulate defense signaling through a MEKK1,
MKK1/MKK2 and MAPK4 pathway by controlling the production of ROS (Gao et al.,
2008). Therefore, MAPK signaling is essential both for mounting a defense response and for limiting the response to appropriate levels.
12
Ethylene biosynthesis and signaling
Induction of ethylene biosynthesis is another early response of the plants to elicitation by
PAMPs (Felix et al., 1999). Ethylene biosynthesis involves the conversion of S-adenosyl methionine (SAM) to 1-amino-cyclopropane-1-carboxylic acid (ACC) by ACC synthase
(ACS), and the oxidative cleavage of ACC by ACC oxidase (ACO) to form ethylene
(Wang et al., 2002). While ACO is constitutively produced in most vegetative tissues,
ACS is produced only under conditions that require large amounts ethylene, making
ACS the rate limiting enzyme in ethylene biosynthesis (Wang et al., 2002). As discussed above, activation of MAPK3 and MAPK6 by PAMPs stabilizes two ACS isoforms,
ACS2/ACS6, by phosphorylation, leading to an increase in ethylene production (Han et al., 2010; Liu and Zhang, 2004).
In Arabidopsis, ethylene perception by its receptors cause inactivation of a negative regulator, CONSTITUTIVE TRIPLE RESPONSE1 (CTR1), leading to the activation of the downstream signaling component ETHYLENE INSENSISTIVE2 (EIN2) and accumulation of two homologous transcription factors ETHYLENE INSENSITIVE3
(EIN3) and EIN3-LIKE (EIL), which in turn activate the expression of downstream target genes (Stepanova and Alonso, 2009). A recent study showed that FLS2 is under direct transcriptional control by EIN3 and EIL (Boutrot et al., 2010). The study proposes a simple positive feedback model, where ethylene produced by flagellin (PAMP) activation positively regulates and maintains plasma membrane FLS2 levels. Another study demonstrated the role of ethylene signaling in callose deposition (discussed below) through the action of the MYB51 transcription factor (Clay et al., 2009). These evidences demonstrate the importance of ethylene in plant innate immune response.
13
Callose deposition
Callose is a 1-3 glucan polymer, which is deposited at the site of pathogen infection strengthening the cell wall and preventing or weakening pathogen entry. Callose deposition has long been correlated with the response of plants to elicitors of plant defense (Gómez-Gómez et al., 1999). Glucosinolates are secondary metabolites important for resistance against a variety of bacterial, fungal and insect pathogens
(Brader et al., 2001; Hiruma et al., 2010; Pfalz et al., 2009). A recent seminal study in
Arabidopsis identified a new role for the glucosinolate metabolic pathway in PAMP- mediated callose deposition (Clay et al., 2009). The study showed that callose deposition in response to PAMPs requires indole glucosinolate (IGS) biosynthesis and that the transcription factor MYB51, acting downstream of ethylene signaling, regulates
IGS biosynthesis.
Systemic acquired resistance
Systemic acquired resistance (SAR) is the spread of resistance to distant parts of the plant body following a localized pathogen infection. It is characterized by the expression of diverse groups of genes called pathogenesis-related (PR) genes (Durrant and Dong,
2004; van Loon et al., 2006). PR genes are used as reliable molecular markers for the onset of SAR in plant-pathogen studies (Ryals et al., 1996). Early studies have established the requirement of a small phenolic compound, salicylic acid (SA), in systemic tissues for the activation of SAR (Gaffney et al., 1993; Malamy et al., 1990;
Métraux et al., 1990; Ryals et al., 1996). Following pathogen infection, SA accumulates in local and systemic tissues activating defense signaling.
14 SA in plants can be synthesized through two different pathways from the primary metabolite chorismate (Chen et al., 2009; Vlot et al., 2009). One pathway involves the conversion of the chorismate-derived phenylalanine to SA through a series of enzymatic reactions catalyzed by phenylalanine ammonia lyase (PAL) (Chen et al., 2009; Vlot et al., 2009). However, majority of SA biosynthesis during plant defense response has been shown to occur through another pathway, which involves the conversion of chorismate to isochorismate by the isochorismate synthase (ICS) (Wildermuth et al.,
2001). Isochorismate is eventually converted to SA though yet unidentified mechanisms
(Chen et al., 2009; Vlot et al., 2009). Two genes ICS1 and ICS2 encode for ICS in
Arabidopsis (Wildermuth et al., 2001). Mutant analysis indicates that ICS1 is accountable for ~90% of the SA biosynthesis during pathogen response (Wildermuth et al., 2001).
Four different mutant screens to identify mutants impaired in the SA signal transduction pathway identified multiple alleles of a key regulator of SAR, NONEXPRESSOR OF PR1
(NPR1) (Cao et al., 1994; Delaney et al., 1995; Glazebrook et al., 1996; Shah et al.,
1997). Through elegant biochemical experiments Mou et al. (Mou et al., 2003) showed that in the absence of pathogens, NPR1 exists in the cytoplasm as an oligomer formed by intermolecular disulfide bonds and that upon pathogen challenge, SA accumulation causes a change in the cellular redox potential resulting in reduction of NPR1 into monomers which then translocate into the nucleus to activate SAR. In the nucleus,
NPR1 has been shown to interact with TGA transcription factors, regulating gene expression (Zhang et al., 1999; Zhang et al., 2003). In addition to PR gene expression,
NPR1 had been shown to regulate expression of WRKY transcription factors and also induce expression of components of the secretory pathway thereby preparing the
15 cellular machinery necessary for secretion of PR proteins (Wang et al., 2006; Wang et al., 2005).
A recent study using microarray experiments and clustering analysis demonstrated the interplay between SA and PTI (Tsuda et al., 2008). The study showed significant overlap between PAMP-induced and SA-induced gene expression and a partial dependence of
PAMP-induced gene expression on SA accumulation. They showed that SA accumulated in an ICS1 dependent manner in response to PAMP treatment, highlighting the importance of SA accumulation and hence SA signaling in PTI.
1.6 Stem cell-mediated immunity
The shoot apical meristem (SAM) is a reservoir of disease-free stem cells in plants from which whole plants can be regenerated (Jun et al., 2008). The molecular basis for stem cell immunity was unknown until recently when a group working on identifying receptor- like kinases involved in peptide signaling in the SAM discovered that the CLAVATA3 peptide (CLV3p), which plays an important role in maintaining the stem cell reservoir, elicits responses similar to flg22 in mesophyll protoplasts (Lee et al., 2011). They showed that CLV3p signals through the flg22 receptor FLS2 to provide constitutive immunity in the SAM against various pathogens. The research highlights the importance of the innate immune response and opens up new venues for research in plant disease resistance.
16 1.7 A role for the endomembrane systems in plant immunity
Overview of the plant endomembrane system and its function
The endoplasmic reticulum (ER) is the largest component of the endomembrane system in a eukaryotic cell. It is a major part of the secretory system comprised of ER, Golgi, vesicles, plasma membrane and hydrolytic compartments such as the vacuole. The ER, placed at the beginning of the secretory pathway, plays a crucial role in optimizing folding and assembly of proteins targeted for secretion and degradation of unassembled proteins (Vembar and Brodsky, 2008; Vitale and Denecke, 1999). Secreted proteins like a subset of the PR proteins have been long known to be important for disease resistance in plants (Stintzi et al., 1993). They comprise 17 families of proteins with broad structural and functional diversity (van Loon et al., 2006). They are induced upon development of Systemic Acquired Resistance (SAR) in both infected and non-infected tissues (Stintzi et al., 1993; van Loon et al., 2006). In addition to PR proteins, cell wall strengthening proteins are also secreted in response to pathogen infection.
Proteins targeted for secretion contain a N-terminal signal peptide. In a simplified model of translocation into the ER lumen, the signal peptide emerging from the ribosome is recognized by the signal recognition particle (SRP) (Galili et al., 1998). The ternary complex consisting of the ribosome, the SRP and the nascent polypeptide docks onto the ER with the help of the SRP receptor and SEC16 (Galili et al., 1998). After docking, the signal peptide is cleaved and the nascent polypeptide chain is pushed into the ER lumen (Galili et al., 1998).
Following translocation, the nascent peptide is folded and assembled with the help of ER resident molecular chaperones, which include BiP (Hsp 70 family), GRP94 (Hsp 90 family), protein disulfide isomerases (PDI), peptidyl-prolyl isomerases (PPI) and
17 calnexins and calreticulins, in a process called ER-quality control (ER-QC).
Glycosylation of asparagine residues (N-glycosylation) is a co-translational modifcation essential for all secreted proteins (Galili et al., 1998; Gupta and Tuteja, 2011).
Glysoylation plays an important role in the function of PRRs. It involves the transfer of
N-glycan to the nascent polypeptide chain by the oligosachcaryl transferase complex
(OST). The glycan chains are further processed by removal of glucose by glucosidase I and glucosidase II enzymes in the ER. The enzyme UDP-glucose:glycoprotein glucosyltransferase (UGGT) functions as a “folding-sensor” allowing properly folded proteins to proceed to the Golgi apparatus while the incompletely folded proteins are monoglucosylated by UGGT. The monoglucosylated glycoproteins interact with soluble calreticulins (CRTs) and membrane bound calnexins (CXNs), which assist in the proper folding of glycoproteins.
A large number of secretory proteins, including PR proteins, contain disulfide bonds that help them withstand the protease-rich extracellular environment. The oxidative environment of the ER lumen facilitates the formation of disulfide bonds while the PDIs and other thiol oxidoreductases catalyze and ensure their correct formation.
The cargo destined for secretion is further processed and sorted in the Golgi and vesicles from the Golgi carrying the processed cargo fuse with the plasma membrane.
Vesicle fusion is mediated by N-ethylmaleimide-sensitive factor adaptor protein receptors (SNAREs). A v-SNARE on the vesicle interacts with a complex formed by a t-
SNARE and a synaptosome-associated protein (SNAP) on the target membrane. This interaction forms a stable SNARE complex, which facilitates the fusion of vesicles with the target membrane.
18 The role of plant secretory pathway in the immune response was first recognized when components of the secretory pathway were found to be induced upon activation of SAR
(Wang et al., 2005). SA-induced expression of ER chaperones, such as BiP2 and
GRP94 as well as co-chaperones, CXNs, CRTs and PDIs, through the action of the master regulator of SAR, NPR1, is essential to prepare the cell machinery for the secretion of PR proteins such as PR1 (Wang et al., 2005).
ER-QC for receptor biogenesis
Recent studies have highlighted the importance of ER-QC in the biogenesis of pattern recognition receptors (Häweker et al., 2010; Li et al., 2009; Lu et al., 2009; Nekrasov et al., 2009; Saijo et al., 2009). Forward and reverse genetic screens by three groups identified various components in the ER-QC to be essential for the function of EFR, the
PRR for recognition of the PAMP EF-Tu. A reverse genetic screen for mutants impaired in PAMP-induced seedling growth inhibition (SGI) identified the Arabidopsis ortholog of stromal-derived factor-2 (SDF2) (Nekrasov et al., 2009). sdf2 loss-of-function mutants showed strong reduction in elf18-induced responses, while flg22 induced responses were only mildly reduced (Nekrasov et al., 2009). Further analysis showed that SDF2 exists in a complex in the ER with Hsp40 co-chaperone ERdj3B and chaperone BiPs and that the functional complex is essential for biogenesis and plasma membrane accumulation of EFR (Nekrasov et al., 2009). This screen also identified staurosporin and temperature-sensitive 3a (STT3A), which encodes a subunit of the OST complex essential for N-glycosylation of nascent polypentide chains, to be essential for EFR function. At the same time, a forward genetics screen by another group studying the role of N-glycosylation in plant immunity also identified STT3A and showed that N- glycosylation is indispensible for ligand binding and accumulation of EFR protein
19 (Häweker et al., 2010). Reverse genetics screens for elfin perception mutants also identified the co-chaperone Calreticulin 3 (CRT3), the CRT3 receptor ERD2b, the folding sensor UGGT, STT3A, and the and subunits of the ER protein glucosidase II highlighting the importance of ER-QC for EFR biogenesis and function (Li et al., 2009;
Lu et al., 2009; Saijo et al., 2009).
Taken together, these studies indicate that certain PRRs like EFR undergo strict quality control in the ER and that proper folding and glycosylation is essential for PAMP perception. Mutants in the ER-QC pathway are more susceptible to pathogens than efr mutants, indicating that proteins involved in quality control of EFR also control other yet unidentified aspects of plant immunity. While the components of ER-QC described in the above studies are essential for EFR biogenesis and function, they appear to be less important for FLS2. Further studies on flg22-insensitive mutants might shed light on the importance of ER-QC in FLS2 biogenesis and functioning.
Endocytosis
Endocytosis is a process by which the proteins in the plasma membrane are removed or recycled (Murphy et al., 2005). This process has been well studied in yeast and mammals, whereas in plants, endocytosis is a newly emerging field (Murphy et al.,
2005). Internalization of two RLKs, BRASSINOSTEROID INSENSITIVE1 (BRI1) and
BAK1, involved in brassinosteroid signaling is one such example (Russinova et al.,
2004). Unlike BRI1 and BAK1 endocytosis, which does not require ligand stimulation, ligand-induced endocytosis was observed for FLS2 upon stimulation by flg22 (Robatzek et al., 2006). The study showed that the kinase activity of FLS2 is essential for endocytosis and that FLS2 is degraded after endocytosis, indicating that endocytosis
20 might be a regulatory mechanism by the host cell for degrading activated receptors to control signaling (Robatzek et al., 2006). Similar to FLS2, the rice PRR Xa21 is also internalized by endocytosis (Chen et al., 2010). Lipopolysaccharides from the pathogen
Xanthomonas campestris were found to be endocytosed in tobacco cells (Gross et al.,
2005). Cryptogein, a known plant defense elicitor whose receptor is still unidentified, has also been shown to trigger endocytosis in BY-2 tobacco cells (Leborgne-Castel et al.,
2008). These evidences point towards an important function for endocytosis in plant immunity by regulating signaling from the activated receptors.
Vesicle transport in plant immune response
The large, diverse group of SNARE proteins and their associated proteins mediate vesicle trafficking between endomembrane system compartments (Sanderfoot et al.,
2000). The involvement of SNARE proteins during plant defense response was first recognized in a study using Arabidopsis as a model for non-host resistance to the barley powdery mildew pathogen Blumeria g. hordei (bgh) (Collins et al., 2003). In a forward genetic screen for mutants that showed increased susceptibility to bgh, indicated by an increase in fungal feeding structures (haustoria), PEN1 was identified. PEN1 encodes a plasma membrane localized protein that belongs to the syntaxin subfamily of SNAREs.
PEN1 was shown to function in a ternary SNARE complex driving vesicle fusion with the
SNARE adaptor protein SNAP33 and a subset of vesicle-associated membrane proteins
(VAMPs), VAMP721 and VAMP722 (Kwon et al., 2008). VAMP722/721 and SNAP33 are also important for developmental processes, implying functions for these proteins in different cellular processes (Kwon et al., 2008). In the above-mentioned genetic screen, two other proteins, PEN2 and PEN3, were identified. PEN2, a peroxisomal protein belonging to Arabidopsis family 1 glycosyl hydrolases (F1GHs) and PEN3, a plasma
21 membrane-localized ATP binding cassette (ABC) transporter, were found to function in a pathway independent of that of PEN1 in mediating resistance against fungal pathogens
(Kobae et al., 2006; Lipka et al., 2005).
Another plasma membrane syntaxin, SYP132, studied in Nicotiana benthamiana, has been shown to be important for restricting bacterial growth (Kalde et al., 2007). SYP132- silenced N. benthamiana plants are unable to secrete the anti-microbial protein PR1, making them more susceptible to bacterial infection (Kalde et al., 2007).
Indication of the importance of the plant secretory pathway in plant immune response comes from studies involving small RNAs (sRNAs). sRNAs are small non-coding RNAs that regulate transcriptional or post-transcriptional gene silencing (Vaucheret, 2006).
Depending on their biogenesis, sRNAs are classified into small interfering RNAs
(siRNAs) and microRNAs (miRNAs) (Vaucheret, 2006). They function in a RNA induced silencing complex (RISC) with Argonaute (AGO) proteins to induce silencing (Vaucheret,
2006). The role of sRNAs in anti-viral defense has been studied in plants (Ding and
Voinnet, 2007). However, the function of sRNAs in plant innate immune response to bacterial pathogens has been demonstrated only recently with the identification of a role for the miRNA miR393 in PTI (Navarro et al., 2006). miR393 is induced by PAMPs and it targets the receptors of the plant growth promoting hormone auxin for degradation, indicating that the plants prioritize defense signaling over growth (Navarro et al., 2006).
Most recently, studies by Zhang et al. (Zhang et al., 2011) showed that miR393b* targets a Golgi-localized SNARE protein MEMB12 for degradation. The study demonstrated that loss of function memb12 mutant plants secreted more PR1 proteins and displayed enhanced resistance to virulent and avirulent P. syringae strains. They hypothesize that
22 MEMB12 may be involved in retrograde trafficking from the Golgi to the ER and that during the immune response plants deploy the miRNA pathway to downregulate retrograde traffic in order to promote secretion of defense products. Taken together, these studies evidently demonstrate the importance of vesicle transport and membrane fusion in plant immune response to a broad range of pathogens.
1.8 Organelle movement during immune response
Not only does secretion through the endomembrane system change during response to infection, but the overall organization of the cell undergoes rearrangement. Sub-cellular components have been found to undergo dynamic reorganization at the site of infection/penetration. Early studies documented the aggregation of cytoplasm at the penetration sites (Freytag et al., 1994). Following this observation, pharmacological studies using drugs such as cytochalasins, which prevent actin polymerization, showed that cytoskeletal components are important for the cytoplasmic aggregation (Lipka and
Panstruga, 2005). Later, with the use of fluorescent-tagged markers for various cellular components and confocal microscopy, clearer evidences emerged for the formation of plasma membrane microdomains (Bhat et al., 2005) and dynamic reorganization of actin, microtubules, ER, Golgi apparatus (Takemoto et al., 2003) and peroxisomes
(Lipka et al., 2005) at the sites of infection. Most recently, focal concentration of components of vesicle trafficking, including PEN1, SNAP33 and VAMP721/722, were observed at the site of fungal infection (Kwon et al., 2008). Similar cellular reorganization was also observed during establishment of symbiosis in plants (Takemoto and Hardham,
2004). These studies define a unique role for the cellular machinery in orchestrating organellar movement and hence, a mechanism for facilitating molecular movement to the sites of infection during the plant immune response.
23
1.9 Effector triggered Immunity
In order to establish successful infection, pathogens need to fight against the arsenal unleashed by the plants. Pathogens respond by secreting effector proteins into the plant cell to dampen innate immunity. The effectors target and inactivate various components of the plant immune system. Effectors and their targets have been studied extensively using the Arabidopsis - P. syringae pathosystem. Below is a brief summary of the function of effectors in attenuating the plant innate immune response in this pathosystem.
A number of effectors from P. syringae have been identified that interfere with PTI in various ways. The effector AvrPtoB, which contains E3 ubiquitin ligase activity, targets the flagellin receptor FLS2 for degradation, dampening PTI (Göhre et al., 2008). Another effector, AvrPto, with yet unknown biochemical function binds the receptors FLS2 and
EFR to block PTI (Xiang et al., 2008). Both AvrPto and AvrPtoB also bind BAK1 and prevent its association with FLS2, thereby preventing the initiation of PTI (Shan et al.,
2008b). The effector HopF2 attenuates PTI signaling by reducing the phosphorylation of
BIK1 (Wu et al., 2011). HopF2 also targets PTI signaling by binding and inactivating a
MAP kinase kinase kinase, MKK5, involved in defense signaling through the MAPK cascade (Wang et al., 2010). Another effector targeting the MAPK cascade is HopAI1, a phosphothreonine lyase that has been shown to directly bind and inactivate MAPK3 and
MAPK6 by dephosphorylation (Zhang et al., 2007). The effector HopAO1, a tyrosine phosphatase, suppresses PTI, possibly through a pathway different from MAPK or downstream of MAPK3/6 activation (Underwood et al., 2007). The effector HopM1 targets and degrades the Arabidopsis protein AtMIN7, an ADP ribosylation factor (ARF)
24 guanine nucleotide exchange factor (GEF) protein, which functions as an important component of vesicle trafficking (Nomura et al., 2006).
Plants have developed a robust mechanism for sensing pathogenic effectors, involving the R proteins that mediate recognition of effectors. Currently, there are two models in the literature regarding the recognition of effectors. One is the “guard hypothesis” according to which the intracellular plant R proteins monitor the targets of effectors. The
R protein recognizes any modification on the target by the effectors (Block and Alfano,
2011; Collier and Moffett, 2009). Another hypothesis is the “decoy model” according to which the guarded effector target is not the operative target of effectors but a decoy that mimics the operative effector target (van der Hoorn and Kamoun, 2008). Following effector perception via R proteins, plants respond to the bacterial effector arsenal by activating a more heightened and sustained immune response called effector triggered immunity (ETI). However, some effectors have been shown to target not only the innate immune response but also ETI. During a successful invasion, the pathogen’s effectors attenuate both PTI and ETI and utilize the plant resources to establish infection. In case of an unsuccessful invasion but successful inhibition of PTI by the pathogen, ETI leads to a hypersensitive response (HR), resulting in localized cell death at the infected sites thus preventing spread of infection (Tsuda and Katagiri, 2010).
1.10 Hormonal cross talk in plant immune response
Similar to other biological processes in plants, cross talk between hormones modulates plant defense response at every stage. While the SA signaling cascade leads to defense against biotrophs, the phytohormones jasmonic acid (JA) and ethylene are important for resistance to necrotrophs (Glazebrook, 2005a). More recently, evidence has emerged
25 demonstrating the importance of the abiotic stress hormone abscisic acid (ABA) and developmental hormones auxin, gibberellic acid, cytokinin and brassinosteroids in the immune response (Robert-Seilaniantz et al., 2011). Earlier, we discussed the roles of ethylene and SA in PTI. In the following section, I will discuss recent literature highlighting the role of ABA in response to pathogens and recent advances in understanding the ABA signal transduction pathway.
ABA in plant immunity
The role of ABA in response to abiotic stress such as drought, salinity and cold is well established (Shinozaki et al., 2003; Xiong et al., 2002). Recent studies (discussed below) have shown that ABA also plays an important role in modulating plant defense response. The bacterial pathogen P. syringae enters plant cells through stomatal openings on the leaf surface. Melotto et al. (Melotto et al., 2006) uncovered the mechanism of pre-invasive stomatal defense response in Arabidopsis. Their study showed that upon perception of PAMPs or pathogens, stomata close as a first defense response to restrict pathogen entry. Previous studies in Arabidopsis have shown that
ABA triggers stomatal closure through the OPEN STOMATA1 (OST1) kinase (Mustilli et al., 2002; Schroeder et al., 2001). Melotto et al. (Melotto et al., 2006) showed that the pathogen triggered stomatal closure requires ABA and the ABA signal transduction pathway through the OST1 kinase. Using SA deficient transgenic plants and SA biosynthetic mutant plants, they showed that the stomata closure is also dependent on
SA-induced defense responses. The bacteria counteract this response by secreting a virulence factor, coronatine, which causes the stomata to reopen (Figure 1.4). While
ABA is essential during pre-invasive defense response for restricting pathogen entry into the plant leaf, during later stages of infection, ABA acts antagonistically to SA and
26 restrict PAMP triggered immunity. Microarray analysis showed that type III effectors secreted by the virulent bacteria P. syringae induce the expression of genes in the ABA biosynthesis and signaling pathways (De Torres-Zabala et al., 2007). Consistently, ABA levels were significantly higher in plants infected with P. syringae than in the avirulent P. syringae strain hrpA, which is defective in secreting type III effectors (De Torres-Zabala et al., 2007). Later on, another study using mutants deficient in ABA and SA biosynthesis showed that ABA is essential for virulence of P. syringae and that it acts by negatively regulating SA mediated defense response (De Torres Zabala et al., 2009). SA mediated defense gene expression is important for PTI and type III effectors target SA signaling and attenuate the response by increasing ABA production in the infected cells
(De Torres Zabala et al., 2009). Around the same time, another group demonstrated that
ABA negatively regulates SAR at multiple steps by inhibiting pathways upstream and downstream of SA accumulation (Yasuda et al., 2008). They also analyzed the inverse relationship between ABA and SAR and showed that SAR inhibits components of ABA signaling. These studies indicate that the hormonal cross talk between ABA and SA signaling pathways occurs at multiple levels, possibly through feedback mechanisms, to modulate plant pathogen interactions (Figure 1.5).
Consistent with the demonstrated ABA-SA antagonism, a very recent study using
DFPM, a small molecule antagonist of ABA signaling, showed that the activation of SA- independent plant immune response interferes with ABA signal transduction (Kim et al.,
2011).
27 ABA perception and signaling
ABA has been established as an important stress hormone in plants. However, the receptor for ABA has been elusive for a long time, which was a big impediment to our understanding of ABA perception and signaling during various stress responses. A major breakthrough in the field came from the recent identification of the PYRABACTIN (4- bromo-N-[pyridin-2-yl methyl]naphthalene-1-sulfonamide) RESISTANCE
(PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family of ABA receptors simultaneously by different groups (Ma et al., 2009; Nishimura et al., 2010;
Park et al., 2009; Santiago et al., 2009). Two groups identified ABA receptors by employing yeast two hybrid library screens using known components of early ABA signal transduction pathways, protein phosphatases type 2C (PP2Cs) - ABA INSENSITIVE 1
(ABI1) and HOMOLOGY TO ABI1 (HAB1), as baits (Ma et al., 2009; Santiago et al.,
2009). The other group devised a powerful chemical genetics strategy and used pyrabactin, a selective agonist of ABA signaling, to identify the ABA receptor family
(Park et al., 2009). Based on these evidences, the current model of the core ABA signaling module comprises of (1) the ABA receptors PYRs/RCARs, (2) the negative regulators PP2Cs and (3) the positive regulators SNF1-related protein kinase 2s
(SnRK2s) (Hubbard et al., 2010). In the absence of ABA, PYRs/RCARs exist as dimers and PP2Cs repress SnRK2 activity, preventing ABA signaling (Hubbard et al., 2010).
Binding of ABA causes the PYRs/RCARs to dissociate and form ABA-PYR/RCAR-PP2C complexes, which inhibits PP2C repression of SnRK2 (Hubbard et al., 2010). This allows
SnRK2s to activate downstream ABA signaling components (Hubbard et al., 2010).
In addition to PYR/RCAR family of receptors, two G-protein coupled receptor (GPCR) type G proteins (GTGs) in Arabidopsis have been proposed to function as ABA receptors (Pandey et al., 2009), indicating the possibility of existence of multiple ABA
28 perception mechanisms. The recent identification of ABA receptors has opened up exiting new opportunities for research. Do the PYR/RCAR and GTG signal transduction pathways converge? If they do, what is the point of convergence? Is one pathway preferred over the other depending upon different stress conditions (biotic versus abiotic)? A recent study showed that innate immune signaling negatively regulates ABA signal transduction (Kim et al., 2011). The study also showed that the PYR/RCAR pathway is not affected by immune signaling. Is the ABA perception and signaling through the GTGs affected during immune response? Future research addressing these questions will shed more light on the hormonal control of plant stress response.
29
Figure 1.1 Overview of the plant immune response
Plant PRRs recognize PAMPs through their extracellular domain in the apoplast and activate PTI. Pathogens secrete effectors to inactivate components of PTI. The plant R proteins recognize effectors and activate effector triggered immune response.
30
Figure 1.2 A schematic representation of initiation of PTI signaling
In the absence of flagellin, FLS2 and BAK1 do not interact and BIK1 is associated with
FLS2 and BAK1 in an inactive state. Upon binding to flagellin, FLS2 undergoes a conformation change causing FLS2 to interact with BAK1 forming a FLS2-BAK1-BIK1 complex. BAK1 in the FLS2-BAK1-BIK1 complex, phosphorylates BIK1. BIK1 in turn phosphorylates FLS2-BAK1 complex. The phosphorylated FLS2-BIK1 complex further phosphorylates BIK1. The fully active BIK1 is then released from the complex to activate downstream targets.
31
Figure 1.3 A schematic representation of various components of PTI signaling
For details see text. Arrows indicate positive regulation.
32
Figure 1.4 The role of ABA in pre-invasive immunity
Recognition of PAMPs results in ABA-dependent closure of stomata. SA plays a positive role in regulating stomatal closure. Pathogens employ coronotine to reopen the stomata and gain entry into the leaf apoplast. Arrows indicate positive regulation and blunt ends indicate negative regulation.
33
Figure 1.5 Cross talk between ABA and SA in immune response
The effectors promote the biosynthesis of ABA. ABA inhibits SA signaling at various levels to promote virulence. Conversely, SA signaling prevents ABA signaling to promote immunity against pathogens. SA-independent immune responses also function to antagonize ABA signaling. Arrows indicate positive regulation and blunt ends indicate negative regulation.
34
CHAPTER 2
The Arabidopsis PAMP INDUCED COILED-COIL is a tail-anchored, long coiled-coil ER protein involved in PAMP triggered immunity
35
2.1 INTRODUCTION
Coiled-coil domains are protein domains that consist of two or more helices that wrap around each other to form a super-coil (Andrei, 1996; Burkhard et al., 2001). The primary polypeptide structure forming a left-handed coiled-coil is typically characterized by a heptad repeat pattern (abcdefg) n, where n is the number of repeats (Andrei,
1996). Positions a and d are occupied preferentially by hydrophobic amino acids which provide the binding energy to form the coiled-coil through hydrophobic interactions.
Polar/charged residues, typically found at positions e and g, contribute to the stability and specificity of binding (Andrei, 1996; Mason and Arndt, 2004). The assembly of coiled-coils is modulated by multiple factors such as ionic interactions, pH of the environment, temperature, metal ions and phosphorylation state of the constituent residues, which make them suitable for versatile functions (Burkhard et al., 2001;
Robson Marsden and Kros, 2010).
Coiled-coils are ubiquitous protein motifs predicted to be present in ~10% of all proteins in eukaryotes (Burkhard et al., 2001). Coiled-coil proteins can roughly be divided into two classes (Rose et al., 2004). Short coiled-coils, containing coiled-coil domains of six or seven heptad repeats, such as those found in the basic region leucine zipper (bZIP) family of transcription factors. In these cases, the coiled-coil domains mediate homo- and hetero-dimerization of the bZIP proteins and play an important role in regulating their activity as transcription factors (Vinson et al.). Short coiled-coiled proteins are also involved in vesicle fusion. N-ethylmaleimide-sensitive factor attachment protein receptor
(SNARE) proteins mediates the fusion of vesicles to their destination compartments by
36 forming a tetrameric coiled-coiled structure (Lin and Scheller, 2000; Sutton et al., 1998).
In contrast, long coiled-coil domains, composed of several hundred amino acids and are found in functionally diverse proteins (Rose et al., 2004). For example, long coiled-coil domains form the structural units of intermediate filament (IF) proteins, which are one of the three eukaryotic cytoskeletal elements. One of the most abundant coiled-coil proteins is the IF protein -keratin, the core structural unit of mammalian hair (Crick,
1953; Pauling and Corey, 1953). Long coiled-coil proteins have been shown to be essential for organelle architecture. Examples of such proteins involved in nuclear architecture animals and yeast include the structural maintenance of chromosome
(SMC) proteins (Jessberger, 2002; Losada and Hirano, 2005), nuclear mitotic apparatus protein (NuMa) (Radulescu and Cleveland, 2010; Yang et al., 1992) and nuclear lamins
(Dechat et al., 2010; Goldman et al., 2002). Golgins are a family of proteins that localize to the cytoplasmic surface of the Golgi apparatus and have extensive coiled-coil domains (up to 90%) (Gillingham and Munro, 2003). They collectively function to maintain Golgi architecture and regulate vesicle trafficking through their coiled-coil domains (Goud and Gleeson, 2010). Long coiled-coil domains are also found as stalk domains in cytoskeletal motor proteins - myosins, kinesins and dyneins - that undergo large conformational changes (Burkhard et al., 2001; Robson Marsden and Kros, 2010;
Schliwa and Woehlke, 2003). The coiled-coil domains in these proteins play a dynamic role in modulating conformational changes and oligomerization. The coiled-coil domain is not restricted to eukaryotes. Coiled-coil domains in lipoproteins of gram-negative bacteria function as spacers separating the outer membrane from the cell wall (Shu et al., 2000). The above examples illustrate the functional diversity of long coiled-coil proteins in animals, yeast, and prokaryotes.
37 Significantly less is known about the function of long coiled-coil proteins in plants. In
Arabidopsis, 286 proteins are predicted to have long coiled-coil domains (Rose et al.,
2004). However, only very few have been functionally investigated. Plant homologs of the mammalian SMCs have been characterized (Liu et al., 2002; Siddiqui et al., 2003;
Watanabe et al., 2009). Large families of myosins and kinesins have been studied in plants (Jakoby et al., 2002; Lee and Liu, 2004; Lipka et al., 2007). While these plant coiled-coil proteins have functional homologs in other systems, novel studies highlight the importance of plant-specific long coiled-coil proteins in various cellular processes.
Recently, a family of WPP interacting proteins (WIPs) comprising of WIP1, WIP2 and
WIP3, was identified as interacting partners for Ran GTPase Activating Protein 1
(RanGAP1) (Xu et al., 2007a). Proteins belonging to the WIP family contain long coiled- coil domains, which mediate their interaction with RanGAP1 (Xu et al., 2007a). The
WIPs function as tethers anchoring RanGAP1 to the nuclear envelope in undifferentiated root cells (Xu et al., 2007a). MAR binding filament-like protein 1 (MFP1) is a long coiled- coil protein associated with nucleiods and thylakoid membranes of the chloroplast
(Jeong et al., 2003). COP1 interacting protein (CIP1) is a cytoskeleton-associated long coiled-coil protein that interacts with the constitutive photomorphogenic protein (COP1), which negatively regulates photomorphogenesis (Matsui et al., 1995; Yi and Deng,
2005). The long coiled-coil domain of Chloroplast Unusual Positioning 1 (CHUP1) anchors the chloroplast to the plasma membrane. Two long coiled-coil proteins, weak chloroplast movement under blue light 1 (WEB1) and plastid movement impaired 2
(PMI2) are involved in maintaining the velocity of chloroplast photorelocation movement in Arabidopsis (Kodama et al., 2010). None of these proteins has homologs outside the plant lineage.
38 The discovery of plant-specific coiled-coil proteins and their functional characterization suggests that some of the currently still uncharacterized proteins might be involved in plant specific processes such as photosynthesis, plant-specific aspects of cytokinesis or plant defense mechanisms. While having some similarity to the immune response in animal systems, the plant immune response also has many unique features (Ausubel,
2005; Nürnberger et al., 2004; Postel and Kemmerling, 2009). Unlike animals, plants lack an adaptive immune system of circulating lymphocytes and respond to pathogens in a cell-autonomous manner (Nürnberger et al., 2004). Plants have a highly sensitive system for perceiving pathogen attack, which consists of multiple layers. The first layer involves the recognition of pathogen associated molecular patterns (PAMPs) or microbe associated molecular patterns (MAMPs), which are conserved molecular components present across a broad range of microorganisms and essential for the microbial life style
(Boller and Felix, 2009). Bacterial flagellin, elongation factor-Tu (EF-Tu), lipopolysachcarides and fungal chitin are some examples of PAMPs that are recognized by plants (Boller and Felix, 2009; Felix et al., 1999; Hamel and Beaudoin, 2010; Kunze et al., 2004). Pattern recognition receptors (PRRs), present on the surface of plant cells, detect the presence of PAMPs and activate the first layer of defense called PAMP triggered immunity (PTI). Pathogens counteract PTI by secreting type III effector proteins
(T3E) into the host plant cytoplasm through a type III protein secretion system (T3SS)
(Collmer et al., 2000). T3Es target various components of the plant immune system resulting in the suppression of immunity. In turn, intracellular nucleotide-binding leucine- rich-repeat (NB-LRR) resistance (R) proteins recognize T3Es and respond by eliciting effector triggered immunity (ETI), a more heightened and sustained immune response that potentially restricts the growth of pathogens.
39 Flagellin, the building block of the bacterial flagellar filament, is the best-characterized
PAMP among the elicitors (Felix et al., 1999). The most conserved N-terminal 22 amino acid epitope of flagellin, flg22, is sufficient to induce PTI in most plant species (Felix et al., 1999). flg22 is recognized in Arabidopsis by the PRR FLS2 (Gomez-Gomez and
Boller, 2000). PTI initiation by FLS2 and other PRRs results in signaling events and defense responses such as generation of reactive oxygen species (ROS), accumulation of the plant hormones ethylene and salicylic acid (SA), activation of mitogen activated protein kinase (MAPK) signaling cascades, global transcriptional reprogramming, secretion of anti-microbial compounds, and callose deposition at the cell wall. PTI eventually results in effective resistance against potentially pathogenic bacteria.
Bacterial strains such as the hrcC mutant of P. syringae pv. tomato DC3000
(PstDC3000) are defective in secreting effectors into the plant cell and therefore, the PTI response induced by hrcC is sufficient to restrict the growth of hrcC in plants (Roine et al., 1997; Truman et al., 2006; Yuan and He, 1996).
In this study, we report the characterization of a family of the two plant-specific long coiled-coil proteins PAMP INDUCED COILED COIL (PICC) and PICC-like (PICL). PICC gene expression is rapidly induced by PAMPs and a picc null mutant shows compromised resistance against hrcC bacteria, indicating a role for PICC in PTI. PICC and PICL are both endoplasmic reticulum (ER) localized tail-anchored proteins with their long coiled-coil domains facing the cytoplasm. While PICL is not induced by PAMPs, and appears to play no role in PTI, both picc and picl mutations modulate post-germination
ABA responses.
40
2.2 RESULTS
Identifying putative membrane-associated long coiled-coil proteins in Arabidopsis
PICC and PICL were identified in a genome-wide screen for Arabidopsis long coiled-coil proteins with one or more putative transmembrane domains (TMDs). The ARABI-COIL
(http://www.coiled-coil.org/arabidopsis) database was used to identify and sort long coiled-coil proteins in the predicted Arabidopsis proteome (Rose et al., 2004). The filter parameters were set to identify genes that are at least 500 amino acid long with at least
25% coiled-coil coverage and containing at least one predicted transmembrane domain
(Rose et al., 2004). Among the fourteen predicted proteins that were identified using the above criteria, PICC, encoded by At2g32240, has the highest coiled-coil coverage
(79.5%). A close homolog PICL, encoded by At1g05320, was also identified based on the above-described criteria. PICC and PICL share 50% identity and 63% similarity at the amino acid level (Figure 2.1A). Querying the protein basic local alignment search tool (BLAST) non-redundant (nr) database, orthologs of PICC and PICL were found exclusively in vascular plants and no orthologs were found in non-vascular plants and non-plant organisms (Figure 2.2). Based on the phylogenetic relationships shown in
Figure 2.3, it is not possible to determine whether the orthologs in other plant species are more closely related to PICC or PICL.
41 PICC and PICL are tail-anchored proteins that are located at the endoplasmic reticulum (ER)
PICC and PICL are located at the ER
The predicted TMD in PICL and PICC is located 4 amino acids from the C-terminus
(Figure 2.1B). To investigate the subcellular location of PICC and PICL, GFP-PICC and
GFP-PICL fusion proteins were transiently expressed under the control of the
Cauliflower mosaic virus 35S promoter in Nicotiana benthamiana leaf epidermal cells and GFP fluorescence was determined by confocal laser scanning microscopy. The proteins were coexpressed with the ER marker HDEL-mCherry. GFP-PICC and GFP-
PICL labeled a sharp reticulate network pattern and colocalized with the ER marker
(Figure 2.4B). To test if a C-terminal fragment of 31 amino acids, (transmembrane domain fragment, TDF) that contains the transmembrane domain and the 4 amino-acid tail is sufficient for ER localization, the GFP-tagged partial proteins GFP-TDFPICC and
GFP-TDFPICL (Figure 2.4A) were generated. In addition, GFP-fused partial proteins without the TDF, GFP-PICCΔTDF and GFP-PICLΔTDF (Figure 2.4A) were generated.
The four proteins were transiently coexpressed with HDEL-mCherry in N. benthamiana.
GFP-TDFPICC and GFP-TDFPICL colocalized with the ER-marker. In contrast, GFP-
PICCΔTDF and GFP-PICLΔTDF were not located at the ER but were found diffusely distributed in the cytoplasm (Figure 2.4B).
To confirm the localization patterns in Arabidopsis, individual transgenic Arabidopsis lines expressing GFP-PICC, GFP-PICL, GFP-TDFPICC, GFP-TDFPICL GFP-PICCΔTDF and GFP-PICLΔTDF were created and at least eight independent T1 transgenic plants for each transgene were imaged. Confirming the localization results obtained in the transient expression experiment, GFP-PICL and GFP-PICC showed the typical reticulate
42 ER localization signals. The TDF domains of both proteins were sufficient to target GFP to the ER. Deleting the TDF of PICL abolished ER targeting, as observed in the transient experiment (Figure 2.4B). Transgenic lines expressing GFP-PICCΔTDF could not be recovered, possibly either because PICCTDF is rapidly degraded or because its expression is deleterious to plants. Taken together, the localization data from N. benthamiana and Arabidopsis show that PICL and PICC are ER-associated proteins and the TDF domain is necessary and sufficient for ER localization.
The N-terminal long coiled-coil domains of PICC and PICL are cytosolic
The position of the single transmembrane domain close to the C-terminus, the absence of any N-terminal signal sequence and the targeting of PICC and PICL to the ER by the
TDF indicate that these proteins are tail-anchored (TA) proteins (Borgese et al., 2003;
Pedrazzini, 2009). TA proteins are post-translationally inserted into their target membranes by a single transmembrane domain within the C-terminal 50 residues
(Borgese et al., 2003; Kriechbaumer et al., 2009). TA proteins are characterized by N- terminal functional domains facing the cytoplasm and a short C-terminal tail protruding into the organellar lumen/matrix (Borgese et al., 2003; Pedrazzini, 2009). In order to determine the topology of PICC and PICL at the ER membrane, a protease protection assay was performed with isolated microsomes. Microsomes were isolated from N. benthamiana leaves transiently expressing the fusion proteins GFP-TDFPICC and GFP-
TDFPICL. Since the localization of GFP-TDFPICC and GFP-TDFPICL is similar to the localization of GFP-PICC and GFP-PICL in both N. benthamiana and Arabidopsis
(Figure 2.4B), the results from this experiment were extrapolated to determine the topology of PICC and PICL. ER-resident GFP-fusion proteins with known topology, GFP-
Calnexin (GFP-CXN, with GFP facing the ER lumen) and CXN- photoactivatable GFP
43 (CXN-PAGFP, with PAGFP facing the cytoplasm) were used as controls (Runions et al.,
2006; Sparkes et al., 2010). Immunoblot analysis using an anti-GFP antibody indicated that GFP in GFP-TDFPICC and GFP-TDFPICL was hydrolysed by proteinase K, whereas the GFP facing the lumen in GFP-CXN was protected from proteinase K (Figure 2.5).
This demonstrates that the N-terminal GFP tethered to the ER by TDFPICC or TDFPICL is facing the cytoplasm, indicating that the N-terminus of PICC and PICL faces the cytoplasm. Together, these data indicate that PICC and PICL are ER localized, tail- anchored proteins with the N-terminal long coiled-coil domains facing the cytoplasm.
PICC forms homodimers and does not interact with PICL
Coiled-coil proteins are known to form homo and hetero-oligomers through specific interactions mediated by their coiled-coil domains (Bruce, 2002; Strauss and Keller,
2008). Since PICC and PICL have long coiled-coil domains, the proteins were tested for homo- and heterodimerization using a split-ubiquitin membrane yeast two-hybrid system
(Iyer et al., 2005). In the split-ubiquitin system, an artificial transcription factor (TF) consisting of the LexA DNA binding domain and the VP16 transactivator protein linked to
C-terminal moiety of ubiquitin (Cub) is fused to one of the transmembrane proteins and
N-terminal moiety of ubiquitin (Nub) is fused to the other transmembrane protein (Iyer et al., 2005). When expressed alone, the TF-Cub is anchored to the membrane by the transmembrane protein and cannot enter the nucleus to activate reporter genes (Iyer et al., 2005). In the event of interaction with the protein fused to Nub, a functional ubiquitin moiety is reconstituted which is recognized by ubiquitin proteases (UBPs) (Iyer et al.,
2005). This results in release of the TF from the Cub, which can then enter the nucleus and activate the expression of reporter genes (Iyer et al., 2005). To test for homo- and hetero-dimerization, Cub and Nub fusion proteins Cub-PICC, Cub-PICL, Nub-PICC and
44 Nub-PICL were generated. Pairwise interactions of PICC (Cub or Nub) with PICL (Cub or Nub) and homodimerization of PICC and PICL were tested in yeast by measuring the
-galactosidase activity of the LacZ reporter (Figure 2.6). The interactions of Cub-PICC with Nub and Cub-PICL with Nub and of Cub-PICC and Cub-PICL with the unrelated protein Alg5-Nub were used as negative controls. The results shown in Figure 2.6 indicate that PICC can form homodimers or homo-oligomers, while no evidence for either PICL homodimerization or interaction of PICC with PICL was observed.
PICC and PICL are expressed in various tissues throughout the development of the plant
To analyze the spatial and temporal expression pattern of PICC and PICL, Arabidopsis transgenic plants carrying the reporter gene -glucuronidase (GUS) driven by either 1.0 kb upstream of the start codon (ATG) of PICL (pPICL) or 2 kb upstream of the start codon of PICC (pPICC) were generated. At least five independent T2 transgenic lines each were analyzed for GUS activity in various organs during different stages of development, from the seedling stage through flowering and maturation of seeds. pPICL::GUS expression was detected in the vascular tissue of cotyledons and roots of
7-day old seedlings, in the vascular tissue of juvenile rosette leaves, in the hydathodes of cotyledons and leaves, and in nodal junction (Figure 2.7B). While pPICL::GUS expression was restricted to vegetative organs, pPICC::GUS showed a more ubiquitous expression pattern. Similar to pPICL::GUS, pPICC::GUS expression was detected in the vasculature of cotelydons and roots of 7-day old seedlings, in the vasculature of juvenile rosette leaves, in the hydathodes of cotyledons and leaves, and in nodal junctions
(Figure 2.7A). Additionally, expression was observed in leaf trichomes and floral organs.
In particular, pPICC::GUS expression was seen in the abscission zone at the base of
45 flowers and siliques, in the vasculature of sepals and petals, and in the stamens (Figure
2.7A). Taken together, PICC and PICL have overlapping expression patterns in the vegetative tissues and differential expression patterns in the floral tissues.
T-DNA insertion alleles of PICC and PICL
A reverse genetics approach was adopted to investigate the function of PICC and PICL.
Towards this end, one T-DNA insertion allele for PICL, picl-1 (SALK_56040), and two T-
DNA insertion alleles for PICC, picc-1 (SALK_58801) and picc-2 (SALK_139836) were acquired from the ABRC (Figure 2.8A). picl-1 has a T-DNA insertion in the last (6th) exon
58 bp upstream of the region encoding the transmembrane domain. picc-1 has an insertion within the 2nd exon. picc-2 also has an insertion within the 2nd exon, 837 bp downstream of the picc-1 insertion site.
A rabbit polyclonal anti-PICC/PICL antibody, which recognizes both PICC and PICL, was generated using as antigen a 100 aa epitope conserved in both the proteins. The anti-
PICC/PICL antibody detects the wild type (WT) PICL protein with an extrapolated mass of ~90 kDa and the WT PICC protein with an extrapolated mass of ~160 kDa (Figure
2.8B). Immunoblot analysis of protein extracts from the T-DNA insertion lines using the anti-PICC/PICL antibody showed that a truncated PICL (tr.PICL) of ~80-85 kDa, and a truncated PICC (tr.PICC) of ~55-60 kDa were produced in picl-1 and picc-1 plants, whereas no PICC protein was detected in picc-2 (Figure 2.8B). The bands representing the truncated proteins were weaker than the WT PICL and PICC bands, indicating reduced protein abundance in addition to truncation (Figure 2.8B). Moreover, the insertion in picc-1 results in the loss of ~2/3rd of the PICC protein and hence, picc-1 is likely a functionally null allele. However, the insertion in picl-1 results in the loss of only a
46 minor portion of PICL (~7-8%). Based on the insertion site in picl-1, we predicted that the transmembrane domain is not present in the truncated PICL protein. Subcellular fractionation using total protein extracts of picl-1 confirmed that tr.PICL is soluble and not associated with membranes (Figure 2.8C). The loss of membrane association of tr.PICL in the picl-1 mutant indicates that picl-1 is a null allele for membrane-associated functions. The major truncation and significantly reduced abundance of PICC in picc-1 and the absence of detectable PICC in picc-2 suggests that picc-1 and picc-2 are likely functionally null alleles.
PICL and PICC are encoded by paralogous genes and have 50% amino acid sequence identity as well as a similar domain structure, localization and topology. Therefore, we predicted that there is a high probability of functional overlap between the two proteins.
Thus, a picl-1;picc-1 double mutant was generated by crossing homozygous picl-1 and picc-1 mutant lines. Since picc-1 was the first allele to be selected, most of our analysis was conducted with the picc-1 mutant allele alongside picl-1, WT and the double mutant picc-1:picl-1.
picc-1, picc-2, picl-1 and picc-1:picl-1 mutant plants are hypersensitive to ABA during post-germination growth
The appearance of the single mutants picc-1, picc-2, picl-1 and the double mutant picc-
1;picl-1 was indistinguishable from WT throughout the development of Arabidopsis, indicating that PICC and PICL functions are dispensable for plant development under standard laboratory growth conditions. Plants in their natural environment are exposed to a variety of abiotic and biotic stress conditions such as drought, high salinity, temperature variations etc. To test whether PICC and PICL are important for Arabidopsis
47 to cope with stress conditions, we investigated the response of picc-1, picl-1 and picc-
1;picl-1 plants under osmotic and salt stress conditions. Germination and post- germination seedling growth were investigated on medium containing 50 mM, 100 mM or 150 mM NaCl (salt-stress), or 100 mM, 200 mM or 300 mM mannitol (osmotic stress). picc-1, picl-1 and picc-1;picl-1 germination and seedling growth was indistinguishable from WT (data not shown). To investigate hormonal stress response, WT and mutant picc-1, picc-2, picl-1 and picc-1;picl-1 seeds were analyzed for germination and post- germination seedling growth on medium containing 1.2, 1.4, and 1.6 M abscisic acid
(ABA). Although the rate of germination of all the mutants was similar to WT, all the mutant plants showed hypersensitivity to ABA during the post-germination growth
(Figure 2.9). picc-1, picc-2, picl-1 and picc-1;picl-1 showed a lower percentage of green and expanded cotyledons compared to the WT (Figure 2.12) indicating that PICC and
PICL may play roles in mediating post-germination growth response to ABA.
PICC expression is activated by the bacterial elicitor flagellin 22 (flg22)
Based on expression analysis of public microarray (affymetrix ATH1) data using the
Genevestigator database and analysis tools (Hruz et al., 2008), PICC expression appeared to be up-regulated after treatment with flg22. Recognition of PAMPs on the bacteria by plant PRRs induces global transcriptional changes in the plant. To confirm the induction of PICC expression by flg22, quantitative RT- PCR analysis was performed on RNA extracted from seedlings and the expression of PICC and PICL was analyzed after 0, 1 and 2 h continuous treatment with flg22. Consistent with the public microarray data, PICC was induced after 1 h and induction was further increased after 2 h of flg22 treatment, whereas PICL expression was not changed (Figure 2.10 A and B).
48 To investigate whether PICC expression is also induced by bacterial infection, rosette leaves of 5-week-old plants grown in short day conditions were syringe-infiltrated with either 1 uM flg22 or the avirulent P. syringae strain PstDC3000 hrcC (hrcC) or water
(mock for flg22) or 10 mM MgCl2 (mock for hrcC) and the expression of PICC and PICL was analyzed at 1,3,6,12 and 24 hours post infiltration (hpi). PICC was induced by mock treatments peaking at 1 hpi, suggesting this gene may be induced by wounding.
However, PICC induction at 1 hpi with both hrcC and flg22 treatments was significantly higher than with mock treatment (Figure 2.11). While PICC expression induced by mock treatment gradually decreased reaching basal levels at 24 hpi, PICC induction by flg22 and hrcC continued to remain significantly higher than the mock induction during all time points tested (Figure 2.11). Consistent with the microarray data analysis and expression analysis in seedlings, PICL was not induced after flg22 and hrcC treatments (data not shown) confirming that PICC and PICL are differentially regulated during plant defense response. The PAMP induction of PICC strongly suggests that PICC may play an important role in PTI.
picc-1 mutant plants are compromised in PTI
PAMPs induce the expression of genes that play an important role in PTI. PTI is sufficient to restrict the growth of avirulent hrcC bacteria. Based on the PAMP induced
PICC expression, we hypothesized that PICC may be involved in PTI and hence, picc-1 mutant plants may be more susceptible to potential-pathogens. To test this hypothesis, the growth of the virulent pathogen (PstDC3000) and the nonviralent pathogen hrcC was analyzed in WT, picl-1, picc-1 and double mutant plants. Rosette leaves of WT, picc-1, picl-1 and picc-1;picl-1 plants were syringe-infiltrated with 105 colony-forming units (CFU) of bacterial suspensions of hrcC, PstDC3000 or 10 mM MgCl2 (mock). Growth of
49 bacteria was measured at 4 days post infiltration. picc-1 and picc-1;picl-1 plants supported 10-15 fold greater hrcC growth compared to WT, while picl-1 plants behaved like WT (Figure 2.12). However, no significant difference in the growth of PstDC3000 was observed between WT and picc-1, picl-1 or picc-1;picl-1 plants (Figure 2.12). Thus, picc-1 and picc-1;picl-1 mutant plants are compromised in PTI, but not ETI, suggesting an important role for PICC in effective defense against hrcC.
To investigate the effectiveness of PTI signaling in picc-1 mutant plants and to narrow down the point of action of PICC, we analyzed different PTI responses. PAMP perception triggers an immediate outburst of reactive oxygen species (ROS) (Felix et al.,
1999). ROS generation occurs as an early response to PAMPs and is considered to be a hallmark of successful pathogen recognition and activation of defense responses (Lamb and Dixon, 1997). We examined ROS production following flg22 treatment in picc-1 and
WT plants using a luminol-based assay. picc-1 plants did not show any significant difference in ROS accumulation compared to WT plants indicating that PICC is not involved in flg22-induced accumulation of ROS (Figure 2.13).
To further investigate PAMP responses, we examined PAMP-induced gene expression changes by Q-RT PCR. Rosette leaves of WT and picc-1 mutant plants were treated with flg22 or hrcC or water (mock for flg22) or 10 mM MgCl2 (mock for hrcC) and mRNA was analyzed at 1, 3, 12 or 24 hpi. MYB51 is an early PAMP induced transcription factor essential for cell wall-reinforcing callose deposition at the sites of infection. Suppression of callose deposition is associated with increased growth of hrcC. MYB51 expression was analysed at 1, 3, 12 and 24 hpi. As expected, MYB51 induction was greater with flg22 and hrcC than with mock treatments (Figure 2.14 A). No significant difference in
50 MYB51 induction was found between picc-1 and WT plants, indicating that PAMP- induced MYB51 expression is not affected by loss of picc-1 (Figure 2.14A). Analysis of the basal level of MYB51 indicated a slight increase in picc-1 mutants compared to WT; however, the difference was not statistically significant.
Next, we examined PAMP induced salicylic acid (SA) accumulation and signaling through gene expression analysis of the SA biosynthesis gene isochorismate synthase
(ICS1) (Wildermuth et al., 2001) and the classic read-out for SA signal transduction, PR1
(Ryals et al., 1996). PAMP-regulated gene expression is partially dependent on PAMP triggered SA accumulation which is important for PTI (Tsuda et al., 2008). ICS1 and PR1 expression was analyzed at 12 and 24 hpi. ICS1 expression was greater with flg22 and hrcC treatments at 12 and 24 hpi than with mock treatments in WT and picc-1 (Figure
2.14B). However, no significant change was observed in picc-1 mutants compared to
WT (Figure 2.14B). Similarly, PR1 expression levels did not show any difference in picc-
1 plants compared to WT indicating that SA signaling leading to PR1 gene expression is not compromised in picc-1 plants (Figure 2.14C).
Previous studies have established a role for ABA in pathogen response. An increase in
ABA levels increases a plant’s susceptibility to pathogens (De Torres-Zabala et al.,
2007; Fan et al., 2009; Yasuda et al., 2008). 9-cis-epoxycarotenoid dioxygenase 3
(NCED3) is a key enzyme in stress induced ABA biosynthesis pathway (Iuchi et al.,
2001). In light of the increased ABA-sensitivity in the post-germination response of picc and picl mutants, we tested if NCED3 expression levels are affected in the picc-1 mutant. The levels of NCED3 transcript were investigated at 1, 3, 12 and 24 hpi after flg22 and hrcC treatments. NCED3 expression levels showed no significant difference
51 between wild type and picc-1 mutants, thus excluding a scenario of increased ABA levels in picc-1 resulting from an increase in the expression of NCED3 (Figure 2.14 D).
Collectively, these data indicate that the branches of PTI leading to ROS production,
MYB51, SA and PR1 transcript accumulation are not compromised in picc-1 mutants.
52
2.3 DISCUSSION
PICC and PICL are plant-specific, ER-associated long coiled-coil proteins
Long coiled-coil proteins play an important role in various cellular processes and function as scaffolds and platforms for tethering cellular functions. In this work, we have characterized a family of two plant-specific long coiled-coil proteins in Arabidopsis, PICC and PICL. Interestingly, only 14 predicted membrane proteins in Arabidopsis contain long coiled-coil domains (Rose et al., 2004) and among them, PICC has the highest percentage (79.5%) of amino acids that can form coiled-coil domains, followed by PICL
(63.7%). Based on sequence similarity, we could identify putative orthologs only in plants, which suggests that PICC and PICL may be involved in plant specific processes
(Figure 2.3).
PICC and PICL are localized at the ER. Confocal microscopic analysis of different domains show that the transmembrane domain fragment (comprising of transmembrane domain and tail) is necessary and sufficient for localizing PICC and PICL to the ER, indicating that the targeting information resides in the C-terminal 31 amino acids (Figure
2.4B). The TDF is highly conserved across all plant orthologs, suggesting that targeting information and hence the targeting mechanism is conserved. Thus, ER localization is likely important for PICC/PICL protein function. Dissecting the TDF by mutational analysis will further reveal whether the ER targeting information is in the tail or in the transmembrane domain region or whether the entire TDF is essential for ER localization.
Mechanism of targeting PICC and PICL to the ER
53 The domain organization of PICC and PICL indicates that the proteins are likely targeted to the ER by a tail-anchoring mechanism. Tail-anchored (TA) proteins are a unique class of integral membrane proteins in eukaryotes that are involved in diverse cellular processes (Abell and Mullen, 2011; Borgese et al., 2003). They are post-translationally targeted to their respective organelles by a single transmembrane domain located close to the C-terminus and feature functional N-terminal domains that face the cytoplasm
(Abell and Mullen, 2011; Borgese et al., 2003). Consistent with the requirements for TA proteins, domain analysis by confocal microscopy showed that the transmembrane domain and the tail of PICC and PICL are necessary and sufficient to target the proteins to the ER (Figure 2.4B). A protease-protection assay showed that the N-termini of PICC and PICL are facing the cytoplasm (Figure 2.5). These studies confirm that PICC and
PICL are indeed TA proteins, targeted to the ER by information contained in the C- terminal 31 amino acids. Supporting our analysis, PICC and PICL were identified along with ~520 other proteins in two bioinformatic screens for TA proteins in Arabidopsis
(Kriechbaumer et al., 2009; Pedrazzini, 2009).
While it is possible to predict TA proteins using bioinformatics based on the simple definition above, accurately predicting their localization is a challenging task.
Bioinformatic tools are able to predict correct TA protein localization to the ER in only
62% of cases (Kriechbaumer et al., 2009). Hence, the transmembrane domain fragments of PICC and PICL can now serve as valuable tools to dissect the importance of individual residues for ER targeting, with the goal to establish more stringent and relevant criteria for predicting TA protein localization in plants. Multiple pathways have been described for targeting TA proteins to the ER membrane in animals and yeast
(Kriechbaumer et al., 2009). However, very little is known about the biogenesis of TA
54 proteins in plants, largely due to a much smaller number of TA proteins that have been experimentally characterized (Kriechbaumer et al., 2009). PICC and PICL are thus excellent new candidate client proteins for approaches to identify and characterize a putative plant ER tail-anchoring machinery.
Homo- and hetero-dimerization
Coiled-coil domains mediate highly specific homo- or heteromeric protein-protein interactions (Bruce, 2002; Strauss and Keller, 2008). Consistent with this, PICC forms homodimers in a yeast split-ubiquitin system (Figure 2.6). However, we did not observe of PICL-PICL homodimers or PICC-PICL heterodimers (Figure 2.6). The absence of
PICC homodimerization suggests that PICC either exists as a monomer or as a dimer with another unknown long coiled-coil protein. The lack of heterodimer formation indicates that PICC and PICL do not interact directly. Nevertheless, PICC and PICL may exist in a common complex in Arabidopsis, which remains to be tested.
Differential expression in response to biotic stimuli
Recognition of pathogens by plants activates complex signal transduction mechanisms leading to global transcriptional reprogramming. Among the genes induced by PAMP recognition are those that encode proteins involved in signal perception and transduction, transcriptional regulation and synthesis of antimicrobial compounds
(Denoux et al., 2008; Navarro et al., 2004; Zipfel et al., 2004). The increase in PICC gene expression at 1h (earliest time point tested) post treatment with either flg22 or hrcC and the persistence of induction for at least 24 hours indicate that PICC is an early
PAMP induced gene (Figure 2.9). In contrast, the expression level of PICL was not affected by flg22 or hrcC. This difference in gene regulation is consistent with the roles
55 of PICC and PICL in PTI. While picc-1 mutant plants supported an increased growth of hrcC bacteria compared to WT plants, picl-1 mutant plants behaved like WT, consistent with a role for PICC, but not PICL in PTI (Figure 2.11).
picc-1 mutant plants have a T-DNA insertion in the second exon of PICC and produce barely detectable levels of truncated PICC protein (loss of 2/3rd of WT PICC protein)
(Figure 2.8A and B). Therefore, we consider picc1 mutant plants to be likely functionally null. picl-1 mutant plants have a T-DNA insertion in the very last exon of PICL, before the region encoding the transmembrane domain (Figure 2.8A). picl-1 mutant plants produce truncated PICL protein, which is no longer associated with the membrane
(Figure 2.8C). picl-1 mutant plants are therefore likely null alleles for any membrane- associated function of PICL. Interestingly, the transmembrane domain is conserved across all plant orthologs and thus membrane localization is likely essential for the function of this protein class.
Based on the PAMP-induced gene expression and the hrcC growth phenotype, we conclude that PICC is involved in PTI in Arabidopsis. However, PICL is not induced by
PAMPs and the membrane association of PICL is dispensable for PTI, which suggests a divergence of function between the duplicated Arabidopsis genes with respect to the plant immune response.
Differential regulation during development
Promoter::GUS analysis of regulatory regions of PICC and PICL indicates that these proteins are differentially regulated during development. However, they show partially overlapping expression patterns in the vasculature of cotelydons and leaves, in roots of
56 seedlings and in hydathodes (Figure 2.6A and B). PICC promoter::GUS activity, in addition, is observed in leaf trichomes, in the vasculature of sepals and petals, in stamen filaments and in the abscission zone at the base of the siliques and flowers (Figure
2.6B). The differential expression of PICC and PICL promoters during development indicates that these paralogous proteins may function in different cellular processes.
Hydathodes are highly specialized pores positioned at the leaf margins (Candela et al.,
1999). They mediate secretion of sap containing ions, metabolites and proteins through a process called guttation (Candela et al., 1999; Pilot et al., 2004). However, they lack physical barriers and are convenient routes for pathogen entry. Xanthomonas campestris, the bacteria responsible for black rot in cabbage, enters the plant apoplast mainly through the hydathodes (Gay and Tuzun, 2000; Hugouvieux et al., 1998).
Immune responses such as lignification of hydathodes has been observed after
X.campestris infection (Gay and Tuzun, 2000). PR proteins such as chitinases are expressed in hydathodes also, presumably as a preventive mechanism for restricting pathogen entry in the absence of physical barriers (Grunwald et al., 2003; Passarinho et al., 2001; Samac and Shah, 1991). PICC is also expressed in the floral abscission zone.
The Arabidopsis transcription factors, AtWRKY6 and AtWRKY33, associated with abscission and defense response, are expressed in the abscission zone (Lippok et al.,
2007; Robatzek and Somssich, 2001). Microarray analysis of tomato and citrus abscission zone transcriptomes showed preferential expression of defense related genes (Agusti et al., 2009; Meir et al., 2010). These studies prompt us to speculate that the expression of PICC in hydathodes and the abscission zone may be related to its role in defense. PICC may function to preempt pathogen entry in these disease vulnerable zones.
57 Dissecting PTI signaling pathways
Early signaling pathways
The rapid production of ROS occurs as an early response to successful pathogen recognition and activation of defense responses (Felix et al., 1999). picc-1 plants are not compromised in ROS production, suggesting that the early signaling events leading to
ROS production do not require PICC (Figure 2.13). Induction of ethylene biosynthesis is another early event in PTI signaling (Felix et al., 1999). Ethylene signaling is important for maintaining FLS2 levels on the plasma membrane (Boutrot et al., 2010). Reduced
FLS2 levels result in dampened PTI signaling which, in turn, results in reduced ROS production (Boutrot et al., 2010). Additionally, ethylene signaling is important for PAMP- induced expression of the MYB51 transcription factor, which regulates callose deposition
(Clay et al., 2009). picc-1 plants do not show any change in MYB51 induction compared to WT (Figure 2.14C). Taken together, WT-level ROS production and MYB51 induction suggest that ethylene signaling is not compromised in picc-1 plants and that PICC functions downstream or in a pathway parallel to that of ROS production and induction of
MYB51 expression. Callose deposition, regulated by MYB51, is a late response in PTI
(Gómez-Gómez et al., 1999). Recognition of PAMPs results in callose deposition at the cell wall, which often correlates with resistance and suppression of bacterial growth.
Future experiments involving analysis of callose deposition in response to flg22 and hrcC in picc-1 plants could determine if PICC has a role in pathogen-induced callose deposition.
SA production and signaling pathways
SA is an important signaling molecule in plant defense response. SA activates the nuclear translocation of NPR1, which directly regulates defense gene expression, such
58 as PR1 (Kinkema et al., 2000). SA accumulates following pathogen infection and PAMP perception (Tsuda et al., 2008). ICS1/SID2 encodes for Isochorismate synthase, the enzyme responsible for the majority of SA production during pathogen infection. Analysis of ICS1/SID2 levels after flg22 and hrcC treatments in picc-1 and WT plants indicate no significant difference, suggesting that the signaling pathway leading to ICS1 accumulation is not affected in picc-1 plants (Figure 2.14A). The absence of change in
ICS1 mRNA levels does not always imply that SA levels are not changed (Tsuda et al.,
2008). However, we can speculate that SA levels in picc-1 plants after PTI induction are not different from WT based on the expression of PR1, which is used as a reliable marker for SA signaling (Ryals et al., 1996). The PR1 expression levels in picc-1 plants after PTI induction are similar to WT (Figure 2.14B), indicating that downstream SA signaling pathway is not compromised in picc-1 plants, which in turn suggests that the
SA levels are probably not changed in picc-1 plants. Further confirmation by quantification of SA levels in WT and picc-1 after PTI induction could resolve this question. Taken together, ICS1 and PR1 expression levels in picc-1 plants suggest that
PICC may either function in a pathway downstream of SA signaling or in a pathway parallel to SA signaling regulating innate immunity.
An important immune response downstream of defense gene expression in response to pathogens is the secretion of anti microbial proteins like PR1 (Durrant and Dong, 2004; van Loon et al., 2006). Proteins involved in vesicle trafficking and secretion, such as the
SNAREs, are known to play an important role in defense against potential pathogens.
More importantly, coiled-coil protein interactions among different SNAREs are known to mediate vesicle trafficking during defense response. For example, PENETRATION1
(PEN1) syntaxin together with adaptor synaptosome associated protein SNAP33 and
59 functionally redundant vesicle associated membrane proteins VAMP721 and VAMP722, form a tetrameric coiled-coil complex which is essential for immunity in Arabidopsis against the non-adapted powdery mildew fungi Blumeria graminis (Bgh) (Kwon et al.,
2008; Pajonk et al., 2008). Evidence for the role of SNAREs also comes from the study of syntaxin SYP132, which is essential for secreting PR1 to restrict bacterial growth in
Nicotiana benthamiana (Kalde et al., 2007). Studies from animals and yeast show that the vesicle fusion events driven by SNARE complexes are primed by the tethering of long coiled-coil proteins, which mediate the initial attachment of the carrier vesicles to the target membrane (Diao et al., 2008; Jahn and Scheller, 2006; Whyte and Munro,
2002). Therefore, it is compelling to hypothesize that PICC functions as a long coiled-coil molecular tether facilitating the secretion of PR1 at the sites of infection. It remains to be tested whether PICC is involved in secretion of anti-microbial PR proteins.
According to expression analysis of public microarray (Affymetrix ATH1) data using the
Genevestigator database and analysis tools (Hruz et al., 2008), in addition to PAMP induction, PICC expression appears to be upregulated upon infection with the powdery mildew fungus Bgh (data not shown). Dynamic reorganization of subcellular components such as actin, microtubule, ER, Golgi apparatus (Takemoto et al., 2003) and peroxisomes (Lipka et al., 2005) at the sites of infection have been shown to be important for resistance against both fungal and oomycete pathogens (Underwood and
Somerville, 2008). Focal concentration of components of vesicle trafficking, PEN1,
SNAP33 and VAMP721/722, are observed at the sites of fungal infection (Kwon et al.,
2008). However, the molecular mechanisms that recruit the cellular components to the infection sites are unknown. It is possible that molecular tethers formed typically by long coiled-coil proteins function in the cellular reorganization during fungal infection. Since
60 PICC is one of the longest coiled-coil proteins in Arabidopsis (1333 aa and 79.5% coiled- coil coverage) and appears to be upregulated by Bgh, it is tempting to speculate a function for PICC in mediating resistance to Bgh in Arabidopsis, possibly by functioning as a molecular tether and facilitating the accumulation of cellular components at the site of fungal infection. Whether PICC indeed plays a role in resistance to Bgh and, if it does, whether it functions as a molecular tether are questions that form exciting grounds for future investigation.
Relationship with ABA
While PICL does not play a role in defense response, the ABA hypersensitivity of picc-1, picc-2 and picl-1 mutants during post-germination growth suggests that PICC and PICL are important for the plant during ABA-induced stress (Figure 2.12). Increased sensitivity to ABA in the mutant plants could be due to either increased levels of endogenous ABA or due to enhanced ABA signaling. The role of ABA in response to abiotic stresses such as drought, salinity and cold is well established (Shinozaki et al., 2003; Xiong et al.,
2002). ABA also plays an important role in modulating plant defense response. ABA functions antagonistically with SA and negatively regulates defense response to pathogens (De Torres Zabala et al., 2009; Yasuda et al., 2008). Increase in ABA levels correlates with increased virulence of pathogens (Fan et al., 2009). NCED3 is a key enzyme in stress induced ABA biosynthesis (Iuchi et al., 2001). Analysis of NCED3 expression levels in WT and picc1 mutant plants after flg22 treatment and hrcC infection showed no change (Figure 2.14D), indicating that the increased growth of hrcC in picc-1 is not due to the increase in ABA biosynthesis by the NCED3 enzyme. This does not rule out the possibility of increased endogenous ABA levels in picc-1 plants which could possibly result in compromised PTI, since an increase in endogenous ABA levels has
61 been associated with increase in growth of pathogens (Fan et al., 2009). However, if the
ABA hypersensitivity of picc-1 is associated with the compromised PTI the question remains why picl-1, which is also hypersensitive to ABA, does not show increased susceptibility to hrcC. Further work that involves analysis of defense response of picc-1, picc-2 and picl-1 mutants in ABA deficient or ABA hypersensitive background and analysis of ABA response during pathogen infection in picc-1, picc-2 and picl-1 mutants will yield better insights into the function of PICC and PICL in hormonal response and its correlation with the innate immune response.
Taken together, our study is the first report showing the importance of a long coiled-coil protein, PICC, in defense response and suggests a possible role for the PICC-PICL family of long coiled-coils in coping with hormonal stress during post-germination growth.
Phylogenetic analysis (Figure 2.3) indicates that a recent gene duplication event in
Arabidopsis has given rise to PICC and PICL while only one ortholog is present in other plant species. It is thus possible that PICC has recently acquired the defense-related function or, alternatively, that PICL has lost the defense-related function after the duplication event. This interesting question can be addressed by investigating
PICC/PICL orthologs in other plant species for their role in PTI as well as in ABA response.
Conclusion
PICC and PICL, two paralogous long-coiled coil proteins in Arabidopsis, are associated with the ER, likely by a tail-anchoring mechanism. PICC is induced by PAMPs and is important for PTI response against the T3SS mutant bacteria hrcC. PICL, however, is not induced by PAMPs and does not seem to play a role in PTI. Interestingly, both PICC
62 and PICL appear to have a function in mediating post-germination growth response to
ABA. Overall, our study highlights the functional importance of long coiled-coil proteins in
Arabidopsis and opens up exciting new opportunities for future investigation as discussed above.
63
2.4 MATERIALS AND METHODS
Plant materials and growth conditions
All Arabidopsis thaliana plants used in this study were in the Col-0 background. T-DNA insertion alleles picc-1 (SALK_58801), picc-2 (SALK_139837) and picl-1 (SALK_56040) were obtained from the Arabidopsis Biological Recourse Center (ABRC; Columbus, OH,
USA). The homozygous mutant lines were identified by PCR of genomic DNA using the primers listed in Table 2.2. To grow Arabidopsis seedlings used for quantitative PCR assays, seeds were sterilized in 40% v/v hypochlorite washed six times with sterile water and germinated in 6-well microtiter dishes (~ 15-20 seeds per well) containing liquid
Murashinge and Skoog (MS) media (1x MS basal salts (Caisson, Logan, UT, USA), 1%
Sucrose, 0.5gl-1 MES, 1x and Gamborg’s vitamins (Sigma, St. Louis, MO, USA), pH 5.7) and sealed with parafilm. The seedlings were grown in a plant growth chamber under long day conditions (16 h light/ 8 h dark) at 22C. Arabidopsis plants used for quantitative RT-PCR, ROS measurements and bacterial growth curve assays were grown in soil at 22C (light)/18C(dark) under short day conditions (8h light/16h dark).
Arabidopsis plants used for all other experiments were grown in soil at 22C under long day conditions (16 h light/ 8 h dark). Nicotiana benthamiana plants were grown in soil under standard long-day conditions (16 h light / 8 h dark) at 24°C.
Constructs and cloning
For localization assays, the PICC and PICL ORF were amplified using the Thermoscript
RT-PCR system (Invitrogen, Carlsbad, CA, USA) and ProSTAR HF Single Tube RT-
PCR System (Agilent, Santa Clara, CA, USA), respectively. The PICC and PICL cDNAs
64 were then cloned into pDONR221 and pENTR/D-TOPO Gateway entry vectors
(Invitrogen), respectively. PICCTDF and PICLTDF were amplified from PICC and
PICL cDNA using Phusion polymerase (New England Biologicals (NEB), Ipswich, MA,
USA) and cloned into pDONR221 entry vector. TDFPICC and TDFPICL were also amplified from PICC and PICL cDNAs using Phusion polymerase and cloned into the pDONR221 entry vector. PICC, PICL and their deletion variants were moved from the entry vectors into the Gateway destination vector pK7WGF2 (Invitrogen) by LR recombination. For
GUS assays, 2.0 kb PICC promoter (pPICC) and 1.0 kb PICL promoter (pPICL) were amplified from the WT Col-0 genomic DNA and cloned into pDONR221 and pENTR/D-
TOPO entry vectors, respectively. pPICC and pPICL were moved into destination vectors pGWB1 and pMDC162 respectively. All the clones in the destination vectors were introduced into Agrobacterium tumefaciens (Agrobacterium) strain GV3101. For split-ubiquitin membrane yeast two-hybrid, PICC and PICL were cloned into Cub and
Nub vectors, pBT3N and pPR3N (Dual Systems Biotech, Switzerland) using the In-
Fusion cloning system (Clontech, Mountainview, CA). The ER marker HDEL-mCherry
(CD3-959) was obtained from the ABRC.
GFP-CXN and CXN-PAGFP used as controls for protease protection assay were kindly donated by Chris Hawes, Oxford Brookes University. The primers used for cloning are listed in Table 2.1. Sequences of all clones in the entry vectors and in the split-ubiquitin membrane yeast two-hybrid vectors were verified by sequencing at the Plant-Microbial
Genomics Facility (PMGF, The Ohio State University, Columbus, USA), which uses
Applied Biosystems 3730 DNA Analyzer and BigDyeTM cycle sequencing terminator chemistry.
65 Generation and selection of Arabidopsis transgenic lines
Transgenic lines GFP-PICC, GFP-PICL, GFP-PICCTDF, GFP-PICLTDF, GFP-
TDFPICC, GFP-TDFPICL, PICC.Pr::GUS, PICL.Pr::GUS, were generated by transforming
Arabidopsis wild type Col-0 plants with Agrobacterium strain GV3101 carrying individual plasmids, by the floral dipping method (Clough and Bent, 1998). Transgenic T1 progeny were selected on agar plates containing MS medium (1x MS basal salts (Caisson) 1%
Sucrose, 0.5 gl-1 MES, 1x Gamborg’s vitamins (Sigma) and 0.8% Agar) with 50gml-1
Kanamycin or 50gml-1 Hygromycin or both. For localization analysis, T1 progeny carrying GFP-fusion genes of interest were analyzed by confocal laser scanning microscopy on a Nikon D-ECLIPSE C1 90i instrument. For promoter analysis, at least 5 independent T2 lines were selected and subjected to staining for GUS expression.
Transient expression of proteins in N. benthamiana leaf epidermal cells
To transiently express GFP-fusion proteins of interest, Agrobacterium cultures containing different plasmids were coinfiltrated with Agrobacterium cultures carrying
HDEL-mCherry into leaves of three to four week old N. benthamiana plants as described previously (Zhao et al., 2006). Agrobacterium cells carrying plasmids of interest were grown at 28C for approximately 24 h. The cells were harvested by centrifugation for 10 minutes at 3000 rpm at 25C and resuspended in a solution containing 10 mM MgCl2, 10 mM MES and 100 M Acetosyringone. The OD of each Agrobacterium culture was adjusted to A600=0.2. For co-infiltration, two cultures were mixed in a ratio of 1:1 and
~200 l – 1000 l of the cultures were syringe infiltrated into N. benthamiana leaves. The
GFP and mCherry expressions were analyzed by confocal microscopy 48 h after infiltration.
66
Confocal laser scanning microscopy
All images were acquired using a confocal laser scanning microscope (Nikon D-
ECLIPSE C1 90i). GFP fluorescence was observed using an excitation wavelength of
488 nm and emission wavelength of 515/530 nm. mCherry was observed using an excitiation wavelength of 543 nm and emission wavelength of 560/615 nm.
Protease protection assay
Protease protection assays were performed as described (Wang et al., 2011).
Agrobacterium infiltrated Arabidopsis leaf sectors (~0.1 g) expressing the relevant proteins at ~48 hours after infiltration were ground to homogeneity in a mortar and pestle
(chilled at 4C) in 500 l ice-cold extraction buffer (100 mM Tris-Cl ph 7.6, 10 mM KCl, 1 mM EDTA and 12% w/w Sucrose). The homogenate was centrifuged at 5000 rpm for 5 min at 4C to sediment the debris and the supernatant was centrifuged at 20,000 g for
20 min at 4C. The supernatant was layered onto 17% sucrose buffer (in water) and centrifuged at 100,000 g for 1 h at 4C. The sediment obtained was resuspended in ice- cold extraction buffer. 75 l of each sample was added to each of four tubes each containing 1 mM CaCl2 + PK buffer (50 mM Tris.HCl pH 8.0,1 mM CaCl2) with or without
-1 Proteinase K (200 g ml , NEB) or 1 mM CaCl2 + 1% triton X-100 + PK buffer (50 mM
-1 Tris.HCl pH 8.0, 1 mM CaCl2) with or without Proteinase K (200 g ml ) and incubated at 25C for 30 min. To terminate the reaction, 1l of Protease Inhibitor Cocktail (Sigma-
Aldrich) was added to each tube and incubated at 25C for 10 min. 3x SDS protein loading buffer (150 mM Tris. HCl pH 6.8, 6% SDS, 300 mM DTT, 30% Glycerol, 0.3%
Bromophenol Blue) was added and samples were boiled for 5 min before subjecting to
67 SDS-PAGE on a 15% SDS-polyacrylamide gel. Immunoblot analysis with anti-GFP antibody (Invitrogen) was performed as described below.
ß-Glucuronidase staining
Arabidopsis tissues were prefixed in ice-cold 90% acetone for 1hr and then immersed in staining solution (50 mM Sodium Phosphate buffer pH 7.0, 10 mM EDTA, 2 mM
Potassium Ferricyanide, 2 mM Potassium Ferrocyanide, 0.1% Triton X-100 and 2 mM 5- bromo-4-chloro-3-indolyl--D-glucuronic acid) at 37C for 16 h. Tissues were rinsed three times in 90% ethanol and stored in 70% ethanol at room temperature (RT) until examination. Micrographs were taken using a Nikon Digital Sight DS-5M camera attached to a Nikon SMZ800 dissecting microscope or a Nikon Eclipse 80i compound microscope.
Membrane Yeast Two Hybrid (split ubiquitin) assay
Yeast competent cell preparation and transformation was carried out as described (Chen et al., 1992). Transformants were selected on yeast dropout media (SD –Leucine -
Tryptophan). Three colonies were picked from each transformation to perform - galactosidase assays. To quantify -galactosidase activity, yeast cells were grown at
28C to A600 = 1 and chilled on ice for 15 min. 2ml of the culture was then centrifuged and the sediment was frozen in liquid nitrogen and resuspended in resuspension buffer consisting of 665 l “H” buffer (150 mM NaCl, 100 mM HEPES, 2 mM MgCl2 and 1%
(w/v) BSA, pH 7.0), 55 l chloroform, 55 l 0.1% (w/v) SDS and 125 l 0.4% (w/v) 2-
Nitrophenyl β-D-galactopyranoside (ONPG)). The suspension was incubated at 30C until visible yellow color developed. The reaction was stopped with 400 l 1 M Na2CO3
68 and the reaction time was recorded. The cells were centrifuged to sediment debris and
OD was measured at A420. -galactosidase activity was calculated using the formula
1000 *(A420 / (t * v * A600 )) where t is the reaction time in minutes and v is the volume of culture assayed in milliliters.
Protein expression, purification and antibody production
The anti-PICC/PICL antibody (OSU272) was generated against a partial recombinant protein (PICL amino acids 1 to 100). The N-terminal 6xHis-tagged protein was purified from Escherichia coli BL21-AI using Ni-NTA resin according to the QIAexpressionist manual (Qiagen, Valencia, CA, USA) and preparative SDS-PAGE. The rabbit antiserum was generated by Cocalico Biologicals, Reamstown, PA, USA.
Immunoblot analysis
Arabidopsis protein extracts were prepared by grinding tissues in liquid nitrogen by mortar and pestle and resuspending 100 l of frozen tissue power in 100 l of extraction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.5% Nonidet P-40, 1 mM EDTA pH 8.0,
3 mM DTT, 1 mM PMSF, and 1x Protease Inhibitor Cocktail (Sigma-Aldrich)). The samples were centrifuged at 20,000 g for 10 minutes at 4C to sediment the debris. 3x
SDS protein loading buffer was added and the samples were boiled for 5 min. The samples were separated by 8% SDS-PAGE and transferred to PVDF membrane (Bio-
Rad, Hercules, CA, USA). The membrane was blocked overnight at 4C with 4% milk
(fat-free dry milk powder) in 1x TBST (50 mM Tris-HCl, 150 mM NaCl, 0.05% Tween 20, pH 8.0) and then probed with anti-PICC/PICL antibody (1:2000) in 1x TBST for 1h at room temperature. After three washes for 10 minutes each with 1x TBST, the membrane
69 was incubated with anti-rabbit peroxidase conjugated secondary antibody (1:20,000 in
TBST, GE Healthcare, Waukesha, WI, USA) for 1h. The membrane was again washed three times for 10 minutes each with 1x TBST and the signals were visualized with
SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific, Waltham, MA,
USA) according to the manufacturer’s instructions. Signals were detected on an
Optimum Brand X-Ray film (Life Science Products, Frederick, Colorado, USA) using a
Konica Minolta Medical Film Processor SRX-101A (Konica Minolta, USA).
Subcellular fractionation
Membrane proteins were fractionated essentially as described (Afzal et al., 2011).
Briefly, one hundred milligram of tissue was homogenized in 1 mL of extraction buffer
(10 mM Tris-HCl pH 7.0, 0.33 M Sucrose, 1 mM EDTA, and 1x Plant Protease Inhibitor
Cocktail (Sigma-Aldrich)). The homogenate was centrifuged at 20,000 g for 20 min at
4C to sediment the debris. The supernatant constituted the total (T) fraction. 10 l of 1
M CaCl2 was added to 500 l of the total fraction and incubated for 1h on ice. The microsomal fraction (M) was obtained by centrifugation of the total fraction at 25,000 g for 90 min at 4C. The supernatant was removed and constituted the soluble (S) fraction.
The sediment was dissolved in 30 l extraction buffer and constituted the microsomal fraction (M). 3x SDS protein loading buffer was added, samples were heated at 65C for
15 min and subjected to 8% SDS-PAGE and subsequent immunoblot analysis with anti-
PICC/PICL antibody as described above.
70 Post-germination growth assays
WT and mutant seeds were sterilized in 40% hypochlorate solution in Ethanol, rinsed 6 times in 95% Ethanol and dried on a sterile filter paper in a sterile laminar flow hood. The seeds were plated on MS media (1x MS, 0.5% Sucrose, 0.5 gl-1 MES, 1x Gamborg’s
Vitamins (Sigma) and 0.8% Agar) containing 0, 1.2, 1.4 or 1.6 M ABA, transferring them individually with a sterile toothpick to ensure even spacing. The plated seeds were vernalized at 4C for 48 h in the dark. The plates were then placed horizontally in a growth chamber set at 22C under long day (16 h light/ 8h dark) conditions. The percentage of green and expanded cotyledons was calculated by visual inspection at 9 days after vernalization.
Bacterial growth assays
Growth assays to determine the growth of the T3SS-deficient mutant of PstDC3000
(hrcC) and PstDC3000 in WT and mutant Arabidopsis plants were carried out essentially as described (Kim and Mackey, 2008). Briefly, suspensions of 1 x 105 CFU ml-1
PstDC3000 or hrcC were syringe infiltrated into the lower epidermis of rosette leaves of
5-week-old plants. After infiltration, the leaves were allowed to dry and were subsequently covered with a clear plastic dome to maintain 100% humidity throughout the rest of the experiment under standard growth conditions. After 4 days, nine leaf discs for each infiltration were collected and divided equally into three tubes containing 200 l
10 mM MgCl2 each, were ground with pestles and serially diluted to measure bacterial growth.
71
RNA isolation and quantitative real-time PCR
For gene expression studies in seedlings, RNA was isolated from 10-day-old seedlings grown in liquid MS media and treated with1 M flg22 (10 l of 1 mM flg22 added to 10 ml of liquid MS media) or water (10l of water added to 10ml of liquid MS media) for 0 h,
1 h and 2 h respectively. For expression studies in Arabidopsis plants, leaves of 5-week- old Arabidopsis plants grown in short day conditions were syringe infiltrated with 1 M
8 -1 flg22 or 1 x 10 CFUml hrcC or water (Mock for flg22) or 10 mM MgCl2 (Mock for hrcC).
Total RNA was isolated using the RNeasy plant mini kit (Qiagen) and treated with
DNase I (Invitrogen).
RNA was quantified using a Nanodrop (Thermo Scientific). cDNA was synthesized from
1 g of RNA with the Thermoscript RT cDNA synthesis kit (Invitrogen) using an oligo-dT primer. Quantitative real-time PCR was performed on a CFX96TM Real-Time PCR detection system (Bio-Rad) at the PMGF using the iQTM SYBR Green Supermix (Bio-
Rad). qPCR data was analyzed using the CFX96 software (Bio-Rad) and the graphs were generated using the Graphpad Prism software. P values were calculated based on two-tail non-parametric test (Mann-Whitney test) using the Graphpad Prism software.
Actin was used as a control and the primers used for real-time PCR analysis are listed in
Table 2.3.
ROS accumulation
ROS accumulation measurements were performed as described (Afzal et al., 2011). 10-
12 leaf discs from 4-week-old plants were excised and floated on distilled water overnight. Three leaf discs each were then transferred into a tube containing 100 l
72 luminol solution Immun-Star HRP substrate (Bio-Rad), 1 l of Horseradish peroxidase- streptavidin (Jackson Immunoresearch, West Grove, PA, USA) and 1 l of 1 mM flg22 or water (“Mock”). Luminescence was measured using a Glomax 20/20 luminometer
(Promega, Fitchburg, Wisconsin) every 10 s until 100 readings were recorded. Three technical repeats were performed for each genotype and treatment (flg22 or Mock). The experiment was reproduced in three biological replicates. The values were calculated with luminescence intensity of WT set to 100.
Computational analysis
Coiled-coil predictions were carried out using Multicoil (Kim et al., 1997).
Transmembrane domain predictions were carried out using the TMHMM server v.2.0
(Krogh et al., 2001). Sequence alignments were generated using the MUSCLE sequence alignment server (Edgar, 2004) and the alignment figure was generated using
TEXshade (Beitz, 2000). The phylogenetic tree was generated using Phylogeny.fr
(Dereeper et al., 2008).
73 Figure 2.1 Sequence alignment and protein structure of PICC and PICL
A) Sequence alignment of PICC and PICL.
B) Putative protein structure of PICC and PICL showing coiled-coil and
transmembrane domains.
Continued
74 Figure 2.1 Continued
75
Continued
75 Figure 2.1 Continued
7
6
Continued
76 Figure 2.1 Continued
77
Figure 2.2 Multiple sequence alignment of PICC, PICL and their orthologs in vascular plants
Blue bar towards the C-terminal end indicates the highly conserved transmembrane domain.
Continued
78 Figure 2.2 Continued
79
Continued
79 Figure 2.2 Continued
80
Continued
80 Figure 2.2 Continued
81
Continued
81 Figure 2.2 Continued
82
Continued
82 Figure 2.2 Continued
83
Continued
83 Figure 2.2 Continued
84
84
Figure 2.3 Phylogenetic tree of PICC, PICL and their orthologs in vascular plants
Graphical representation of the maximum-likehood phylogenetic tree of PICC, PICL and their orthologs. This phylogenetic tree is based on the multiple sequence alignment shown in Figure 2.2. Branch support values are indicated at the nodes as calculated by the PhyML program using default parameters. Os, Oryza sativa; Pt, Populus trichocarpa; Rc, Ricinus communis; Sb, Sorghum bicolor; Vv, Vitis vinifera
85
Figure 2.4 PICL and PICC are associated with the ER by their C-terminal transmembrane domain
A) N-terminally tagged GFP-fusion proteins used in this study. Amino acid sequence of
the transmembrane domain and the C-terminal tail are shown in blue and red letters,
respectively. Numbers indicate amino acid positions. Drawings are not to scale.
B) Confocal images showing localization of the fusion proteins indicated on the left in
N. benthamiana and Arabidopsis leaf epidermal cells. Cytoplasmic localization of
unfused GFP (“Free GFP”) in N. benthamina and Arabidopsis are shown as controls
Continued
86
Figure 2.4 Continued
87
Figure 2.5 PICL and PICC N-termini face the cytoplasm
Immunoblot analysis using GFP antibody. Microsomal preparations were treated with and without proteinase K. GFP-CXN and CXN-PAGFP were used as controls. In the microsome fraction containing GFP-CXN, GFP is protected from proteinase K treatment, whereas GFP of CXN-PAGFP is hydrolyzed. GFP of GFP-TDFPICL and GFP-TDFPICC are also hydrolyzed indicating exposure to Proteinase K.
88
Figure 2.6 PICC forms homodimers
galactosidase activity as a reporter for interaction in a membrane yeast two hybrid
(split-ubiquitin) assay. PICC shows self-interaction as indicated by increased galactosidase activity in yeast containing the constructs Cub-PICC and NubG-PICC. galactosidase activity in yeast transformed with combinations of Cub-PICL or Cub-PICC with either empty vector NubG or unrelated gene Alg5-NubG were used as negative controls. a.u., arbitrary units. Mean values and standard deviation from 3 samples are shown.
89
Figure 2.7 PICC and PICL promoters have partially overlapping patterns of activity
A) -Glucuronidase staining indicating PICC promoter activity in the vasculature of
cotyledons, roots, young and mature leaves (I, II and III), in the hydathodes (arrows
in III and IV), in the trichomes (IV and inset in IV), in the vasculature of sepals and
petals (V and VI), in the filaments of the anther (VI), in the stem and at the nodes
(VII) and in the abscission zone of flowers and siliques (arrows in VIII and IX)
Continued
90
Figure 2.7 Continued
B) -Glucuronidase staining indicating PICL promoter activity in the vasculature of
cotyledons and young leaves (I, II and III), in the vasculature of hypocotyls and
roots (I), in the hydathodes (arrow in IV) and at the nodes (V). No activity was
visible in the buds, flowers (VI) and siliques (not shown) of the inflorescence.
91
Figure 2.8 T-DNA insertion alleles of PICL and PICC
A) Genomic structure of PICL and PICC showing T-DNA insertion sites in picl-1, picc-1 and picc-2 alleles. Black asterisk (*) indicates the region encoding the antigen (amino acids 1-100) used for anti-PICC/PICL antibody development. This sequence is highly conserved in PICC and PICL.
Continued
92
Figure 2.8 Continued
B) Immunoblot analysis using PICL antibody detecting the presence of full-length
PICC and PICL and truncated PICL (tr.PICL) and truncated PICC (tr.PICC) in WT and mutant Arabidopsis protein extracts. Molecular mass markers are indicated on the right.
Ponceau: membrane stained with Ponceau S before immunoblotting, indicating close-to equal loading. The 50 kDa RBCS band is shown.
C) Total (T), microsomal (M) and soluble (S) fractions of WT and picl-1 Arabidopsis leaf protein extracts detected in an immunoblot with the PICL antibody. In WT, PICL is associated with the membrane and is detected in the microsomal fraction. In picl-1, the truncated protein lacks the transmembrane domain and is no longer associated with the membrane, which is evident by the absence of truncated PICL in the microsomal fraction. Ponceau-stained membrane is shown for loading control.
93
Figure 2.9 picl-1, picc-1, picc2, and picc-1;picl-1 are hypersensitive to ABA at the post-germination growth stage
WT, picl-1, picc-1, picc2 and picc-1;picl-1 were grown on MS plates containing different concentrations of ABA. Post germination growth efficiency was determined as percentage of green and expanded cotyledons at 10 days after stratification. Values represent average of three replicates, where number of seeds = 54 in each replicate.
Error bars represent one standard deviation. Similar results were obtained in two biological replicate
94
Figure 2.10 PICC expression is induced by flg22
10-day old liquid grown seedlings were treated with water or flg22. PICC (A) and PICL
(B) steady-state mRNA levels were quantified by real-time RT-PCR at times indicated.
(C) MYB51, a known flg22-induced gene, was used as a positive control. Transcript levels were normalized to ACTIN measured in the same samples. Values are given in arbitrary units with expression in 2 h flg22 treated samples set to 1. Each value is represented as the average of two biological replicates. Error bars represent one standard deviation. Double asterisks (**) indicate statistically significant difference in values compared to mock treated samples at the corresponding time point (P < 0.01).
95
Figure 2.11 Time course of PICC induction
Four-week-old WT Col-0 plants were infiltrated with 1 M flg22 (A), or 2 x 108 CFU ml-1 type III secretion deficient hrcC (B). PICC steady state mRNA levels were quantified by real-time PCR at times indicated. Transcript levels were normalized to ACTIN levels from the same sample. Values are given in arbitrary units with the value in 1 h flg22 treated sample set to 1. Each value is represented as the average of three biological replicates for treatment with flg22 (A) and hrcC (B). Error bars represent one standard deviation. Double (**P < 0.01) and single (* P < 0.05) asterisks indicate statistically significant difference in values compared to mock treated samples at the corresponding time point.
96
Figure 2.12 picc-1 and picc-1;picl-1 Arabidopsis plants are more susceptible to avirulent bacteria hrcC
Values represent average of three replicates. Error bars represent one standard deviation. The experiment was repeated three times with identical outcomes. CFU,
Colony Forming Units.
97
Figure 2.13 Generation of reactive oxygen species is not compromised in picc-1
A) Total ROS generation triggered by 10M flg22 in WT and picc-1 represented as a percentage of WT. Values represent average of three biological replicates. Error bars represent one standard deviation.
B) A time trace of the flg22 triggered oxidative outburst in WT and picc-1. Similar results were obtained in three biological replicates.
98 Figure 2.14 PAMP induced expression changes are not altered in picc-1
Leaves from four-week-old WT and picc-1 plants were infiltrated with 1M flg22 or bacterial suspensions (2 x 108 CFU ml-1) of type III secretion deficient hrcC. Steady state mRNA levels of (A) MYB51, (B) ICS1, (C) PR1 and (D) NCED3 were quantified by real-time PCR at times indicated. Transcript levels were normalized to ACTIN levels from the same sample. Values are given in arbitrary units with the value in 24h WT samples infiltrated with either flg22 or hrcC set to 1. Each value is represented as an average of three biological replicates. Error bars indicate one standard deviation.
Continued
99
Figure 2.14 Continued
100 Table 2.1 Primers used for cloning
Primer Name Primer sequence (5’ – 3’) Source
PICCattB1F GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGAAGAAGCAACTCAAGTAACG This study
PICCattB2R GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAATACTTTCTCCCAAGAATTATACC This study
PICLpentrF CACCATGGAAGAAGCAACAAAA This study
PICLpentrR TCAATAATTTTTCCCAACAATGAT This study
PICCTDFattB1F GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGAAGAAGCAACTCAAGTAACG This study
PICCTDFattB2R GGGGACCACTTTGTACAAGAAAGCTGGGTCCTATGTTTGAGTAGGAGTAGTAAC This study
101 PICLTDFattB1F GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGAAGAAGCAACAAAA This study
PICLTDFattB2R GGGGACCACTTTGTACAAGAAAGCTGGGTCCTACTGAATCATAACGTGCCCTG This study
Continued
101 Table 2.1 Continued
TDFPICCattB1F GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGCATCAACTTCACATCTCATGACAG This study
TDFPICCattB2R GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAATACTTTCTCCCAAGAATTATACC This study
TDFPICLattB1F GGGGACAAGTTTGTACAAAAAAGCAGGCTTCAAAGCTGAAACATGGCATCTCATG This study
TDFPICLattB2R GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAATAATTTTTCCCAACAATGATAC This study
prPICCattB1F GGGGACAAGTTTGTACAAAAAAGCAGGCTCGGTGTTGTGAACGGATTTAGAAGG This study
prPICCattB2R GGGGACCACTTTGTACAAGAAAGCTGGGTCCTGAGTGTTCGCCTGTTTTTTCTCTTC This study
PICCpBT3NF GAATTCCTGCAGGGCCATTACGGCCATGGAAGAAGCAACTCAAGTAAC This study
102 PICCpBT3NR CTACTTACCATGGGGCCGAGGCGGCCTTTTAATACTTTCTCCCAAGAATTATAC This study
PICLpBT3NF GAATTCCTGCAGGGCCATTACGGCCATGGAAGAAGCAACAAAAGTGAG This study
Continued
102 Table 2.1 Continued
PICLpBT3NR CTACTTACCATGGGGCCGAGGCGGCCTTTTAATAATTTTTCCCAACAATGATAC This study
PICCpPR3NF CAACGCAGAGTGGCCATTACGGCCATGGAAGAAGCAACTCAAGTAAC This study
PICCpPR3NR GAATTCTCGAGAGGCCGAGGCGGCCTTAATACTTTCTCCCAAGAATTATAC This study
PICLpPR3NF CAACGCAGAGTGGCCATTACGGCCATGGAAGAAGCAACAAAAGTGAG This study
PICLpPR3NR GAATTCTCGAGAGGCCGAGGCGGCCTTAATAATTTTTCCCAACAATGATAC This study
103
103 Table 2.2 Primers used for genotyping
Primer name Primer sequence (5’ – 3’) Source
PICC_58801_LP GCTTGCGGAAGAACTCAAGGAG This study
PICC_58801_RP CTTCTTCGGCAACTTCAATAGCAG This study
PICC_139837_LP CAGTATTGAACTAGAAGG This study
PICC_139837_RP CTGGTAGTGAACTCCTCCATTG This study
PICL_56040_LP GCTTGCAGATGCTAAATCTTAAG This study
PICL_56040_RP TATGGTAGAAGCAAAAATTCTTAGA This study
Lba1 TGGTTCACGTAGTGGGCCATCG http://signal.salk.edu
/tdnaprimers.2.html
104
Table 2.3 Primers used for real-time PCR
Primer Name Primer Sequence (5’ – 3’) Source
PICC_F CGAGAAGGAGCAAACAGCCAATG This study
PICC_R CCTCAGTGTGGGAAGAAATCTGTG This study
PICL_F CATTCGATTCAGCACCTTCAACGG This study
PICL_R CCTTAGCTTGAGGGACGTCTGAAC This study
MYB51_F CCTTCACGGCAACAAATGGTCTG This study
MYB51_R TACCGGAGGTTATGCCCTTGTG This study
ICS1_F GCTTGGCTAGCACAGTTACAGC This study
ICS1_R CACTGCAGACACCTAATTGAGTCC This study
PR1_F CTACGCAGAACAACTAAGAGGCAAC This study
PR1_R TTGGCACATCCGAGTCTCACTG This study
NCED3_F AGCTCCTTACCTATGGCCAGT (De Torres Zabala et
al., 2009)
NCED3_R CGCTCTCTGGAACAAATTCATC (De Torres Zabala et
al., 2009)
Actin_F CTAAGCTCTCAAGATCAAAGGCTTA (An et al., 1996)
Actin_R TTAACATTGCAAAGAGTTTCAAGGT (An et al., 1996)
105
CHAPTER 3
Towards identification of the PICC and PICL interaction network
106
3.1 INTRODUCTION
Protein-protein interactions form the central theme of all biological processes ranging from assembly and formation of cellular structures, and enzyme complexes to transducing and modulating signaling pathways. The understanding of the function of a protein requires a comprehensive knowledge of its various dynamic and stable interactions with other proteins in the cell, as protein-protein interactions define its functionality. Therefore, identification of interaction partners is an important step in the quest for elucidating protein function. It is possible to formulate a hypothesis about the function of an unknown protein if the function of an interacting partner is known, a concept commonly termed “guilt by association” (Auerbach et al., 2002).
Various technologies have been developed and refined during the past three decades that are useful in identifying protein interactions (Kuroda et al., 2006; Lalonde et al.,
2008). The yeast two hybrid system is the oldest and the most widely used assay to determine protein-protein interactions in vivo (Fields and Song, 1989) (Illustrated in
Figure 3.1). This system takes advantage of the properties of the transcriptional activator GAL4 of the yeast Saccharomyces cerevisiae. The GAL4 protein has two functionally separable domains, one that mediates DNA binding and the other that activates transcription. In this technique, a ”bait” is generated by fusing a protein X to the
DNA binding domain (BD) derived from the GAL4 protein and a “prey” is generated by fusing a protein Y to the transcriptional activation domain (AD). To test for interaction, the bait and the prey are coexpressed in yeast. If the proteins interact, they bring together the BD and AD of the GAL4, thereby, reconstituting a functional transcription
107 factor, which activates the expression of reporter genes. Auxotrophic markers such as
HIS3 and ADE2, in combination with the bacterial LacZ gene that codes for - galactosidase are commonly used reporter genes. Interaction is then analyzed by growth on selective plates lacking histidine and adenine or LacZ activity is measured using a colorimetric assay. This yeast two-hybrid approach can be expanded to a large scale
“library screening” approach in which the BD-bait fusion is screened against a cDNA library to identify interacting partners for the bait protein of interest. This approach has been successfully employed to identify interacting partners for heterologous proteins from Drosophila, Caenorhabditis, Arabidopsis, etc. (Formstecher et al., 2005; Kee et al.,
2007; Ma et al., 2009). A particularly successful example for the yeast two-hybrid approach in plants was the break-though study in Arabidopsis that identified receptors for the plant hormone ABA (Ma et al., 2009).
Another yeast-based system that has been developed is the membrane yeast two-hybrid
(MYTH) or split-ubiquitin system, which is a powerful tool for testing and identifying interactions between integral membrane proteins (Johnsson and Varshavsky, 1994;
Stagljar et al., 1998) (Illustrated in Figure 3.2). For example, the split-ubiquitin system has been used to develop a membrane based interactome map of Arabidopsis membrane proteins (Lalonde et al., 2010). The MYTH system was designed based on the finding that ubiquitin specific proteases (UBPs) mediate highly specific cleavage of proteins tagged with the 76 amino-acid protein Ubiquitin that is highly conserved among all eukaryotes (Hershko and Ciechanover, 1992). Ubiquitin can be separated into two stable moities, an N-terminal fragment of Ubiquitin (Nub) and a C-terminal fragment of
Ubiquitin (Cub). In the MYTH approach, an integral membrane bait protein is fused to the Cub along with an artificial transcription factor (TF) that is composed of the
108 Escherichia coli DNA-binding domain of LexA and the Herpes simplex virus VP16 transcriptional activation domain and the prey (cytoplasmic or membrane-associated) protein is fused to the Nub. The bait and prey fusion proteins are expressed in yeast. In the event of an interaction, the bait and prey proteins bring the Cub and Nub together reconstituting a “pseudoubiquitin” moiety. The UBPs recognize the pseudoubiquitin moiety and cleave after the C-terminal residue of the pseudoubiquitin releasing the TF, which then translocates into the nucleus to activate the transcription of the reporter genes. Similar to the yeast two-hybrid approach, the MYTH system can be extended to high-throughput studies to screen for interacting partners.
In this study, we have employed both the conventional yeast two-hybrid and the MYTH system to identify interacting partners for the ER localized, tail-anchored long coiled-coil proteins PAMP INDUCED COILED COIL (PICC) and PICC-LIKE (PICL). We have shown that PICC plays an important role in PAMP triggered Immunity (PTI) in defense against pathogens in Arabidopsis, whereas PICL does not function in PTI (see chapter
2). However, both PICC and PICL modulate post-germination growth response to the plant hormone abscissic acid (ABA) (see chapter 2). Through the yeast two-hybrid and
MYTH library screens, we have identified a tetratricopeptide repeat containing protein
(TP) as an interacting partner for PICC and the cytoplasmic Glutamyl t-RNA synthetase
(GluRS) as an interacting partner for PICL.
109
3.2 RESULTS
Yeast two-hybrid library screen
The strategy and preliminary tests
To identify interacting partners for PICL, a yeast two-hybrid library screen was performed using PICL as bait. The yeast two-hybrid system relies on the translocation of proteins into the nucleus by the GAL4 BD domain fused to the protein of interest (Fields and
Song, 1989). PICL is associated with the endoplasmic reticulum (ER) by its C-terminal transmembrane domain in Arabidopsis and N. benthamiana, (see chapter 2). Therefore, it was possible that PICL would also associate with membranes in yeast, which could potentially prevent its translocation to the nucleus. Thus, the PICL ORF was cloned into the yeast two-hybrid vector pAS1 without the C-terminal region encoding for the transmembrane domain (PICLTDF). pAS1-PICLTDF was then transformed into the host yeast strain PJ69-4A. The resulting bait fusion protein carries a HA tag and the
GAL4 BD at its N-terminus (Figure 3.3A). To confirm the expression of PICLTDF, yeast protein extracts were subjected to immunoblotting and PICLTDF was detected using the anti-PICC/PICL antibody (Figure 3.3B). For additional confirmation, the yeast protein extracts were subjected to a second immunoblot analysis using an anti-HA antibody
(Figure 3.3C). Yeast expressing the vector pAS1 was used as a negative control.
Immunoblotting analysis showed that PICLTDF was expressed in the host yeast strain.
This yeast strain PJ69-4A expressing PICLTDF was then used for large-scale library transformation.
110
The library screen
The Walker Arabidopsis cDNA library made from mRNA isolated from mature leaves and roots was obtained from the ABRC. The library was transformed into the yeast strain
PJ69-4A expressing PICLTDF. Transformants containing both the bait and prey were first selected based on growth on media lacking tryptophan (for bait plasmid) and leucine
(for prey plasmid). Two rounds of transformation resulted in a total of ~ 1 x 105 colonies.
The colonies were replica plated onto quadruple selection media lacking tryptophan, leucine, adenine and histidine (SM –L-W-A-H) to select for positive interactors. 38 colonies were selected based on growth on the quadruple selection media. To confirm the interactions, the prey plasmid isolated from the yeast colonies were transformed back into the yeast strain PJ69-4A expressing PICLTDF, which resulted in a total of 25 positive interactions. Sequencing of the 24 prey plasmids revealed sequences encoding for 3 proteins, two of which were represented multiple times: Glutamyl t-RNA synthetase
(GluRS) encoded by At5g26710 (3 times), DEHYDRATION RESPONSE ELEMENT B1A
(DREB1A) encoded by At4g25480 (21 times) and a putative Glycine rich protein (GRP) encoded by At1g67870 (1 time).
Elimination of false-positives after screening
Up to two-thirds of the clones transformed into yeast are predicted to have out-of-frame
GAL4 AD – Prey fusions encoding short peptide fragments that can potentially interact with the GAL4 BD – Bait protein giving rise to false positive interactions (Vidalain et al.,
2004). In order to eliminate out-of-frame false positives, we performed bioinformatic analysis of the sequences obtained after the screening in a two-step process. First, we
111 translated the sequence in-frame with the GAL4 AD sequence and then performed a
Basic Local Alignment Search Tool (BLAST) against the Arabidopsis non-redundant protein database using the translated prey protein as query and eliminated those sequences that did not retrieve any significant positive hits (e-value >10-5). Using the above criteria, we eliminated all the sequences that encoded for DREB1A and GRP as false-positives. In our analysis, we observed that the false-positives resulted from either out-of-frame prey fusions due to the presence of a 5` UTR upstream of the coding region, or due to inverted prey inserts because a single restriction site (Xho1) was used to clone the cDNA into the prey vector. After eliminating the false positives, GluRS remained as the only putative interacting partner for PICL from the yeast two-hybrid library screen (Table 3.1). Sequence analysis of the translated GluRS cDNA insert in the prey plasmid using the BLAST sequence alignment tool identified the N-terminal 1-189 amino acids as the PICL binding domain.
GluRS interacts with PICL in planta
To confirm the interaction between PICL and GluRS in vivo, we employed a co- immunoprecipitation (Co-IP) assay. Protein extracts from N. benthamiana leaves co- expressing the fusion protein Myc-GluRS and PICL or the fusion protein LFY-Myc and
PICL (as control) were used for the assay. An anti- Myc antibody was used to immunoprecipitate (IP) Myc-GluRS or LFY-Myc and the anti- PICC/PICL antibody was used to test the presence of PICL in the immunoprecipitated complexes. Immunoblot analysis showed that PICL was co-immunoprecipitated with Myc-GluRS but not with the negative control LFY-Myc confirming the interaction between PICL and GluRS in planta
(Figure 3.4).
112
GluRS is located in the cytoplasm
To investigate the sub-cellular localization of GluRS, the RFP fusion protein RFP-GluRS was transiently expressed under the CaMV 35S promoter in N. benthamiana and the localization was observed by confocal microscopy. RFP-GluRS was diffusely distributed in the cytoplasm (Figure 3.5). The cytoplasmic localization was confirmed by the colocalization of RFP-GluRS with the 35S promoter driven cytoplasmic unfused GFP
(Free-GFP) (Figure 3.4). PICL has a transmembrane domain at its C-terminal end which targets PICL to the ER (see chapter 2). To test if GluRS is enriched at the ER in presence of PICL, RFP-GluRS was coexpressed with GFP-PICL and the localization was observed by confocal microscopy. GFP-PICL labeled a clear reticulate ER network whereas, RFP-GluRS was diffusely distributed in the cytoplasm (Figure 3.5).
Taken together, the localization and interaction analysis suggests that PICL and GluRS may interact in the cytoplasm.
Membrane Yeast two-hybrid (MYTH) library screen
The strategy and preliminary tests
The conventional yeast two-hybrid library screen relies on the translocation of the non- nuclear proteins into the nucleus for the interaction to take place (Fields and Song,
1989). The transmembrane domain (TMD) of the bait was deleted to ensure nuclear localization of the bait. However, membrane-localized prey proteins will not translocate into the nucleus because of the presence of TMDs. Therefore, the yeast two-hybrid system does not identify interactors that are integral membrane proteins. To identify integral membrane proteins that interact with PICC and PICL, we adopted the membrane yeast two-hybrid approach (Iyer et al., 2005).
113 The membrane topology of the bait protein of interest is a critical factor in determining the suitability of a protein for use as MYTH bait (Iyer et al., 2005; Snider et al., 2010).
For proper functioning of the MYTH system, it is essential for the Cub to face the cytoplasm so that in the event of an interaction, when Cub and Nub reconstitute, the pseudoubiquitin moiety can be recognized by the cytoplasmic ubiquitin proteases
(UBPs) (Iyer et al., 2005; Snider et al., 2010). PICC and PICL are TA proteins anchored to the ER by their C-terminal tail (see chapter 2). The N-terminal coiled-coil domains of
PICC and PICL face the cytoplasm (see chapter 2). The TA mechanism is conserved across all eukaryotes and hence, it is possible that when expressing PICC and PICL in yeast, the proteins are targeted by the TA machinery in yeast and adopt a TA topology
(Abell and Mullen, 2011; Borgese et al., 2003). Therefore, we fused the artificial transcription factor (TF, consisting of bacterial LexA-DNA binding domain and the
Herpes simplex VP16 transactivator protein) and Cub at the N-terminus of PICC and
PICL so that when expressed in yeast, the Cub is present in the cytoplasm.
To verify the suitability of PICC and PICL as a MYTH bait, a NubG/NubI control test was performed. (Figure 3.6B and C).The NubG/NubI control test involves transforming Cub- bait with NubI or NubG and analyzing for activation of reporter genes. NubI is the wild type Nub with isoleucine (Ile) at position 13. Cub and NubI have high affinity for association and spontaneously interact to form the pseudo-ubiquitin moiety. NubG has
Glycine instead of Ile-13 and cannot spontaneously associate with Cub. The bait is considered suitable for MYTH if it activates the reporter genes when transformed with the interacting NubI and shows no activation of reporter genes when transformed with the non-interacting NubG. To perform the NubG/NubI control test, Cub-PICC or Cub-
PICL was transformed with NubG or NubI. The transformants were tested for growth on
114 yeast media lacking leucine, tryptophan, histidine and adenine. Yeast transformed with
Cub-PICL and NubI showed growth on the selective media whereas, yeast transformed with Cub-PICL and NubG did not grow on selective media confirming the suitability of
PICL as a MYTH bait (Figure 3.6B). Yeast transformed with Cub-PICC and NubI, also grew on selective media confirming its suitability as bait (Figure 3.6B). However, Cub-
PICC also showed a low level of self-activation, which was evident by weak growth of yeast cells when transformed with Cub-PICC and NubG (Figure 3.6B). This issue was addressed by increasing the stringency of the test by adding the histidine biosynthesis inhibitor 3-aminotriazole (3-AT) to the selective media and the growth of yeast was tested on selective media containing various concentrations (0-50 mM) of 3-AT. At 25 mM 3-AT, the Cub-PICC did not show self-activation and this concentration was used to select for interactors of PICC (data not shown).
Additionally, a -galactosidase assay was used to confirm the NubG/NubI control test.
Cub-PICC and Cub-PICL showed activation of the lacZ reporter gene when transformed along with NubI but not NubG, supporting the results from the growth assay (Figure
3.6C). Together, the NubG/NubI control test confirmed that Cub-PICC and Cub-PICL are suitable baits for MYTH library screening.
The library screen and elimination of false positives
An Arabidopsis thaliana NubG-Prey cDNA library made from mRNA isolated from 6-day- old seedlings was transformed into yeast strains expressing Cub-PICC or Cub-PICL.
The transformants were directly selected for interaction on selective yeast media. The transformants containing Cub-PICL as bait were selected for interaction based on growth on selective media lacking leucine, tryptophan, histidine and adenine. However,
115 the transformants containing Cub-PICC as bait were selected on selective media lacking leucine, tryptophan, histidine and adenine and containing 25mM 3-AT. 9 putative interactors out of 2.4 x 106 transformants (Table 3.2) and 28 putative interactors out of
1.44 x 107 transformants (Table 3.3) were obtained for PICL and PICC, respectively.
The prey plasmids were sequenced to identify putative interactors for PICC and PICL.
To eliminate false positives, the sequences were analyzed for out-of-frame NubG-Prey fusions. All the 9 putative interactors for PICL had out-of-frame NubG-Prey fusions and were eliminated as false positives. However, for PICC, following elimination of false- positives, 3 putative interactors, Ras-related protein (RABA2c) encoded by At3G46830, alpha-1,4-galacturonosyltransferase 1 (GAUT1) encoded by At3G61130, and a tetratricopeptide repeat-containing protein (TP) encoded by At1G56090, were identified.
To confirm the interaction of the 3 putative interactors with PICC and to test their interaction with PICL, the prey plasmids were retransformed into yeast with Cub-PICC or transformed into yeast with Cub-PICL and tested for growth on selective media. Yeast containing TP and PICC, and TP and PICL showed robust growth on the selection media suggesting interaction (Figure 3.7). However, yeast transformed with PICC and
GAUT1 or RABA2c, and PICL and GAUT1 or RABA2c failed to grow on the selective media and hence, were not selected for further analysis (Figure 3.7). Sequence analysis of the TP cDNA insert in the prey plasmid using BLAST sequence alignment showed that the complete TP ORF was present.
Taken together, from the MYTH library screens, TP was identified as a putative interactor for PICC and PICL
116
TP is located at the cytoplasm
To investigate the sub cellular localization of TP, RFP and GFP fusion proteins RFP-TP and TP-GFP were transiently expressed under the CaMV 35S promoter in N. benthamiana and the localization was observed by confocal microscopy. RFP-TP and
GFP-TP showed diffuse cytoplasmic distribution and colocalized with cytoplasmic Free-
GFP and RanGAP-mCherry (Figure 3.8A and B).
117
3.3 DISCUSSION
PICC and PICL are homologous long coiled-coil proteins localized at the ER. Coiled-coil domains are known to mediate specific interactions by forming homo-and hetero- oligomers (Bruce, 2002; Strauss and Keller, 2008). These protein-protein interactions play a central role in defining the functionality of the proteins. In this study, we have used a yeast two-hybrid system and a membrane yeast-two hybrid system to identify interacting partners for PICC and PICL to help us further our understanding of PICC and
PICL functions through their interaction networks.
Interaction between PICL and GluRS
Using a yeast two-hybrid library screen, we identified GluRS as a putative interacting partner for PICL and confirmed the interaction by Co-IP in planta. GluRS belongs to the family of amino acyl t-RNA synthetases (ARS), which play an important role in protein synthesis by catalyzing the aminoacylation of t-RNAs with amino acids (Ibba and Söll,
2000). While ARS have been extensively studied in yeast and mammalian systems, the investigation into the function and regulation of ARS in plants is limited despite its functional importance in protein synthesis. Plant ARS are classified into either cytosolic or organellar t-RNA synthetases based on their substrate specificity. We have identified the cytosolic GluRS as the interacting partner for PICL. We have shown that the long coiled-coil domains of PICL are cytoplasmic (see chapter 2), which prompts us to speculate that PICL interacts with GluRS possibly through its cytosolic long-coiled-coil domains.
118 Recent studies have demonstrated the importance of the organellar GluRS (encoded by
At5g64050), which is dual targeted to mitochondria and chloroplasts (Berg et al., 2005;
Kim et al., 2005; Pujol et al., 2008). However, there are no reports on the characterization of cytoplasmic GluRS in plants. Protein synthesis is a crucial cellular process, central to the functioning of an organism. Plant ARS have been shown to be important for development and gametogenesis and loss of the cytoplasmic ARS studied so far has resulted in lethal phenotypes signifying the importance of ARS in maintaining viability (Berg et al., 2005; Verderio et al., 1998; Zhang and Somerville, 1997). picl-1 mutant plants do not show any developmental phenotype and resemble WT plants under standard laboratory conditions (see chapter 2). However, picl-1 mutants are not null mutants. A truncated soluble PICL protein is produced in picl-1 mutants (see chapter 2).
Therefore, it is possible that interaction of PICL with GluRS is important for the canonical function of GluRS in protein synthesis. Several vertebrate ARSes have been shown to have non-canonical functions (Pujol et al., 2008). In particular, the vertebrate glutamyl- prolyl-t-RNA synthetase (GluProRS) has been shown to function as a component of the interferon (IFN)-gamma-activated inhibitor of translation (GAIT) complex involved in translational silencing (Sampath et al., 2004). Based on these studies, we can speculate that PICL could either be involved in a yet unidentified non-canonical function of GluRS or in protein synthesis assisting GluRS.
GluRS has been shown to interact with HOPZ-ACTIVATED RESISTANCE 1 (ZAR1) which belongs to the coiled-coil (CC) class of nucleotibe binding site and leucine-rich repeat (NBS-LRR) containing resisance (R) proteins, in a yeast two-hybrid system
(Brandao et al., 2009). ZAR1 is required for recognition and virulence attenutation of the
Pseudomonas syringae type III secreted effector (T3SE) HopZ1A (Lewis et al., 2010).
119 PICC has been shown to play a role in plant immunity (see chapter 2). It will be interesting to see whether PICC also interacts with GluRS and whether PICC, PICL,
GluRS and ZAR1 exist in a complex. It is hypothesized that the ZAR1 resistance- signaling pathway is independent of the known pathways (Lewis et al., 2010). Therefore, it is tempting to speculate that PICC and PICL along with GluRS may be involved in a yet unidentified ZAR1 resistance-signaling pathway. Future work involving testing for virulence attenuation of HopZ1 in picc and picl mutant plants has the potential to open up exciting new venues for unraveling a new resistance-signaling pathway.
Interaction between PICC and TP
TP is a tetratricopeptide repeat (TPR)-containing protein. The TPR motif consists of 3-
16 repeats of loosely conserved 34 amino acids that are generally arranged in tandem arrays and known to function as mediators of protein-protein interactions (D'Andrea and
Regan, 2003). The TPR motif has been identified in all organisms and is known to be involved in a wide range of cellular functions (Blatch and Lässle, 1999; D'Andrea and
Regan, 2003). TP is predicted to have 3 tandem TPR repeats at its N-terminus. In
Arabidopsis, 79 TPR-containing proteins have been identified by bioinformatic analysis
(D'Andrea and Regan, 2003) and those which have been functionally studied are involved in a variety of actitvites. For example, the Tertratricopeptide thioredoxin like 1
(TTL1) protein has been shown to be required for osmotic stress responses and ABA sensitivity (Rosado et al., 2006). The carboxylate clamp type tetratricopeptide repeat proteins (CC-TPR) have been suggested to function as co-chaperones of heat shock proteins Hsp90 and Hsp70 (Prasad et al., 2010). However, the function of the interacting partner for PICC, TP, has not been characterized so far. The MYTH interaction analysis showed that TP interacts with both PICC and PICL suggesting that TP interaction maybe
120 important for a common function of PICC and PICL. picc-1, picc-2 and picl-1 mutant plants are hypersensitive to ABA during their post-germination growth stage (see chapter 2). Based on the ABA hypersensitive phenotype of picc and picl mutants, and the interaction of PICC and PICL with TP, it is tempting to speculate that the interaction of PICC and PICL with TP might play a role in post-germination growth response to
ABA. Analysis of knock-out mutants of tp for ABA hypersensitivity in the WT, picc-1, picc-2, picl-1 and picc-1;picl-1 double mutant backgrounds will reveal the relationship between PICC, PICL and TP in response to ABA. TP was originally identified as an interacting partner for PICC. Therefore, it is possible that TP plays a role in PTI against pathogens similar to PICC (see chapter 2). PICC expression is induced by PAMPs (see chapter 2). However, Genevestigator analysis did not show any upregulation of TP by
PAMPs (data not shown), suggesting that TP may not be involved in PTI. Experimental analysis of TP expression during PTI and analysis of tp mutants in WT and picc mutant background for compromised PTI remains to be performed, which will help us determine the role of TP-PICC interaction in disease resistance.
Limitations of the library screens
One of the major limitations of screening for interacting partners in a heterologous system such as yeast is that the post-translational modifications that may be important for certain key interactions do not occur in yeast or occur inaccurately. Such modifications include phosphorylation, glycosylation, and formation of disulfide bridges, etc. (Bruckner et al., 2009; Osborne et al., 1996; Van Criekinge and Beyaert, 1999).
Phosphoproteomic studies have shown that PICC is phosphorylated after treatment with
ABA in Arabidopsis (Kline et al., 2010). ABA was shown to play multiple roles in defense response to bacterial pathogens. During pre-invasive stages, ABA has been shown to be
121 important for stomatal closure preventing the entry of pathogens through the stomata
(Melotto et al., 2006), whereas, during later stages of infection, virulence is correlated with an increase in ABA production facilitating the establishment of infection (De Torres
Zabala et al., 2009; Yasuda et al., 2008). picc mutant plants are compromised in PTI and show hypersensitivity to ABA during post-germination growth stages (see chapter 2).
Taken together, these lines of evidence prompt us to speculate that phosphorylation of
PICC by components of the ABA signaling cascade may play a role in modulating defense responses and plant responses to ABA. Phosphorylated PICC may interact with a different set of proteins crucial for its function in response to ABA and pathogens. The library screen is limiting since the library is not enriched for proteins involved in defense response or ABA response. Additionally, the yeast library screens may not identify interactors that require phosphorylated PICC for interaction especially if PICC phosphorylation is mediated by plant-specific kinases. In vivo pull down assays in
Arabidopsis following pathogen infection or ABA treatment might provide greater insights into the interaction network of PICC.
Other putative interacting partners
Data mining the MIND 0.5 database
(http://www.associomics.org/Associomics/MIND_0.5.html), which contains results from a large scale interaction screen involving membrane proteins in Arabidopsis, resulted in the identification of two membrane proteins – a Cornichon family protein encoded by
At3G12180 and a Leucine-rich repeat (LRR) protein kinase family protein encoded by
At4G20790 as putative interacting partners for PICC. Cornichon family proteins have been characterized in Drosophila and mammalian cells. They are known to function as chaperones facilitating the secretion of specific cargo from the ER (Bäkel et al., 2006;
122 Kato et al., 2010; Schwenk et al., 2009). However, Cornichon family proteins have not been studied in plants. In Arabidopsis, activation of immune response results in the secretion of antimicrobial compounds such as the pathogenesis related (PR) proteins
(Durrant and Dong, 2004; van Loon et al., 2006). It will be interesting to see if Cornichon proteins and PICC together play a role in secretion during immune response. LRR protein kinases play an important role in development and defense in plants by perceiving and transducing signals for growth and activation of defense response
(Diévart and Clark, 2004). Some of the LRR kinases known to function in defense response include the FLS2 and EFR receptors, which recognize pathogens through their
LRR domains and activate defense signaling through their kinase domains (Gomez-
Gomez and Boller, 2000; Zipfel et al., 2006). A potential interaction of PICC with an LRR kinase may play an important part in immune response. Both the Cornichon family protein and the LRR receptor kinase, if confirmed as interacting partners for PICC, will make excellent candidates for exploring the molecular mechanism of PICC function.
Conclusion
Using yeast two hybrid and MYTH library screening and through data mining we have identified putative interacting partners for PICC and PICL. Biochemical verification of interaction and functional characterization of these proteins using the reverse genetics approach and dissection of their genetic interaction are some of the approaches that will provide valuable information to establish and expand the interaction network of PICC and PICL.
123
3.4 MATERIALS AND METHODS
Plant material and growth conditions
Plant growth conditions for Nicotiana benthamiana are as described in Chapter 2.
Yeast strains
The yeast strain Saccharomyces cerevisiae PJ69-4A (genotype: MATa trp1-901 leu2-
3,112 ura3-52 his3-200 gal4 gal80 LYS2::GAL1-HIS3 GAL2-ADE2 met2::GAL7-lacZ) was used for the yeast two-hybrid library screen (James et al., 1996).
The yeast strain Saccharomyces cerevisiae strain THY.AP4 (genotype: MATa, ura3, leu2, lexA::lacZ::trp1, lexA::HIS3, lexA::ADE2) was used for the MYTH library screens
(Obrdlik et al., 2004).
Yeast two-hybrid library screen
The host strain PJ69-4a was grown in liquid YPAD (1% Yeast Extract, 2% Bacto peptone, 2% Glucose, 0.01% Adenine Hemisulfate) medium and transformed with the bait plasmid as described in Chapter 2. Yeast strains containing the bait plasmid were selected on synthetic drop out (SD) plates (6.7gl-1 Yeast Nitrogen Base without amino acids (Sunrise Sciences, San Diego, CA, USA), Complete Supplement Mixture (CSM,
Sunrise Sciences) drop out mixture lacking appropriate amino acid according to manufacturer’s instructions, 2% W/V Glucose, 1.5% Agar-Agar, pH 5.8) lacking
Tryptophan (SD-W). The Walker two-hybrid Arabidopsis cDNA library was obtained from
ABRC and transformed into yeast containing the bait plasmid. Large-scale high- efficiency Library transformation was performed using the LiAc/SS carrier DNA/PEG
124 method as described (Gietz and Schiestl, 2007). The transformants were selected on SD plates lacking leucine and tryptophan (SD –L-W). The transformants were replica plated onto SD media lacking leucine, tryptophan, histidine and adenine (SD –L-W-H-A) to identify interactors. The positive colonies were grown overnight in liquid SD -L-W media for plasmid isolation. Yeast plasmid rescue was performed as described (Robzyk and
Kassir, 1992). Plasmids isolated from yeast were transformed into the E.coli shuttle strain KC8 by electroporation and the bacterial transformants containing only the prey plasmids were selected on M9 media lacking leucine. M9 media was prepared as described (2006). The prey plasmids were isolated from KC8 with the Nucleospin
Plasmid Miniprep Kit (Clontech) using the manufacturer’s protocol for plasmid isolation from EndA+ strains. The purified plasmid DNA was retransformed into the host yeast strain along with the bait. The transformants were selected on SD-L-W plates and then plated onto SD-L-W-H-A plates to confirm interaction. The prey plasmids that showed positive interaction after retransformation were sequenced as described in Chapter 2 using the primers listed in Table 3.4.
Constructs and Cloning
GluRS and TP ORFs were amplified using the Thermoscript RT-PCR system
(Invitrogen) from seedling mRNA isolated as described in Chapter 2. PICLTDF was amplified from the PICL cDNA (see Chapter 2) using the primers listed in Table 3.4 and cloned into the yeast two-hybrid bait vector pAS1 using the In-fusion cloning system
(Clontech). PICC and PICL were cloned into the MYTH bait vector pBT3N as described in Chapter 2 using primers listed in Table 2.1. The GluRS and TP cDNA were cloned into the pENTR/D-TOPO Gateway entry vector (Invitrogen). GluRS was moved into the
Gateway destination vectors pGWB6 (35S promoter, N-sGFP), pGWB21 (35S promoter,
125 N-10x Myc) and pH7WGR2 (35S promoter, N-RFP) by LR recombination. The
35S::LFY-MYC construct used as a control was a kind gift from Dr. Rebecca Lamb (The
Ohio State University, Columbus, OH, USA). The TP ORF was moved into the destination vectors pK7FWG2 (35S promoter, C-EGFP) and pH7WGR2 (35S promoter,
N-RFP) by LR recombination. All the clones in destination vectors were introduced into
Agrobacterium tumefaciens (Agrobacterium) strain GV3101.
Membrane Yeast two-hybrid library screen
The host strain THY.AP4 was grown in YPAD and transformed with the baits as described in Chapter 2. Yeast strains containing the bait plasmid were selected on SD plates lacking leucine (SD-L). The Arabidopsis cDNA library was obtained from Dual systems biotech, Switzerland. The cDNA library was transformed into yeast containing the bait plasmid using the LiAc/SS carrier DNA/PEG method as described (Gietz and
Schiestl, 2007). The interactors were directly selected on SD-L-W-H-A when PICL was used as bait or on SD-L-W-H-A plates containing 25mM 3-AT when PICC was used as bait. The positive colonies were grown overnight in SD-L-W liquid media for plasmid isolation. Plasmid rescue was performed as described (Robzyk and Kassir, 1992). The plasmids were then transformed into the bacterial strain DH5 by electroporation and the bacteria containing only the prey plasmid were selected on plates containing LB media + 50gl-1 Kanamycin. Plasmids from the E. coli were isolated using the
Nucleospin Plasmid Miniprep Kit (Clonetech) and sequenced as described in Chapter 2 using the primer listed in Table 3.4. To estimate the total number of transformants, 100
l of 1:100, 1:1000 and 1:10,000 dilutions of the yeast were plated onto SD -L-W plates and the colonies were counted after 3-4 days on selection plates. The total number of transformants were calculated using the formula: number of colonies on the SD-L-W
126 plate * dilution factor * 10 * total amount of yeast (in ml) plated onto the quadruple selection media.
-galactosidase assay
The -galactosidase assay to evaluate the NubG/NubI control test was performed as described in Chapter 2
Co-Immunoprecipitation
Co-Immunoprecipitation was performed using Agrobacterium infiltrated N. benthamiana leaves. Agrobacterium infiltration was performed as described in Chapter 2. N. benthamiana plants infiltrated with Agrobacterium were grown under standard growth conditions for 48 hours after which, the infiltrated leaves were collected in liquid Nitrogen and ground to a fine powder using mortar and pestle chilled with liquid Nitrogen.
Approximately 1ml of the ground tissue was resuspended in ice-cold 1ml
Immunoprecipitation (IP) buffer (50 mM Tris.HCl (pH 7.5), 150 mM NaCl, 0.5% NP-40, 1 mM EDTA, 3 mM DTT and 1x Protease Inhibitor Cocktail (Sigma)) to extract the proteins. The suspension was centrifuged at 20,000 g at 4C for 10 minutes to precipitate the debris. Immunoprecipitations were done using anti-Myc antibody (Sigma) bound overnight to Protein A Sepharose beads (GE Healthcare, Waukesha, WI, USA).
Protein extracts were incubated with the antibody-bound beads for 3 h at 4C. After washing 4 times (2000 rpm, 5 min) with the ice-cold IP buffer, immunoprecipitates were resuspended in 3x SDS protein loading dye and boiled for 5 minutes. The proteins were separated on an 8% SDS-PAGE gel, transferred to PVDF membranes and subjected to immunoblot analysis with primary monoclonal anti-cMyc antibody (Sigma-Aldrich,
127 1:2,000) and secondary anti-mouse HRP conjugated antibody (Sigma-Aldrich, 1:10,000) or with primary rabbit polyclonal anti-PICC/PICL antibody (see Chapter 2,1:2000) and secondary anti-rabbit HRP conjugated antibody (GE Healthcare,1:20,000), as described in Chapter 2.
Yeast protein extraction
Yeast protein extraction was performed as described in (Michael P, 1991). Briefly, 10ml yeast culture in appropriate dropout media was grown to saturation. The cells were pelleted by centrifugation (4000g, 10 minutes, 4C) and washed with 1ml of sterile water.
The cells were then resuspended in 1.5 ml of extraction buffer (1.85 ml of 10M NaOH,
0.74 ml β-mercaptoethanol and 7.41 ml water) and incubated on ice for 10 minutes. 1.5 ml of 50% trichloroacetic acid (TCA) was added to the suspension, incubated on ice for
10 minutes and centrifuged (4000 g, 5 minutes, 4C) to precipitate the proteins. The pellet was washed with 11ml ice-cold acetone (-20C) to remove traces of TCA. The pellet was finally resuspended in 200 l of 5% SDS – 50 mM Tris (non-buffered), boiled for 5 minutes and centrifuged (20,000 g, 5 min, room temperature (RT)). 2.5 l of 3x
SDS protein loading dye (see chapter 2) was added to 5l of the supernatant before loading onto an SDS gel for immunoblot analysis.
Immunoblot analysis
Immunoblot analyses were performed as described in Chapter 2. For detecting HA tagged fusion proteins, anti-HA peroxidase conjugated antibody was used (Sigma,
1:5000).
128
Confocal microscopy
Confocal microscopy to study the localization of RFP-GluRS, RFP-TP and TP-GFP was performed as described in Chapter 2.
129
Figure 3.1 A graphical representation of the yeast two-hybrid system In the absence of interaction, the bait alone cannot activate the expression of reporter genes. When the bait interacts with a prey protein, the interaction brings together the Gal4 DNA binding domain (BD) and Gal4 activation domain (AD), which can activate the transcription of reporter genes such as ADE2, HIS3 and LacZ. UAS, upstream activating sequence.
130
Figure 3.2 A graphical representation of the MYTH (split-ubiquitin) system Membrane bound bait proteins are tagged with the LexA-VP16 artificial transcription factor (TF) and C-terminal fragment of Ubiquitin (Cub). The prey is tagged with N- terminal fragment of Ubiquitin (Nub). The Interaction of the bait with the prey protein brings together Cub and Nub forming a pseudoubiquitin molecule, which can be recognized by the Ubiquitin proteases (UBPs) in the cytoplasm. UBPs cleave at C- terminus of the Cub tag leading to the release of the TF factor, which then translocates into the nucleus to activate the expression of reporter genes such as ADE2, HIS3 and LacZ. Note that, although the prey protein is shown as a membrane associated protein in this figure, the MYTH system is effective for prey proteins located in the cytoplasm as well.
131
Figure 3.3 Immunoblot showing expression of the bait PICLTDF in the yeast strain PJ69-4A Protein was extracted from two independent yeast colonies (pAS1- PICLTDF1 and pAS1-PICLTDF2) and subjected to immunoblot analysis. The protein extract from yeast carrying the vector alone (pAS1) was used as a negative control. A) Graphical representation of the bait fusion protein. PICLTDF (1 – 763aa) is fused to the HA tag and the Gal4 BD at its N-terminus. B) The bait fusion protein HA-Gal4 BD-PICLTDF (arrow) detected with anti- PICC/PICL antibody. C) The bait fusion protein HA-Gal4 BD-PICLTDF (arrow) detected with anti-HA antibody.
132
Figure 3.4 PICL interacts with GluRS in a co-immunoprecipitation assay Protein extracts from N. benthamiana leaves transiently coexpressing 35S::PICL with 35S::MYC-GluRS or 35S::LFY-MYC (negative control) were immunoprecipitated with anti-MYC antibody and detected with anti-MYC antibody (IP) or anti-PICC/PICL antibody (Co-IP). Black arrowheads indicate PICL.
133
Figure 3.5 RFP-GluRS is localized in the cytoplasm Confocal images showing co-localization of the fusion protein RFP-GluRS with cytoplasmic, un-tagged GFP (Free-GFP) or ER localized GFP-PICL in N. benthamiana leaf epidermal cells. Scale = 10m
134
Figure 3.6 PICC and PICL are suitable baits for library screening using the MYTH (split-ubiquitin) system as determined by the NubG/NubI control test A) Graphical representation of the bait fusion protein. The bait PICC or PICL is tagged with the artificial transcription factor LexA-VP16 (TF) and Cub at its N- terminus.
Continued
135 Figure 3.6 Continued B) Growth on selection media lacking Leucine, Tryptophan, Adenine and Histidine.The bait fusion proteins Cub-PICL or Cub-PICC transformed along with WT NubI activate the expression of reporter genes resulting in robust growth on the selection media (I and II). The bait proteins when transformed along with the non-interacting NubG, do not activate the reporter genes (III and IV). However, weak self-activation of Cub-PICC with NubG is seen (IV). C) -galactosidase activity showing the activation of the LacZ reporter gene due to spontaneous association of Cub-PICC or Cub-PICL with WT NubI.
136
Figure 3.7 TP interacts with PICC and PICL Growth on selection media lacking Leucine, Tryptophan, Adenine and Histidine, and containing 25mM 3-AT. GAUT1 and AtRab2C are false positives obtained from the library screen. Unfused Nub was used as a negative control.
137
Figure 3.8 TP is located in the cytoplasm Confocal images showing colocalization of TP-GFP with cytoplasmic RanGAP-mCherry (A) and colocalization of RFP-TP with cytoplasmic Free-GFP (B). Scale = 10m.
138 Table 3.1 Putative interactors for PICL identified by yeast two-hybrid library screen Name Locus In-frame prey cDNA Glutamyl t-RNA synthetase (GluRS) At5g26710 Yes Glycine rich protein (GRP) At1g67870 No Dehydration response element B1A (DREB1A) At4g25480 No
139
139 Table 3.2 Putative interactors for PICL identified by the MYTH library screen Name Locus In-frame prey cDNA Adenylate kinase1 (ADK1) AT5G63400 No Acyl-coenzyme A oxidase 2 (ACX2) AT5G65110 No Transcription factor bHLH147 AT3G17100 No Photosystem II light harvesting complex protein 2.1 (LHC2.1) AT2G05100 No Photosystem I light harvesting complex protein (LHCA2) AT3G61470 No Disulfide-isomerase A6 (PDIL2-3) AT2G32920 No Expansin A6 (EXPA6) AT2G28950 No Ubiquitin-associated (UBA) protein AT2G41160 No Peroxidase AT2G37130 No
140
140 Table 3.3 Putative interactors for PICC identified by the MYTH library screen
Name Locus In-frame prey cDNA Plasma membrane intrinsic protein 1-3 (PIP1-3) AT1G01620 No Serine acetyltransferase 5 (SERAT1-1) AT5G56760 No Small Ras-like GTP-binding protein At5g20020 No
Ras-related protein RABA2c (RABA2c) AT3G46830 No
Invertase/pectin methylesterase inhibitor family protein AT1G55000 No Light-harvesting chlorophyll B-binding protein3 (LHCB3) AT5G54270 No Brassinazole-resistant 2 (BES1) AT1G19350 No
PPPDE putative thiol peptidase-like protein AT4G17486 No
Putative aquaporin (TIP2-2) AT4G17340 No Peroxisomal acyl-coenzyme A oxidase 1 (ACX1) AT4G16760 No
141
Continued
141 Table 3.3 Continued
Carbonic anhydrase 2 (CA2) AT5G14740 No
Sodium bile acid symporter-like protein AT2G26900 No Heat stress transcription factor B-2a (HSFB2A) AT5G62020 No
Uncharacterized protein (AT2G28370) AT2G28370 No Putative peroxisomal (S)-2-hydroxy-acid oxidase 2 AT3G14420 No Tetratricopeptide repeat-containing protein (TP) At1g56090 Yes DEAD-box ATP-dependent RNA helicase 5 (STRS1) AT1G31970 No
Putative endoxyloglucan glycosyltransferase At2g06850 No
Light-harvesting complex I chlorophyll a/b binding protein 1 (LHCA1) AT3G54890 No Alpha-1,4-galacturonosyltransferase 1 (GAUT1) AT3G61130 No Xyloglucan-xyloglucosyl transferase (XTH15) AT4G14130 No
142
Continued
142 Table 3.3 Continued
Plasma-membrane associated cation-binding protein 1 (PCAP1) AT4G20260 No Putative endoxyloglucan glycosyltransferase At2g06850 No Uncharacterized protein AT4g05050. AT4g05050 No Homeobox protein knotted-1-like 1 (KNAT1) AT4G08150 No Plastid division2 protein (PDV2) AT2G16070 No Glutathione S-transferase TAU 22 (GSTU22) AT1G78340 No Malate dehydrogenase (PMDH1) AT2G22780 No
143
143 Table 3.4 List of Primers
Primer Name Primer Sequence (5’ – 3’) Source Purpose
PICLTDF_F1 GCTTGGGTGGTCATATGATGGAAGAAGCAACAAAAGTGAGTTCAG This study Cloning
PICLTDF_R1 CCCGGGGCCTCCATGGTCAGAGATGCCATGTTTCAGCTTTG This study Cloning
GLURS_F CACCATGGATGGGATGAAG This study Cloning
GLURS_R CTTAGCGGCTCTTCCATCTG This study Cloning
TP_F CACCATGGCGTCAGCGGTGAC This study Cloning
TP_R_S TCACTTCACAGGACGCACCCCG This study Cloning
TP_R2_NOS CTTCACAGGACGCACCCCGACTG This study Cloning
144 PACT_F1 CTATCTATTCGATGATGAAGATACC This study Sequencinga
PACT_R1 CGGGGTTTTTCAGTATCTACGAT This study Sequencinga
Continued
144 Table 3.4 Continued
pNubGx GTCGAAAATTCAAGACAAGG www.dualsystems.com Sequencingb
a, Sequencing yeast two-hybrid library prey vector
b, Sequencing MYTH library prey vector
145
145
APPENDIX
Towards identification of the NUCLEAR PORE ANCHOR
protein interacting network
146
A.1 INTRODUCTION
The nuclear pore complex (NPC) is the sole gateway for RNA and protein trafficking between the nucleus and the cytoplasm (Meier, 2005; Xu and Meier, 2008). The large multiprotein complex of the NPC forms a channel-like structure and is roughly organized into three elements: a nuclear basket, a central pore and cytoplasmic fibrils (Meier,
2005; Xu and Meier, 2008). The Arabidopsis NUCLEAR PORE ANCHOR (NUA) and its orthologs, the vertebrate TRANSLOCATED PROMOTER REGION (TPR), the yeast
MYOSIN-LIKE PROTEINs (MLP1/MLP2) and the Drosophila MEGATOR (MTOR), are conserved proteins located at the nuclear side of the NPC (Xu et al., 2007b). NUA is a
237-KDa protein with long N-terminal coiled-coil domains and a C-terminal acidic non- coiled-coil tail. NUA plays a role in the nuclear-pore associated processes of sumoylation and mRNA export and therefore, loss of NUA leads to a defect in these processes which causes complex developmental phenotypes such as early flowering, stunted growth, defective stamen and silique development and changes in phyllotaxy
(Xu et al., 2007b).
Given the importance of NUA in the development and health of the plant, it is crucial to develop a comprehensive understanding of the molecular mechanism of NUA function.
As discussed in Chapter 3, protein-protein interactions play a major role in determining the functionality of a protein. Towards this end, we describe our efforts to identify the
NUA protein interaction networks using yeast two-hybrid assays and a yeast two-hybrid library screen.
147
A.2 RESULTS AND DISCUSSION
NUA forms homodimers and interacts with ESD4
Coiled-coil domains mediate homo and hetero oligomerization through specific interactions (Bruce, 2002; Strauss and Keller, 2008). Mammalian Tpr has been shown to form homodimers through its coiled-coil domains (Hase et al., 2001). To investigate the homodimerization potential of NUA, a yeast two-hybrid assay was performed. Fusion proteins AD:NUA and BD:NUA were expressed in the yeast strain PJ69-4A and the self- interaction was analyzed by growth on selective media. The results show that NUA forms homodimers (Figure A1-B). We further tested different domains of NUA in the yeast two-hybrid system to map the homodimerization domain (Figure A1-A). Our results show that the N-terminal 533 amino acids are sufficient to mediate homodimerization of
NUA (Figure A1-B).
The Arabidopsis protein EARLY IN SHORT DAYS 4 (ESD4) is a SUMO protease located at the nuclear periphery (Murtas et al., 2003). Null mutants of NUA and ESD4 show similar developmental and molecular phenotypes (Xu et al., 2007b). Analysis of nua;esd4 double mutants indicate that NUA and ESD4 may function in the same complex or pathway (Xu et al., 2007b). Moreover, the nuclear envelope localization of the yeast ortholog of ESD4, ULP1, depends upon the NUA orthologs MLP1/MLP2 (Zhao et al., 2004). Based on these evidences, we hypothesized that NUA may interact with
ESD4. To test NUA-ESD4 interaction, we performed a yeast two-hybrid analysis. Fusion protein BD:ESD4 was tested for interaction with AD:NUA and with different domains of
NUA (Figure A1-A). Supporting our hypothesis, the results show that NUA interacts with
148 ESD4. The interaction domain was mapped to the N-terminal 533 amino acids (Figure
A1-B).
Taken together, our results from the yeast two-hybrid assays indicate that NUA forms homodimers, and interacts with ESD4 through its N-terminal coiled-coil domains.
Yeast two-hybrid library screen
In addition to its involvement in SUMO homeostasis, probably through its interaction with
ESD4, NUA also has a function in the export of poly(A)+ RNA, suggesting that NUA may interact with proteins involved in the mRNA export pathway (Xu et al., 2007b).
Mammalian TPR interacts with the nucleoporin NUP153 (Hase and Cordes, 2003), and forms a complex with the mitotic spindle assembly checkpoint proteins MAD1 and MAD2
(Lee et al., 2008). Yeast Mlp1 is a docking site for heterogenous nuclear ribonucleoproteins (hnRNPs) that are required for mRNA export (Green et al., 2003).
These lines of evidence suggest that NUA may be interacting with proteins other than
ESD4. To identify more interacting partners for NUA, we performed a yeast two-hybrid library screen. Since coiled-coil domains are known to function as hubs for protein- protein interactions (Rose and Meier, 2004), we used the N-terminal coiled-coil region of
NUA (NUA-B, 1-1248 aa) as bait in the library screen (Figure A2-A).
The Walker Arabidopsis cDNA library (see Chapter 3) was transformed into yeast strain
PJ69-4A expressing BD:NUA-B (Figure A2-B). After selecting for transformants containing both the prey and the bait plasmid on selection media lacking leucine and tryptophan, the yeast were replica plated onto quadruple selection media lacking leucine, tryptophan, histidine, and adenine, to select for interactors. A total of 20 yeast colonies from ~1 x 105 transformants showed positive interaction. To confirm the
149 interaction, the plasmids isolated from yeast colonies were retransformed into the yeast and the positive interactors were selected on the quadruple selection media. The prey plasmids giving rise to positive interactions were sequenced. This resulted in the identification of 5 putative interactors listed in Table A1. The 5 prey sequences were subjected to bioinformatic analysis to eliminate false positives as described in Chapter 3.
The results showed that all the 5 prey plasmids contained cDNA inserts fused in the correct reading frame.
Data mining using the Arabidopsis information resource (TAIR) database showed that 3 putative interactors, TRYPTOPHAN SYNTHASE BETA-SUBUNIT (TSB1) encoded by
AT5G54810, putative p35 protein encoded by At1G05860, and LIGHT HARVESTING
COMPLEX B SUBUNIT 6 (LHCB6) encoded by At1G15820, were localized in the chloroplast. NUA is localized at the inner nuclear envelope. Therefore, the putative interactors localized at the chloroplast maybe false positive interactors. The bZIP transcription factor family protein encoded by At4G02640 and the
PHOSPHOGLYCERATE MUTASE family protein encoded by At3G50520 are potential interactors for NUA. Future work involving confirmation of the interaction in planta and establishing the sub-cellular localization of these proteins will form the basis for a more comprehensive interaction analysis between NUA and the two putative interactors identified by the yeast two-hybrid library screen.
150
A.3 MATERIAL AND METHODS
Constructs and Cloning
Due to large size of NUA (~6Kb), the NUA ORF was cloned in four fragments using the Thermoscript RT-PCR system (Invitrogen). Partial fragments were cloned into pENTR/D-TOPO Gateway entry vector and confirmed by sequencing. The full length
NUA ORF was assembled by restriction cloning using the unique AatII, ScaI and
XmaI restriction enzyme sites. The full length NUA ORF sequence in pENTR/D-
TOPO was confirmed by sequencing. The full length NUA ORF was moved into the yeast two-hybrid Gateway destination vectors pDEST22 and pDEST32 (Invitrogen) by LR recombination. The ESD4 ORF in pENTR/D-TOPO was obtained from ABRC and confirmed by sequencing. The ESD4 ORF was moved into the yeast two-hybrid
Gateway destination vectors pDEST22 and pDEST32. The partial fragment NUA-B was cloned into the yeast two-hybrid bait vector pGBT9 by In-fusion Cloning System
(Clontech) using primers listed in Table A1 and confirmed by sequencing.
Sequencing was performed as described in Chapter 2.
Yeast two-hybrid analysis
The bait and prey plasmids were transformed into the host strain PJ69-4A as described in Chapter 2. The transformants were selected on dropout media SD -L-W
(see Chapter 3 for composition) and interactions were analyzed by observing for growth on plates containing the quadruple dropout media SD-L-W-H-A.
151
The yeast two-hybrid library screen
Yeast two-hybrid library screen was performed as described in Chapter 3 using
NUA-B as bait.
Yeast protein extraction and immunoblot analysis
Yeast protein extraction was performed as described in Chapter 3. The proteins were separated on an 8% SDS-PAGE gel and transferred onto PVDF membrane.
Immunoblot analysis was performed as described in Chapter 2 with the primary rabbit polyclonal anti-NUA antibody [3] (1:2,000) and secondary anti-rabbit HRP conjugated antibody (GE healthcare,1:20,000) to detect the presence of NUA-B.
152
Figure A.1 NUA self interacts and interacts with ESD4 in yeast two-hybrid assays A) Different domains of NUA tested in yeast two-hybrid. In the depiction of the full-length protein, coiled-coil domains are indicated by black bars. NLS, nuclear localization signal. First and last amino acids of each fragment are indicated. B) Interaction shown on selection medium lacking Leucine, Tryptophan, Histidine and Adenine. Full-length NUA protein (NUA-A) interacts with itself and with ESD4. Partial NUA proteins NUA-B and NUA-C self-interact, interact with NUA-A and with ESD4. Empty BD vector was used as negative control. C) Control plates (selection medium lacking Leucine and Tryptophan) showing stable yeast transformants. Asterisk, BD:SELF indicates that the fragment fused to AD was also fused to BD and the domains were tested for self-interaction.
Continued
153 Figure A.1 Continued
154
Figure A.2 Expression of the N-terminal coiled-coil fragment of NUA in the yeast strain PJ69-4A A) A graphical representation indicating the N-terminal fragment (NUA-B) used in the yeast two hybrid library screen. In the depiction of the full-length protein, coiled-coil domains are indicated by black bars. NLS, nuclear localization signal. B) Immunoblot showing the expression of the bait fusion protein BD:NUA-B (black arrow) detected with the anti-NUA antibody.
155 Table A.1 Putative NUA interacting partners In-frame prey Predicted Name Locus cDNA Localization LIGHT HARVESTING COMPLEX B SUBUNIT 6 (LHCB6) AT1G15820 Yes Chloroplast BZIP TRANSCRIPTION FACTOR FAMILY PROTEIN AT4G02640 Yes Nucleus/Cytoplasm TRYPTOPHAN SYNTHETASE BETA SUBUNIT AT5G54810 Yes Chloroplast p35 AT1G05860 Yes Chloroplast PHOSPHOGLYCERATE/BISPHOSPHOGLYCERATE MUTASE AT3G50520 Yes Unknown FAMILY PROTEIN
156
156 Table A.2 List of Primers
Name Sequence Source
F1 CACCATGCCCTTGTTTATGCCTGA This study (Xu et al., 2007b)
F2 (1255) CACCATGGTTACGATACTACTGAAGGAA This study (Xu et al., 2007b)
F3 (2251) GAGTTCTCACAGCTAATCATTGA This study (Xu et al., 2007b)
F3-1 (3100) GTGTCAGAACTTGAAAACGACTGTA This study (Xu et al., 2007b)
F4 (3751) CACCATGTCGCAAAGTGCATTGAAGAT This study (Xu et al., 2007b)
F4-1 (3703) CACCGCTGAAACAGAGATCTCACTAATGAGACAGGAGAAACT This study (Xu et al., 2007b)
F5 (4871) CACCACCAAGCCGCTGCTT This study (Xu et al., 2007b)
F6 (5631) AACCATTCCTACCGAAGAAGAGTCT This study (Xu et al., 2007b)
157 R1 (1599) TCATCCACATCGAAGTTGGACGT This study (Xu et al., 2007b)
R2 (3798) TCAAGTAAGTGAACCCCGGGCA This study (Xu et al., 2007b)
R3 (4993) GAATGCCAGAGGAAGGTTCA This study (Xu et al., 2007b)
R4 (6336) TCATGGTGGGCTCGGGGA This study (Xu et al., 2007b)
Continued
157 Table A.2 Continued
R4-1 TCATGGTGGGCTCGGGGATTGTCCACGT This study (Xu et al., 2007b)
R5 (6333) TGGTGGGCTCGGGGATTGT This study (Xu et al., 2007b)
F1_PGBT9_F GAATTCCCGGGGATCATGCCCTTGTTTATGCCTGA This study
R2_PGBT9_R CGGAATTAGCTTGGCTCAAGTAAGTGAACCCCGGGCA This study
158
158
A.4 SEQUENCES OF THE PREY cDNA
Sequences of the prey cDNA from the cloning site up to the stop codon are given below.
LIGHT HARVESTING COMPLEX B SUBUNIT 6 (LHCB6, AT1G15820)
CGAGGCCACGAAGGCCCAACGCCATGGTCGAAGACCGCCGAGAATTTCGCGAACT
ATACCGGCGATCAGGGATACCCCGGTGGGAGATTCTTCGATCCGTTGGGTCTCGC
CGGGAAAAACCGCGACGGTGTTTATGAGCCGGACTTTGAGAAGCTGGAGAGGCTG
AAATTGGCAGAGATTAAGCACTCGAGGCTCGCAATGGTTGCCATGTTGATCTTTTAC
TTTGAGGCCGGGCAGGGGAAAACGCCTCTCGGTGCTCTTGGTTTGTGA (270bp)
BZIP TRANSCRIPTION FACTOR FAMILY PROTEIN (AT4G02640)
CGAGGCCACGAAGGCCTAAAAGGTGAGCATTCATCACTTCTTAAACAACTGAGCAA
CATGAATCACAAGTATGACGAGGCTGCTGTTGGCAATAGAATACTAAAGGCTGACA
TTGAGACATTAAGAGCTAAGGTGAAAATGGCGGAAGAAACCGTGAAGAGAGTAACA
GGAATGAATCCGATGCTTCTCGGAAGATCAAGTGGACATAACAACAACAACAGAAT
GCCAATAACTGGTAACAACAGGATGGATTCTTCTAGCATTATTCCAGCTTATCAACC
ACACTCAAACTTAAACCATATGTCAAACCAAAACATCGGGATCCCAACCATTCTACC
TCCAAGACTCGGAAACAATTTCGCTGCTCCTCCATCCCAAACCAGCTCTCCCTTGC
AGAGAATTAGAAATGGGCAAAATCACCATGTTACTCCAAGCGCCAACCCGTATGGC
TGGAATACCGAACCTCAGAACGATTCAGCATGGCCGAAAAAATGCGTGGACTGA
(504 bp)
159
TRYPTOPHAN SYNTHETASE BETA SUBUNIT (AT5G54810)
CGAGGCCACGAAGGCCCTTCCTCTTCTTCCCAATTGACCCATTTGAAATCACCCTT
CAAAGCTGTCAAATATACGCCTCTGCCATCGTCTCGCTCCAAGTCATCATCCTTCTC
CGTCTCCTGCACCATCGCCAAGGACCCGCCTGTTCTCATGGCCGCCGGATCTGAC
CCGGCCCTGTGGCAACGACCCGATTCGTTCGGTCGGTTTGGGAAGTTTGGTGGGA
AGTATGTACCTGAAACCCTTATGCACGCTCTATCTGAGCTTGAATCCGCTTTCTATG
CTCTTGCCACCGACGATGATTTCCAGAGAGAGTTGGCTGGAATCTTGAAGGACTAT
GTGGGTAGAGAAAGTCCTCTGTATTTTGCAGAGAGGCTTACGGAGCATTACAGGCG
CGAGAATGGCGAAGGGCCTCTTATATACTTGAAGAGAGAAGACTTGAATCACACAG
GAGCTCACAAGATTAACAACGCTGTGGCTCAGGCTCTTCTTGCTAAGCGGTTGGGG
GGCCTTCGTGGCCTCGAGAGATCTATGAATTTGCCTTCTTTTATGTAACTATACTCC
TCTAAGTTTCAATCTTGGCCTGA (584 bp)
p35 (AT1G05860)
CGAGGCCACGAAGGCCCCAATCACCTCACTCGCCCGGAGCTTCTCCGACGCAGAT
CGCACAACCTGAAGCAGCTCTCTAGATGCTACAGAGACCATTACTGGGCTCTAATG
GAGGATCTCAAGGCACAACATAGATATTATAGCTGGAACTATGGTGTTAGTCCTTTC
AAAGATGAGAATTATCACCAAAACAAGAGACGTAAGGTTGAAGGACAAACTGGGGA
TGAAATTGAAGGTAGCGGAGACAATGATAATAACAACAACGATGGCGTTAAGGCTG
GTAATTGTGTTGCTTGTGGTAGTGGATGCAAATCTAAGGCCATGGCACTCACCAATT
ACTGTCAGCTTCATATCCTCATGGATAAAAAGCAGAAGCTTTATACGTCTTGTACTT
ACGTCAATAAAAGAGCTCAGTCGAAAGCAATAACTTGTCCAAAACCAACTCTTGCAT
CGACTGTTCCTGCCCTCTGTAATGTGCACTTTCAGAAAGCCCAAAAGGATGTTGCT
CGAGCTTTGAAGGATGCTGGTCATAATGTTTCTTCAGCAAGCAGGCCTCCCCCGAA
160
ACTCCACGGGCCACGAAGGCCGGCCTTCGTGGCCTCGAGAGATCTATGA (612 bp)
PHOSPHOGLYCERATE/BISPHOSPHOGLYCERATE MUTASE FAMILY PROTEIN
(AT3G50520)
CGAGGCCACGAAGGCCATTCTGAAGATGTTGATTATGCTGAGATTGTTGTTGTTCG
TCATGGTGAAACATCTTGGAATGCCGAGAGAAAAATCCAGGGTCATTTGGATGTTG
AGTTAAATGATGCAGGAAGACAACAAGCACAAAGAGTTGCAGAGCGGTTATCGAAG
GAGCAGAAGATATCTCATGTATACTCTTCTGACTTGAAGAGAGCCTTTGAGACTGCT
CAGATCATTGCTGCTAAATGCGGCAAGCTTGAGGTGCTTACCGATCGTGATTTGCG
GGAAAGACATTTAGGAGATATGCAAGGGCTTGTGTATCAAGAAGCTTCGAAAATTC
GTCCGGAAGCTTACAAGGCTTTTTCATCTAACCGCACAGACGTTGATATTCCAGGT
GGAGGAGAAAGTCTTGATAAACTTTACGATAGATGTACAACTGCATTACAGAGAATC
GGCGACAAACATAAAGGTGAAAGGCCTTCGTGGCCTCGAGAGATCTATGAATCGTA
G (507 bp)
161
BIBLIOGRAPHY
Abell, B., and Mullen, R. (2011). Tail-anchored membrane proteins: exploring the complex diversity of tail-anchored-protein targeting in plant cells. Plant Cell Reports 30, 137-151.
Afzal, A.J., da Cunha, L., and Mackey, D. (2011). Separable Fragments and Membrane Tethering of Arabidopsis RIN4 Regulate Its Suppression of PAMP-Triggered Immunity. The Plant Cell Online.
Agusti, J., Merelo, P., Cercos, M., Tadeo, F., and Talon, M. (2009). Comparative transcriptional survey between laser-microdissected cells from laminar abscission zone and petiolar cortical tissue during ethylene-promoted abscission in citrus leaves. BMC Plant Biology 9, 127.
An, Y., McDowell, J.M., Huang, S., McKinney, E.C., Chambliss, S., and Meagher, R.B. (1996). Strong, constitutive expression of the Arabidopsis ACT2/ACT8 actin subclass in vegetative tissues. The Plant Journal 10, 107-121.
Andreasson, E., and Ellis, B. (2010). Convergence and specificity in the Arabidopsis MAPK nexus. Trends in Plant Science 15, 106-113.
Andrei, L. (1996). Coiled coils: new structures and new functions. Trends in Biochemical Sciences 21, 375-382.
Asai, S., Ohta, K., and Yoshioka, H. (2008). MAPK Signaling Regulates Nitric Oxide and NADPH Oxidase-Dependent Oxidative Bursts in Nicotiana benthamiana. The Plant Cell Online 20, 1390-1406.
Asai, T., Tena, G., Plotnikova, J., Willmann, M.R., Chiu, W., Gomez-Gomez, L., Boller, T., Ausubel, F.M., and Sheen, J. (2002). MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 415, 977-983.
Auerbach, D., Thaminy, S., Hottiger, M.O., and Stagljar, I. (2002). The post-genomic era of interactive proteomics: Facts and perspectives. PROTEOMICS 2, 611-623. 162
Ausubel, F.M. (2005). Are innate immune signaling pathways in plants and animals conserved? Nat Immunol 6, 973-979.
Bäkel, C., Dass, S., Wilsch-Bräuninger, M., and Roth, S. (2006). Drosophila Cornichon acts as cargo receptor for ER export of the TGFalpha-like growth factor Gurken. Development 133, 459-470.
Beitz, E. (2000). TeXshade: shading and labeling of multiple sequence alignments using LaTeX2e. Bioinformatics 16, 135-139.
Belkhadir, Y., and Chory, J. (2006). Brassinosteroid Signaling: A Paradigm for Steroid Hormone Signaling from the Cell Surface. Science 314, 1410-1411.
Berg, M., Rogers, R., Muralla, R., and Meinke, D. (2005). Requirement of aminoacyl- tRNA synthetases for gametogenesis and embryo development in Arabidopsis. The Plant Journal 44, 866-878.
Bhat, R.A., Miklis, M., Schmelzer, E., Schulze-Lefert, P., and Panstruga, R. (2005). Recruitment and interaction dynamics of plant penetration resistance components in a plasma membrane microdomain. Proceedings of the National Academy of Sciences of the United States of America 102, 3135-3140.
Blatch, G.L., and Lässle, M. (1999). The tetratricopeptide repeat: a structural motif mediating protein-protein interactions. BioEssays 21, 932-939.
Block, A., and Alfano, J.R. (2011). Plant targets for Pseudomonas syringae type III effectors: virulence targets or guarded decoys? Current Opinion in Microbiology 14, 39- 46.
Boller, T., and Felix, G. (2009). A Renaissance of Elicitors: Perception of Microbe- Associated Molecular Patterns and Danger Signals by Pattern-Recognition Receptors. Annual Review of Plant Biology 60, 379-406.
Borgese, N., Colombo, S., and Pedrazzini, E. (2003). The tale of tail-anchored proteins. The Journal of Cell Biology 161, 1013-1019.
163
Boudsocq, M., Willmann, M.R., McCormack, M., Lee, H., Shan, L., He, P., Bush, J., Cheng, S., and Sheen, J. (2010). Differential innate immune signalling via Ca2+ sensor protein kinases. Nature 464, 418-422.
Boutrot, F., Segonzac, C., Chang, K.N., Qiao, H., Ecker, J.R., Zipfel, C., and Rathjen, J.P. (2010). Direct transcriptional control of the Arabidopsis immune receptor FLS2 by the ethylene-dependent transcription factors EIN3 and EIL1. Proceedings of the National Academy of Sciences 107, 14502-14507.
Brader, G., Tas, É., and Palva, E.T. (2001). Jasmonate-Dependent Induction of Indole Glucosinolates in Arabidopsis by Culture Filtrates of the Nonspecific PathogenErwinia carotovora. Plant Physiology 126, 849-860.
Bradley, D.J., Kjellbom, P., and Lamb, C.J. (1992). Elicitor- and wound-induced oxidative cross-linking of a proline-rich plant cell wall protein: A novel, rapid defense response. Cell 70, 21-30.
Brandao, M., Dantas, L., and Silva-Filho, M. (2009). AtPIN: Arabidopsis thaliana Protein Interaction Network. BMC Bioinformatics 10, 454.
Bruce, Y. (2002). Coiled-coils: stability, specificity, and drug delivery potential. Advanced Drug Delivery Reviews 54, 1113-1129.
Bruckner, A., Polge, C., Lentze, N., Auerbach, D., and Schlattner, U. (2009). Yeast Two- Hybrid, a Powerful Tool for Systems Biology. International Journal of Molecular Sciences 10, 2763-2788.
Brutus, A., Sicilia, F., Macone, A., Cervone, F., and De Lorenzo, G. (2010). A domain swap approach reveals a role of the plant wall-associated kinase 1 (WAK1) as a receptor of oligogalacturonides. Proceedings of the National Academy of Sciences 107, 9452-9457.
Burkhard, P., Stetefeld, J., and Strelkov, S.V. (2001). Coiled coils: a highly versatile protein folding motif. Trends in Cell Biology 11, 82-88.
164
Candela, H., Martínez-Laborda, A., and Luis Micol, J. (1999). Venation Pattern Formation inArabidopsis thalianaVegetative Leaves. Developmental Biology 205, 205- 216.
Cao, H., Bowling, S.A., Gordon, A.S., and Dong, X. (1994). Characterization of an Arabidopsis Mutant That Is Nonresponsive to Inducers of Systemic Acquired Resistance. The Plant Cell Online 6, 1583-1592.
Chen, D.-C., Yang, B.-C., and Kuo, T.-T. (1992). One-step transformation of yeast in stationary phase. Current Genetics 21, 83-84.
Chen, F., Gao, M.-J., Miao, Y.-S., Yuan, Y.-X., Wang, M.-Y., Li, Q., Mao, B.-Z., Jiang, L.- W., and He, Z.-H. (2010). Plasma Membrane Localization and Potential Endocytosis of Constitutively Expressed XA21 Proteins in Transgenic Rice. Molecular Plant 3, 917-926.
Chen, Z., Zheng, Z., Huang, J., Lai, Z., and Fan, B. (2009). Biosynthesis of salicylic acid in plants. Plant Signaling & Behavior 4, 493-496.
Chinchilla, D., Zipfel, C., Robatzek, S., Kemmerling, B., Nurnberger, T., Jones, J.D.G., Felix, G., and Boller, T. (2007). A flagellin-induced complex of the receptor FLS2 and BAK1 initiates plant defence. Nature 448, 497-500.
Clay, N.K., Adio, A.M., Denoux, C., Jander, G., and Ausubel, F.M. (2009). Glucosinolate Metabolites Required for an Arabidopsis Innate Immune Response. Science 323, 95- 101.
Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified method forAgrobacterium- mediated transformation ofArabidopsis thaliana. The Plant Journal 16, 735-743.
Collier, S.M., and Moffett, P. (2009). NB-LRRs work a "bait and switch" on pathogens. Trends in Plant Science 14, 521-529.
Collins, N.C., Thordal-Christensen, H., Lipka, V., Bau, S., Kombrink, E., Qiu, J.-L., Huckelhoven, R., Stein, M., Freialdenhoven, A., Somerville, S.C., et al. (2003). SNARE- protein-mediated disease resistance at the plant cell wall. Nature 425, 973-977.
165
Collmer, A., Badel, J.L., Charkowski, A.O., Deng, W.-L., Fouts, D.E., Ramos, A.R., Rehm, A.H., Anderson, D.M., Schneewind, O., van Dijk, K., et al. (2000). Pseudomonas syringae Hrp type III secretion system and effector proteins. Proceedings of the National Academy of Sciences 97, 8770-8777.
Collmer, A., Schneider, D.J., and Lindeberg, M. (2009). Lifestyles of the Effector Rich: Genome-Enabled Characterization of Bacterial Plant Pathogens. Plant Physiology 150, 1623-1630.
Crick, F.H.C. (1953). The packing of α-helices: simple coiled-coils. Acta Crystallographica 6, 689-697.
CristinaRodriguez, M., Petersen, M., and Mundy, J. (2010). Mitogen-Activated Protein Kinase Signaling in Plants. Annual Review of Plant Biology 61, 621-649.
D'Andrea, L.D., and Regan, L. (2003). TPR proteins: the versatile helix. Trends in Biochemical Sciences 28, 655-662.
Danna, C.H., Millet, Y.A., Koller, T., Han, S.-W., Bent, A.F., Ronald, P.C., and Ausubel, F.M. (2011). The Arabidopsis flagellin receptor FLS2 mediates the perception of Xanthomonas Ax21 secreted peptides. Proceedings of the National Academy of Sciences 108, 9286-9291.
De Torres Zabala, M., Bennett, M.H., Truman, W.H., and Grant, M.R. (2009). Antagonism between salicylic and abscisic acid reflects early host–pathogen conflict and moulds plant defence responses. The Plant Journal 59, 375-386.
De Torres-Zabala, M., Truman, W., Bennett, M.H., Lafforgue, G., Mansfield, J.W., Rodriguez Egea, P., Bogre, L., and Grant, M. (2007). Pseudomonas syringae pv. tomato hijacks the Arabidopsis abscisic acid signalling pathway to cause disease. EMBO J 26, 1434-1443.
Dechat, T., Adam, S.A., Taimen, P., Shimi, T., and Goldman, R.D. (2010). Nuclear Lamins. Cold Spring Harbor Perspectives in Biology 2.
166
Delaney, T.P., Friedrich, L., and Ryals, J.A. (1995). Arabidopsis signal transduction mutant defective in chemically and biologically induced disease resistance. Proceedings of the National Academy of Sciences 92, 6602-6606.
Denoux, C., Galletti, R., Mammarella, N., Gopalan, S., Werck, D., De Lorenzo, G., Ferrari, S., Ausubel, F.M., and Dewdney, J. (2008). Activation of Defense Response Pathways by OGs and Flg22 Elicitors in Arabidopsis Seedlings. Molecular Plant 1, 423- 445.
Dereeper, A., Guignon, V., Blanc, G., Audic, S., Buffet, S., Chevenet, F., Dufayard, J.-F., Guindon, S., Lefort, V., Lescot, M., et al. (2008). Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Research 36, W465-W469.
Diao, A., Frost, L., Morohashi, Y., and Lowe, M. (2008). Coordination of Golgin Tethering and SNARE Assembly. Journal of Biological Chemistry 283, 6957-6967.
Diévart, A., and Clark, S.E. (2004). LRR-containing receptors regulating plant development and defense. Development 131, 251-261.
Ding, S.-W., and Voinnet, O. (2007). Antiviral Immunity Directed by Small RNAs. Cell 130, 413-426.
Droillard, M.-J., Boudsocq, M., Barbier-Brygoo, H.l.n., and Laurière, C. (2004). Involvement of MPK4 in osmotic stress response pathways in cell suspensions and plantlets of Arabidopsis thaliana: activation by hypoosmolarity and negative role in hyperosmolarity tolerance. FEBS Letters 574, 42-48.
Durrant, W.E., and Dong, X. (2004). SYSTEMIC ACQUIRED RESISTANCE. Annual Review of Phytopathology 42, 185-209.
Edgar, R.C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32, 1792-1797.
Fan, J., Hill, L., Crooks, C., Doerner, P., and Lamb, C. (2009). Abscisic Acid Has a Key Role in Modulating Diverse Plant-Pathogen Interactions. Plant Physiology 150, 1750- 1761. 167
Felix, G., Duran, J.D., Volko, S., and Boller, T. (1999). Plants have a sensitive perception system for the most conserved domain of bacterial flagellin. The Plant Journal 18, 265-276.
Ferrari, S., Galletti, R., Denoux, C., De Lorenzo, G., Ausubel, F.M., and Dewdney, J. (2007). Resistance to Botrytis cinerea Induced in Arabidopsis by Elicitors Is Independent of Salicylic Acid, Ethylene, or Jasmonate Signaling But Requires PHYTOALEXIN DEFICIENT3. Plant Physiology 144, 367-379.
Fields, S., and Song, O.-k. (1989). A novel genetic system to detect protein–protein interactions. Nature 340, 245-246.
Fiil, B.K., Petersen, K., Petersen, M., and Mundy, J. (2009). Gene regulation by MAP kinase cascades. Current Opinion in Plant Biology 12, 615-621.
Formstecher, E., Aresta, S., Collura, V., Hamburger, A., Meil, A., Trehin, A., Reverdy, C., Betin, V., Maire, S., Brun, C., et al. (2005). Protein interaction mapping: A Drosophila case study. Genome Research 15, 376-384.
Freytag, S., Arabatzis, N., Hahlbrock, K., and Schmelzer, E. (1994). Reversible cytoplasmic rearrangements precede wall apposition, hypersensitive cell death and defense-related gene activation in potato/ Phytophthora infestans interactions. Planta 194, 123-135.
Gaffney, T., Friedrich, L., Vernooij, B., Negrotto, D., Nye, G., Uknes, S., Ward, E., Kessmann, H., and Ryals, J. (1993). Requirement of Salicylic Acid for the Induction of Systemic Acquired Resistance. Science 261, 754-756.
Galili, G., Sengupta-Gopalan, C., and Ceriotti, A. (1998). The endoplasmic reticulum of plant cells and its role in protein maturation and biogenesis of oil bodies. Plant Molecular Biology 38, 1-29.
Gao, M., Liu, J., Bi, D., Zhang, Z., Cheng, F., Chen, S., and Zhang, Y. (2008). MEKK1, MKK1/MKK2 and MPK4 function together in a mitogen-activated protein kinase cascade to regulate innate immunity in plants. Cell Res 18, 1190-1198.
168
Gay, P.A., and Tuzun, S. (2000). Involvement of a novel peroxidase isozyme and lignification in hydathodes in resistance to black rot disease in cabbage. Canadian Journal of Botany 78, 1144-1149.
Gietz, D. (2006). Yeast Two-Hybrid System Screening, Second edn (Totowa, New Jersey, Humana Press).
Gietz, R.D., and Schiestl, R.H. (2007). Large-scale high-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat Protocols 2, 38-41.
Gillingham, A.K., and Munro, S. (2003). Long coiled-coil proteins and membrane traffic. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1641, 71-85.
Gimenez-Ibanez, S., Hann, D.R., Ntoukakis, V., Petutschnig, E., Lipka, V., and Rathjen, J.P. (2009). AvrPtoB Targets the LysM Receptor Kinase CERK1 to Promote Bacterial Virulence on Plants. Current Biology 19, 423-429.
Glazebrook, J. (2005a). Contrasting Mechanisms of Defense Against Biotrophic and Necrotrophic Pathogens. Annual Review of Phytopathology 43, 205-227.
Glazebrook, J. (2005b). Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. In Annual Review of Phytopathology (Palo Alto, Annual Reviews), pp. 205-227.
Glazebrook, J., Rogers, E.E., and Ausubel, F.M. (1996). Isolation of Arabidopsis Mutants With Enhanced Disease Susceptibility by Direct Screening. Genetics 143, 973-982.
Göhre, V., Spallek, T., Häweker, H., Mersmann, S., Mentzel, T., Boller, T., de Torres, M., Mansfield, J.W., and Robatzek, S. (2008). Plant Pattern-Recognition Receptor FLS2 Is Directed for Degradation by the Bacterial Ubiquitin Ligase AvrPtoB. Current Biology 18, 1824-1832.
Goldman, R.D., Gruenbaum, Y., Moir, R.D., Shumaker, D.K., and Spann, T.P. (2002). Nuclear lamins: building blocks of nuclear architecture. Genes & Development 16, 533- 547.
169
Gomez-Gomez, L., and Boller, T. (2000). FLS2: An LRR Receptor-like Kinase Involved in the Perception of the Bacterial Elicitor Flagellin in Arabidopsis. Molecular Cell 5, 1003- 1011.
Gómez-Gómez, L., Felix, G., and Boller, T. (1999). A single locus determines sensitivity to bacterial flagellin in Arabidopsis thaliana. The Plant Journal 18, 277-284.
Goud, B., and Gleeson, P.A. (2010). TGN golgins, Rabs and cytoskeleton: regulating the Golgi trafficking highways. Trends in Cell Biology 20, 329-336.
Green, D.M., Johnson, C.P., Hagan, H., and Corbett, A.H. (2003). The C-terminal domain of myosin-like protein 1 (Mlp1p) is a docking site for heterogeneous nuclear ribonucleoproteins that are required for mRNA export. Proceedings of the National Academy of Sciences 100, 1010-1015.
Gross, A., Kapp, D., Nielsen, T., and Niehaus, K. (2005). Endocytosis of Xanthomonas campestris pathovar campestris lipopolysaccharides in non-host plant cells of Nicotiana tabacum. New Phytologist 165, 215-226.
Grunwald, I., Rupprecht, I., Schuster, G., and Kloppstech, K. (2003). Identification of guttation fluid proteins: the presence of pathogenesis-related proteins in non-infected barley plants. Physiologia Plantarum 119, 192-202.
Gupta, D., and Tuteja, N. (2011). Chaperones and foldases in endoplasmic reticulum stress signaling in plants. Plant Signal Behav 6, 232-236.
Gust, A.A., Biswas, R., Lenz, H.D., Rauhut, T., Ranf, S., Kemmerling, B., Götz, F., Glawischnig, E., Lee, J., Felix, G., et al. (2007). Bacteria-derived Peptidoglycans Constitute Pathogen-associated Molecular Patterns Triggering Innate Immunity in Arabidopsis. Journal of Biological Chemistry 282, 32338-32348.
Hamel, L., and Beaudoin, N. (2010). Chitooligosaccharide sensing and downstream signaling: contrasted outcomes in pathogenic and beneficial plant-microbe interactions. Planta 232, 787-806.
170
Han, L., Li, G., Yang, K., Mao, G., Wang, R., Liu, Y., and Zhang, S. (2010). Mitogen- activated protein kinase 3 and 6 regulate Botrytis cinerea-induced ethylene production in Arabidopsis. The Plant Journal 64, 114-127.
Hase, M.E., and Cordes, V.C. (2003). Direct Interaction with Nup153 Mediates Binding of Tpr to the Periphery of the Nuclear Pore Complex. Molecular Biology of the Cell 14, 1923-1940.
Hase, M.E., Kuznetsov, N.V., and Cordes, V.C. (2001). Amino Acid Substitutions of Coiled-Coil Protein Tpr Abrogate Anchorage to the Nuclear Pore Complex but Not Parallel, In-Register Homodimerization. Molecular Biology of the Cell 12, 2433-2452.
Häweker, H., Rips, S., Koiwa, H., Salomon, S., Saijo, Y., Chinchilla, D., Robatzek, S., and von Schaewen, A. (2010). Pattern Recognition Receptors Require N-Glycosylation to Mediate Plant Immunity. Journal of Biological Chemistry 285, 4629-4636.
Heese, A., Hann, D.R., Gimenez-Ibanez, S., Jones, A.M.E., He, K., Li, J., Schroeder, J.I., Peck, S.C., and Rathjen, J.P. (2007). The receptor-like kinase SERK3/BAK1 is a central regulator of innate immunity in plants. Proceedings of the National Academy of Sciences 104, 12217-12222.
Hershko, A., and Ciechanover, A. (1992). The Ubiquitin System for Protein Degradation. Annual Review of Biochemistry 61, 761-807.
Hiruma, K., Onozawa-Komori, M., Takahashi, F., Asakura, M., Bednarek, P., Okuno, T., Schulze-Lefert, P., and Takano, Y. (2010). Entry Mode-Dependent Function of an Indole Glucosinolate Pathway in Arabidopsis for Nonhost Resistance against Anthracnose Pathogens. The Plant Cell Online 22, 2429-2443.
Hruz, T., Laule, O., Szabo, G., Wessendorp, F., Bleuler, S., Oertle, L., Widmayer, P., Gruissem, W., and Zimmermann, P. (2008). Genevestigator V3: A Reference Expression Database for the Meta-Analysis of Transcriptomes. Advances in Bioinformatics 2008.
171
Hubbard, K.E., Nishimura, N., Hitomi, K., Getzoff, E.D., and Schroeder, J.I. (2010). Early abscisic acid signal transduction mechanisms: newly discovered components and newly emerging questions. Genes & Development 24, 1695-1708.
Huffaker, A., Pearce, G., and Ryan, C.A. (2006). An endogenous peptide signal in Arabidopsis activates components of the innate immune response. Proceedings of the National Academy of Sciences 103, 10098-10103.
Hugouvieux, V., Barber, C.E., and Daniels, M.J. (1998). Entry of Xanthomonas campestris pv. campestris into Hydathodes of Arabidopsis thaliana Leaves: A System for Studying Early Infection Events in Bacterial Pathogenesis. Mol Plant-Microbe Interact 11, 537-543.
Ibba, M., and Söll, D. (2000). AMINOACYL-tRNA SYNTHESIS. Annual Review of Biochemistry 69, 617-650.
Iuchi, S., Kobayashi, M., Taji, T., Naramoto, M., Seki, M., Kato, T., Tabata, S., Kakubari, Y., Yamaguchi-Shinozaki, K., and Shinozaki, K. (2001). Regulation of drought tolerance by gene manipulation of 9-cis-epoxycarotenoid dioxygenase, a key enzyme in abscisic acid biosynthesis in Arabidopsis. The Plant Journal 27, 325-333.
Iyer, K., Burkle, L., Auerbach, D., Thaminy, S., Dinkel, M., Engels, K., and Stagljar, I. (2005). Utilizing the Split-Ubiquitin Membrane Yeast Two-Hybrid System to Identify Protein-Protein Interactions of Integral Membrane Proteins. Sci STKE 2005, pl3-.
Jahn, R., and Scheller, R.H. (2006). SNAREs - engines for membrane fusion. Nat Rev Mol Cell Biol 7, 631-643.
Jakoby, M., Weisshaar, B., Dröge-Laser, W., Vicente-Carbajosa, J., Tiedemann, J., Kroj, T., and Parcy, F. (2002). bZIP transcription factors in Arabidopsis. Trends in Plant Science 7, 106-111.
James, P., Halladay, J., and Craig, E.A. (1996). Genomic Libraries and a Host Strain Designed for Highly Efficient Two-Hybrid Selection in Yeast. Genetics 144, 1425-1436.
172
Jeong, S.Y., Rose, A., and Meier, I. (2003). MFP1 is a thylakoid-associated, nucleoid- binding protein with a coiled-coil structure. Nucleic Acids Research 31, 5175-5185.
Jessberger, R. (2002). The many functions of smc proteins in chromosome dynamics. Nature Reviews Molecular Cell Biology 3, 767-778.
Jeworutzki, E., Roelfsema, M.R.G., Anschütz, U., Krol, E., Elzenga, J.T.M., Felix, G., Boller, T., Hedrich, R., and Becker, D. (2010). Early signaling through the Arabidopsis pattern recognition receptors FLS2 and EFR involves Ca2+-associated opening of plasma membrane anion channels. The Plant Journal 62, 367-378.
Johnsson, N., and Varshavsky, A. (1994). Split ubiquitin as a sensor of protein interactions in vivo. Proceedings of the National Academy of Sciences 91, 10340-10344.
Jun, J., Fiume, E., and Fletcher, J. (2008). The CLE family of plant polypeptide signaling molecules. Cellular and Molecular Life Sciences 65, 743-755.
Kaku, H., Nishizawa, Y., Ishii-Minami, N., Akimoto-Tomiyama, C., Dohmae, N., Takio, K., Minami, E., and Shibuya, N. (2006). Plant cells recognize chitin fragments for defense signaling through a plasma membrane receptor. Proceedings of the National Academy of Sciences 103, 11086-11091.
Kalde, M., Nühse, T.S., Findlay, K., and Peck, S.C. (2007). The syntaxin SYP132 contributes to plant resistance against bacteria and secretion of pathogenesis-related protein 1. Proceedings of the National Academy of Sciences 104, 11850-11855.
Kato, A.S., Gill, M.B., Ho, M.T., Yu, H., Tu, Y., Siuda, E.R., Wang, H., Qian, Y., Nisenbaum, E.S., Tomita, S., et al. (2010). Hippocampal AMPA Receptor Gating Controlled by Both TARP and Cornichon Proteins. Neuron 68, 1082-1096.
Kee, H.J., Kim, J., Nam, K., Park, H.Y., Shin, S., Kim, J.C., Shimono, Y., Takahashi, M., Jeong, M.H., Kim, N., et al. (2007). Enhancer of Polycomb1, a Novel Homeodomain Only Protein-binding Partner, Induces Skeletal Muscle Differentiation. Journal of Biological Chemistry 282, 7700-7709.
173
Kim, M.G., and Mackey, D. (2008). Measuring Cell-Wall-Based Defenses and Their Effect on Bacterial Growth in Arabidopsis Innate Immunity. In, J. Ewbank, and E. Vivier, eds. (Humana Press), pp. 443-452.
Kim, P.S., Berger, B., and Wolf, E. (1997). MultiCoil: A program for predicting two-and three-stranded coiled coils. Protein Science 6, 1179-1189.
Kim, T., Hauser, F., Ha, T., Xue, S., Böhmer, M., Nishimura, N., Munemasa, S., Hubbard, K., Peine, N., Lee, B., et al. (2011). Chemical Genetics Reveals Negative Regulation of Abscisic Acid Signaling by a Plant Immune Response Pathway. Current Biology 21, 990-997.
Kim, Y.-K., Lee, J.-Y., Cho, H.S., Lee, S.S., Ha, H.J., Kim, S., Choi, D., and Pai, H.-S. (2005). Inactivation of Organellar Glutamyl- and Seryl-tRNA Synthetases Leads to Developmental Arrest of Chloroplasts and Mitochondria in Higher Plants. Journal of Biological Chemistry 280, 37098-37106.
Kinkema, M., Fan, W., and Dong, X. (2000). Nuclear Localization of NPR1 Is Required for Activation of PR Gene Expression. The Plant Cell Online 12, 2339-2350.
Kline, K.G., Barrett-Wilt, G.A., and Sussman, M.R. (2010). In planta changes in protein phosphorylation induced by the plant hormone abscisic acid. Proceedings of the National Academy of Sciences 107, 15986-15991.
Kobae, Y., Sekino, T., Yoshioka, H., Nakagawa, T., Martinoia, E., and Maeshima, M. (2006). Loss of AtPDR8, a Plasma Membrane ABC Transporter of Arabidopsis thaliana, Causes Hypersensitive Cell Death Upon Pathogen Infection. Plant and Cell Physiology 47, 309-318.
Kodama, Y., Suetsugu, N., Kong, S.-G., and Wada, M. (2010). Two interacting coiled- coil proteins, WEB1 and PMI2, maintain the chloroplast photorelocation movement velocity in Arabidopsis. Proceedings of the National Academy of Sciences 107, 19591- 19596.
174
Kovtun, Y., Chiu, W., Tena, G., and Sheen, J. (2000). Functional analysis of oxidative stress-activated mitogen-activated protein kinase cascade in plants. Proceedings of the National Academy of Sciences 97, 2940-2945.
Kriechbaumer, V., Shaw, R., Mukherjee, J., Bowsher, C.G., Harrison, A., and Abell, B.M. (2009). Subcellular Distribution of Tail-Anchored Proteins in Arabidopsis. Traffic 10, 1753-1764.
Krogh, A., Larsson, B., von Heijne, G., and Sonnhammer, E.L.L. (2001). Predicting transmembrane protein topology with a hidden markov model: application to complete genomes. Journal of Molecular Biology 305, 567-580.
Kunze, G., Zipfel, C., Robatzek, S., Niehaus, K., Boller, T., and Felix, G. (2004). The N Terminus of Bacterial Elongation Factor Tu Elicits Innate Immunity in Arabidopsis Plants. The Plant Cell Online 16, 3496-3507.
Kuroda, K., Kato, M., Mima, J., and Ueda, M. (2006). Systems for the detection and analysis of protein–protein interactions. Applied Microbiology and Biotechnology 71, 127-136.
Kwon, C., Neu, C., Pajonk, S., Yun, H.S., Lipka, U., Humphry, M., Bau, S., Straus, M., Kwaaitaal, M., Rampelt, H., et al. (2008). Co-option of a default secretory pathway for plant immune responses. Nature 451, 835-840.
Lalonde, S., Ehrhardt, D.W., Loqué, D., Chen, J., Rhee, S.Y., and Frommer, W.B. (2008). Molecular and cellular approaches for the detection of protein–protein interactions: latest techniques and current limitations. The Plant Journal 53, 610-635.
Lalonde, S., Sero, A., Pratelli, R., Pilot, G., Chen, J., Sardi, M.I., Parsa, S.A., Kim, D.-Y., Acharya, B.R., Stein, E.V., et al. (2010). A membrane protein / signaling protein interaction network for Arabidopsis version AMPv2. Frontiers in Physiology 1.
Laluk, K., Luo, H., Chai, M., Dhawan, R., Lai, Z., and Mengiste, T. (2011). Biochemical and Genetic Requirements for Function of the Immune Response Regulator BOTRYTIS-
175
INDUCED KINASE1 in Plant Growth, Ethylene Signaling, and PAMP-Triggered Immunity in Arabidopsis. The Plant Cell Online.
Lamb, C., and Dixon, R.A. (1997). THE OXIDATIVE BURST IN PLANT DISEASE RESISTANCE. Annual Review of Plant Physiology and Plant Molecular Biology 48, 251- 275.
Leborgne-Castel, N., Lherminier, J., Der, C., Fromentin, J., Houot, V., and Simon-Plas, F. (2008). The Plant Defense Elicitor Cryptogein Stimulates Clathrin-Mediated Endocytosis Correlated with Reactive Oxygen Species Production in Bright Yellow-2 Tobacco Cells. Plant Physiology 146, 1255-1266.
Lee, H., Chah, O., and Sheen, J. (2011). Stem-cell-triggered immunity through CLV3p- FLS2 signalling. Nature 473, 376-379.
Lee, S.-W., Han, S.-W., Sririyanum, M., Park, C.-J., Seo, Y.-S., and Ronald, P.C. (2009). A Type I-Secreted, Sulfated Peptide Triggers XA21-Mediated Innate Immunity. Science 326, 850-853.
Lee, S.H., Sterling, H., Burlingame, A., and McCormick, F. (2008). Tpr directly binds to Mad1 and Mad2 and is important for the Mad1–Mad2-mediated mitotic spindle checkpoint. Genes & Development 22, 2926-2931.
Lee, Y.-R.J., and Liu, B. (2004). Cytoskeletal Motors in Arabidopsis. Sixty-One Kinesins and Seventeen Myosins. Plant Physiology 136, 3877-3883.
Lewis, J.D., Wu, R., Guttman, D.S., and Desveaux, D. (2010). Allele-Specific Virulence Attenuation of the Pseudomonas syringae HopZ1a Type III Effector via the Arabidopsis ZAR1 Resistance Protein. PLoS Genetics 6, e1000894.
Li, J., Wen, J., Lease, K.A., Doke, J.T., Tax, F.E., and Walker, J.C. (2002). BAK1, an Arabidopsis LRR Receptor-like Protein Kinase, Interacts with BRI1 and Modulates Brassinosteroid Signaling. Cell 110, 213-222.
Li, J., Zhao-Hui, C., Batoux, M., Nekrasov, V., Roux, M., Chinchilla, D., Zipfel, C., and Jones, J.D.G. (2009). Specific ER quality control components required for biogenesis of 176 the plant innate immune receptor EFR. Proceedings of the National Academy of Sciences 106, 15973-15978.
Lin, R.C., and Scheller, R.H. (2000). Mechanisms of synaptic vesicle exocytosis. Annual Review of Cell and Developmental Biology 16, 19-49.
Lipka, V., Dittgen, J., Bednarek, P., Bhat, R., Wiermer, M., Stein, M., Landtag, J., Brandt, W., Rosahl, S., Scheel, D., et al. (2005). Pre- and postinvasion defenses both contribute to nonhost resistance in Arabidopsis. Science 310, 1180 - 1183.
Lipka, V., Kwon, C., and Panstruga, R. (2007). SNARE-Ware: The role of SNARE- Domain proteins in plant biology. In Annual Review of Cell and Developmental Biology (Palo Alto, Annual Reviews), pp. 147-174.
Lipka, V., and Panstruga, R. (2005). Dynamic cellular responses in plant–microbe interactions. Current Opinion in Plant Biology 8, 625-631.
Lippok, B., Birkenbihl, R.P., Rivory, G., Brümmer, J., Schmelzer, E., Logemann, E., and Somssich, I.E. (2007). Expression of AtWRKY33 Encoding a Pathogen- or PAMP- Responsive WRKY Transcription Factor Is Regulated by a Composite DNA Motif Containing W Box Elements. Mol Plant-Microbe Interact 20, 420-429.
Liu, C., McElver, J., Tzafrir, I., Joosen, R., Wittich, P., Patton, D., Van Lammeren, A.A.M., and Meinke, D. (2002). Condensin and cohesin knockouts in Arabidopsis exhibit a titan seed phenotype. The Plant Journal 29, 405-415.
Liu, Y., and Zhang, S. (2004). Phosphorylation of 1-Aminocyclopropane-1-Carboxylic Acid Synthase by MPK6, a Stress-Responsive Mitogen-Activated Protein Kinase, Induces Ethylene Biosynthesis in Arabidopsis. The Plant Cell Online 16, 3386-3399.
Losada, A., and Hirano, T. (2005). Dynamic molecular linkers of the genome: the first decade of SMC proteins. Genes & Development 19, 1269-1287.
Lu, D., Wu, S., Gao, X., Zhang, Y., Shan, L., and He, P. (2010). A receptor-like cytoplasmic kinase, BIK1, associates with a flagellin receptor complex to initiate plant innate immunity. Proceedings of the National Academy of Sciences 107, 496-501. 177
Lu, X., Tintor, N., Mentzel, T., Kombrink, E., Boller, T., Robatzek, S., Schulze-Lefert, P., and Saijo, Y. (2009). Uncoupling of sustained MAMP receptor signaling from early outputs in an Arabidopsis endoplasmic reticulum glucosidase II allele. Proceedings of the National Academy of Sciences 106, 22522-22527.
Ma, W., and Berkowitz, G.A. (2007). The grateful dead: calcium and cell death in plant innate immunity. Cellular Microbiology 9, 2571-2585.
Ma, Y., Szostkiewicz, I., Korte, A., Moes, D., Yang, Y., Christmann, A., and Grill, E. (2009). Regulators of PP2C Phosphatase Activity Function as Abscisic Acid Sensors. Science 324, 1064-1068.
Malamy, J., Carr, J.P., Klessig, D.F., and Raskin, I. (1990). Salicylic Acid: A Likely Endogenous Signal in the Resistance Response of Tobacco to Viral Infection. Science 250, 1002-1004.
Mason, J.M., and Arndt, K.M. (2004). Coiled Coil Domains: Stability, Specificity, and Biological Implications. ChemBioChem 5, 170-176.
Matsui, M., Stoop, C.D., von Arnim, A.G., Wei, N., and Deng, X.W. (1995). Arabidopsis COP1 protein specifically interacts in vitro with a cytoskeleton-associated protein, CIP1. Proceedings of the National Academy of Sciences 92, 4239-4243.
Meier, I. (2005). Nucleocytoplasmic Trafficking in Plant Cells. In International Review of Cytology, W.J. Kwang, ed. (Academic Press), pp. 95-135.
Meir, S., Philosoph-Hadas, S., Sundaresan, S., Selvaraj, K.S.V., Burd, S., Ophir, R., Kochanek, B., Reid, M.S., Jiang, C.-Z., and Lers, A. (2010). Microarray Analysis of the Abscission-Related Transcriptome in the Tomato Flower Abscission Zone in Response to Auxin Depletion. Plant Physiology 154, 1929-1956.
Melotto, M., Underwood, W., Koczan, J., Nomura, K., and He, S.Y. (2006). Plant Stomata Function in Innate Immunity against Bacterial Invasion. Cell 126, 969-980.
178
Métraux, J.P., Signer, H., Ryals, J., Ward, E., Wyss-Benz, M., Gaudin, J., Raschdorf, K., Schmid, E., Blum, W., and Inverardi, B. (1990). Increase in Salicylic Acid at the Onset of Systemic Acquired Resistance in Cucumber. Science 250, 1004-1006.
Michael P, Y. (1991). Analysis of mitochondrial function and assembly. In Methods in Enzymology, G.R.F. Christine Guthrie, ed. (Academic Press), pp. 627-643.
Miya, A., Albert, P., Shinya, T., Desaki, Y., Ichimura, K., Shirasu, K., Narusaka, Y., Kawakami, N., Kaku, H., and Shibuya, N. (2007). CERK1, a LysM receptor kinase, is essential for chitin elicitor signaling in Arabidopsis. Proceedings of the National Academy of Sciences 104, 19613-19618.
Mou, Z., Fan, W., and Dong, X. (2003). Inducers of Plant Systemic Acquired Resistance Regulate NPR1 Function through Redox Changes. Cell 113, 935-944.
Mur, L.A.J., Kenton, P., Lloyd, A.J., Ougham, H., and Prats, E. (2008). The hypersensitive response; the centenary is upon us but how much do we know? Journal of Experimental Botany 59, 501-520.
Murphy, A.S., Bandyopadhyay, A., Holstein, S.E., and Peer, W.A. (2005). ENDOCYTOTIC CYCLING OF PM PROTEINS. Annual Review of Plant Biology 56, 221- 251.
Murtas, G., Reeves, P.H., Fu, Y.-F., Bancroft, I., Dean, C., and Coupland, G. (2003). A Nuclear Protease Required for Flowering-Time Regulation in Arabidopsis Reduces the Abundance of SMALL UBIQUITIN-RELATED MODIFIER Conjugates. The Plant Cell Online 15, 2308-2319.
Mustilli, A.-C., Merlot, S., Vavasseur, A., Fenzi, F., and Giraudat, J. (2002). Arabidopsis OST1 Protein Kinase Mediates the Regulation of Stomatal Aperture by Abscisic Acid and Acts Upstream of Reactive Oxygen Species Production. The Plant Cell Online 14, 3089-3099.
179
Navarro, L., Dunoyer, P., Jay, F., Arnold, B., Dharmasiri, N., Estelle, M., Voinnet, O., and Jones, J.D.G. (2006). A Plant miRNA Contributes to Antibacterial Resistance by Repressing Auxin Signaling. Science 312, 436-439.
Navarro, L., Zipfel, C., Rowland, O., Keller, I., Robatzek, S., Boller, T., and Jones, J.D.G. (2004). The Transcriptional Innate Immune Response to flg22. Interplay and Overlap with Avr Gene-Dependent Defense Responses and Bacterial Pathogenesis. Plant Physiology 135, 1113-1128.
Nekrasov, V., Li, J., Batoux, M., Roux, M., Chu, Z.-H., Lacombe, S., Rougon, A., Bittel, P., Kiss-Papp, M., Chinchilla, D., et al. (2009). Control of the pattern-recognition receptor EFR by an ER protein complex in plant immunity. EMBO J 28, 3428-3438.
Nishimura, N., Sarkeshik, A., Nito, K., Park, S.-Y., Wang, A., Carvalho, P.C., Lee, S., Caddell, D.F., Cutler, S.R., Chory, J., et al. (2010). PYR/PYL/RCAR family members are major in-vivo ABI1 protein phosphatase 2C-interacting proteins in Arabidopsis. The Plant Journal 61, 290-299.
Nomura, K., DebRoy, S., Lee, Y.H., Pumplin, N., Jones, J., and He, S.Y. (2006). A Bacterial Virulence Protein Suppresses Host Innate Immunity to Cause Plant Disease. Science 313, 220-223.
Nürnberger, T., Brunner, F., Kemmerling, B., and Piater, L. (2004). Innate immunity in plants and animals: striking similarities and obvious differences. Immunological Reviews 198, 249-266.
Obrdlik, P., El-Bakkoury, M., Hamacher, T., Cappellaro, C., Vilarino, C., Fleischer, C., Ellerbrok, H., Kamuzinzi, R., Ledent, V., Blaudez, D., et al. (2004). K+ channel interactions detected by a genetic system optimized for systematic studies of membrane protein interactions. Proceedings of the National Academy of Sciences of the United States of America 101, 12242-12247.
Oliver, R.P., and Ipcho, S.V.S. (2004). Arabidopsis pathology breathes new life into the necrotrophs-vs.-biotrophs classification of fungal pathogens. Molecular Plant Pathology 5, 347-352. 180
Osborne, M.A., Zenner, G., Lubinus, M., Zhang, X., Songyang, Z., Cantley, L.C., Majerus, P., Burn, P., and Kochan, J.P. (1996). The Inositol 5'-Phosphatase SHIP Binds to Immunoreceptor Signaling Motifs and Responds to High Affinity IgE Receptor Aggregation. Journal of Biological Chemistry 271, 29271-29278.
Pajonk, S., Kwon, C., Clemens, N., Panstruga, R., and Schulze-Lefert, P. (2008). Activity Determinants and Functional Specialization of Arabidopsis PEN1 Syntaxin in Innate Immunity. Journal of Biological Chemistry 283, 26974-26984.
Pandey, S., Nelson, D.C., and Assmann, S.M. (2009). Two Novel GPCR-Type G Proteins Are Abscisic Acid Receptors in Arabidopsis. Cell 136, 136-148.
Park, S., Fung, P., Nishimura, N., Jensen, D.R., Fujii, H., Zhao, Y., Lumba, S., Santiago, J., Rodrigues, A., Chow, T.-f.F., et al. (2009). Abscisic Acid Inhibits Type 2C Protein Phosphatases via the PYR/PYL Family of START Proteins. Science 324, 1068-1071.
Passarinho, P.A., Van Hengel, A.J., Fransz, P.F., and de Vries, S.C. (2001). Expression pattern of the Arabidopsis thaliana AtEP3/ AtchitIV endochitinase gene. Planta 212, 556- 567.
Pauling, L., and Corey, R.B. (1953). Compound Helical Configurations of Polypeptide Chains: Structure of Proteins of the [alpha]-Keratin Type. Nature 171, 59-61.
Pedrazzini, E. (2009). Tail-Anchored Proteins in Plants. Journal of Plant Biology 52, 88- 101.
Petutschnig, E.K., Jones, A.M.E., Serazetdinova, L., Lipka, U., and Lipka, V. (2010). The Lysin Motif Receptor-like Kinase (LysM-RLK) CERK1 Is a Major Chitin-binding Protein in Arabidopsis thaliana and Subject to Chitin-induced Phosphorylation. Journal of Biological Chemistry 285, 28902-28911.
Pfalz, M., Vogel, H., and Kroymann, J. (2009). The Gene Controlling the Indole Glucosinolate Modifier1 Quantitative Trait Locus Alters Indole Glucosinolate Structures and Aphid Resistance in Arabidopsis. The Plant Cell Online 21, 985-999.
181
Pilot, G., Stransky, H., Bushey, D.F., Pratelli, R., Ludewig, U., Wingate, V.P.M., and Frommer, W.B. (2004). Overexpression of GLUTAMINE DUMPER1 Leads to Hypersecretion of Glutamine from Hydathodes of Arabidopsis Leaves. The Plant Cell Online 16, 1827-1840.
Pitzschke, A., Schikora, A., and Hirt, H. (2009). MAPK cascade signalling networks in plant defence. Current Opinion in Plant Biology 12, 421-426.
Postel, S., and Kemmerling, B. (2009). Plant systems for recognition of pathogen- associated molecular patterns. Seminars in Cell and Developmental Biology 20, 1025- 1031.
Prasad, B.D., Goel, S., and Krishna, P. (2010). In Silico Identification of Carboxylate Clamp Type Tetratricopeptide Repeat Proteins in Arabidopsis and Rice As Putative Co- Chaperones of Hsp90/Hsp70. PLoS ONE 5, e12761.
Pujol, C., Bailly, M., Kern, D., Maréchal-Drouard, L., Becker, H., and Duchêne, A.-M. (2008). Dual-targeted tRNA-dependent amidotransferase ensures both mitochondrial and chloroplastic Gln-tRNAGln synthesis in plants. Proceedings of the National Academy of Sciences 105, 6481-6485.
Qi, Z., Verma, R., Gehring, C., Yamaguchi, Y., Zhao, Y., Ryan, C.A., and Berkowitz, G.A. (2010). Ca2+ signaling by plant Arabidopsis thaliana Pep peptides depends on AtPepR1, a receptor with guanylyl cyclase activity, and cGMP-activated Ca2+ channels. Proceedings of the National Academy of Sciences 107, 21193-21198.
Radulescu, A.E., and Cleveland, D.W. (2010). NuMA after 30 years: the matrix revisited. Trends in Cell Biology 20, 214-222.
Ren, D., Liu, Y., Yang, K., Han, L., Mao, G., Glazebrook, J., and Zhang, S. (2008). A fungal-responsive MAPK cascade regulates phytoalexin biosynthesis in Arabidopsis. Proceedings of the National Academy of Sciences 105, 5638-5643.
Robatzek, S., Chinchilla, D., and Boller, T. (2006). Ligand-induced endocytosis of the pattern recognition receptor FLS2 in Arabidopsis. Genes & Development 20, 537-542.
182
Robatzek, S., and Somssich, I.E. (2001). A new member of the Arabidopsis WRKY transcription factor family, AtWRKY6, is associated with both senescence- and defence- related processes. The Plant Journal 28, 123-133.
Robert-Seilaniantz, A., Grant, M., and Jones, J.D.G. (2011). Hormone Crosstalk in Plant Disease and Defense: More Than Just JASMONATE-SALICYLATE Antagonism. Annual Review of Phytopathology 49, 317-343.
Robson Marsden, H., and Kros, A. (2010). Self-Assembly of Coiled Coils in Synthetic Biology: Inspiration and Progress. Angewandte Chemie International Edition 49, 2988- 3005.
Robzyk, K., and Kassir, Y. (1992). A simple and highly efficient procedure for rescuing autonomous plasmids from yeast. Nucleic Acids Research 20, 3790.
Roine, E., Wei, W., Yuan, J., Nurmiaho-Lassila, E., Kalkkinen, N., Romantschuk, M., and He, S.Y. (1997). Hrp pilus: An hrp-dependent bacterial surface appendage produced by Pseudomonas syringae pv. tomato DC3000. Proceedings of the National Academy of Sciences 94, 3459-3464.
Rosado, A., Schapire, A.L., Bressan, R.A., Harfouche, A.L., Hasegawa, P.M., Valpuesta, V., and Botella, M.A. (2006). The Arabidopsis Tetratricopeptide Repeat-Containing Protein TTL1 Is Required for Osmotic Stress Responses and Abscisic Acid Sensitivity. Plant Physiology 142, 1113-1126.
Rose, A., Manikantan, S., Schraegle, S.J., Maloy, M.A., Stahlberg, E.A., and Meier, I. (2004). Genome-Wide Identification of Arabidopsis Coiled-Coil Proteins and Establishment of the ARABI-COIL Database. Plant Physiology 134, 927-939.
Rose, A., and Meier, I. (2004). Scaffolds, levers, rods and springs: diverse cellular functions of long coiled-coil proteins. Cellular and Molecular Life Sciences 61, 1996- 2009.
183
Runions, J., Brach, T., Kūhner, S., and Hawes, C. (2006). Photoactivation of GFP reveals protein dynamics within the endoplasmic reticulum membrane. Journal of Experimental Botany 57, 43-50.
Russinova, E., Borst, J, Kwaaitaal, M., Caño-Delgado, A., Yin, Y., Chory, J., and de Vries, S.C. (2004). Heterodimerization and Endocytosis of Arabidopsis Brassinosteroid Receptors BRI1 and AtSERK3 (BAK1). The Plant Cell Online 16, 3216-3229.
Ryals, J.A., Neuenschwander, U.H., Willits, M.G., Molina, A., Steiner, H.Y., and Hunt, M.D. (1996). Systemic Acquired Resistance. The Plant Cell Online 8, 1809-1819.
Saijo, Y., Tintor, N., Lu, X., Rauf, P., Pajerowska-Mukhtar, K., Haweker, H., Dong, X., Robatzek, S., and Schulze-Lefert, P. (2009). Receptor quality control in the endoplasmic reticulum for plant innate immunity. EMBO J 28, 3439-3449.
Samac, D.A., and Shah, D.M. (1991). Developmental and Pathogen-Induced Activation of the Arabidopsis Acidic Chitinase Promoter. The Plant Cell Online 3, 1063-1072.
Sampath, P., Mazumder, B., Seshadri, V., Gerber, C.A., Chavatte, L., Kinter, M., Ting, S.M., Dignam, J.D., Kim, S., Driscoll, D.M., et al. (2004). Noncanonical Function of Glutamyl-Prolyl-tRNA Synthetase: Gene-Specific Silencing of Translation. Cell 119, 195- 208.
Sanderfoot, A.A., Assaad, F.F., and Raikhel, N.V. (2000). The Arabidopsis Genome. An Abundance of Soluble N-Ethylmaleimide-Sensitive Factor Adaptor Protein Receptors. Plant Physiology 124, 1558-1569.
Santiago, J., Rodrigues, A., Saez, A., Rubio, S., Antoni, R., Dupeux, F., Park, S.-Y., Márquez, J.A., Cutler, S.R., and Rodriguez, P.L. (2009). Modulation of drought resistance by the abscisic acid receptor PYL5 through inhibition of clade A PP2Cs. The Plant Journal 60, 575-588.
Schliwa, M., and Woehlke, G. (2003). Molecular motors. Nature 422, 759-765.
184
Schroeder, J.I., Allen, G.J., Hugouvieux, V., Kwak, J.M., and Waner, D. (2001). GUARD CELL SIGNAL TRANSDUCTION. Annual Review of Plant Physiology and Plant Molecular Biology 52, 627-658.
Schwenk, J., Harmel, N., Zolles, G., Bildl, W., Kulik, A., Heimrich, B., Chisaka, O., Jonas, P., Schulte, U., Fakler, B., et al. (2009). Functional Proteomics Identify Cornichon Proteins as Auxiliary Subunits of AMPA Receptors. Science 323, 1313-1319.
Shah, J., Tsui, F., and Klessig, D.F. (1997). Characterization of a Salicylic Acid- Insensitive Mutant (sai1) of Arabidopsis thaliana, Identified in a Selective Screen Utilizing the SA-Inducible Expression of the tms2 Gene. Mol Plant-Microbe Interact 10, 69-78.
Shan, L., He, P., Li, J., Heese, A., Peck, S.C., Nürnberger, T., Martin, G.B., and Sheen, J. (2008a). Bacterial Effectors Target the Common Signaling Partner BAK1 to Disrupt Multiple MAMP Receptor-Signaling Complexes and Impede Plant Immunity. Cell Host & Microbe 4, 17-27.
Shan, L., He, P., Li, J., Heese, A., Peck, S.C., Nürnberger, T., Martin, G.B., and Sheen, J. (2008b). Bacterial Effectors Target the Common Signaling Partner BAK1 to Disrupt Multiple MAMP Receptor-Signaling Complexes and Impede Plant Immunity. Cell Host & Microbe 4, 17-27.
Shen, Y., and Ronald, P. (2002). Molecular determinants of disease and resistance in interactions of Xanthomonas oryzae pv. oryzae and rice. Microbes and Infection 4, 1361- 1367.
Shibuya, N., and Minami, E. (2001). Oligosaccharide signalling for defence responses in plant. Physiological and Molecular Plant Pathology 59, 223-233.
Shimizu, T., Nakano, T., Takamizawa, D., Desaki, Y., Ishii-Minami, N., Nishizawa, Y., Minami, E., Okada, K., Yamane, H., Kaku, H., et al. (2010). Two LysM receptor molecules, CEBiP and OsCERK1, cooperatively regulate chitin elicitor signaling in rice. The Plant Journal 64, 204-214.
185
Shinozaki, K., Yamaguchi-Shinozaki, K., and Seki, M. (2003). Regulatory network of gene expression in the drought and cold stress responses. Current Opinion in Plant Biology 6, 410-417.
Shirasu, K., Nakajima, H., Rajasekhar, V.K., Dixon, R.A., and Lamb, C. (1997). Salicylic Acid Potentiates an Agonist-Dependent Gain Control That Amplifies Pathogen Signals in the Activation of Defense Mechanisms. The Plant Cell Online 9, 261-270.
Shu, W., Liu, J., Ji, H., and Lu, M. (2000). Core structure of the outer membrane lipoprotein from Escherichia coli at 1.9 å resolution. Journal of Molecular Biology 299, 1101-1112.
Siddiqui, N.U., Stronghill, P.E., Dengler, R.E., Hasenkampf, C.A., and Riggs, C.D. (2003). Mutations in Arabidopsis condensin genes disrupt embryogenesis, meristem organization and segregation of homologous chromosomes during meiosis. Development 130, 3283-3295.
Snider, J., Kittanakom, S., Damjanovic, D., Curak, J., Wong, V., and Stagljar, I. (2010). Detecting interactions with membrane proteins using a membrane two-hybrid assay in yeast. Nat Protocols 5, 1281-1293.
Song, W.-Y., Wang, G.-L., Chen, L.-L., Kim, H.-S., Pi, L.-Y., Holsten, T., Gardner, J., Wang, B., Zhai, W.-X., Zhu, L.-H., et al. (1995). A Receptor Kinase-Like Protein Encoded by the Rice Disease Resistance Gene, Xa21. Science 270, 1804-1806.
Sparkes, I., Tolley, N., Aller, I., Svozil, J., Osterrieder, A., Botchway, S., Mueller, C., Frigerio, L., and Hawes, C. (2010). Five Arabidopsis Reticulon Isoforms Share Endoplasmic Reticulum Location, Topology, and Membrane-Shaping Properties. The Plant Cell Online 22, 1333-1343.
Spoel, S.H., and Dong, X. (2008). Making Sense of Hormone Crosstalk during Plant Immune Responses. Cell Host & Microbe 3, 348-351.
186
Spoel, S.H., Johnson, J.S., and Dong, X. (2007). Regulation of tradeoffs between plant defenses against pathogens with different lifestyles. Proceedings of the National Academy of Sciences 104, 18842-18847.
Stagljar, I., Korostensky, C., Johnsson, N., and te Heesen, S. (1998). A genetic system based on split-ubiquitin for the analysis of interactions between membrane proteins in vivo. Proceedings of the National Academy of Sciences 95, 5187-5192.
Stepanova, A.N., and Alonso, J.M. (2009). Ethylene signaling and response: where different regulatory modules meet. Current Opinion in Plant Biology 12, 548-555.
Stintzi, A., Heitz, T., Prasad, V., Wiedemann-Merdinoglu, S., Kauffmann, S., Geoffroy, P., Legrand, M., and Fritig, B. (1993). Plant 'pathogenesis-related' proteins and their role in defense against pathogens. Biochimie 75, 687-706.
Strauss, H.M., and Keller, S. (2008). Pharmacological Interference with Protein-Protein Interactions Mediated by Coiled-Coil Motifs Protein-Protein Interactions as New Drug Targets. In, E. Klussmann, and J. Scott, eds. (Springer Berlin Heidelberg), pp. 461-482.
Sutton, R.B., Fasshauer, D., Jahn, R., and Brunger, A.T. (1998). Crystal structure of a SNARE complex involved in synaptic exocytosis at 2.4 A resolution. Nature 395, 347- 353.
Takai, R., Isogai, A., Takayama, S., and Che, F.S. (2008). Analysis of Flagellin Perception Mediated by flg22 Receptor OsFLS2 in Rice. Mol Plant-Microbe Interact 21, 1635-1642.
Takemoto, D., and Hardham, A.R. (2004). The Cytoskeleton as a Regulator and Target of Biotic Interactions in Plants. Plant Physiology 136, 3864-3876.
Takemoto, D., Jones, D.A., and Hardham, A.R. (2003). GFP-tagging of cell components reveals the dynamics of subcellular re-organization in response to infection of Arabidopsis by oomycete pathogens. The Plant Journal 33, 775-792.
187
Torres, M.A., and Dangl, J.L. (2005). Functions of the respiratory burst oxidase in biotic interactions, abiotic stress and development. Current Opinion in Plant Biology 8, 397- 403.
Truman, W., de Zabala, M.T., and Grant, M. (2006). Type III effectors orchestrate a complex interplay between transcriptional networks to modify basal defence responses during pathogenesis and resistance. The Plant Journal 46, 14-33.
Tsuda, K., and Katagiri, F. (2010). Comparing signaling mechanisms engaged in pattern-triggered and effector-triggered immunity. Current Opinion in Plant Biology 13, 459-465.
Tsuda, K., Sato, M., Glazebrook, J., Cohen, J.D., and Katagiri, F. (2008). Interplay between MAMP-triggered and SA-mediated defense responses. The Plant Journal 53, 763-775.
Underwood, W., and Somerville, S.C. (2008). Focal accumulation of defences at sites of fungal pathogen attack. Journal of Experimental Botany 59, 3501-3508.
Underwood, W., Zhang, S., and He, S.Y. (2007). The Pseudomonas syringae type III effector tyrosine phosphatase HopAO1 suppresses innate immunity in Arabidopsis thaliana. The Plant Journal 52, 658-672.
Van Criekinge, W., and Beyaert, R. (1999). Yeast two-hybrid: State of the art. Biological Procedures Online 2, 1-38. van der Hoorn, R.A.L., and Kamoun, S. (2008). From Guard to Decoy: A New Model for Perception of Plant Pathogen Effectors. The Plant Cell Online 20, 2009-2017. van Loon, L.C., Rep, M., and Pieterse, C.M.J. (2006). Significance of Inducible Defense- related Proteins in Infected Plants. Annual Review of Phytopathology 44, 135-162.
Vaucheret, H. (2006). Post-transcriptional small RNA pathways in plants: mechanisms and regulations. Genes & Development 20, 759-771.
188
Vembar, S.S., and Brodsky, J.L. (2008). One step at a time: endoplasmic reticulum- associated degradation. Nat Rev Mol Cell Biol 9, 944-957.
Verderio, E., Nicholas, B., Gross, S., and Griffin, M. (1998). Regulated Expression of Tissue Transglutaminase in Swiss 3T3 Fibroblasts: Effects on the Processing of Fibronectin, Cell Attachment, and Cell Death. Experimental Cell Research 239, 119-138.
Veronese, P., Nakagami, H., Bluhm, B., AbuQamar, S., Chen, X., Salmeron, J., Dietrich, R.A., Hirt, H., and Mengiste, T. (2006). The Membrane-Anchored BOTRYTIS-INDUCED KINASE1 Plays Distinct Roles in Arabidopsis Resistance to Necrotrophic and Biotrophic Pathogens. The Plant Cell Online 18, 257-273.
Vidalain, P.-O., Boxem, M., Ge, H., Li, S., and Vidal, M. (2004). Increasing specificity in high-throughput yeast two-hybrid experiments. Methods 32, 363-370.
Vinson, C., Acharya, A., and Taparowsky, E.J. (2006). Deciphering B-ZIP transcription factor interactions in vitro and in vivo. Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression 1759, 4-12.
Vitale, A., and Denecke, J. (1999). The Endoplasmic Reticulum-Gateway of the Secretory Pathway. The Plant Cell Online 11, 615-628.
Vlot, A.C., Dempsey, D.M.A., and Klessig, D.F. (2009). Salicylic Acid, a Multifaceted Hormone to Combat Disease. Annual Review of Phytopathology 47, 177-206.
Wan, J., Zhang, X.-C., Neece, D., Ramonell, K.M., Clough, S., Kim, S.-y., Stacey, M.G., and Stacey, G. (2008). A LysM Receptor-Like Kinase Plays a Critical Role in Chitin Signaling and Fungal Resistance in Arabidopsis. The Plant Cell Online 20, 471-481.
Wang, D., Amornsiripanitch, N., and Dong, X. (2006). A Genomic Approach to Identify Regulatory Nodes in the Transcriptional Network of Systemic Acquired Resistance in Plants. PLoS Pathog 2, e123.
Wang, D., Weaver, N.D., Kesarwani, M., and Dong, X. (2005). Induction of Protein Secretory Pathway Is Required for Systemic Acquired Resistance. Science 308, 1036- 1040. 189
Wang, K.L.C., Li, H., and Ecker, J.R. (2002). Ethylene Biosynthesis and Signaling Networks. The Plant Cell Online 14, S131-S151.
Wang, P., Hummel, E., Osterrieder, A., Meyer, A.J., Frigerio, L., Sparkes, I., and Hawes, C. (2011). KMS1 and KMS2, two plant endoplasmic reticulum proteins involved in the early secretory pathway. The Plant Journal 66, 613-628.
Wang, Y., Li, J., Hou, S., Wang, X., Li, Y., Ren, D., Chen, S., Tang, X., and Zhou, J.-M. (2010). A Pseudomonas syringae ADP-Ribosyltransferase Inhibits Arabidopsis Mitogen- Activated Protein Kinase Kinases. The Plant Cell Online 22, 2033-2044.
Watanabe, K., Pacher, M., Dukowic, S., Schubert, V., Puchta, H., and Schubert, I. (2009). The STRUCTURAL MAINTENANCE OF CHROMOSOMES 5/6 Complex Promotes Sister Chromatid Alignment and Homologous Recombination after DNA Damage in Arabidopsis thaliana. The Plant Cell Online 21, 2688-2699.
Wei, M. (2011). Roles of Ca2+ and cyclic nucleotide gated channel in plant innate immunity. Plant Science 181, 342-346.
Whyte, J.R.C., and Munro, S. (2002). Vesicle tethering complexes in membrane traffic. Journal of Cell Science 115, 2627-2637.
Wildermuth, M.C., Dewdney, J., Wu, G., and Ausubel, F.M. (2001). Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature 414, 562-565.
Wu, S., Lu, D., Kabbage, M., Wei, H., Swingle, B., Records, A.R., Dickman, M., He, P., and Shan, L. (2011). Bacterial Effector HopF2 Suppresses Arabidopsis Innate Immunity at the Plasma Membrane. Mol Plant-Microbe Interact 24, 585-593.
Xiang, T., Zong, N., Zou, Y., Wu, Y., Zhang, J., Xing, W., Li, Y., Tang, X., Zhu, L., Chai, J., et al. (2008). Pseudomonas syringae Effector AvrPto Blocks Innate Immunity by Targeting Receptor Kinases. Current Biology 18, 74-80.
Xiong, L., Schumaker, K.S., and Zhu, J. (2002). Cell Signaling during Cold, Drought, and Salt Stress. The Plant Cell Online 14, S165-S183.
190
Xu, X.M., and Meier, I. (2008). The nuclear pore comes to the fore. Trends in Plant Science 13, 20-27.
Xu, X.M., Meulia, T., and Meier, I. (2007a). Anchorage of Plant RanGAP to the Nuclear Envelope Involves Novel Nuclear-Pore-Associated Proteins. Current Biology 17, 1157- 1163.
Xu, X.M., Rose, A., Muthuswamy, S., Jeong, S.Y., Venkatakrishnan, S., Zhao, Q., and Meier, I. (2007b). NUCLEAR PORE ANCHOR, the Arabidopsis Homolog of Tpr/Mlp1/Mlp2/Megator, Is Involved in mRNA Export and SUMO Homeostasis and Affects Diverse Aspects of Plant Development. The Plant Cell Online 19, 1537-1548.
Yamaguchi, Y., Pearce, G., and Ryan, C.A. (2006). The cell surface leucine-rich repeat receptor for AtPep1, an endogenous peptide elicitor in Arabidopsis, is functional in transgenic tobacco cells. Proceedings of the National Academy of Sciences 103, 10104- 10109.
Yang, C.H., Lambie, E.J., and Snyder, M. (1992). NuMA: an unusually long coiled-coil related protein in the mammalian nucleus. The Journal of Cell Biology 116, 1303-1317.
Yasuda, M., Ishikawa, A., Jikumaru, Y., Seki, M., Umezawa, T., Asami, T., Maruyama- Nakashita, A., Kudo, T., Shinozaki, K., Yoshida, S., et al. (2008). Antagonistic Interaction between Systemic Acquired Resistance and the Abscisic Acid–Mediated Abiotic Stress Response in Arabidopsis. The Plant Cell Online 20, 1678-1692.
Yi, C., and Deng, X.W. (2005). COP1-from plant photomorphogenesis to mammalian tumorigenesis. Trends in Cell Biology 15, 618-625.
Yoo, S.-D., Cho, Y.-H., Tena, G., Xiong, Y., and Sheen, J. (2008). Dual control of nuclear EIN3 by bifurcate MAPK cascades in C2H4 signalling. Nature 451, 789-795.
Yuan, J., and He, S.Y. (1996). The Pseudomonas syringae Hrp regulation and secretion system controls the production and secretion of multiple extracellular proteins. Journal of Bacteriology 178, 6399-6402.
191
Zhang, J., Shao, F., Li, Y., Cui, H., Chen, L., Li, H., Zou, Y., Long, C., Lan, L., Chai, J., et al. (2007). A Pseudomonas syringae Effector Inactivates MAPKs to Suppress PAMP- Induced Immunity in Plants. Cell Host & Microbe 1, 175-185.
Zhang, J.Z., and Somerville, C.R. (1997). Suspensor-derived polyembryony caused by altered expression of valyl-tRNA synthetase in the twn2 mutant ofArabidopsis. Proceedings of the National Academy of Sciences 94, 7349-7355.
Zhang, X., Zhao, H., Gao, S., Wang, W.-C., Katiyar-Agarwal, S., Huang, H.-D., Raikhel, N., and Jin, H. (2011). Arabidopsis Argonaute 2 Regulates Innate Immunity via miRNA393‚àó-Mediated Silencing of a Golgi-Localized SNARE Gene, MEMB12. Molecular Cell 42, 356-366.
Zhang, Y., Fan, W., Kinkema, M., Li, X., and Dong, X. (1999). Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene. Proceedings of the National Academy of Sciences 96, 6523-6528.
Zhang, Y., Tessaro, M.J., Lassner, M., and Li, X. (2003). Knockout Analysis of Arabidopsis Transcription Factors TGA2, TGA5, and TGA6 Reveals Their Redundant and Essential Roles in Systemic Acquired Resistance. The Plant Cell Online 15, 2647- 2653.
Zhao, Q., Leung, S., Corbett, A.H., and Meier, I. (2006). Identification and Characterization of the Arabidopsis Orthologs of Nuclear Transport Factor 2, the Nuclear Import Factor of Ran. Plant Physiology 140, 869-878.
Zhao, X., Wu, C., and Blobel, G. (2004). Mlp-dependent anchorage and stabilization of a desumoylating enzyme is required to prevent clonal lethality. The Journal of Cell Biology 167, 605-611.
Zhu, S., Yu, X., Wang, X., Zhao, R., Li, Y., Fan, R., Shang, Y., Du, S., Wang, X., Wu, F., et al. (2007). Two Calcium-Dependent Protein Kinases, CPK4 and CPK11, Regulate Abscisic Acid Signal Transduction in Arabidopsis. The Plant Cell Online 19, 3019-3036.
192
Zipfel, C., Kunze, G., Chinchilla, D., Caniard, A., Jones, J.D.G., Boller, T., and Felix, G. (2006). Perception of the Bacterial PAMP EF-Tu by the Receptor EFR Restricts Agrobacterium-Mediated Transformation. Cell 125, 749-760.
Zipfel, C., Robatzek, S., Navarro, L., Oakeley, E.J., Jones, J.D.G., Felix, G., and Boller, T. (2004). Bacterial disease resistance in Arabidopsis through flagellin perception. Nature 428, 764-767.
193