Collapse of the Keratin Filament Network Through the Expression Of

15 March 2005

Use of Articles in the Pachyonychia Congenita Bibliography

The articles in the PC Bibliography may be restricted by copyright laws. These have been made available to you by PC Project for the exclusive use in teaching, scholarship or research regarding Pachyonychia Congenita.

To the best of our understanding, in supplying this material to you we have followed the guidelines of Sec 107 regarding fair use of copyright materials. That section reads as follows:

Sec. 107. - Limitations on exclusive rights: Fair use Notwithstanding the provisions of sections 106 and 106A, the fair use of a copyrighted work, including such use by reproduction in copies or phonorecords or by any other means specified by that section, for purposes such as criticism, comment, news reporting, teaching (including multiple copies for classroom use), scholarship, or research, is not an infringement of copyright. In determining whether the use made of a work in any particular case is a fair use the factors to be considered shall include - (1) the purpose and character of the use, including whether such use is of a commercial nature or is for nonprofit educational purposes; (2) the nature of the copyrighted work; (3) the amount and substantiality of the portion used in relation to the copyrighted work as a whole; and (4) the effect of the use upon the potential market for or value of the copyrighted work. The fact that a work is unpublished shall not itself bar a finding of fair use if such finding is made upon consideration of all the above factors.

We hope that making available the relevant information on Pachyonychia Congenita will be a means of furthering research to find effective therapies and a cure for PC.

2386 East Heritage Way, Suite B, Salt Lake City, Utah 84109 USA Phone +1-877-628-7300 • Email—[email protected] www.pachyonychia.org doi: 10.1111/1346-8138.12185 Journal of Dermatology 2013; 40: 553–557

CASE REPORT Collapse of the keratin ﬁlament network through the expression of mutant keratin 6c observed in a case of focal plantar keratoderma

Akiharu KUBO,1,2,* Yuiko OURA,1,* Takashige HIRANO,1,3 Yumi AOYAMA,4 Showbu SATO,1 Kaori NAKAMURA,5 Yujiro TAKAE,1 Masayuki AMAGAI1 1Department of Dermatology, 2Center for Integrated Medical Research, Keio University School of Medicine, Tokyo, 3Research Laboratories, Kyoto R&D Center, Maruho Co., Ltd, Kyoto, 4Department of Dermatology, Okayama University Graduate School of Medicine, Okayama, and 5Department of Dermatology, Saitama Medical Center, Saitama, Japan

ABSTRACT Focal palmoplantar keratoderma (PPK) with severe pain is a hallmark of pachyonychia congenita, a rare autosomal dominant disorder involving PPK and hypertrophic nail dystrophy. Some families present focal PPK with either minimal or no nail changes. Dominant-negative mutations in any of the four identified keratin genes, KRT6A, KRT6B, KRT16 or KRT17, lead to pachyonychia congenita. However, the majority of families with focal PPK showing minimal or no nail changes do not harbor mutations in these genes. Recently, mutations of KRT6C were identified in families with focal PPK alone. Here, we report a 26-year-old Japanese man with focal plantar hyperkeratosis that developed at approximately 10 years of age with no palmar involvement and no nail alterations. We identified a missense KRT6C mutation c.1414G>A resulting in an p.Glu472Lys substitution, as reported in other Japanese patients. When the mutant keratin 6c protein is exogenously expressed in human HaCaT cells, a collapse of the keratin filament network is observed in a dose-dependent manner, suggesting the mutation has a dominant-negative effect on keratin filament network formation. The mutated residue is located at the helix termination motif of keratin 6c. The peptide sequence around this residue is highly conserved among type II, III and IV intermediate filament proteins. Glu to Lys mutations of the equivalent residue have been reported in a variety of inherited diseases, including neurodegenerative diseases, corneal dystrophy and skin disorders, suggesting that this residue is vital to keratin function. Key words: intermediate filament proteins, keratin 6c, KRT6C, pachyonychia congenita, palmoplantar keratoderma.

INTRODUCTION families, KRT16 or KRT6C mutations have been reported.4–6 Here, we report a case of focal plantar keratoderma in a Palmoplantar keratoderma (PPK) is part of the phenotype of patient with a KRT6C mutation. We demonstrate the dominant- various inherited skin diseases.1,2 PPK is divided into several negative effect of the mutated keratin 6c protein on the keratin categories by its clinical phenotype, depending on the pattern ﬁlament network in vitro. of hyperkeratotic lesions (i.e. diffuse PPK, focal or striate PPK, and punctate PPK) and other complications. The palmoplantar CASE REPORT epidermis is a highly specialized epidermis designed to resist a high degree of mechanical stress. PPK patients characteristi- The proband, a 26-year-old Japanese man, presented with cally exhibit keratinocyte fragility, blistering in the epidermis thickened skin on the soles that had developed at approxi- and hypertrophy of the corniﬁed layer (hyperkeratosis). mately 10 years of age. His soles exhibited focal hyperkeratotic Focal PPK with severe pain is a characteristic feature of plaques (Fig. 1a), some of which were severely painful when pachyonychia congenita, a rare autosomal-dominant keratin walking. The palms were not involved and the nails of the disorder involving PPK and severe nail hypertrophy caused by hands and feet had a normal appearance (Fig. 1a). No oral the keratin genes KRT6A, KRT6B, KRT16 or KRT17.3 Focal leukokeratosis was observed. The proband had a family history PPK can also present with slight or no nail lesions. In these of plantar hyperkeratosis, suggesting autosomal dominant

Correspondence: Akiharu Kubo, M.D., Ph.D., Department of Dermatology, Keio University School of Medicine, 35 Shinanomachi, Shinjuku, Tokyo 160-8582, Japan. Email: [email protected] *These two authors contributed equally to this work. Received 29 July 2012; accepted 3 April 2013.

(a) (b) (c)

(d)

(e)

Figure 1. (a) Clinical images of the proband’s soles, palms and nails. (b) Family history. (c) Skin biopsy from the sole of the proband’s foot, displaying hyperkeratosis (hematoxylin–eosin, original magnification 9100). (d) Clinical image of the 8-year-old daugh- ter’s soles shows slight focal hyperkeratosis (arrows). (e) Sequencing of exon 7 of KRT6C reveals the presence of a heterozygous c.1414G>A (p.Glu472Lys) mutation in the patients. inheritance (Fig. 1b). Severe hyperkeratosis and some hetero- mutational analyses using genomic DNA prepared from the geneity in the eosin staining of the keratinocyte cytoplasm peripheral blood leukocytes of the proband and two of his chil- were observed in the biopsy specimen of the hyperkeratotic dren (8 and 9 years old) using a method described previously.5 sole of the proband (Fig. 1c). One of his children, who was Direct sequencing revealed a heterozygous c.1414G>A muta- 8 years old, had slight focal hyperkeratosis on her soles, which tion in exon 7 of KRT6C, which is a recurrent mutation that was first observed when aged 5 and recently became painful results in a glutamic acid (Glu) to lysine (Lys) mutation at posi- (Fig. 1d). The nails of her hands and feet together with her tion 472 of the keratin 6c protein (p.Glu472Lys),6 in both the palms were not involved, as was the case for the proband. proband and the affected child (Fig. 1e). Other affected individuals in this family refused to be exam- To confirm the phenotype of this mutation, we investigated ined. As in-frame deletions and missense mutations of KRT6C its effects on keratin filament organization in vitro. We obtained have been identified in families with focal PPK with slight or no cDNA of human keratin 6c from an I.M.A.G.E/MGC Clone nail changes,5,6 we obtained informed consent and performed (clone ID: 10146614) and introduced the c.1414G>A mutation

via QuickChange II (Stratagene, La Jolla, CA, USA) using N-terminally Myc-tagged wild-type and mutant keratin 6c pro- the following primers: GCAAGCTGCTGGAGGGCAAGGAGTG teins as described previously.7 HaCaT cells were transfected CAGGCTGAATGG and CCATTCAGCCTGCACTCCTTGCCCTC with these expression vectors using Lipofectamine 2000 (Invitro- CAGCAGCTTGC. We constructed expression vectors of gen, Carlsbad, CA, USA).8 Twenty-four hours post-transfection,

(a)

(b)

(c)

(d)

Figure 2. Immunoﬂuorescent images of HaCaT cells expressing Myc-tagged wild-type (WT) keratin 6c (a) or Myc-tagged mutant (MT) keratin 6c (b,c). The left panel shows nuclei (blue), Myc (red) and keratin 14 (green). The middle and right panels show keratin 14 and Myc, respectively. The expression level of the mutant protein varied from low (arrows) to high (arrowheads), and was occa- sionally extremely high (open arrowheads). Scale bars = 10 lm. (d) Percentage of cells expressing low or high levels of WT or MT keratin 6c that exhibit a collapsed keratin ﬁlament network.

Table 1. Amino acid sequence of the conserved domain at the helix termination motif of the intermediate ﬁlament proteins and reported Glu-Lys mutations of the equivalent residue

Amino acid sequence and Gene Chromosome Disease Mutation location† KRT1 12 Epidermolytic hyperkeratosis p.Glu489Lys10 p.478–490 EIATYRTLLEGEE KRT2 12 Ichthyosis bullosa of Siemens p.Glu487Lys11 p.476–488 EIATYRKLLEGEE KRT3 12 Corneal dystrophy, Meesmann p.Glu509Lys18 p.498–510 EIATYRKLLEGEE KRT5 12 Epidermolysis bullosa simplex p.Glu477Lys12 p.466–478 EIATYRKLLEGEE KRT6A 12 Pachyonychia congenita p.Glu472Lys15 p.461–473 EIATYRKLLEGEE KRT6B 12 Pachyonychia congenita p.Glu472Lys14 p.461–473 EIATYRKLLEGEE KRT6C 12 Focal plantar hyperkeratosis p.Glu472Lys6,* p.461–473 EIATYRKLLEGEE KRT14 17 Epidermolysis bullosa simplex p.Glu422Lys13 p.411–423 EIATYRRLLEGED KRT81 12 Monilethrix p.Glu413Lys17 p.402–414 EIATYRRLLEGEE KRT86 12 Monilethrix p.Glu413Lys16,17 p.402–414 EIATYRRLLEGEE GFAP 17 Alexander disease p.Glu373Lys19 p.362–374 EIATYRKLLEGEE NEFL 8 Charcot–Marie–Tooth disease p.Glu396Lys20 p.385–397 EIAAYRKLLEGEE

*Mutation observed in this study. †Each equivalent residue is shown in bold italic. cells were fixed with 4% paraformaldehyde and permeabilized as epidermolytic hyperkeratosis (KRT1 mutation),10 ichthyosis using 0.1% Triton X-100 in phosphate-buffered saline. The bullosa of Siemens (KRT2 mutations),11 epidermolysis bullosa cells were labeled with anti-Myc rabbit polyclonal antibody (KRT5 or KRT14 mutations),12,13 pachyonychia congenita (MBL, Nagoya, Japan) and anti-keratin 14 mouse monoclonal (KRT6A or KRT6B mutations)14,15 and monilethrix (KRT81 or antibody (clone LL002; Abcam, Cambridge, UK), and stained KRT86 mutations),16,17 as well as diseases that affect other with Alexa 488-conjugated goat anti-mouse immunoglobulin organs, such as Meesmann corneal dystrophy (KRT3 muta- (Ig)G antibody and Alexa 568-conjugated goat anti-rabbit IgG tions),18 Alexander disease (GFAP mutations)19 and Charcot– antibody (Invitrogen). The cells were mounted using Mowiol Marie–Tooth disease (NEFL mutations).20 These mutations dis- (Calbiochem, San Diego, CA, USA) and imaged using a Leica play autosomal dominant inheritance, suggesting that they TCS SP5 confocal microscope equipped with a 963 objective. have a dominant-negative effect on the formation of interme- Images (0.5-lm optical slices) were Z-stacked and merged diate filaments. using the ImageJ software. The images were processed using To confirm the phenotype of the p.Glu472Lys mutation, we Adobe Photoshop CS4. Wild-type keratin 6c-expressing cells expressed the mutant protein in HaCaT cells. Overexpression exhibited no alterations in the keratin filament network when of wild-type keratin 6c led to no apparent change of the kera- keratin 14 staining was assessed (Fig. 2a). When mutant keratin filament network visualized through keratin 14 staining. In tin 6c was transfected, cells expressing low levels of mutated contrast, overexpression of p.Glu472Lys keratin 6c induced a protein exhibited no alterations in the keratin filament network dose-dependent collapse of the keratin filament network and (arrows in Fig. 2b), whereas cells expressing high levels dis- the formation of large aggregates containing keratin 14 and played a collapsed network of keratin filaments (arrowheads mutant keratin 6c. In other intermediate filament diseases, a and open arrowheads in Fig. 2b,c). We semiquantified the similar phenotype is apparent upon expression of the mutated expression level of exogenously expressed keratin 6c using the proteins. In this patient, hyperkeratosis was limited to the ImageJ software by measuring the intensity of the Myc-tag weight-bearing area of the sole, suggesting that mutant kera- immunofluorescence signals in the Z-stacked images obtained tin 6c is expressed only in this hyperkeratotic area. The area by confocal microscopy under uniform imaging conditions. The is continually subjected to mechanical stress, suggesting that transfected cells were divided into Myclow and Mychigh cells, the expression of keratin 6c is primarily limited to the weight- which confirmed that the collapse of the keratin filament net- bearing area of the sole in normal (unaffected) individuals and work occurred in a manner dependent on the level of expres- is induced by repeated physical stimuli on the keratinocytes sion of mutant keratin 6c (Fig. 2d). of the palmoplantar lesion. In terms of keratin 6a and 6b, KRT6A and KRT6B mRNA are found in the epidermis DISCUSSION throughout the body but are not translated into protein, with the exception of palmar and plantar skin by a possible The p.Glu472Lys mutation resides at the helix termination post-transcriptional regulating mechanism.21,22 Clarifying the motif of keratin 6c. The sequence around this residue is highly mechanism of how keratin 6c expression is controlled (i.e. conserved among type II, III and IV intermediate filament pro- analysis of the transcriptional regulatory domain of KRT6C or teins, and Glu to Lys mutations of the equivalent residue have the post-transcriptional regulatory mechanism of its expres- been reported in a variety of inherited diseases caused by sion and their possible response to physical stimuli on the genomic mutations of the intermediate filament proteins keratinocytes) will improve our understanding of how focal (Table 1).1,9 These diseases include diseases of the skin, such PPK develops.

ACKNOWLEDGMENTS 10 Chassaing N, Kanitakis J, Sportich S et al. Generalized epidermolytic hyperkeratosis in two unrelated children from parents with local- We thank Hiromi Sakuragi for technical support. This work was ized linear form, and prenatal diagnosis. J Invest Dermatol 2006; supported by the “Promotion of Environmental Improvement 126: 2715–2717. 11 Rothnagel JA, Traupe H, Wojcik S et al. Mutations in the rod for Independence of Young Researchers” program of the Min- domain of keratin 2e in patients with ichthyosis bullosa of Siemens. istry of Education, Culture, Sports, Science and Technology of Nat Genet 1994; 7: 485–490. Japan. 12 Stephens K, Ehrlich P, Weaver M et al. Primers for exon-specific amplification of the KRT5 gene: identification of novel and recurrent mutations in epidermolysis bullosa simplex patients. J Invest Derma- CONFLICTS OF INTEREST tol 1997; 108: 349–353. 13 Hut PH, v d Vlies P, Jonkman MF et al. Exempting homologous None. pseudogene sequences from polymerase chain reaction amplification allows genomic keratin 14 hotspot mutation analysis. J Invest Dermatol 2000; 114: 616–619. REFERENCES 14 Smith FJ, Jonkman MF, van Goor H et al. A mutation in human keratin K6b produces a phenocopy of the K17 disorder pachyonychia 1 Omary MB, Coulombe PA, McLean WHI. Intermediate filament pro- congenita type 2. Hum Mol Genet 1998; 7: 1143–1148. – teins and their associated diseases. N Engl J Med 2004; 351: 2087 15 Terrinoni A, Smith FJ, Didona B et al. Novel and recurrent mutations 2100. in the genes encoding keratins K6a, K16 and K17 in 13 cases of 2 Petrof G, Mellerio JE, McGrath JA. Desmosomal genodermatoses. pachyonychia congenita. J Invest Dermatol 2001; 117: 1391–1396. – Br J Dermatol 2012; 166:36 45. 16 Winter H, Rogers MA, Gebhardt M et al. A new mutation in the type 3 McLean WHI, Hansen CD, Eliason MJ et al. The phenotypic and II hair cortex keratin hHb1 involved in the inherited hair disorder mo- molecular genetic features of pachyonychia congenita. J Invest Der- nilethrix. Hum Genet 1997; 101: 165–169. – matol 2011; 131: 1015 1017. 17 Korge BP, Hamm H, Jury CS et al. Identification of novel mutations 4 Shamsher MK, Navsaria HA, Stevens HP et al. Novel mutations in in basic hair keratins hHb1 and hHb6 in monilethrix: implications for keratin 16 gene underly focal non-epidermolytic palmoplantar kera- protein structure and clinical phenotype. J Invest Dermatol 1999; – toderma (NEPPK) in two families. Hum Mol Genet 1995; 4: 1875 113: 607–612. 1881. 18 Irvine AD, Corden LD, Swensson O et al. Mutations in cornea-spe- 5 Wilson NJ, Messenger AG, Leachman SA et al. Keratin K6c muta- cific keratin K3 or K12 genes cause Meesmann’s corneal dystrophy. tions cause focal palmoplantar keratoderma. J Invest Dermatol Nat Genet 1997; 16: 184–187. – 2010; 130: 425 429. 19 Gorospe JR, Naidu S, Johnson AB et al. Molecular findings in 6 Akasaka E, Nakano H, Nakano A et al. Diffuse and focal palmoplan- symptomatic and pre-symptomatic Alexander disease patients. tar keratoderma can be caused by a keratin 6c mutation. Br J Der- Neurology 2002; 58: 1494–1500. – matol 2011; 165: 1290 1292. 20 Fabrizi GM, Cavallaro T, Angiari C et al. Charcot-Marie-Tooth dis- 7 Gu L-H, Coulombe PA. Defining the properties of the nonhelical tail ease type 2E, a disorder of the cytoskeleton. Brain 2007; 130: 394– domain in type II keratin 5: insight from a bullous disease-causing 403. – mutation. Mol Biol Cell 2005; 16: 1427 1438. 21 Tyner AL, Fuchs E. Evidence for posttranscriptional regulation of the 8 Deyrieux AF, Wilson VG. In vitro culture conditions to study kerati- keratins expressed during hyperproliferation and malignant transfor- nocyte differentiation using the HaCaT cell line. Cytotechnology mation in human epidermis. J Cell Biol 1986; 103: 1945–1955. – 2007; 54:77 83. 22 Takahashi K, Paladini RD, Coulombe PA. Cloning and characteriza- 9 Szeverenyi I, Cassidy AJ, Chung CW et al. The human intermediate tion of multiple human genes and cDNAs encoding highly related filament database: comprehensive information on a gene family type II keratin 6 isoforms. J Biol Chem 1995; 270: 18581–18592. involved in many human diseases. Hum Mutat 2008; 29: 351–360.