The Role of Sgs1 and Mph1 in DNA Repair and Mismatch Correction A

Unwinding Pathways: The Role of Sgs1 and Mph1 in DNA Repair and Mismatch Correction

A Master’s Thesis

Presented to

The Faculty of the Graduate School of Arts and Sciences Brandeis University

Department of Biology

James E. Haber, Advisor

In Partial Fulfillment of the Requirements for the Degree Master of Science

Mosammat Faria Afreen

February 2021

ACKNOWLEDGEMENTS

When I applied to college, I intended to be a philosophy or politics major, but after reading a series of books and experiencing personal health complications, I decided to try out science. It turns out that I really love it and I owe a huge thank you to the Haber lab for making my journey in science so far, an enjoyable one. I am particularly thankful for James Haber and Elena Sapede for creating a welcoming lab environment where I could ask as many questions as I wanted and felt safe to grow as a scientist and learn from my mistakes. I remember my first lab meeting and feeling very confused and writing down names of what where then random proteins and pathways. I am amazed that I can now follow along the presentations with relative ease. I will always remember Professor Haber’s willingness to answer any of my smallest or biggest questions during undergrad lab meetings. I will also never forget my time working with Elena and the care she put into training me and how thorough she taught to me to be in my work, while still making sure I took time to time to take care of myself. I could not have asked for better mentors and this project would not have been possible without their guidance. I am also thankful for my mentors outside of lab: Don Katz, Rachel Woodruff, Kathrine Kimbrell, and Lisa Rourke. Don for making me laugh and reminding me to not take myself too seriously, but also teaching me to be critical of science and scientists. Dr. Woodruff for teaching me the importance of pedagogy in science and helping me become a better teacher and student. Katie for helping me bring my passion for science equity and inclusion to Brandeis through our involvement with Brandeis Encourages Women in Science in Engineering (BeWise), and for helping me develop my science writing skills during our many sessions together at the CommSci lab and in her class. Lisa for being my campus mom and listening to my rants and worries about school and home. I could not have made it through four years at Brandeis without their encouragement and support. Finally, I am thankful for my friends who laughed with me through the hard times, stayed up with me until 2am numerous times, and took me out for ice cream and froyo runs to Chillbox when I didn’t want to, but really needed it.

iii ABSTRACT

The Role of Sgs1 and Mph1 in DNA Repair and Mismatch Correction

A thesis presented to the Faculty of the Graduate School of Arts and Sciences of Brandeis University Waltham, Massachusetts

By Mosammat Faria Afreen

Double strand breaks (DSBs) can occur in the genome from regular cellular processes and environmental, clastogenic agents. Failure and error in repairing DSBs results in genome instability, which can lead to cancer or cell death. Thus, our understanding of DNA repair is intertwined with our understanding of cancer, current therapeutic agents, and gene therapy.

There are two major categories of DNA repair: homologous recombination (HR) and non- homologous end joining (NHEJ). The focus of the first half of this thesis is a subtype of homologous recombination repair known as Single Strand Annealing (SSA). SSA is a repair pathway which occurs when a DSB is produced between repeats. In humans, short interspersed repeated sequences (SINES) and long interspersed repeated sequences (LINES), constitute at least

40% of genome. To mimic human SSA repair, the Haber laboratory designed yeast (S. cerevisiae) strains that carry two 205-bp URA3 sequences separated by a 2.3kb phage lambda DNA fragment, in which a site-specific DSB can be created. To study mismatch repair (MMR) during SSA, a second yeast strain was created to have 7 mismatches (6 base-pair substitutions and 1-bp insertion/deletion), resulting in a 3% divergence between the repeats.

The product of SSA repair is a single copy of one of the two repeats. Thus, SSA is a highly mutagenic repair pathway. My research confirms that that the helicase Sgs1 decreases

SSA by two fold, most likely through a process called heteroduplex rejection (Sugawara et al.,

2004). Through sequence analysis of the repaired SSA product, I show that the left fragment is

iv favored during MMR and that heteroduplex rejection and mismatch correction in SSA is mediated by the non-homologous tail.

The second half of this thesis explores how the helicase Mph1 directs BIR and other HR mechanisms when mismatches exist between template and donor sequences. The parental strains

I used for this project were created by Ranjith Anand, a former postdoc at the Haber lab and contains 300 base pairs of homology between the template and donor sequence. A similar strain was created using the Kluyveromyces lactis URA3 (Kl-URA3) gene, which is only 71% identical to the Saccharomyces cerevisiae gene. Previous data collected by Ranjith Anand suggests that mismatch repair proteins may be playing a role in suppressing BIR and as mismatches increases between the template and donor sequences (Anand et al., 2014). Initial results show that in completely homologues strains, mph1Δ increases BIR and CO, but GC events are still dominant.

In divergent strains compared to completely homologous strains, BIR increases. I also show that

Mph1 and Msh2 have a similar effect on repair frequency and viability, suggesting that they work together.

TABLE OF CONTENTS

Chapter 1: The Role of Sgs1 in Single Strand Annealing

1. Introduction …………………………………………………………………..………………....1

2. Materials and Methods …………………………………………………………………….....…9

3. Results ………………………………………………………………………………………....13

4. Conclusions and Further Direction………………………………………………………….…25

5. Additional Results……………………………………………………………………………...27

Chapter 2: The Role of Mph1 in Directing DNA Repair

6. Introduction ……………………………………………………………………………...... 30

7. Materials and Methods…………………………………………………………………...... 30

8. Results …………………………………………………………………………………...... 35

9. Conclusion and Further Directions…………………………………………………………….43

10. Bibliography…………………………………………………………………………………..44

vi LIST OF TABLES

Table 1. Yeast Strains Relevant to First Study

Table 2. Primers Used in First Study

Table 3. Yeast Strains Used for Second Study

Table 4. Primers Used in Second Study

vii

LIST OF FIGURES

Figure 1. Possible Pathways to Repair Double Strand Breaks

Figure 2. Model for Mismatch Repair of a Single Base Pair Mutation

Figure 3. Two Possible Outcomes for SSA Intermediate Containing Mismatches

Figure 4. Sgs1 Levels During the Cell Cycle

Figure 5. Mismatches in the Divergent Strains used in Sugawara et al (2004)

Figure 6. Single Strand Annealing Assay

Figure 7. Examples of a Heteroduplex Colony and a Corrected Colony

Figure 8. Viability in Homologous Repeats and Heterologous Repeats

Figure 9. Repair Outcomes of Mismatches in WT strains

Figure 10. Viability in Homologous Repeats and Heterologous Repeats in sgs1Δ strains and

Sgs1 WT strains

Figure 12. Repair Outcomes of Mismatches in Tailed, mlh1Δ strains

Figure 11. Repair Outcomes of Mismatches in Tailed, sgs1Δ strains

Figure 13. Single Strand Annealing (SSA) in Tailless Strains

Figure 14. Viability Comparisons Between Tail and Tailless and SGS1 and sgs1Δ in both F-A and A-A Strains

Figure 15. Repair Outcome of Mismatches in Tailless Strain

Figure 16. Repair Outcome of Tailless, sgs1Δ Strains

Figure 17. Repair Outcome of Mismatches in Tailed, MIP-box-mutated AF Strains

Figure 18. Viability with Mph1 and Sgs1 Deletion

viii Figure 19. Diagram of yRA97 and Phenotypes Associated with Repair Outcomes

Figure 20. Viability Between yRA97 and yMFA200 (yRA97 mph1::HYG)

Figure 21. Repair Frequency between yRA97 and yMFA200 (yRA97 mph1::HYG)

Figure 22. Crossover Outcomes in yRA97, yMFA200, and yMFA201

Figure 23. Diagram of yRA99

Figure 24. Viability Between yRA97 and yRA99

Figure 25. Repair Frequency Between yRA97 and yRA99

Figure 26. Repair Frequency in yRA99 after mph1 deletion

Figure 27. Viability with mph1 and msh2 Deletion in yRA97 and yRA99

Figure 28. Repair frequency with mph1and msh2 Deletion in yRA97 and yRA99

1. Introduction

Using Yeast as a Model Organism

For many years Saccharomyces cerevisiae, commonly known as budding or baker’s yeast, has been used a model organism to shine light on almost every area of molecular and cell biology. S. cerevisiae is small unicellular organism with 16 chromosomes compared to the 23 chromosomes in humans; however, almost 50% of the genes associated with a human disease have a close homolog in yeast genome and 31% of yeast proteins have a human homolog

(Conconi, 2008). Furthermore, the cellular organization and functional pathways of S. cerevisiae are also similar to those of higher-level eukaryotes (Conconi, 2008; Mohammadi et al., 2015).

For example, yeast DNA is also found in the nucleus and the metabolism, protein folding, and

DNA repair pathways found in humans are similar to those found in yeast (Mohammadi et al.

2015). Finally, the ease at in which genetic manipulations can be performed, as well as their short doubling time of 90 minutes and inexpensive growth conditions also makes yeast a great model organism (Duina et al., 2014; Pâques and Haber, 1999). The majority of the experiments presented and discussed in this paper have been conducted using baker’s yeast or S. cerevisiae.

DNA Damage and Double Strand Break Repair

DSBs occur when the phosphate backbone of two complementary strands of DNA are broken.

They are the most lethal type of damage that can occur in the genome and arise from regular cellular processes such as DNA replication and from environmental clastogenic agents such as

UV light and ionizing radiation (Bhargava et al., 2016; Iyama and Wilson, 2013). DSB event are more frequent than people may think. It is estimated that a DSB occurs spontaneously for every

108 base pair (Mehta and Haber, 2014). Failure and error in repairing DSBs results in genome

1 instability, which is a hallmark of cancer, premature aging, and many other human diseases

(Iyama and Wilson, 2013). Eukaryotic cells have developed many pathways of repairing DSBs

(Figure 1). These pathways can be divided in two categories: non-homologous end joining

(NHEJ) and homologous recombination (HR).

NHEJ, as the name suggests, does not require a homology search and fixes DNA breaks through ligation of broken ends often with slight modifications in the DNA such as small insertions or deletions (Mehta and Haber, 2014). During NHEJ, the stabilizing heterodimers

Ku70 and Ku80 bind to the ends of the DNA and start a signaling cascade that results in the recruitment of DNA ligase IV, Xrcc4/Lif1, and Nej1/Xlf (Symington and Gautier, 2011).

Unlike NHEJ, homologous recombination (HR) requires a sister chromatid, a homologous chromosome or an allelic or ectopic region of homology (Iyama and Wilson, 2013;

Mehta and Haber, 2014). There are many variations of the HR pathway known as Gene

Conversion (GC), which includes Synthesis-Dependent Strand Annealing (SDSA) and double

Holliday Junction (dHJ), Break Induced Replication (BIR), and single strand annealing (SSA).

All HR pathways begin with extensive 5’ to 3’ resection of the DNA called the presynaptic stage

(Mehta and Haber, 2014). There are multiple proteins involved in resection. It is initiated by

Mre11-Rad50-Xrs2 (MRX) and Sae2 and continued by Exo1 and Dna2. Dna2 activity is mediated by Sgs1-Top2-Rmi1 (STR) (Chakraborty and Alani, 2016).

HR mechanisms begin to differ at the second step called synapsis, which occurs only in

SDSA, dHJ, and BIR. During the synapsis stage, Rad51 displaces the Replication Protein A

(RPA) covering the 3’ single stranded end of the DNA and performs a homology search. When a homologous sequence is found, the 3’ end of the single-stranded DNA invades the homologous donor strand, resulting in the formation of a displacement loop (D-loop) (Li and Heyer, 2008).

2 This is a necessary step for proteins to initiate DNA synthesis. The post-synapsis stage varies depending on the pathway and can result in crossover or non-crossovers (Figure 1). Crossovers are events that lead to the exchange of DNA from one region of the chromosome to another. In both SDSA and dHJ, the 3’ end of the invading strand is used as a primer. In the SDSA pathway, after DNA synthesis, the strand is displaced and results primarily in non-crossovers (Jain et al.,

2009). In dHJ pathway the D-loop is extended, and a second round of DNA synthesis creates a double Holliday junction structure with the broken chromosome. Depending how the dHJ structure is resolved, the outcome can be a crossover or non-crossover.

BIR occurs when only one side of the DSB shares homology with a donor, which often occurs due to broken or stalled replication forks or shorten telomeres. BIR can also occur if the

DSB occurs within mostly nonhomologous sequence, but near a repeated element such as a transposon and lead to a nonreciprocal translocation. BIR compared to GC is very mutagentic and can lead to nonreciprical translocation and extensive DNA loss (Lydeard et al., 2010).

Yet another HR pathway exists known as single strand annealing (SSA). Compared to the HR events discussed above, SSA is by far the simplest and the preferred process when a DSB is initiated between repeats. SSA requires extensive DNA resection of the DNA between the repeats. After resection, which is Rad52 dependent and Rad51-independent, the two repeats anneal. The nonhomologous tails flanking the annealed structure are recognized by mismatch repair protein dimers Msh2 and Msh3 and clipped off by Rad1-Rad10. As the length of the repeat gets longer, the requirement of Msh2 and Msh3 in SSA appears to decrease due to increased stability of longer annealed intermediates (Sugawara et al., 1997).

Figure 1. Possible Pathways to Repair Double Strand Breaks

Two Major DNA repair pathways exist: Homologous Recombination (HR) and Non- Homologous End Joining (NHEJ). SDSA and dHJ both fall under gene conversion events (GC). BIR events are favored when only one end of the DSB is able to undergo a homology search. SSA events are favored when DSB arise between repeats. (Kramara et al., 2018)

Mismatch Correction during Homologous Recombination

HR and Mismatch Correction or Repair (MMC or MMR) are intertwined. Frequently during HR, heteroduplex DNA arises due to slight divergences in sequence identity. These mismatches are identified and often repaired by MMR proteins to maintain the fidelity of HR. In yeast, mismatches are primarily recognized by the MutS a or � homolog complexes: Msh2-

4 Msh6 and Msh2-Msh3 (Chakraborty and Alani 2016). Single base pair mismatches and 1 to 2 nucleotide insertion/deletions are recognized by Msh2-Msh6. With slight redundancy, Msh2-

Msh3 proteins are able recognize up to 17-nucleotide mismatches (Chakraborty and Alani 2016).

In the Sliding Clamp Model, it is postulated that the Msh proteins form a clamp-link structure around the mismatch and slide along DNA (Chakraborty and Alani, 2016) (Figure 2). They recruit PCNA to increase mismatch-binding ability and MutL homologs: Mlh1 and Pms1 for endonuclease processing (Kunkel and Erie 2005; Chakraborty and Alani 2016). Exo1 enters and excises DNA in a 5’ to 3’ manner. Finally, DNA polymerase delta resynthesizes the DNA.

Figure 2. Model for Mismatch Repair of a Single Base Pair Mutation

A mismatch is recognized by MSH2-MSH3 proteins that form slidable clamp the area of the mutation. A nick is created by PCNA adjacent to and allows for 5’-3’ excision by Exo1. Polymerase delta comes in to resynthesize the strain. (Chakraborty and Alani

2016)

Anti-Recombinant Activity of Mismatch Correction Proteins: Heteroduplex Rejection

MMR proteins are critical for suppressing recombination of divergent sequences

(Chakraborty and Alani 2016). Sugawara et al. (2004) showed that when there is 3% sequence divergence between 205-bp repeats, SSA was reduced 6-fold. Investigation of various MMR proteins during SSA, revealed that this reduction is due to Msh6 as msh6 deletion nearly restores

SSA levels back to SSA levels when the repeats do not contain mismatches (Sugawara et al.

5 2004). Further investigations showed that a3 sgs1 deletion also restores SSA levels back WT levels similar to an msh6 deletion. This suggests that Msh6 and Sgs1 work together to prevent recombination between divergent sequences (Figure 3). Moreover, Sugawara et al. (2004) study showed that separation of function msh2-R730W mutant was defective in mismatch repair, but could still facilate removal of the non-homoglous tails in SSA. The msh2-R730W mutation also suppressed heterologous recombination more strongly compared to exo1, rad1 or mlh1

(Sugawara et al. 2004). Together with these studies support what is postulated to happen to SSA intermediate containing mismatches: Msh2 with Msh6 can recruit Sgs1 to facilitate heteroduplex rejection via unwinding of the heteroduplex DNA in a 3’ to 5’ direction or Msh2 paired with

Msh3 can recruit Rad1 and Rad10 and facilitate the completion of SSA via clipping of the nonhomologous tail (Goldfarb and Alani, 2005; Sugawara et al., 2004) (Figure 3).

6 Figure 3. Two Possible Outcomes for SSA Intermediate Containing Mismatches

Msh2-Msh3 proteins bind mismatches and recruit Rad1 and Rad10 to clip of the nonhomologous tails to complete SSA or MSh2-Msh6 binds to the mismatches and recruits Sgs1 to facilitate heteroduplex rejection, resulting in cell death. (Goldfarb and Alani 2005)

SGS1 Helicase

Sgs1 is an ortholog of the human BLM helicase and can act on a variety of DNA structures such as double Holliday junctions, D-loops, G4-DNA, DNA:RNA hybrids and single- stranded over hangs as seen in SSA (Chang et al., 2017). Mutations in Sgs1 has been shown to lead to hyper-recombination and chromosome loss. Thus, Sgs1 has a critical role in maintaining genome integrity both in meiosis and miosis (Myung et al., 2001; Ouyang et al., 2008). A variety of mutation studies show that helicase activity of Sgs1 is critical for suppressing the phenotypes mentioned above (Bernstein et al., 2009; Lo et al., 2006; Mullen et al., 2000).

Additional studies have shown Sgs1 to interaction with mismatch repair proteins such as

Msh2 as is the case during SSA between homoeologous or divergent repeats (Lo et al. 2006).

Sgs1 has also been shown to have a motif that interacts with Mlh1, an essential mismatch repair protein (Dherin et al. 2009).

Interestingly, the human BLM helicase has been shown to be cell-cycle regulated with highest level in late S and G2 and lowest levels in G1(Ouyang et al. 2008). In yeast, Sgs1 level is highest in S-phase because of its role in replication fork progression during the S-phase checkpoint (Frei and Gasser, 2000) (Figure 4).

Figure 4. Sgs1 Levels During the Cell Cycle

SDS-polyacrylamide gel blotted for Sgs1-myc tag at various points of the cell cycle showed that Sgs1 levels are highest in S phase. (Frei and Gasser 2000)

Current Work

My current research is based on the study done in our lab by Sugawara et al. in 2004.

Sugawara et al. (2004) added much to our understanding of SSA between divergent direct repeats. For their study they created yeast strains containing two 205-bp URA3 sequences separated by a total of 2.5 kb (178 bp of pUC9 DNA, 117bp for the homothallic switching (HO) endonuclease cut site and 2.3-kb lambda DNA). Their homoeologous strain contained 7 single- base-pair site mismatches between the repeats (Figure 5). Using these strains and a single strand annealing assay similar to the one described below, the study showed that MMR complex Msh2-

Msh6, and the helicase activity of Sgs1 is required for facilating heteroduplex rejection of the

SSA intermediate containing mismatches. They also showed that both Msh2-Msh6 and Mlh1–

8 Pms1 complexes are required to fix the mismatches. However, it is still unclear how exactly the mismatches are repaired during SSA. To study how the mismatches are repaired, I used a similar model created by Elena Sapede where the repeats left and right of HO cut site are flipped. I employ both the HO and Cas9 endonucleases to induce a DSB my studies to investigate how the helicase Sgs1 impacts the repair of the mismatches. Additionally, it has not been shown how the nonhomologous tail in SSA influences the repair outcome, and so I investigated this as well.

Figure 5. Mismatches in the Divergent Strains Used in Sugawara et al (2004)

The seven single base pair mismatches are boxed. The repeat left of the HO cut-site is identified as “ura3-A” and the the repeat right of HO cut- site as “ura3-FL100”.

2. Materials and Methods

Yeast Strains

Yeast strains were created using High-efficiency Transformation Yeast Protocol (Amberg,

2005). Sgs1∆ derivatives were created using a sgs1::kanMX cassette. Once transformed, cells were replica plated onto KAN marker. After a few days of growth, Sgs1 deletion was confirmed using the primers NS014 and DG181. Tailless strains (Figure 13) were created using pAB101, a cas9 plasmid which cuts within the non-homologous tail sequence, and a double-stranded DNA template, which was created by duplexing NS150 and NS151 primers together.

9 Table 1. Yeast Strains Used in First Study

Strain Name Genotype Description

tNS1357 ho HMLalpha matDEL.::leu2::hisG hmr-3DEL. mal2 F-A strain, with 7 mismatches leu2 trp1 thr4 (THR4 ura3-F(205 bp) HOcs URA3-A) between the repeats involved in pFH800 (GAL::HO TRP1 CEN) SSA tNS1379 ho HMLalpha matDEL.::leu2::hisG hmr-3DEL. mal2 A-A strains, with no mismatches leu2 trp1 thr4 (THR4 ura3-(205 bp) HOcs URA3) between the repeats involved in pFH800 (GAL::HO TRP1 CEN) SSA EAY997 tNS1357, sgs1::kanMX F-A strain, with sgs1 replacement with KAN marker EAY994 tNS1379 sgs1::kanMX A-A strain, with sgs1 replacement with KAN marker YRT001a tNS1357, without HOcs locus and 2.5kb lambda F-A strain (tNS1357) was fragment between repeats removed transformed with the pAB101 (Cas9 cuts at HOcs) with annealed primers NS150-ura3 and NS151-ura3. This deletes the HOcs and lambda sequences. YRT002a tNS1379, without HOcs locus and 2.5kb lambda tNS1379 was transformed with fragment between repeats removed the pAB101 (Cas9 cuts at HOcs) with annealed primers NS150- ura3 and NS151-ura3. This deletes the HOcs and lambda sequences. YRT003a YRT002a, pRT002 (Gal::Cas9 LEU2) YRT001 was transformed with pRT002 (Gal::Cas9 LEU2). Cas9 targets tailless SSA substrate (A/A). YRT004a YRT001a, pRT002 (Gal::Cas9 LEU2) YRT001 was transformed with pRT002 (Gal::Cas9 LEU2). Cas9 targets tailless SSA substrate (F/A). YES94 tNS1357, mlh1::kanMX F-A strain, with mlh1 deletion with KanMX cassette FA_MIP tNS1357, F1385A FA strain, with the motif involved with interacting with Mlh1 on Sgs1 mutated.

Table 2. Primers Used in First study

Primer Sequence Description

Name

NS154 ggtgtgaaataccgcacagatg Forward Primer to detect SSA product

URA3p14 aacgaagataaatcatgtcgaaagctac Reverse Primer to detect SSA product NS014- ACCGACAGCCATATTTCGTG Forward Primer to confirm Sgs1 deletion Sgs1p5 DG_181 GGGTCACAGTCTATATCATC Reverse Primer to confirm Sgs1 deletion

10 DG_179 AGCAGGCTGGGTGATCATTGGTGATACATT Forward mixed oligo to delete sgs1 with TCGGATTTGTGGCTTTACCGTTTAG any MX cassette gcttgccttgtccccgccgggtcac DG_180 GAGAAAATTCGAAGTTGATAACT reverse mixed oligo to delete sgs1 with any GAGCAATGTGCACACCACAATATGTC MX cassette GTGGTTGAgacactggatggcggcgttagta NS150- GAAATTGCCCAGTATTCTTAA Sequences are from upstream of the ura3 ura3 CCCAACTGCACAGAACAAAAA ORF sense. CCtgcaTTTTCAATTCATCaTTTT Used to construct tailless SSA strains TTTTTTaTTCTTTTTTTTGATTtCGGTTTCcTTG

NS151- CAAgGAAACCGaAATCAAAAAAAA Sequences are from upstream of the ura3 ura3 GAAtAAAAAAAAAAtGATGAATTGAAA ORF anti-sens AtgcaGGTTTTTGTTCTGTGCAGTTG Used to construct tailless SSA strains GGTTAAGAATACTGGGCAATTTC

Viability Assay

Colonies were grown overnight on yeast extract peptone dextrose (YEPD) plates. The next day, a single colony was first confirmed through PCR (using primers NS154 and URA3p14) to be unrecombined and then inoculated in YP-lactate for six hours. Around 200 colonies were plated on to YEPD and YEP-Galactose (YEP-Gal) plates and scored after 48 hours. Both Cas9 and HO endonucleases are under the galactose promoter and carried on a centromeric plasmid, therefore cells undergo a DSB in YEP-Gal plates. Percent viability was calculated to be the fraction of colonies YEP-Galactose over total YEPD colonies.

Single Strand Annealing Assay

After following the Viability assay, cells on YEP-Gal plates are checked by PCR (using primers NS154 and URA3p14) to confirm whether the cell underwent SSA (Figure 6 a). If the cell underwent SSA, a 300 base-pair fragment would be identified on a 1.5% agarose gel (Figure

6 b).

11 a

YEPD YEP -GAL

500 bp

12 Figure 6. Single Strand Annealing Assay

Diagram illustrating the site of investigation (a). Approximate location of forward and reverse primers outside this 2.5kb region are shown with blue arrows (a). If cells underwent SSA, a 300 base pair fragment is seen on 1.5% agarose gel (b).

Sequence Analysis

The PCR products of cells that were confirmed to have undergone SSA were sent to be sequenced by Genewiz. Repair outcome of each mismatch was analyzed using Geneious software. Heteroduplexes are any mismatches that contain a peak that is half of the size of the other peak (Figure 7).

Figure 7. Examples of a Heteroduplex Colony and a Corrected Colony

On this photo, mismatch number 4 was left unrepaired (contained a heteroduplex) by two colonies and repaired as C (right repeat) by one colony.

3. Results

Using the viability assay described above, we show that viability is reduced 2-fold when there is 3% divergence between the repeats involved in SSA (Figure 8). Reduction in SSA in divergent strain is likely due to heteroduplex rejection which occurs when the mismatch repair

13 complex (Msh2-Msh6) recognizes the mismatches in the DNA-duplex and stimulates the unwinding of the DNA via Sgs1 helicase, resulting in cell death (Sugawara et al., 2004).

Analysis of mismatches from wildtype, F-A colonies shows that the left repeat is used as a template for repair (Figure 9a). When looking holistically at the repair outcomes, we see that

44% single colonies repaired all mismatches entirely as F and 50% single colonies had a mix of

F, A and unrepaired mismatches in their SSA product (Figure 9 b).

Viability in Homologous Repeats and Heterologous Repeats 100 90 80 70 60 50 ** 40 30 20 % of Viable Colonies 10 0 A-A strain F-A strain

Figure 8. Viability in Homologous Repeats and Heterologous Repeats

Strains with 3% divergence (heterologous repeats) between the repeats, designated as the F-A strain, reduced SSA two-fold compared to the identical strains, designated as the A-A strain.

14 a Repair Outcome of Mismatches in F-A Strains

repaired as A repaired as F heteroduplex

100 0.0 4.9 7.0 6.3 13.3 9.1 90 14.7

60 67.1 53.1 86.7 74.1 68.5 50 86.7 72.7

Percent of Repair Type 20 32.2 26.6 10 18.9 22.4 13.3 14.0 8.4 0 MM1 MM2 MM3 MM4 MM5 MM6 MM7 Mismatches

b Overall Repair Outcome of F-A Colonies

44% F repaired colonies

50% A repaired colonies Mixed

15 Figure 9. Repair Outcomes of Mismatches in WT Strains

Sequence analysis shows that the left fragment is favored during mismatch correction (a) and 44% single colonies repaired all mismatches entirely as F and 50% single colonies had a mix of F, A and unrepaired mismatches in their SSA product repeat (b). 6% single colonies repair all mismatches to match the A repeat. n= 154

Since it was previously shown that Sgs1 helicase is responsible for stimulating heteroduplex rejection, we investigated whether or not it has a role in facilitating mismatch correction (Sugawara et al., 2004). We found that sgs1 deletion increased viability in both the

F-A and A-A strain (Figure 10). Given that Sgs1 facilities heteroduplex rejection, it is not surprising to see a significant increase with sgs1 deletion in F-A strain (Figure 10). An increase in viability in A-A strains with sgs1 deletion suggest a possible role of Sgs1 in mismatch correction or that there another aspect of the SSA pathway that is important for facilitating heteroduplex rejection such as the non-homologous tail (Figure 3; Figure 10).

Analysis of the mismatches of the SSA product in sgs1-deleted F-A strains shows that there is increase in heteroduplex or uncorrected mismatches from the third to seventh mismatch

(Figure 11, a). We also see an increase in the number of cells that only contain heteroduplex

(Figure 11, b). This increase in heteroduplexes in the product is expected since Sgs1 would normally unwind SSA products with heteroduplexes (Sugawara et al., 2004). It also suggests that

Sgs1 is necessary to the mismatch repair machinery. In fact, it was shown that the mismatch repair protein Mlh1 has domain that physically interacts with Sgs1, called the “MIP box” (Dherin et al., 2009). I find that mlh1 deletion results in more heteroduplex much more than sgs1 deletion

(Figure 12). This suggests that Mlh1 has a more critical role than Sgs1 in mismatch correction during SSA. It also implies that Sgs1 does not have a direct role in mismatch correction and is likely important only for recruiting other mismatch machineries. To investigate this further, I

16 mutated the Mlh1-interacting domain (the MIP box) on Sgs1. However, due to Covid-19, I was only able to investigate the effect of this mutation in a different strain in which the F repeat is on the right and A repeat is on the left (the A-F strain). I found that repair outcomes are similar to wild-type Sgs1 results, except that the A fragment is favored during repair (Figure 16). The preference for A may be due to the A fragment being placed on the left side of the HO cut side in this strain.

Viability in Tailed, sgs1Δ and SGS1 Strains

SGS1 sgs1Δ 100 90 ** 80 70 60 50 40 % Viability 30 20 10 0 F-A strain A-A strain

17 Figure 10. Viability in Homologous Repeats and Heterologous Repeats in sgs1Δ strains and SGS1 WT strains

Strains with 3% divergence between the repeats (heterologous repeats), designated as the F-A strain, shows a two-fold increase in SSA with sgs1 deletion. Sgs1 deletion in A-A strains also increases viability.

a Repair Outcome of Mismatches in Tailed, sgs1Δ Strains

repaired as A repaired as F heteroduplex 100 11.1 11.1 20.4 24.1 22.2 24.1 27.8 80

60 31.5 74.1 72.2 63.0 57.4 57.4 51.9 40

20 40.7 24.1 14.8 16.7 16.7 18.5 20.4 0

Percent of Repair Type MM1 MM2 MM3 MM4 MM5 MM6 MM7 Mismatches

18 b Overall Repair Outcome of Tailed, sgs1Δ Colonies

30% F repaired colonies

A repaired colonies

48% Heteroduplex

Mixed

11%

Figure 11. Repair outcomes of Mismatches in Tailed, sgs1Δ strains

Sequence analysis shows that there is still a gradient of repair, meaning that initially the mismatches are corrected to match the left (F) fragment, but some mismatches begin to be corrected as the right (A) fragment (a). However, with sgs1-deletion there is increase in the number of heteroduplex colonies (b). n= 54

19 Repair Outcome of Mismatches in Tailled, mlh1 Strains

repaired as A repaired as F heteroduplex

100 0.0 90 20.7 80 70 58.6 72.4 60 82.8 89.7 89.7 89.7 50 40 75.9 30 31.0 20 27.6 3.4 Percent of Repair Type 10 3.4 0.0 0.0 10.3 10.3 10.3 13.8 0 3.4 6.9 MM1 MM2 MM3 MM4 MM5 MM6 MM7 Mismatches

Figure 12. Repair outcomes of Mismatches in Tailed, mlh1Δ strains

Sequence analysis shows that mlh1 deletion results increased heteroduplexes across all mismatches, except at mismatch two which is difference between an insertion and deletion. n= 29

Impact of the Non-homologous Tail in Mismatch Correction

The next part of this project explores the role of the non-homologous tail in directing mismatch repair since Sgsl facilitates heteroduplex rejection through this structure. We were also driven to investigate this outcome because sgs1 deletion increased viability in strains that did not contain any mismatches between the repeats (Figure 10; Figure 13). We found that removal of the non-homologous tail increased SSA significantly in both divergent strain (F-A) and the identical strain (A-A) (Figure 14). Additionally, we found that sgs1 deletion increased viability

20 in F-A tailed strains, F-A tailless strains, and A-A tailed strains, but not A-A tailless (Figure 15).

This confirms that sgs1 deletion suppresses heteroduplex rejection and that the non-homologous tail is required for heteroduplex rejection.

Sequence analysis shows that without the non-homologous tail heteroduplexes, and mixed repaired colonies increase (Figure 15, a and b), which suggests that the non-homologous tail is critical for facilitating mismatch correction during SSA. When both the non-homologous tail and sgs1are removed, there is uniform correction, meaning mismatches are corrected similarly in each location. Furthermore, repair still favors the left, F fragment like the tailed strains (Figure 16, a). We also see more than half of the colonies investigated repaired all of their mismatches to match the F fragment (Figure 16, b). This confirms that the non- homologous tail is critical for mismatch correction because it recruits Sgs1 which helps with the recruitment of mismatch repair proteins during SSA.

21 Figure 13. Single Strand Annealing (SSA) in Tailless Strains

This diagram depicts how SSA Assay in tailless strains. A double strand break is created using the Cas9 endonuclease. The ends are resected in the 5’ to 3’ direction, and then the repeated intermediate anneals.

Figure 14. Viability Comparisons Between Tail and Tailless and SGS1 and sgs1Δ in both F-A and A-A Strains

Deletion of sgs1 and removal of the non-homologous tail in SSA increases viability in divergent F-A strains. Sgs1 deletion, but not the removal of the non-homologous tail increases viability.

23 a Repair Outcome of Mismatches in Taillesss Strains

repaired as A repaired as F heteroduplex

100 0.0 11.1 90 23.3 21.1 22.2 18.9 18.9 80 70 60 74.4 50 71.1 61.1 60.0 60.0 57.8 60.0 40 30 20 25.6 Percent of Repair Type 10 17.8 16.7 21.1 17.8 20.0 21.1 0 MM1 MM2 MM3 MM4 MM5 MM6 MM7 Mismatches

b Overall Repair Outcome of Tailless Colonies

26%

F repaired colonies A repaired colonies

53% Heteroduplex 6% Mixed

15%

24 Figure 15. Repair Outcome of Mismatches in Tailless Strain

In tailless F-A strains, F fragment is favored during mismatch correction and there is an increase in the number of mismatches left unrepaired compared to WT(a). Overall, just like WT strains, the F fragment is favored (b). However, one fourth of colonies did not consistently repair mismatches as F or A (b). n = 90

a Repair Outcome of Mismatches in Tailless, sgs1Δ Strains repaired as A repaired as F heteroduplex 100 14.6 14.6 14.6 14.6 16.7 16.7 18.8 80 60 64.6 62.5 64.6 64.6 62.5 62.5 60.4 40 20 20.8 22.9 20.8 20.8 20.8 20.8 20.8

Percent of Repair Type 0 MM1 MM2 MM3 MM4 MM5 MM6 MM7 Mismatches

25 b Overall Repair Outcome of Tailless, sgs1Δ Colonies

15%

F repaired colonies A repaired colonies Heteroduplex 58% Mixed 21%

Figure 16. Repair Outcome of Tailless, sgs1Δ Strains

Mismatches are corrected similarly across all seven mismatch and repair shows preference for the left fragment (a). Over half of tailless, sgs1Δ colonies corrected every mismatch to match the left, F fragment and less “Mixed” colonies are seen (b). n= 48

4. Conclusions and Future Directions

Altogether, current data shows that sgs1Δ increases SSA in divergent strains by preventing heteroduplex rejection after identification of the mismatches. Additionally, we see consistently across multiple strains (Sgs1 WT and sgs1Δ, tailed and tailless) that the left (F) fragment is favored during MM correction in SSA repair. Perhaps this is due to the location of the mismatches which are primarily on the left half or beginning of the repeat (Figure 5). A further study should investigate mismatch correction when mismatches are spread equally within the repeat and located on the right half of the repeat.

26 We also show that the non-homologous sequence between the repeats or tail is necessary for heteroduplex rejection as its deletion improves viability in divergent strains. This and sequences analysis of tailed and tailless sgs1 strains suggests that Sgs1 facilitates heteroduplex rejection and mismatch correction by binding onto this structure.

Furthermore, I investigated the role of Mlh1 in mismatch correction during SSA since

Sgs1 contains a specific binding domain for Mlh1. I found that tailed, Mlh1 strains contained large amounts of heteroduplex duplexes, which suggests that Sgs1’s role in mismatch correction during SSA is primarily to recruit other mismatch repair proteins. A future study should investigate Mlh1 in the absence of the non-homologous tail to better determine how the tailed structure influences the recruitment of mismatch repair proteins. Another study should also investigate a double deletion of both Sgs1 and Mlh1 in tailed and tailless strains to better understand how mismatch repair proteins and Sgs1 work together to influence mismatch repair outcomes.

To further investigate the role Sgs1 during mismatch correction during SSA, another study should assess how the cell cycle impacts mismatch correction since Sgs1 has been shown to be cell cycle arrested (Ouyang et al., 2008). This will elucidate when MM correction is occurring during SSA and perhaps the large number of colonies with mixed repair with sgs1 deletion (Figure 11 b).

27 5. Additional Results

Repair Outcome of Mismatches in Tailled, MIP- box-mutated AF Strains

repaired as A repaired as F heteroduplex

100 0.0 0.0 12.5 12.5 12.5 90 25.0 18.8 18.8 18.8 80 70 18.8 37.5 31.3 60 56.3 50 75 40 75.0 81.3 30 62.5 50.0 50.0 20 31.3 10 Percent of Repair Type 12.5 0 MM1 MM2 MM3 MM4 MM5 MM6 MM7 Mismatches

Figure 17. Repair Outcome of Mismatches in Tailed, MIP-box-mutated AF Strains

Sgs1 one has a domain which interacts directly with Mlh1, a mismatch repair protein. Mutation of this domain results in increased heteroduplex at all mismatch locations, except mismatch 2. n=16

Out of curiosity, I also investigated the role of another helicase, Mph1 in SSA. I found that

Mph1-deletion does not impact SSA viability significantly (Figure 18).

Figure 18. Viability with Mph1 and Sgs1 Deletion

Mph1 does not impact the viability in the F-A strains compared to Sgs1.

CHAPTER TWO

30 6. Introduction

The second half of this thesis explores how the helicase Mph1 directs BIR and other HR mechanisms when mismatches exist between template and donor sequences. The parental strains

In divergent strains compared to completely homologous strains, BIR increases. I also show that

Mph1 and Msh2 have a similar effect on repair frequency and viability, suggesting that they work together.

7. Materials and Methods

Yeast Strains

Yeast strains were created using High-efficiency Transformation Yeast Protocol

(Amberg, 2005). All knockout derivatives were created using “cassettes” which shared 20 base- pairs of homology to the marker of interest and 40 base-pairs of homology to the gene of interest.

31 Table 3: Yeast Strains Used for Second Project

Yeast Strain Genotype Description

yRA97 300bp of homology between break MATa::DEL.HOcs::hisG site and template. ura30851 trp1DEL.63 leu2DEL.::KAN hmlDEL.:: hisG HMR::ADE3 ade3::GAl.::HO can1DEL.::UA:: HOcs::NAT, RA::LEU2, A3::TRP1 yMFA200 yRA97, mph1::HYG yRA97 with Mph1 deleted with HYG marker yMFA201 yRA97, mph1::HYG and lig4::NAT yRA97 with Mph1 deleted with HYG marker and lig4 deleted with NAT marker yMFA202 yRA97, msh2::NAT yRA97 with Msh2 deleted with HYG marker yRA99 yRA97 derivative with A3 MATa::DEL.HOcs::hisG replaced with Kl-A3 ura30851 trp1DEL.63 leu2DEL.::KAN hmlDEL.:: hisG HMR::ADE3 ade3::GAl.::HO can1DEL.::UA:: HOcs::NAT, RA::LEU2, KI-A3::TRP1 yMFA203 yRA99 with Mph1 deleted with yRA99, mph1::HYG HYG marker yRA146 yRA99 with Msh2 deleted with yRA99, msh2::HYG HYG marker

Table 4: Primers Used in Second Study

Primer Sequence Description

DG_84 GCCCTATGCTCTATCACGGA Mixed oligo to delete mph1 with GCTAAGAT any MX cassette, forward primer ATTGTGATTCAAGATATAGTA GCT CACgcttgccttgtccccgccgggtcac

DG_85 CGTGGAAGATTACAGATTGT Mixed oligo to delete mph1 with ACTCGTCGTTGGCTCAATTTT any MX cassette, reverse primer. TATATTTTGTTGCTTC gacactggatggcggcgttagta

32 DG_86 CTAGCTTACTGTGCTCACAG Lies 200 bp before MPH1 ATG start codon use with DG_87 to check for MPH1 deletion

DG_87 GCCTATGCAATCTCTCTACC Internal of MPH1 (1.5 kb past start ATG); use with DG_86 to make a 1,750 bp band)

KL015-HPHorf+751-Anti gccgtcaaccaagctctg hph (hygromycin resistance) gene; antisense orientation; +751 within ORF, Tm 56.6C

MFA_24_msh2_mixed_oligo AGGCTCTTTAAATGTTGACAC FWD primer to delete MSH2 with TCTACTCCAATATCAACTGgct any MX cassette. R tgccttgtccccgccgggtcac

MFA_24_msh2_rev GAACACTTTTAGGGATTATG MSH2 reverse primer to delete AATAAACTGTACCTTGTCTAg gene with any MX cassette. acactggatggcggcgttagta

DG_25 TCGAACCATGTGTCTTCTTCT Sense, upstream of msh2 ORF G DG_26 CTGTCGACAACTCAATGTACT antisense TC within msh2 ORF DG_286 TTAGCAGTTTTCGGTGTTTAG forward mixed oligo to delete mlh1 TAATCGCGCTAGCATGCTAG with any MX cassette GACAATTTAACTGCgcttgccttgtc cccgccgggtcac DG_287 GATGAATCGTTAAAGGAAAG reverse mixed oligo to delete mlh1 GGCATACACTTTCAAATGAA with any MX cassette ACACAATCACACTCAGGgacac tggatggcggcgttagta mlh1p1 TTTTGAGACCGCTTGCTGTT Mlh1p1 begins 173 nt upstream of MLH1 ORF, sense. DG_289 CCAACATCTTACCTTCTGCA reverse primer lies 400 bp inside of mlh1 ORF. Use with DG_288 to screen for mlh1 KO (makes 710 bp band in WT) KL067- NATMX6 +313bp TGTTCGGATGTGATGTGAGA Reverse, 313bp after start within Antisense AC NATMX6

RA_295 URA3 for ATGTCGAAAGCTACATATAA Forward primer at the start of the GGAACGTGCT URA ORF

MFA25_rev_TRP_20plus CAAACTTTCACCAATGGACC Reverse TRP primer, used to AGAACTACCT determiner CO outcomes with RA_295 MFA26_rev_LEU TTTAAGAACCTTAATGGCTTC Reverse Leu primer, used to GGCTGTGAT determiner LEU outcomes with RA_295

Repair Assay

Colonies were streaked onto YEPD plates and grown to singles for two days. Single colonies of similar sizes were diluted 10^4 fold and plated onto YEPD and YEP-Gal plates.

After 3-4 days, colonies were counted to determine viability (YEP-Gal/YEPD plates). YEP-Gal plates were replica plated onto URA, LEU, and TRP to determine repair outcome.

Phenotypically, gene conversion (GC) events are URA3+ TRP+ and LEU+ and Break Induced

Replication events (BIR) are URA-, TRP-, LEU+ (Figure 19). Since CO and NHEJ events have the same phenotype, PCR was performed to confirm the repair outcome. URA-, LEU+, and

TRP+ colonies that amplify with a forward URA primer and the reverse LEU primer are considered crossover events (Figure 19). If they amplify instead with a reverse TRP primer, they are scored as NHEJ events. Statistical significance was determined by using a t-Test, assuming unequal variances.

Figure 19. Diagram of yRA97 and Phenotypes Associated with Repair Outcomes

8. Results

Mph1 deletion reduced viability in yRA97 (Figure 20). Since all the homologous repair outcomes possible in this strain require extension of D-loop, which is facilitated in part by Mph1, this result is consistent with known functions of Mph1 (Mehta et al., 2017).

Viability 60.0 *

50.0

40.0

30.0

48.7 20.0 39.9

10.0

0.0 yRA97 yMFA200 (yRA97 mph1::HYG)

Figure 20. Viability between yRA97 and yMFA200 (yRA97 mph1::HYG)

Viability decreases from approximately 50% to 40% with Mph1 deletion. (p= 0.024).

When looking at the repair outcomes, I noticed a significant increase in the number of

BIR events and significant decrease in the number of gene conversion events with Mph1

36 deletion. This is consistent with the theory that BIR and GC events are in competition with each other when there is 300 bp homology and that Mph1 directs repair towards gene conversion

(Mehta et al., 2017). I found too that the number of CO events also increase significantly with

Mph1 deletion, which is consistent with the idea that Mph1 is involved in dismantling D-loops.

Repair Frequency 100.0 90.0 80.0 70.0 87.2 60.0 BIR 50.0 98.7 CO 40.0 GC 30.0 Repair Frequenxy (%) 20.0 10.0 6.40 6.5 1.04 0.3 0.0 yRA97 yMFA200 (yRA97 mph1::HYG)

Figure 21. Repair Frequency between yRA97 and yMFA200 (yRA97 mph1::HYG)

There is a significant increase in both BIR and CO events with Mph1 deletion (p= 1.31E- 05 for BIR and p= 1.71E-06 for CO). There is also significant decrease in Gene Conversion events (p=1.25E-09).

Since crossover outcomes are phenotypically like that of NHEJ events, I also investigated CO outcomes in a strain in which Dnl4, a protein necessary for NHEJ, was deleted. I find that while CO outcomes are decreased with Dnl4 deletion compared to the yMFA200 strain, there is still a significant increase in CO from the WT strain (Figure 22). Moreover, PCR analysis of 17 colonies from yMFA200 strains that where phenotypically both CO and NHEJ events, showed that only 5 out 17 colonies (29%) were NHEJ and the rest were CO events (71%). This confirms

37 that the phenotypically determined CO events in yMFA200 are indeed mostly CO events and that Mph1 promotes non-crossovers outcomes (GC & BIR) through dismantling of D-loops

(Prakash et al., 2009; Metha et al. 2017).

Crossovers Outcomes in YRA97, yMFA200, and yMFA201 8.00

7.00

6.00

5.00

4.00

3.00

Repari Frequency (%) 2.00

1.00

0.00 yRA97 yMFA200 (mph1::HYG) yMFA201 (mph1::HYG; lig4:NAT)

Figure 22. Crossover Outcomes in yRA97, yMFA200, and yMFA201

Crossover outcomes increase significantly in both yMFA200 and yMFA201 strains (p= 1.71E-06F for yMFA200 and p = 6.93E-06 for yMFA201 when compared to yRA97)

Next, I explored how repair frequency changes when there are mismatches between the template and donor sequence. To do this I used yRA99 which is a derivative of the yRA97 strain and has the A3 locus replaced with the A3 region of Kluyveromyces lactis (Figure 23). As expected, viability decreases significantly with decreased homology (Figure 24). Next, I found that when there are mismatches in the template sequence the repair shifts to BIR (Figure 25).

38 This is likely due to the lack of homology on the right side of the break which is necessary to complete GC (Anand et al., 2014).

Figure 23. Diagram of yRA99

Viability between yRA97 and yRA99 100.0

90.0

80.0

70.0

60.0

50.0

40.0

30.0 48.7 20.0

10.0 18.7

0.0 yRA97 yRA99

Figure 24. Viability Between yRA97 and yRA99

Viability decreases by four-fold when the S. cerevisiae A3 fragment is replaced with K. lactis A3 fragment. (p = 2.12E-07)

39 Repair Frequency between yRA97 and yRA99 98.7 100.00 95.12

90.00

80.00

70.00

60.00 BIR 50.00 CO or NHEJ 40.00 GC

30.00

20.00

10.00 3.7 1.04 0.3 1.2 0.00 yRA97 yRA99

Figure 25. Repair Frequency Between yRA97 and yRA99

The preferred mode of repair in yRA97 strain is GC, whereas the preferred mode of repair in yRA99 is BIR. There is significant change in all three repair outcomes, except for COs (p= 5.55E-16 for BIR; p= 0.16 for CO, p= 3.19E-20 for GC).

To better understand the increase in BIR in yRA99 strain, I deleted MPH1 and found that

unlike its effect in yRA97, mph1 deletion does not change repair frequency in yRA99 (Figure

26). However, I find that when I compare to mph1 deletion between in yRA97 and yRA99, BIR increases significantly (Figure 28). This suggest that maybe Mph1 coordinates with mismatch repair proteins to promote BIR events. To figure out if this is the case, I deleted msh2 in both yRA97 and yRA99, and find that msh2 deletion increases BIR to similar levels as those seen in the mph1 deleted strains (Figure 28). Moreover, viability results for mph1 deletion and msh2 deletion are also similar, suggesting that these two proteins act in the same pathway to prevent

BIR (Figure 27).

Repair Frequencey after mph1 Deletion in yRA99 100.0

90.0 95.1 95.1

80.0

70.0

60.0

50.0

40.0 Reoair Frequency(%) 30.0

20.0 3.7 3.1 10.0 1.2 1.8

0.0 BIR CO or NHEJ GC

yRA99 WT yRA99 mph1::HYG

Figure 26. Repair Frequency in yRA99 after mph1 deletion

Mph1 deletion does not change repair frequency in yRA99.

41 Viability with mph1 Deletion in yRA97 and yRA99 100.0 90.0 80.0 70.0 60.0 50.0 39.87 40.0 Viability (%) 30.0 19.1 20.0 10.0 0.0 97 mph1::HYG 99 mph1::HYG

Viability with msh2 deletion in yRA97 and yRA99 100.0 90.0 80.0 70.0 60.0 50.0 42.18 40.0 Viability (%) 30.0 16.66 20.0 10.0 0.0 yRA97 msh2::NAT yRA99 msh2::HYG

Figure 27. Viability with mph1 and msh2 Deletion in yRA97 and yRA99

Msh2 and mph1 deletion have a similar effect on viability in yRA99 and yRA97 strains.

42 Repair frequncy with mph1 Deletion in yRA97 and yRA99 100.0 95.12

90.0 87.24

80.0

70.0

60.0

50.0

40.0

30.0 Repair Frequency (%) 20.0

10.0 6.40 6.54 1.82 3.06 0.0 BIR CO or NHEJ GC

97 mph1::HYG 99 mph1::HYG

Repair Frequency with msh2 deletion in yRA97 and yRA99 98.96 100.0 96.04

90.0

80.0

70.0

60.0

50.0

40.0

Repair Frequency(%) 30.0

20.0

10.0 1.04 0.00 1.69 2.27 0.0 BIR CO or NHEJ GC

yRA97 msh2::NAT yRA99 msh2::NAT

Figure 28. Repair Frequency with mph1and msh2 Deletion in yRA97 and yRA99

Single mph1 and msh2 deletion increases BIR significantly in yRA99 compared to yRA97 and has the opposite effect on GC events.

43 9. Conclusion and Future Direction

In the second half of this project, I explored the function of the helicase Mph1 in directing repair outcomes. I show that when there are 300 base pairs of homology between donor and template strands, Mph1 favors gene conversion outcome and in its absence, crossover outcomes increase. This is consistent with the idea that Mph1 promotes non-crossover outcomes by dismantling D-loops (Mehta et al., 2017; Prakash et al., 2009). Furthermore, I show that there are mismatches in the template sequence the repair shifts to BIR and this effect is unlikely due to

Mph1 and Msh2. To better understand the role of Mph1 and Msh2 in directing repair outcomes, I created strains in which both mph1 and msh2 are deleted for both the yRA97 and yRA99 strain. I also created strains in which both Mph1 and Mlh1 are deleted in these strains. However, due to time constraints, I have not been able to perform a repair analysis with these strains. Further studies should use these strains to explore how Mph1 in conjunction with mismatch repair proteins directs repair outcomes.

44 10. Bibliography

Amberg, D.C., 2005. Methods in yeast genetics : a Cold Spring Harbor Laboratory course manual, 2005 ed. ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Anand, R.P., Tsaponina, O., Greenwell, P.W., Lee, C.-S., Du, W., Petes, T.D., Haber, J.E., 2014. Chromosome rearrangements via template switching between diverged repeated sequences. Genes Dev. 28, 2394–2406. https://doi.org/10.1101/gad.250258.114 Bernstein, K.A., Shor, E., Sunjevaric, I., Fumasoni, M., Burgess, R.C., Foiani, M., Branzei, D., Rothstein, R., 2009. Sgs1 function in the repair of DNA replication intermediates is separable from its role in homologous recombinational repair. EMBO J. 28, 915–925. https://doi.org/10.1038/emboj.2009.28 Bhargava, R., Onyango, D.O., Stark, J.M., 2016. Regulation of Single-Strand Annealing and its Role in Genome Maintenance. Trends Genet. 32, 566–575. https://doi.org/10.1016/j.tig.2016.06.007 Chakraborty, U., Alani, E., 2016. Understanding how mismatch repair proteins participate in the repair/anti-recombination decision. FEMS Yeast Res. 16. https://doi.org/10.1093/femsyr/fow071 Chang, H.H.Y., Pannunzio, N.R., Adachi, N., Lieber, M.R., 2017. Non-homologous DNA end joining and alternative pathways to double-strand break repair. Nat. Rev. Mol. Cell Biol. 18, 495–506. https://doi.org/10.1038/nrm.2017.48 Conconi, A., 2008. Yeast as a Model System to Study DNA Damage and DNA Repair, in: Sourcebook of Models for Biomedical Research. Humana Press, pp. 445–453. https://doi.org/10.1007/978-1-59745-285-4_47 Dherin, C., Gueneau, E., Francin, M., Nunez, M., Miron, S., Liberti, S.E., Rasmussen, L.J., Zinn- Justin, S., Gilquin, B., Charbonnier, J.-B., Boiteux, S., 2009. Characterization of a Highly Conserved Binding Site of Mlh1 Required for Exonuclease I-Dependent Mismatch Repair. Mol. Cell. Biol. 29, 907–918. https://doi.org/10.1128/MCB.00945-08 Duina, A.A., Miller, M.E., Keeney, J.B., 2014. Budding Yeast for Budding Geneticists: A Primer on the Saccharomyces cerevisiae Model System. Genetics 197, 33–48. https://doi.org/10.1534/genetics.114.163188 Frei, C., Gasser, S.M., 2000. The yeast Sgs1p helicase acts upstream of Rad53p in the DNA replication checkpoint and colocalizes with Rad53p in S-phase-specific foci. Genes Dev. 14, 81–96. Goldfarb, T., Alani, E., 2005. Distinct roles for the Saccharomyces cerevisiae mismatch repair proteins in heteroduplex rejection, mismatch repair and nonhomologous tail removal. Genetics 169, 563–574. https://doi.org/10.1534/genetics.104.035204 Iyama, T., Wilson, D.M., 2013. DNA repair mechanisms in dividing and non-dividing cells. DNA Repair 12, 620–636. https://doi.org/10.1016/j.dnarep.2013.04.015 Jain, S., Sugawara, N., Lydeard, J., Vaze, M., Tanguy Le Gac, N., Haber, J.E., 2009. A recombination execution checkpoint regulates the choice of homologous recombination pathway during DNA double-strand break repair. Genes Dev. 23, 291–303. https://doi.org/10.1101/gad.1751209 Li, X., Heyer, W.-D., 2008. Homologous recombination in DNA repair and DNA damage tolerance. Cell Res. 18, 99–113. https://doi.org/10.1038/cr.2008.1

45 Liddell, L., Manthey, G., Pannunzio, N., Bailis, A., 2011. Quantitation and analysis of the formation of HO-endonuclease stimulated chromosomal translocations by single-strand annealing in Saccharomyces cerevisiae. J. Vis. Exp. JoVE. https://doi.org/10.3791/3150 Lo, Y.-C., Paffett, K.S., Amit, O., Clikeman, J.A., Sterk, R., Brenneman, M.A., Nickoloff, J.A., 2006. Sgs1 Regulates Gene Conversion Tract Lengths and Crossovers Independently of Its Helicase Activity. Mol. Cell. Biol. 26, 4086–4094. https://doi.org/10.1128/MCB.00136-06 Lydeard, J.R., Lipkin-Moore, Z., Jain, S., Eapen, V.V., Haber, J.E., 2010. Sgs1 and Exo1 Redundantly Inhibit Break-Induced Replication and De Novo Telomere Addition at Broken Chromosome Ends. PLOS Genet. 6, e1000973. https://doi.org/10.1371/journal.pgen.1000973 Mehta, A., Beach, A., Haber, J.E., 2017. Homology Requirements and Competition between Gene Conversion and Break-Induced Replication during Double-Strand Break Repair. Mol. Cell 65, 515-526.e3. https://doi.org/10.1016/j.molcel.2016.12.003 Mehta, A., Haber, J.E., 2014. Sources of DNA Double-Strand Breaks and Models of Recombinational DNA Repair. Cold Spring Harb. Perspect. Biol. 6, a016428. https://doi.org/10.1101/cshperspect.a016428 Mohammadi, S., Saberidokht, B., Subramaniam, S., Grama, A., 2015. Scope and limitations of yeast as a model organism for studying human tissue-specific pathways. BMC Syst. Biol. 9. https://doi.org/10.1186/s12918-015-0253-0 Mullen, J.R., Kaliraman, V., Brill, S.J., 2000. Bipartite Structure of the SGS1 DNA Helicase in Saccharomyces cerevisiae. Genetics 154, 1101–1114. Myung, K., Datta, A., Chen, C., Kolodner, R.D., 2001. SGS1, the Saccharomyces cerevisiae homologue of BLM and WRN, suppresses genome instability and homeologous recombination. Nat. Genet. 27, 113–116. https://doi.org/10.1038/83673 Ouyang, K.J., Woo, L.L., Ellis, N.A., 2008. Homologous recombination and maintenance of genome integrity: Cancer and aging through the prism of human RecQ helicases. Mech. Ageing Dev., DNA damage, repair, ageing and age-related disease 129, 425–440. https://doi.org/10.1016/j.mad.2008.03.003 Pâques, F., Haber, J.E., 1999. Multiple Pathways of Recombination Induced by Double-Strand Breaks in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 63, 349–404. Prakash, R., Satory, D., Dray, E., Papusha, A., Scheller, J., Kramer, W., Krejci, L., Klein, H., Haber, J.E., Sung, P., Ira, G., 2009. Yeast Mph1 helicase dissociates Rad51-made D- loops: implications for crossover control in mitotic recombination. Genes Dev. 23, 67– 79. https://doi.org/10.1101/gad.1737809 Sugawara, N., Goldfarb, T., Studamire, B., Alani, E., Haber, J.E., 2004. Heteroduplex rejection during single-strand annealing requires Sgs1 helicase and mismatch repair proteins Msh2 and Msh6 but not Pms1. Proc. Natl. Acad. Sci. 101, 9315–9320. https://doi.org/10.1073/pnas.0305749101 Sugawara, N., Pâques, F., Colaiácovo, M., Haber, J.E., 1997. Role of Saccharomyces cerevisiae Msh2 and Msh3 repair proteins in double-strand break-induced recombination. Proc. Natl. Acad. Sci. 94, 9214–9219. https://doi.org/10.1073/pnas.94.17.9214 Symington, L.S., Gautier, J., 2011. Double-Strand Break End Resection and Repair Pathway Choice. Annu. Rev. Genet. 45, 247–271. https://doi.org/10.1146/annurev-genet-110410- 132435