Trp53 Regulates Notch 4 Signaling Through Mdm2

Research Article 1067 Trp53 regulates Notch 4 signaling through Mdm2

Youping Sun1, Malgorzata Klauzinska2, Robert J. Lake1,3, Joseph M. Lee2, Stefania Santopietro2, Ahmed Raafat2, David Salomon2, Robert Callahan2,* and Spyros Artavanis-Tsakonas1,4,5,* 1Department of Cell Biology, Harvard Medical School, 240 Longwood Avenue, Boston, MA 02115, USA 2Mammary Biology and Tumorigenesis Laboratory, Center for Cancer Research, National Institutes of Health, Building 37/Room 1118A, 37 Convent Drive, Bethesda, MD 20892, USA 3Department of Biochemistry and Biophysics, University of Pennsylvania Medical School, Philadelphia, PA 19104, USA 4Collège de France, 11 Place Marcelin Berthelot, 75231 Paris Cedex 05, France 5Institut Curie, 75248, Paris, France *Authors for correspondence ([email protected]; [email protected])

Summary Notch receptors and their ligands have crucial roles in development and tumorigenesis. We present evidence demonstrating the existence of an antagonistic relationship between Notch 4 and Trp53, which is controlled by the Mdm2-dependent ubiquitylation and degradation of the Notch receptor. We show that this signal-controlling mechanism is mediated by physical interactions between Mdm2 and Notch 4 and suggest the existence of a trimeric complex between Trp53, Notch 4 and Mdm2, which ultimately regulates Notch activity. Functional studies indicate that Trp53 can suppress NICD4-induced anchorage-independent growth in mammary epithelial cells and present evidence showing that Trp53 has a pivotal role in the suppression of Notch-associated tumorigenesis in the mammary gland.

Key words: Trp53, Mdm2, Notch, Ubiquitylation, Tumorigenesis

Introduction Notch receptor have been shown to be oncogenic both in vitro and The Notch locus encodes a transmembrane receptor that is the in vivo (Robbins et al., 1992; Smith et al., 1995; Talora et al., central element of an evolutionarily conserved signaling pathway 2008). Importantly, activating mutations in Notch1 have been controlling a broad spectrum of cell-fate decisions during metazoan linked in humans to almost 50% of all cases of T-cell acute development. Signals through the Notch receptor couple cell-fate lymphoblastic leukemia (T-ALL) (Weng et al., 2004). Although

Journal of Cell Science acquisition of an individual cell to the cell-fate choices made by the Notch receptor can behave as an oncogene, it is becoming its immediate neighbors (Artavanis-Tsakonas et al., 1999) affecting increasingly clear that the Notch pathway can have a very proliferation, differentiation and apoptotic decisions in significant role in oncogenesis via the synergy between Notch development. Abnormal Notch signaling has profound signals and other cellular elements, which, in a context-dependent consequences for normal development in metazoans and increasing manner, can create the conditions favoring tumor development evidence links the Notch signaling pathway with pathogenic (Fre et al., 2009; Kiaris et al., 2004). How Notch integrates its conditions such as cancer (Callahan and Egan, 2004; Ellisen et al., action with other cellular elements is of fundamental interest, both 1991; Fre et al., 2009; Jhappan et al., 1992; Kiaris et al., 2004). to understand the role of the pathway in development as well as to Our current mechanistic understanding of Notch signaling has gain insights into its pathogenic action. the Notch receptor on the surface of one cell, interacting with Several studies associated the Notch receptor and, indeed, membrane-bound ligands on the surface of a neighboring cell, differential Notch receptor paralog action, with the major tumor triggering a cascade of proteolytic events that eventually cleave suppressor transformation-related protein 53 (henceforth we refer the entire intracellular domain of the receptor. The intracellular to the mouse gene as Trp53 and to the human counterpart as domain carries nuclear localization signals (Kopan et al., 1996; TP53), which is somatically mutated in almost half of all human Stifani et al., 1992) and translocates into the nucleus, where it cancers (Vogelstein et al., 2000). The levels of the Trp53 protein, directly participates in a transcriptional complex, which drives which under normal circumstances are very low, are regulated by Notch-dependent transcription. The complexity of the genetic E3 ubiquitin-protein ligase Mdm2-dependent ubiquitylation (Fang circuitry controlling Notch signals is very high, and invariably the et al., 2000; Haupt et al., 1997; Honda and Yasuda, 2000), which developmental outcome of modulating the activity of the Notch in turn is affected by an autoregulatory loop that directly targets pathway depends on the cellular context (Hurlbut et al., 2009; expression of the Mdm2 gene by Trp53 (Gottlieb and Oren, 1996; Hurlbut et al., 2007; Kankel et al., 2007). Picksley and Lane, 1993). Mammals contain four Notch receptor paralogs: Notch 1, Notch In spite of the significant number of studies linking Notch and 2, Notch 3 and Notch 4, all of which have been associated with Trp53, the underlying molecular basis remains unclear (Beverly et tumorigenic events (Allenspach et al., 2002; Callahan and Egan, al., 2005; Kim et al., 2007; Mao et al., 2004). Here, we examine 2004; Capobianco et al., 1997; Kiaris et al., 2004). Notch can the antagonistic relationship between Trp53 and Notch4, a Notch behave as a bona fide oncogene. For instance, somatic or viral- receptor paralog shown to be highly tumorigenic in the mouse induced mutations that result in the constitutive activation of the mammary epithelium (Jhappan et al., 1992). We find that Trp53 1068 Journal of Cell Science 124 (7)

directly affects Notch signaling through the Mdm2-dependent Notch 4 levels were increased when compared with Trp53+/+ ubiquitylation of the receptor and present evidence indicating that controls (Mao et al., 2004). this relationship is important for the oncogenic activity of Notch To examine further the relationship between Notch 4 and Trp53, both in cell culture and in mammary tumors. co-expression experiments were carried out in 293T/17 cells, which can be readily transfected. As shown in Fig. 1B, when either Results FLAG-tagged Trp53 or a V5-tagged NICD4, was individually Trp53 influences the levels of the Notch 4 protein expressed, each of these proteins accumulated to readily detectable To probe the relationship between Notch 4 and Trp53, we compared levels (Fig. 1B, lanes 2 and 3, respectively). However, when both either endogenous or exogenously delivered Notch 4 intracellular Trp53 and NICD4 were simultaneously expressed, the detectable domain (NICD4) steady state protein levels. Several different cell levels of the NICD4 protein were substantially reduced (Fig. 1B, lines, which have been well characterized and have mutant or lane 4 vs lane 2) whereas levels of Trp53 remained the same (Fig. wild-type TP53 genetic backgrounds, were used to test the 1B, lane 4 vs lane 3), suggesting that Trp53 is associated with the generality of our observations. We first compared the endogenous reduction of NICD4 protein levels. NICD4 levels in TP53-deficient HCT116 human colon carcinoma To examine whether the observed Trp53-dependent reduction of cells, which were generated by targeted disruption of both TP53 the endogenous NICD4 protein levels in the HCT116 cells reflected alleles (Bunz et al., 1998), with those in the parental TP53 wild- transcriptional control, we compared levels of mRNA encoding type HCT116 cells. We found that the level of NICD4 was 20-fold NICD4 in the HCT116 parent cells versus TP53-null HCT116 higher in HCT116 TP53-null cells (Fig. 1A, lane 2) compared with cells, using qRT-PCR and found no significant differences (P>0.05, the parental HCT116 cells (Fig. 1A, lane 1). This is consistent with Fig. 1C). This observation indicated that the striking differences in the notion that Trp53 antagonizes the expression of NICD4 and NICD4 protein levels associated with the downregulation of Trp53 corroborates observations involving mouse embryonic fibroblasts did not reflect Trp53-mediated transcriptional control. (MEFs) lacking Trp53 activity (Trp53–/–), where it was shown that NICD4 is a target of the Mdm2 E3 ligase Given that the level and, consequently, the activity of Trp53 are controlled largely by the E3-ubiquitin ligase Mdm2 (Geyer et al., 2000) and, conversely, that Mdm2 is a transcriptional target of Trp53 (Haupt et al., 1997; Honda and Yasuda, 2000), we reasoned that the effect of Trp53 on NICD4 could be possibly influenced by Mdm2. We first examined MDM2 mRNA and protein expression in HCT116 cells and found, as expected (Haupt et al., 1997; Honda and Yasuda, 2000), that both were significantly lower in the HCT116 TP53-null cells compared with levels in the parental cells (Fig. 1D and data not shown). Consistent with the observations involving the HCT116 cells, a comparison of endogenous NICD4

Journal of Cell Science protein levels in MEFs lacking Trp53 or lacking both Trp53 and Mdm2 revealed that the steady-state level of NICD4 in MEFs null for both Trp53 and Mdm2 was increased relative to MEFs null for Trp53 alone by approximately threefold (Fig. 2A,B). Since the Mdm2 E3 ligase activity depends on its RING domain (Fang et al., 2000; Honda and Yasuda, 2000), we investigated whether the observed differences in NICD4 expression levels could be directly linked to the ligase activity of Mdm2, by transfecting 293T/17 cells with either a transgene carrying a wild-type copy of Mdm2 or a mutant form lacking the RING domain (Mdm2 DR). Fig. 2C summarizes these results. The expression levels of HA-tagged NICD4 were reduced when co-expressed with wild-type Mdm2 (Fig. 2C, lane 2 vs lane 3), whereas they were essentially unaffected when co-expressed with Mdm2 DR (Fig. 2C, lane 2 vs lane 4). Fig. 1. Trp53 antagonizes NICD4 steady-state protein levels. (A)Lysates This analysis was extended by transfecting a plasmid encoding from HCT116 TP53 wild-type cells (lane 1) and HCT116 TP53-null cells wild-type Mdm2 into the MEFs null for both Trp53 and Mdm2, (lane 2) were analyzed for NICD4 protein levels by western blot using an anti- which displayed high NICD4 levels (see above), and resulted in Notch-4 antibody and an anti-a-tubulin antibody (loading control). (B)Effects the significant reduction of NICD4 (Fig. 2D, lane 2) protein levels of Trp53 on NICD4 levels in transfected 293T/17 cells. Western blot analysis compared with control cells (Fig. 2D, lane 1). Furthermore, when of lysates from 293T/17 cells mock transfected (lane 1) or transfected with H1299 cells, which endogenously express Notch 4 but do not V5–NICD4 (lane 2), FLAG–Trp53 (lane 3) or both expression vectors (lane express Trp53 protein were treated with shRNA targeting MDM2, 4). Relative transfection efficiencies were monitored by co-transfection with a NICD4 levels increased (Fig. 2E, lane 2) above levels in the plasmid encoding GFP (lanes 2–4). (C)Relative NICD4 RNA levels in HCT116 TP53 wild-type cells and HCT116 TP53-null cells were examined by control (Fig. 2E, lane 1). Finally, to further probe the dependence qRT-PCR. Shown are NICD4 RNA levels normalized to HPRT (hypoxanthine of NICD4 levels on Mdm2, a series of H1299 cells were transfected phophoribosyltransferase) RNA levels. (D)Relative MDM2 RNA levels were with a constant amount of plasmid encoding NICD4 and increasing examined by qRT-PCR in HCT116 TP53 wild-type cells and HCT116 TP53- amounts of a plasmid encoding Mdm2. A clear dose response was null cells. observed, where NICD4 levels decreased with increasing levels of Notch–Trp53–Mdm2 interactions 1069

Fig. 3. Mdm2 targets NICD4 for ubiquitylation. (A)293T/17 cells expressing HA-NICD4, ubiquitin and the indicated wild-type or mutant E3 Fig. 2. Mdm2 expression affects NICD4 steady state protein levels. ligases were treated with 30mM MG-132 for 5 hours. NICD4 was (A)Lysates from Trp53-null MEFs (lane 1) and MEFs null for both Trp53 and immunoprecipitated from cell lysates with an anti-HA antibody, and Mdm2 (lane 2) were analyzed for NICD4 protein levels by western blot. immunoprecipitates were analyzed by western blot with anti-ubiquitin (top (B)Densitometric quantification of raw data in Fig. 2A. Plotted are NICD4 panel) and anti-HA (NICD4) antibodies (middle panel). Mdm2 expression levels normalized to a-tubulin levels. (C)Lysates from H1299 cells expressing was monitored by western blot of whole cell lysates using an anti-MDM2 NICD4-HA and either wild-type MDM2 or a mutant MDM2 protein lacking antibody (lower panel). (B)293T/17 cells expressing HA-NICD4, Myc- the RING domain (Mdm2DR) were analyzed for NICD4 protein levels by tagged ubiquitin and the indicated wild-type Mdm2 (lane 2) or the mutant western blot using the indicated antibodies. (D)Lysates from MEFs null for Mdm2 E3 ligases (lane 3) were treated with 30mM MG-132 overnight. Myc- both Trp53 and Mdm2 (lane 1) and from MEFs reconstituted with Mdm2 (lane

Journal of Cell Science tagged ubiquitin was immunoprecipitated from cell lysates with an anti-Myc 2) were analyzed for NICD4 and MDM2 protein levels by western blot. antibody, and immunoprecipitates were analyzed by western blot with anti- (E)Lysates from H1299 cells expressing control shRNA (lane 1) or MDM2 HA (NICD4) antibodies (top panel). Mdm2 and Mdm2DR expression were shRNA (lane 2) were analyzed for NICD4 protein levels by western blot using monitored by western blot of whole-cell lysates using an anti-Mdm2 antibody the indicated antibodies. (F)H1299 cells were transfected with 2mg of plasmid (lower panel). encoding V5-tagged NICD4 and 0.5mg a GFP expression vector, which allowed us to monitor transfection efficiency, together with 0.2mg (lane 3), 0.8mg (lane 4), 3.2mg (lane 5) and 6.4mg (lane 6) of plasmid encoding Mdm2. 3A, compare lanes 2 and 4). We also examined the effect of Equal plasmid mass for each transfection was ensured by the addition of overexpressing Sel-10 (also known as FBXW7), another E3 pcDNA3. The two characteristic MDM2 protein forms, long (L) and short (S) ubiquitin ligase reported to target NICD4 (Wu et al., 2001). Cells are indicated. Lysates were analyzed by western blot using the antibodies expressing Sel-10 also displayed, as expected, enhanced NICD4 indicated to the right. For a densitometric quantification of the data see ubiquitylation, albeit to an apparently lower degree, than cells supplementary material Fig. S2. expressing Mdm2 (Fig. 3A, lane 5). In a complementary strategy to monitor ubiquitylation of NICD4, Mdm2 expression (Fig. 2F; and for densitometric evaluation, see we expressed HA-tagged NICD4 and Myc-tagged ubiquitin along supplementary material Fig. S1) corroborating an antagonistic link with Mdm2 or Mdm2DR and treated cells with MG132 overnight. between Mdm2 and NICD4. The generality of this conclusion was After immunoprecipitation with an anti-Myc antibody, corroborated by carrying out an analogous experiment with another immunoblotting was performed to detect HA–NICD4 expression. cell line, 293T/17, in which we could also demonstrate the The result showed increased levels of higher molecular mass antagonism between Notch 4 and Mdm2 (data not shown). NICD4 in Mdm2-transfected cells (Fig. 3B, lane 2) compared with Given that the antagonistic relationship between Mdm2 and Mdm2DR-transfected cells (Fig. 3B, lane 3). On the basis of this NICD4 depends on the presence of the RING domain in Mdm2, we analysis, we conclude that NICD4 is a substrate for Mdm2-mediated examined NICD4 ubiquitylation in 293T/17 cells overexpressing ubiquitylation and degradation. either wild-type Mdm2 or Mdm2DR (Fig. 3A). Cells expressing wild-type Mdm2 and treated with the MG132 proteasome inhibitor Trp53 attenuates Notch 4 signaling displayed robust NICD4 ubiquitylation (Fig. 3A, lane 3), whereas Because Trp53 controls the levels of Mdm2 protein, which can cells expressing the Mdm2DR protein did not show an appreciable target NICD4, we expected that modulation of Trp53 should be increase in ubiquitylated NICD4 above background levels (Fig. consequential for Notch 4 signaling. To explore this possibility, we 1070 Journal of Cell Science 124 (7)

of levels of HES1 (an endogenous Notch target) mRNA as revealed by RT-PCR (Fig. 4C, top panel, lane 2 vs lane 1). This effect was not seen in the HCT116 TP53-null cells (Fig. 4C, top panel, lanes 3 and 4). These observations were extended with a second Notch reporter assay in HCT116 cells. We determined whether Trp53 modulation affects Notch-induced expression of the viral TP1 promoter, using a TP1–luc reporter assay (Strobl et al., 1997). In HCT116 TP53- null cells, NICD4 activated the TP1–luc reporter as expected (supplementary material Fig. S2A); however, TP1–luc reporter activity was reduced to 29% when Trp53 was coexpressed (supplementary material Fig. S2A). Significantly, and consistent with the analysis described above, we found that Mdm2 expression reduced Notch-induced TP1 reporter activity by 42% (supplementary material Fig. S2B). Taken together, these results indicate that modulation of Trp53 attenuates Notch 4 signaling through Mdm2 and that this property is general, because it is observed across different cell lines.

NICD4 physically interacts with Trp53 and Mdm2 To gain further insight into the antagonistic relationship between NICD4, Trp53 and Mdm2, we sought to examine the possibility that these proteins physically interact, as is known to be the case between Trp53 and Mdm2 (Barak and Oren, 1992; Chen et al., 1993; Momand et al., 1992). We first examined the relationship between Trp53 and NICD4 and included in these experiments NICD1, which has been previously reported to interact with Trp53 (Kim et al., 2007), as well as NICD3. HA-tagged forms of the intracellular domains of these Notch receptors were either independently expressed or co-expressed with FLAG-tagged Trp53 in 293T/17 cells (Fig. 5A). Forty-eight hours after transfection, cells were treated with MG132 for an additional 5 hours and co- Fig. 4. Trp53 modulates NICD4 signaling. (A)Luciferase assays in H1299 immunoprecipitation assays were performed using an anti-FLAG cells (TP53 null) expressing the HES-1–luc promoter reporter (0.5mg) and the antibody. We note that treatment with MG132 was crucial for these control Renilla luciferase reporter (0.05mg) were either mock transfected (lane

Journal of Cell Science experiments. As judged by co-immunoprecipitation, interactions 1) or transfected with expression constructs encoding NICD4 alone (lane 2), Trp53 alone (lane 3) or both. Lane 4 shows reduced NICD4 activity when both were observed between Trp53 and all three Notch receptors (Fig. NICD4 and Trp53 are expressed (compare lanes 2 and 4). Luciferase assays 5A) after treatment with MG132. We examined whether the Trp53– were performed according to the manufacturer’s (Promega) protocol, as NICD4 interaction can be corroborated by assessing endogenous previously described (Sun et al., 2005a). (B)Luciferase assays of HC11 (Trp53 protein interactions and, indeed, we detected NICD4 in mutant) cells containing the HES-1–luc Notch signal reporter (Takebayashi et immunoprecipitates using an anti-Trp53 antibody (Fig. 5B) in al., 1994). Cells were mock transfected (lane 1) or transfected with expression NIH3T3 cells. constructs encoding either NICD4 (lane 2) or Trp53 (lane 3) alone or both To map the region(s) of NICD4 that mediate interaction with (lane 4). (C)RT-PCR assays of HES1 mRNA levels in HCT116 TP53 wild- Trp53, we generated a series of deletion constructs (supplementary type cells (lanes 1 and 2) and HCT116 TP53-null cells (lanes 3 and 4), either material Fig. S3A). These HA-tagged polypeptides were expressed treated with cisplatin (5mM) (lanes 2 and 4) for 5 hours, or untreated (lanes 1 in 293T/17 cells with or without FLAG-tagged Trp53, and and 3). Lower panel is a western blot showing the effects of cisplatin on Trp53 protein levels monitored with an anti-Trp53 antibody (Vikhanskaya et al., interactions were monitored by co-immunoprecipitation. We found 1999) which, in addition to Trp53, crossreacts with another nonspecific protein that both the Ankyrin repeats and RAM domains of NICD4 appear (lower band), which was used as a loading control. to be involved in the Trp53 interaction, whereas the C-terminal PEST-containing domain does not show detectable interactions (supplementary material Fig. S3B). used a Notch signal reporter, HES-1–luc (Takebayashi et al., 1994), We also explored the possibility that Mdm2 and NICD4 could to monitor the effects of Trp53 on Notch-dependent transcription physically interact. Immunoprecipitation experiments using extracts in H1299 cells, which are null for TP53, and in HC11 cells, in of TP53-null H1299 cells, which express endogenously both which both alleles of endogenous Trp53 are mutant (hypomorphic) NICD4 and Mdm2, revealed interactions between these two (Merlo et al., 1994). As shown in Fig. 4A,B NICD4 expression proteins (Fig. 5C, lane 3). These findings are consistent with the significantly stimulated the activity of the HES-1–luc reporter notion that NICD4 is a direct target of the Mdm2 E3 ligase. Using transfected into both cell lines. This effect was suppressed when the Notch 4 deletion mutants (supplementary material Fig. S3A), NICD4 was co-expressed with wild-type Trp53. Consistently, when we examined which domain of Notch 4 is responsible for the parental wild-type HCT116 cells were treated with the DNA- interaction between NICD4 and Mdm2. The relevant deletion damaging agent cisplatin, which upregulates Trp53 (Vikhanskaya constructs were expressed in 293T/17 cells with or without Mdm2 et al., 1999) (Fig. 4C, bottom panel), we observed downregulation coexpression (supplementary material Fig. S3C). Interactions were Notch–Trp53–Mdm2 interactions 1071

Fig. 5. Protein interactions between Trp53, Mdm2 and NICD. (A)Co- immunoprecipitation of Trp53 with different NICD paralogs. 293T/17 cells were transfected with plasmids encoding HA-tagged NICD1 (lanes 2 and 3), Fig. 6. Trp53 suppresses NICD4-induced anchorage-independent growth NICD3 (lanes 4 and 6) or NICD4 (lanes 5 and 7) either alone (lanes 3, 6, and of mammary epithelial cells in soft agar. Representative colony formation 7) or with Trp53 (lanes 1, 2, 4 and 5). Forty-eight hours after transfection, assay for (A) HC11, HC11-NICD4 and (B) C57MG, C57MG-NICD4 cell pools. Wild-type Trp53 was introduced into the cell lines using the inducible cells were treated with 30mM MG-132 for 5 hours. Co-immunoprecipitations were performed on cell lysates with an anti-FLAG antibody (Trp53), and retroviral vector 1529-neo containing the metallothionine promoter sensitive to protein interactions were monitored by western blots using anti-HA and anti- cadmium ions. Growth medium was supplemented with cadmium ions (cd) to FLAG (Trp53) antibodies (upper two panels). Relative levels of protein induce Trp53 expression (v is empty vector control). The original

Journal of Cell Science ϫ expression were monitored by western blot of cell lysates (lower two panels). magnification was 40 . Numbers of counted colonies are shown in the (B)Western blot analysis of endogenous NICD4–Trp53 interaction in graphs. (C)Representative colony formation assay for HC11 cells stably overexpressing oncogenes FGF-3, ErbB2 and Wnt1. Wild-type Trp53 was NIH3T3 cells treated with 30mM MG-132 for 5 hours. Immunoprecipitations were performed with an anti-Trp53 antibody (Trp53) (lane 3) or control introduced into cell lines through transient transfection with wt Trp53 vector. serum (lane 2), and proteins were detected by western blot using the indicated Soft agar assays were performed 48 hours after transfection. Cells were placed antibodies. (C)Interaction between NICD4 and Mdm2 Lysates from H1299 in six-well plates in 0.3% soft agar at a density of 30,000 cells/well. After 21 days, they were visualized by overnight staining with Nitroblue Tetrazolium cells (TP53-null) treated with 30mM MG-132 for 5 hours were immunoprecipitated with an anti-Mdm2 antibody or control serum. NICD4 and counted for size ≥0.2 mm. and Mdm2 coimmunoprecipitation was assessed by western blot using antibodies against Mdm2 and NICD4 (see also supplementary material Fig. S1). Trp53 suppresses NICD4-induced anchorage-independent growth in mammary epithelial cells The observations described above clearly indicate a mechanistic detected with full-length NICD4 (construct F, supplementary link between Notch 4 and Trp53 and suggest that this Mdm2- material Fig. S3A) and the C-terminal region (construct C, dependent relationship could be relevant in tumorigenesis. To supplementary material Fig. S3A) but not with the NICD4 deletion explore this possibility, we took advantage of an assay for construct N, which contains the RAM-Ankyrin domains, but lacks anchorage-independent growth in soft agar, using HC11 and the C-terminal region, in contrast to the NICD4–Trp53 interactions. C57MG mammary epithelial cells that express NICD4 (Robbins et A reciprocal experiment was performed using the wild-type Mdm2 al., 1992). Both alleles of Trp53 in HC11 cells are mutated (Merlo or the Mdm2DR deletion, which lacks the RING domain. These et al., 1994), whereas in C57MG cells both alleles are wild type constructs were co-transfected with a V5-tagged NICD4 in 293T/17 (our unpublished data). cells. After 48 hours, the cells were treated with MG132 for 5 Introduction of a NICD4 expression vector into the HC11 hours and the lysates were immunoprecipitated with antibodies (Robbins et al., 1992) and C57MG cell lines confers on them the against the V5 NICD4 tag. Both Mdm2 constructs displayed ability to form colonies in soft agar (Fig. 6A,B). This is consistent interactions with NICD4, suggesting that the interaction is with the well-documented role of NICD4 as an oncogene in the independent of the RING domain (supplementary material Fig. mouse mammary gland (Jhappan et al., 1992). Significantly, S3D). however, the oncogenic activity of NICD4, as revealed by the soft 1072 Journal of Cell Science 124 (7)

agar assay, was reduced by the cadmium (Cd2+)-induced expression (Merlo et al., 1994) of wild-type Trp53 (P<0.001) in HC11-NICD4 cells (Fig. 6A) consistent with the notion that Trp53 regulates the protein level of NICD4. Similarly, C57MG-NICD4 cells, in which Trp53 is not mutated but is only weakly expressed, colony formation was inhibited by the expression of exogenous wild-type Trp53 (Fig. 6B). The ability of Trp53 to block oncogene-related colony formation in HC11 cells is not universal. When we introduced the Cd2+-inducible wild-type Trp53 retroviral vector into HC11 cells stably expressing the FGF-3, ErbB2 or Wnt1 oncogenes, anchorage-independent growth by these cells in soft agar was not blocked (Fig. 6C). Thus Trp53 is able to suppress the tumorigenic activity of NICD4, as predicted from the aforementioned analysis, but not that of FGF-3, Wnt1 or ErbB2.

Trp53 status associated with NICD4 mouse mammary tumors To examine the status of Trp53 locus in NICD4 mammary tumors, we determined the nucleotide sequence of exons 3–7 of the Trp53 gene from mouse mammary tumors induced by NICD4 driven by the whey acidic protein (WAP) (Michelsen et al., 2007) or the MMTV LTR promoters. The Trp53 status was initially examined using SSCP (single-strand conformation polymorphisms) analysis. Using this technique, a single nucleotide substitution in DNA can be detected as a mobility shift during gel electrophoresis (indicated with arrows in Fig. 7A). The nucleotide sequences of amplified products derived from the Trp53 exons 3–7 from the WAP-NICD4 and MMTV-NICD4 mammary tumors exhibiting different mobilities were determined. We found a remarkable frequency of Trp53 mutations in the NICD4 tumors (41%, 6/14) and NICD1 (14%, 1/7) in comparison with that in tumors generated by the expression of Fig. 7. Trp53 status associated with NICD4 mammary tumors. Cripto-1 (0%, 0/4) or Int6 (0%, 0/7) oncogenes (Fig. 7B). The (A)Representative examples of SSCP polymorphism. Exons 3–7 of Trp53 characteristics of these mutations are shown in Fig. 7C. These were amplified by PCR, separated by 10% TBE polyacrylamide gel results clearly show an unexpectedly high frequency of Trp53 electrophoresis and silver stained. Differences of mobility shift were observed

Journal of Cell Science mutations in the NICD4 tumors, strengthening the relevance of a among the PCR products of samples 2 and 3 obtained from WAP-Int3 crucial functional link between Notch 4 and Trp53 in oncogenesis. (NICD4) transgenic tumors (indicated with arrows). (B)Frequencies and (C) characteristics of mutations found in all analyzed transgenic models. The Discussion mutations of Trp53 DNA binding domain status were checked in several The Notch pathway is one of a handful of fundamental signaling transgenic models: WAP–Int3 (NICD4) (Gallahan and Callahan, 1987), mechanisms controlling metazoan cell fate (Gerhart, 1999; Hurlbut MMTV LTR-Int3 (NICD4) (Jhappan et al., 1992), Wap-Int3sh (Wap-Int3short) et al., 2007). The fundamental nature of the pathway is reflected (Raafat et al., 2004), Wap-CBF1 KO (Wap-NICD4/CBF1 knockout) (Raafat et al., 2009) Wap-Cripto-1 (Sun et al., 2005b), Wap-Int6 (Mack et al., 2007) and by the striking conservation across species, as well as the pleiotropic MMTV-NICD1 (Kiaris et al., 2004). PCR products showing different SSCP action across tissues and developmental processes. Molecular patterns were purified by electrophoresis on 1% agarose gel, cloned into TA- evidence indicates that, in spite of the numerous effects of Notch cloning system or directly sequenced. activity, there is a unitary, basic underlying molecular mechanism that governs Notch signaling. However, genetic studies have uncovered a complex circuitry that is capable of modulating Notch Here, we uncovered a molecular mechanism linking Notch activity and a diversity of mechanisms that can ultimately control protein stability to oncogenic events driven by the tumor suppressor signaling at distinct cellular levels (Kankel et al., 2007). Trp53. We demonstrate that the intracellular domain of Notch 4 is An important and unique aspect of the Notch pathway is its targeted for ubiquitylation and hence degradation by the ubiquitin exquisite sensitivity to dosage, first revealed by the haplo-insufficient ligase Mdm2. Mdm2, however, is involved in a feedback genetic behavior of the Notch receptor and its ligands (Artavanis- mechanism with Trp53, being on one hand the transcriptional Tsakonas et al., 1995; Artavanis-Tsakonas et al., 1999). Moreover, target of Trp53 and on the other hand, a protein interaction partner the developmental outcome of Notch signals might differ, depending (Kussie et al., 1996; Schon et al., 2002), eventually targeting the on the level of receptor activity, such that the quantity of ligand- Trp53 protein for degradation through ubiquitylation (Fang et al., competent receptors in a cell defines a crucial developmental 2000; Haupt et al., 1997; Honda and Yasuda, 2000). The data we parameter. Not surprisingly, therefore, mechanisms that affect the gathered indicate that although the Mdm2 E3 ligase can target trafficking and the stability of the Notch receptor have emerged as Notch 4 in the absence of Trp53, its presence seems to significantly pivotal signal-controlling devices (Baron et al., 2002; Fortini, 2009) accelerate this process, given that we found higher levels of NICD4 and might also serve as integration nodes between Notch and other in Trp53–/– Mdm2–/– MEFs than in Trp53–/– Mdm2+/+ MEFs. We cellular processes (Mukherjee et al., 2005). thus propose a model where the Trp53–Mdm2 feedback loop is Notch–Trp53–Mdm2 interactions 1073

linked to the regulation of Notch protein levels (Fig. 8). Moreover, given that our biochemical analyses support the existence of physical interactions between NICD4 and both Mdm2 and Trp53, our model suggests that a tripartite interaction between Notch, Mdm2 and Trp53 modulates the degradation of NICD4 and hence NICD4-mediated signaling (Fig. 8). The inverse correlation between Trp53 expression and Notch 4 protein levels was, to our knowledge, first documented by Mao and co-workers using fibroblasts lacking Trp53 (Mao et al., 2004). Our biochemical analysis indicating physical interactions not only between NICD4 and Trp53 but also with the intracellular domain of other Notch receptor paralogs raises the possibility that the Trp53 and, by extension, Mdm2-directed degradation is a general mechanism that controls Notch signalling, at least in certain developmental contexts. Indeed, the general features of the mechanism for the antagonistic relationship between Notch and Trp53 we propose is compatible and, in some cases, explains a diverse set of observations that have suggested links between Fig. 8. A model for the Trp53-mediated downregulation of Notch Notch and Trp53 over the years. Kim and co-workers (Kim et al., signaling. The Mdm2 E3 ubiquitin ligase is a transcriptional target of Trp53. 2007) have previously shown that the N-terminal region of Trp53 The Trp53 protein associates with and is ubiquitylated (red dots) by Mdm2 binds to the RAM-Ank domain of NICD1. Beverly and colleagues (Fang et al., 2000; Honda and Yasuda, 2000). Mdm2 can also associate with observed suppression of Trp53 levels by NICD1 and suggested the intracellular domain of Notch 4 (NICD4) and cause its ubiquitylation that this might reflect Mdm2-dependent events (Beverly et al., (dashed line). However, in the presence of Trp53, which can also associate 2005). Secchiero and colleagues (Secchiero et al., 2009) found with NICD4, a trimeric complex (solid bold lines) is formed (NICD–Trp53– Mdm2), and as a result NICD4 becomes highly ubiquitylated and, that, in cells lacking active Trp53, Notch1 protein levels were subsequently, rapidly degraded. This results in a loss of Notch signaling and stable in the presence or absence of the Mdm2 and Trp53 inhibitor might provide a selective environment for fixation of Trp53 mutations during Nutlin, consistent with the notion that binding of Trp53 to Notch the evolution of mammary tumor development in the Notch transgenic 1 is important for Mdm2-mediated degradation of Notch1. mammary tumor models. Our study indicates that NICD4 physically interacts with the Mdm2 ubiquitin ligase, but the notion of direct interactions between Notch and ubiquitin ligases is not unique, because there have been expression of the Notch transcriptional target HES-1. Importantly, other documented examples. The C-terminal domain of Notch 1 our study revealed that the Trp53–Mdm2–Notch relationship and Notch 4 have been shown to interact with another nuclear E3 influences anchorage-independent growth in soft agar, which is a ligase, Sel-10 (FBXW7) (Mao et al., 2004; Wu et al., 2001). measure of malignant transformation. Thus, the ability of wild-

Journal of Cell Science Another example is the E3 ligase Deltex in Drosophila, which type Trp53 to inhibit anchorage-independent growth of HC11 and interacts physically with the Ankyrin domain region of Notch and C57MG-NICD4 cells in soft agar, but not of HC11 cells expressing results in the ubiquitylation of the receptor (Matsuno et al., 1995). Wnt1, FGF-3 and ErbB2, is consistent with a functionally This latter example offers some noteworthy analogies with the significant relationship between Trp53 and NICD4. This finding Trp53–Mdm2–Notch tripartite mechanism we propose here. The has in vivo implications on NICD4-induced mammary tumor efficiency of Deltex to ubiquitylate Notch is highly enhanced development in mice and suggests that an early event in through a third molecule, Kurz, which is the single Drosophila tumorigenesis is the loss or mutation of Trp53. homolog of non visual b-arrestin, which interacts physically with It is well documented that analogous Trp53 mutations in the deltex, and as a result, influences signaling (Mukherjee et al., solid tumors of mice are far less frequent than in humans (Blackburn 2005). The topology of this trimeric complex is different from and Jerry, 2002). For instance, no Trp53 mutations have been what we suggest here between Notch–Trp53 and Mdm2 in that found in MMTV-Ras (Hundley et al., 1997), MMTV-Wnt1 Notch does not seem to interact directly with Kurz. Nevertheless, (Donehower et al., 1995) or WAP-DES(1–3) IGF-induced the notion that sequences in the intracellular domain of Notch act mammary tumors (Hadsell et al., 2000). Remarkably, we found as adaptors to recruit its ubiquitin ligases, whose activity, and that 41% (6/14) of the mammary tumors in NICD4 transgenic hence effects on Notch signaling, might be modulated by a third mice, as well as 14% (1/7) of mammary tumors in NICD1 molecular partner could extend to other cellular circumstances transgenic mice had Trp53 mutations. Although we have not (Mazaleyrat et al., 2003). identified any Trp53 mutations in four WAP-Cripto-1 and seven Notch signal modulation has profound developmental and WAP-Int6sh mammary tumors, others have found loss of pathogenic consequences, and the link with Trp53 is potentially heterozygosity (LOH) for Trp53 in transgenic MMTV–c-Myc and relevant for tumorigenesis given the importance of Trp53 in these MMTV-Wnt1 mammary tumors (Blackburn and Jerry, 2002). The events. The ultimate consequences of lower Notch receptor levels mechanism by which LOH for Trp53 synergizes or collaborates is downregulation of the Notch signal, whereas stabilization of the with these transgenes has not been established. Notch protein might, in the right developmental context, lead to The implication our findings have for human mammary signal upregulation (Mukherjee et al., 2005). Here, in the context oncogenesis is yet to be determined, but the apparent generality of of all the cell types we used in our in vitro experiments, we the antagonistic relationship between Notch and Mdm2 or Trp53 demonstrated that the Trp53–Mdm2-mediated regulation of Notch raises some significant hypotheses. Moreover, recent evidence that has direct consequences on Notch signaling, as measured by the is compatible with our model indicates that expansion of stem or 1074 Journal of Cell Science 124 (7)

progenitor cells, cell populations that are crucial for carcinogenesis previously (Sun et al., 2005a). The RAM domain (4382-4861) was amplified by the forward primer A1: 5Ј-GGAATTCCGCCAC CATGGCAGCAGTGGGAGC - in the mouse mammary gland, might be influenced by Trp53 TCTGGAGCCCCTGCTGC-3Ј that created a EcoRI site and the reverse primer B2: through its ability to influence Notch activity (Tao et al., 2010). 5Ј-CCGCTCGAGTCAAGCGTAATCTGGAACATCGTATGGCAGAACCTCCGA - Notch can act as an oncogene, as demonstrated by the association TTCACACTCCTGAG-3Ј, which created an XhoI site as well as HA tag. The of activating mutations with T-ALL in humans (Ellisen et al., Ankyrin repeat domain (4862–5512) was amplified by forward primer A2: 5Ј- CGCGGATCCGCCACCAT GGATGTGGACA CCTGTGGACCTGATGGGGTGA - 1991; Weng et al., 2004). However, as we have argued before on CACC CCTGATGTC-3 Ј, which created a EcoRI site and the reverse primer B3: the basis of tumor models in the mouse mammary gland and the 5Ј-CCGCTCGAGTC AAGCGT AATCTGGAACATCGTATGGGCCGCCCCGAG - intestine (Fre et al., 2009; Kiaris et al., 2004), the oncogenic CTCC AGCAACAGCTG-3 Ј, which created an XhoI site as well as HA tag. The RAM plus Ankyrin repeats domain (4382–5512) (RAM_Ank) was amplified using activity of Notch, unlike what has been documented in the case of primer A1 and primer B3. The C-terminal domain (5513–6043) was amplified using T-ALL, might not be manifested by oncogenic Notch mutations the forward primer A3: 5Ј-GGAATTCCGCCACCATGCCGGGGACTGCGAGAC- per se, but rather by an oncogenic synergy of Notch signals with CAGGCCGGGCTGG C CCCAGGAGATGTGG-3 Ј, which created a EcoRI site and other cellular elements. It is for this reason that the modulation of the reverse primer B1. All NICD4 and its deletion plasmids have sequenced and verified. Mdm2 and Mdm2 RING deletion (DR) vectors were obtained from Carl G. Notch signaling through the Notch–Mdm2–Trp53 axis defined Maki (University of Chicago). here might be consequential in human tumorigenesis. Protein extraction, antibodies and immunoprecipitation Cells were lysed as previously described (Sun et al., 2005b). The antibodies used Materials and Methods were: anti-V5 (Invitrogen; 1:5000), anti-FLAG-HRP (Sigma; 1:1000), anti-Notch 4 Cell culture, retroviral production and transduction are from Upstate (Charlottesville, VA; 1:1000) and AVIVA System Biology (San The murine mammary epithelial cell line HC11 was maintained in RPMI-1640 Diego, CA; 1:2000), anti-HA (Roche), anti-Mdm2 (Santa Cruz, N-20 and SMP14), medium, supplemented with 10% fetal bovine serum (FBS), 5 mg/ml insulin, and anti-a-HSP70, anti-NICD4 (AVIVA, 1:4000), anti-Trp53 protein (CM5) (Vector 10 ng/ml EGF (Invitrogen; Carlsbad, CA). The murine mammary epithelial cell line Laboratories). C57MG (Jue et al., 1992) was grown in DMEM, supplemented with 10% FBS and For the Notch and Trp53 interaction analysis, 293T/17 cells (1ϫ106 cells on 60- 10 mg/ml insulin. Phoenix293/Ecotropic and HEK293T/17 cells were purchased mm-diameter plates) were transfected with 2 mg HA–NICD1, HA–NICD3, HA– from the ATCC (Mannassas, VA) and EcoPack 293T cells were purchased from NICD4 expression vectors with, or without, 2 mg FLAG–Trp53. Alternatively, for Clontech (Valencia, CA). These cells were grown in DMEM medium, supplemented the Notch–MDM2 interaction analysis, the cells were transfected with 2 mg HA- with 10% FBS. HCT116 and HCT116 TP53-null cells (kindly supplied by Bert NICD4 mutant expression vectors with or without the addition of 2 mg Mdm2 Vogelstein, Johns Hopkins University, Baltimore, MD) were cultured with McCoy’s expression vector. Tranfections were performed using Lipofectamine 2000 reagent 5a medium with 10% FBS. H1299 cells were purchased from the ATCC (Manassas, (Invitrogen) according to the manufacturer’s instruction. Seventy-two hours after VA) and cultured with RPMI-1640 medium, supplemented with 10% FBS. HeLa transfection, the cells were lysed for 20 minutes with 0.5 ml lysis buffer as previously cells were grown in DMEM, supplemented with 10% FBS. Wild-type, Trp53-null described (Sun et al., 2005a). Before lysis, the cells were treated for 5 hours with 30 and Mdm2-null MEFs (Montes de Oca Luna et al., 1995) were kindly provided by mM MG-132. Immunoprecipitations were carried out as previously described (Sun Guillermina Lozano (University of Texas M.D. Anderson Cancer Center, Houston, et al., 2005a) by incubating 1.0 mg of total protein with 30 ml anti-FLAG antibody TX). conjugated to resin beads (Aguila et al., 2007) overnight at 4°C. The resin was For the production of Trp53 and Int2/FGF3 retroviral constructs, 10 mg of vector washed four times with 0.5 ml lysis buffer and eluted with high concentration of DNA were transfected into EcoPack 293T cells using FuGene (Roche Applied FLAG peptide according to the procedure from Sigma. Immunoprecipitates were Science; Indianapolis, IN). All other retroviral vectors were transfected into visualized by western blotting with anti-HA (Roche) or anti-FLAG horseradish Phoenix293/Ecotropic cells using LipoD293 DNA transfection reagent (SignaGen peroxidase-conjugated antibody (Aguila et al., 2007). Laboratories; Gaithersburg, MD) according to the manufacturer’s suggested The antibodies against Trp53 (Santa Cruz, sc-99 AC) and Mdm2 (Santa Cruz, sc- procedures. Viral supernatants were collected at 48 and 72 hours after transfection, 965 AC) and control mouse serum, conjugated to agarose beads (Santa Cruz, sc- pooled, filtered (0.45 mm) and stored at –80°C. 2343) were used in immunoprecipitations involving NIH3T3 and H1299 cell lysates. Recipient HC11 and C57MG cells were transduced with retroviral particles at Journal of Cell Science approximately 40% confluence for 8–12 hours in the presence of polybrene (5 Western blots mg/ml), followed by replacement with fresh medium. Cells were selected with Cells were harvested in RIPA buffer (150 mM NaCl, 10 mM Tris-HCl, pH 7.2, 0.1% appropriate antibiotics 36 hours after infection. Transgene expression was confirmed SDS, 1.0% Triton X-100, 1% sodium deoxycholate, 5 mM EDTA) supplemented by RT-PCR and immunoblotting. All viral work conformed to accepted Biosafety with the protease inhibitor cocktail set 1 (Calbiochem). Total protein concentration Level 2+ guidelines as described by the National Institutes of Health was determined with the BCA Protein Assay Kit (Pierce Biotechnology). Protein (50 (http://bmbl.od.nih.gov/contents.htm). mg total) was loaded on gradient 4–20% SDS-PAGE gels and transferred to HC11 cells were transfected with 2 mg pCEV29-ErbB2 (gift from S. Aaronson, nitrocellulose membrane using the iBlot Transfer System (Invitrogen). Membranes Mount Sinai School of Medicine, New York, NY) or HA-tagged Wnt-1 (Upstate were blocked with blocking buffer (5% non-fat milk in TBS with 0.1% Tween20 Biotech; Lake Placid, NY) using FuGene6 (Roche Applied Science) reagent in a 3:1 (Tris-buffered saline Tween-20, TBS/T) for 1 hour at room temperature and then ratio according to the manufacturer’s instructions. Cells were selected with the incubated with primary a-tubulin (Aguila et al., 2007) antibodies. After washing appropriate antibiotics under standard conditions. with TBS/T (Tris-Buffered Saline tween-20) membranes were incubated for 1 hour at room temperature with the appropriate secondary antibody conjugated to HRP, Construction of Trp53 and NICD4 vectors diluted in TBS/T. Proteins were visualized using the ECL Western Blotting Detection FLAG-tagged Trp53 (Zhao et al., 2004) obtained from Daiqing Liao (University of System (Amersham, GE Healthcare). Florida, Gainsville, FL) and HA–tagged human NICD1 and human NICD3 from Lizi Wu (Wu et al., 2000), Ha-tagged Mouse NICD4 expression vectors were made In vivo ubiquitylation assay through PCR using Pfu polymerase from Stratagene and NICD4 sequences were In vivo ubiquitylation assays were carried out essentially as described (Wu et al., cloned into pcDNA3 vector (Invitrogen; Carlsbad, CA), NICD4 was also cloned into 2001; Yang et al., 2005) with minor modifications. Briefly, 293T/17 cells or Bosc23 pcDNA 3.1 pEF1/V5His TOPO TA expression vector (Sun et al., 2005a) (Invitrogen). cells were transfected with 2 mg HA-NICD4, 1 mg ubiquitin and 2 mg indicated wild- The 1529-neo retroviral vector (McGeady et al., 1989) was used to introduce the type or mutant Mdm2 E3 ligases or Sel-10 E3 ligase expression vectors, for 48 wild-type TP53 cDNA into HC11 and C57MG cells. This vector contains an internal hours, using Lipofectamine 2000 and then treated with MG-132 for 5 hours before metallothionine (MT) promoter that can be induced by low levels of cadmium harvesting. NICD4 was immunoprecipitated from cell lysates with an anti-HA sulfate (3 mM). Mouse Trp53 was cloned into the 1529 vector using BamHI and antibody, and the immunoprecipitates were analyzed by western blot with anti- EcoRI restriction sites. ubiquitin (Yang et al., 2005). The murine NICD4 cDNA corresponding to a truncated Notch4 cDNA (residues 4382–6043) has been described (Gallahan and Callahan, 1987; Jhappan et al., 1992). Quantitative real-time PCR An oligonucleotide encoding hemagglutinin (HA) tag was appended to the 3Ј end of Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using NICD4 cDNA. The HA-tagged NICD4 expression vector was generated through the SYBR Green Master Mix (Bio-Rad Laboratories). The following primers were PCR using Pfu polymerase from Stratagene and cloned into the eukaryotic expression used for qRT-PCR: Notch 4 Forward primer; 5Ј AGT CCA GGC CTT GCC AGA vector pcDNA3. The forward primers, A1: 5Ј-GGAATTCCGCCACC ATGG CA - ACG-3Ј; Notch 4 Reverse primer; 5Ј GTA GAA GGC ATT GGC CAG AGA G-3Ј; GCAGTGGGAGCTCTGGAGCCCCTGCTGC-3Ј was used to generate an EcoRI Mdm2-Forward primer; GCA AAT GTG CAA TAC CAA CAT GTC; Mdm2- site and B1: 5Ј-CCGCTCGAGTCAAGCGTA TCTGGAA CATCGTATGGGT T - Reverse primer; 5Ј-GCC AAA CAA ATC TCC TAG AAG ATC-3Ј; HPRT Forward CAGAT TTCTTACAACCGAGTTTAAG-3Ј to create an XhoI site and an HA tag. primer; 5Ј-GACACTGGCAAAACAATGCAGAC-3Ј and HPRT Reverse primer; pc DNA3 was cut by both EcoRI and XhoI and the ligations were done as described 5Ј-CAGTTTCACTAATGACACATTCATG-3Ј. Normalization of NICD4 and Mdm2 Notch–Trp53–Mdm2 interactions 1075

mRNA levels to HPRT were done according to the manufacturer’s protocol. Mdm2 References vectors were purchased from Open Biosystem. Lentivirus was produced following Aguila, B., Coulbault, L., Boulouard, M., Liotaveilliota, F., Davis, A., Tsigmath, G., the manufacturer’s protocol and viral infections were carried out according to Sun Borsodi, A., Balboni, G., Salvadori, S., Jauzac, P. et al. (2007). In vitro and in vivo et al. (Sun et al., 2005a). pharmacological profile of UFP-512, a novel selective delta-opioid receptor agonist; correlations between desensitization and tolerance. Br. J. Pharmacol. 152, 1312-1324. PCR, SSCP, and Trp53 nucleotide sequence analysis Allenspach, E. J., Maillard, I., Aster, J. C. and Pear, W. S. (2002). Notch signaling in The primers for Exon 3 are F, 5Ј-CCATCACCTCACTGCATGGACGAT-3Ј and R, cancer. Cancer Biol. Ther. 1, 466-476. 5Ј-CGTGCACATAACAGACTTGGCTG-3Ј; exon 4 F, 5Ј-TACTCTCCTCCC - Artavanis-Tsakonas, S., Matsuno, K. and Fortini, M. E. (1995). Notch signaling. CTCAATAAGC-3Ј and R, 5Ј-CATCACCATCGGAGCAGCGCTC-3Ј; exon 5 F, Science 268, 225-232. 5Ј-GCCTGGCTCCTCCCCAGCATCTTATC-3Ј and R, 5Ј-CTCGGG TGG CTC - Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J. (1999). Notch signaling: cell fate ATAAGGTACCACC-3Ј; exons 6 and 7 F, 5Ј-CTCTCTTTGCGCTCCCTGGGGGC- control and signal integration in development. Science 284, 770-776. Barak, Y. and Oren, M. (1992). Enhanced binding of a 95 kDa protein to p53 in cells 3Јand R, 5Ј-GCCGGCTCTGAGTATACCACCATCC-3Ј. Amplified products were  undergoing p53-mediated growth arrest. EMBO J. 11, 2115-2121. screened for sequence variations using single strand conformation polymorphism Baron, M., Aslam, H., Flasza, M., Fostier, M., Higgs, J. E., Mazaleyrat, S. L. and (SSCP) analysis (Merlo et al., 1994). The PCR product was heat-denatured at 95°C Wilkin, M. B. (2002). Multiple levels of Notch signal regulation (review). Mol. Membr. for 5 minutes and immediately placed on ice until it was loaded onto the gel. The Biol. 19, 27-38. denatured products were resolved in 10% polyacrylamide gels. Gels were Beverly, L. J., Felsher, D. W. and Capobianco, A. J. (2005). Suppression of p53 by subsequently fixed and stained with silver nitrate and photographed. Direct sequencing Notch in lymphomagenesis: implications for initiation and regression. Cancer Res. 65, was done on selected samples as follows: after PCR amplification, products were 7159-7168. purified by electrophoresis on 1% agarose gel. The DNA fragment was excised from Blackburn, A. C. and Jerry, D. J. (2002). Knockout and transgenic mice of Trp53: what the gel, purified with an Extraction Kit (QIAquick Spin; Qiagen, Hilden, Germany), have we learned about p53 in breast cancer? Breast Cancer Res. 4, 101-111. and ligated into a plasmid TOPO TA Cloning (Invitrogen, Carlsbad, CA). The Bunz, F., Dutriaux, A., Lengauer, C., Waldman, T., Zhou, S., Brown, J. P., Sedivy, J. constructs were transformed into Escherichia coli strain DH5alpha and plated. M., Kinzler, K. W. and Vogelstein, B. (1998). Requirement for p53 and p21 to sustain Plasmid DNA from single cell clones was isolated using EcoRI to assay for an insert. G2 arrest after DNA damage. Science 282, 1497-1501. The clones to be sequenced were purified with QIAprep Miniprep (Qiagen). The Callahan, R. and Egan, S. E. (2004). Notch signaling in mammary development and sequence was obtained using one of the original primers in a sequencing reaction oncogenesis. J. Mammary Gland Biol. Neoplasia 9, 145-163. performed on an ABI PRISM 310 automated DNA sequencer with the BigDye Capobianco, A. J., Zagouras, P., Blaumueller, C. M., Artavanis-Tsakonas, S. and terminator sequencing kit (Applied Biosystems, Foster City, CA). Sequences were Bishop, J. M. (1997). Neoplastic transformation by truncated alleles of human compared with the GenBank sequence number U94788 for the mouse Trp53 gene. NOTCH1/TAN1 and NOTCH2. Mol. Cell. Biol. 17, 6265-6273. The Trp53 DNA binding domain status was checked in cellular DNA from Chen, J., Marechal, V. and Levine, A. J. (1993). Mapping of the p53 and mdm-2 mammary tumors of several transgenic models: WAP-Int3 (Gallahan and Callahan, interaction domains. Mol. Cell. Biol. 13, 4107-4114. 1987), MMTV LTR-Int3 (Jhappan et al., 1992), WAP-Int3sh (WAP-Int3short) (Raafat Donehower, L. A., Godley, L. A., Aldaz, C. M., Pyle, R., Shi, Y. P., Pinkel, D., Gray, J., Bradley, A., Medina, D. and Varmus, H. E. (1995). Deficiency of p53 accelerates et al., 2004), WAP-CBF1 KO (Wap-NICD4/CBF1 knock out) (Raafat et al., 2009), mammary tumorigenesis in Wnt-1 transgenic mice and promotes chromosomal WAP-Cripto-1 (Sun et al., 2005b), WAP-Int6 (Mack et al., 2007) and MMTV- instability. Genes Dev. 9, 882-895. NICD1 (Kiaris et al., 2004). Ellisen, L. W., Bird, J., West, D. C., Soreng, A. L., Reynolds, T. C., Smith, S. D. and Sklar, J. (1991). TAN-1, the human homolog of the Drosophila notch gene, is broken RNA isolation, cDNA synthesis and RT-PCR by chromosomal translocations in T lymphoblastic neoplasms. Cell 66, 649-661. RNA isolation, cDNA synthesis and RT-PCR were performed as previously described Fang, S., Jensen, J. P., Ludwig, R. L., Vousden, K. H. and Weissman, A. M. (2000). (Sun et al., 2005a; Sun et al., 2002). Briefly, total cellular RNA was isolated using Mdm2 is a RING finger-dependent ubiquitin protein ligase for itself and p53. J. Biol. TRIzol (Invitrogen, Carlsbad, CA). cDNA was synthesized from 1 mg total RNA, Chem. 275, 8945-8951. after treatment with DNaseI (Invitrogen), using oligo(dT)12-15 primers and the Fortini, M. E. (2009). Notch signaling: the core pathway and its posttranslational regulation. SuperScript II kit, according to the manufacturer’s protocol (Invitrogen, Carlsbad, Dev. Cell 16, 633-647. CA). Primers used were GAPDH, 5Ј-CCCTTCATTGACCTCAACTAC-3Ј and 5Ј- Fre, S., Pallavi, S. K., Huyghe, M., Lae, M., Janssen, K. P., Robine, S., Artavanis- CCACCTTCTTGATGTCATCAT-3Ј, and HES-1, 5Ј-ATGAGATCAGTACTGCGG - Tsakonas, S. and Louvard, D. (2009). Notch and Wnt signals cooperatively control ATGCCATCT-3Ј and 5Ј-GCACAGAGACGGTGCTGCCATCAGACT-3Ј (Accession cell proliferation and tumorigenesis in the intestine. Proc. Natl. Acad. Sci. USA 106, Number, M16006) 6309-6314. Journal of Cell Science Gallahan, D. and Callahan, R. (1987). Mammary tumorigenesis in feral mice: Colony formation in soft agar identification of a new int locus in mouse mammary tumor virus (Czech II)-induced The soft agar assay was performed as described previously (Raafat et al., 2007). mammary tumors. J. Virol. 61, 66-74. Briefly, tissue culture cells in an agar mixture were seeded at 1.5ϫ104 or 3ϫ104 Gerhart, J. (1999). 1998 Warkany lecture: signaling pathways in development. Teratology 60, 226-239. cells/well in triplicate. The plates were incubated at 37°C with 5% CO2 for 21 days. Colonies measuring 0.2 mm or more were counted using the AccuCount 1000 colony Geyer, R. K., Yu, Z. K. and Maki, C. G. (2000). The MDM2 RING-finger domain is required to promote p53 nuclear export. Nat. Cell Biol. 2, 569-573. counter (Biologics, Inc., Manassas, VA, USA). For Trp53 induction 3 mM CdSO4 was added to growth media. Gottlieb, T. M. and Oren, M. (1996). p53 in growth control and neoplasia. Biochim. Biophys. Acta 1287, 77-102. Hadsell, D. L., Murphy, K. L., Bonnette, S. G., Reece, N., Laucirica, R. and Rosen, Statistics J. M. (2000). Cooperative interaction between mutant p53 and des(1-3)IGF-I accelerates Quantitative values are represented as the mean value of at least three repeats of one mammary tumorigenesis. Oncogene 19, 889-898. representative experiment. All experiments were repeated at least three times. The Haupt, Y., Maya, R., Kazaz, A. and Oren, M. (1997). Mdm2 promotes the rapid statistical significance of the difference between groups was determined by the degradation of p53. Nature 387, 296-299. Student t-test. Comparisons resulting in P<0.05 were considered statistically Honda, R. and Yasuda, H. (2000). Activity of MDM2, a ubiquitin ligase, toward p53 or significant and identified in the figures with an asterisk. itself is dependent on the RING finger domain of the ligase. Oncogene 19, 1473-1476. Hundley, J. E., Koester, S. K., Troyer, D. A., Hilsenbeck, S. G., Subler, M. A. and We thank our colleagues R. A. Obar, A. Mukherjee, K. G. Windle, J. J. (1997). Increased tumor proliferation and genomic instability without Guruharsha and A. Louvi (Yale University) for their help. We also decreased apoptosis in MMTV-ras mice deficient in p53. Mol. Cell. Biol. 17, 723-731. Hurlbut, G. D., Kankel, M. W., Lake, R. J. and Artavanis-Tsakonas, S. (2007). thank Guillermina Lozano for providing Trp53-null, Mdm2-null MEFs Crossing paths with Notch in the hyper-network. Curr. Opin. Cell Biol. 19, 166-175. and wild-type MEFs; Bert Vogelstein for supplying HCT116 TP53- Hurlbut, G. D., Kankel, M. W. and Artavanis-Tsakonas, S. (2009). Nodal points and null and parental cells; S. Aaronson for crucial reagents and Daiqing complexity of Notch-Ras signal integration. Proc. Natl. Acad. Sci. USA 106, 2218- Liao for pcDNA3 FLAG–Trp53 expression vectors; Lizi Wu for 2223. Jhappan, C., Gallahan, D., Stahle, C., Chu, E., Smith, G. H., Merlino, G. and pcDNA3 HA–NICD1 and pcDNA3 HA–NICD3; and Carl G. Maki Callahan, R. (1992). Expression of an activated Notch-related int-3 transgene interferes for pcDNA3 Mdm2 and pcDNA3 Mdm2DR vectors. This research with cell differentiation and induces neoplastic transformation in mammary and salivary was supported in part by the National Institutes of Health Grants glands. Genes Dev. 6, 345-355. NS26084 and CA098402 (to S.A.-T.) and partly by the Intramural Jue, S. F., Bradley, R. S., Rudnicki, J. A., Varmus, H. E. and Brown, A. M. (1992). The mouse Wnt-1 gene can act via a paracrine mechanism in transformation of Research Program of the NIH, National Cancer Institute, Center for mammary epithelial cells. Mol. Cell. Biol. 12, 321-328. Cancer Research. The authors declare no competing interests. Deposited Kankel, M. W., Hurlbut, G. D., Upadhyay, G., Yajnik, V., Yedvobnick, B. and in PMC for release after 12 months. Artavanis-Tsakonas, S. (2007). Investigating the genetic circuitry of mastermind in Drosophila, a notch signal effector. Genetics 177, 2493-2505. Supplementary material available online at Kiaris, H., Politi, K., Grimm, L. M., Szabolcs, M., Fisher, P., Efstratiadis, A. and http://jcs.biologists.org/cgi/content/full/124/7/1067/DC1 Artavanis-Tsakonas, S. (2004). Modulation of notch signaling elicits signature tumors 1076 Journal of Cell Science 124 (7)

and inhibits hras1-induced oncogenesis in the mouse mammary epithelium. Am. J. Schon, O., Friedler, A., Bycroft, M., Freund, S. M. and Fersht, A. R. (2002). Molecular Pathol. 165, 695-705. mechanism of the interaction between MDM2 and p53. J. Mol. Biol. 323, 491-501. Kim, S. B., Chae, G. W., Lee, J., Park, J., Tak, H., Chung, J. H., Park, T. G., Ahn, J. Secchiero, P., Melloni, E., di Iasio, M. G., Tiribelli, M., Rimondi, E., Corallini, F., K. and Joe, C. O. (2007). Activated Notch1 interacts with p53 to inhibit its Gattei, V. and Zauli, G. (2009). Nutlin-3 up-regulates the expression of Notch1 in both phosphorylation and transactivation. Cell Death Differ. 14, 982-991. myeloid and lymphoid leukemic cells, as part of a negative feedback antiapoptotic Kopan, R., Schroeter, E. H., Weintraub, H. and Nye, J. S. (1996). Signal transduction mechanism. Blood 113, 4300-4308. by activated mNotch: importance of proteolytic processing and its regulation by the Smith, G. H., Gallahan, D., Diella, F., Jhappan, C., Merlino, G. and Callahan, R. extracellular domain. Proc. Natl. Acad. Sci. USA 93, 1683-1688. (1995). Constitutive expression of a truncated INT3 gene in mouse mammary epithelium Kussie, P. H., Gorina, S., Marechal, V., Elenbaas, B., Moreau, J., Levine, A. J. and impairs differentiation and functional development. Cell Growth Differ. 6, 563-577. Pavletich, N. P. (1996). Structure of the MDM2 oncoprotein bound to the p53 tumor Stifani, S., Blaumueller, C. M., Redhead, N. J., Hill, R. E. and Artavanis-Tsakonas, suppressor transactivation domain. Science 274, 948-953. S. (1992). Human homologs of a Drosophila Enhancer of split gene product define a Mack, D. L., Boulanger, C. A., Callahan, R. and Smith, G. H. (2007). Expression of novel family of nuclear proteins. Nat. Genet. 2, 119-127. truncated Int6/eIF3e in mammary alveolar epithelium leads to persistent hyperplasia Strobl, L. J., Hofelmayr, H., Stein, C., Marschall, G., Brielmeier, M., Laux, G., and tumorigenesis. Breast Cancer Res. 9, R42. Bornkamm, G. W. and Zimber-Strobl, U. (1997). Both Epstein-Barr viral nuclear Mao, J. H., Perez-Losada, J., Wu, D., Delrosario, R., Tsunematsu, R., Nakayama, K. antigen 2 (EBNA2) and activated Notch1 transactivate genes by interacting with the I., Brown, K., Bryson, S. and Balmain, A. (2004). Fbxw7/Cdc4 is a p53-dependent, cellular protein RBP-J kappa. Immunobiology 198, 299-306. haploinsufficient tumour suppressor gene. Nature 432, 775-779. Sun, Y., Nonobe, E., Kobayashi, Y., Kuraishi, T., Aoki, F., Yamamoto, K. and Sakai, Matsuno, K., Diederich, R. J., Go, M. J., Blaumueller, C. M. and Artavanis-Tsakonas, S. (2002). Characterization and expression of L-amino acid oxidase of mouse milk. J. S. (1995). Deltex acts as a positive regulator of Notch signaling through interactions Biol. Chem. 277, 19080-19086. with the Notch ankyrin repeats. Development 121, 2633-2644. Sun, Y., Lowther, W., Kato, K., Bianco, C., Kenney, N., Strizzi, L., Raafat, D., Hirota, Mazaleyrat, S. L., Fostier, M., Wilkin, M. B., Aslam, H., Evans, D. A., Cornell, M. M., Khan, N. I., Bargo, S. et al. (2005a). Notch4 intracellular domain binding to and Baron, M. (2003). Down-regulation of Notch target gene expression by Suppressor Smad3 and inhibition of the TGF-beta signaling. Oncogene 24, 5365-5374. of deltex. Dev. Biol. 255, 363-372. Sun, Y., Strizzi, L., Raafat, A., Hirota, M., Bianco, C., Feigenbaum, L., Kenney, N., McGeady, M. L., Kerby, S., Shankar, V., Ciardiello, F., Salomon, D. and Seidman, M. Wechselberger, C., Callahan, R. and Salomon, D. S. (2005b). Overexpression of (1989). Infection with a TGF-alpha retroviral vector transforms normal mouse mammary human Cripto-1 in transgenic mice delays mammary gland development and epithelial cells but not normal rat fibroblasts. Oncogene 4, 1375-1382. differentiation and induces mammary tumorigenesis. Am. J. Pathol. 167, 585-597. Merlo, G. R., Venesio, T., Taverna, D., Marte, B. M., Callahan, R. and Hynes, N. E. Takebayashi, K., Sasai, Y., Sakai, Y., Watanabe, T., Nakanishi, S. and Kageyama, R. (1994). Growth suppression of normal mammary epithelial cells by wild-type p53. (1994). Structure, chromosomal locus, and promoter analysis of the gene encoding the Oncogene 9, 443-453. mouse helix-loop-helix factor HES-1. Negative autoregulation through the multiple N Michelsen, K., Schmid, V., Metz, J., Heusser, K., Liebel, U., Schwede, T., Spang, A. box elements. J. Biol. Chem. 269, 5150-5156. and Schwappach, B. (2007). Novel cargo-binding site in the {beta} and {delta} Talora, C., Campese, A. F., Bellavia, D., Felli, M. P., Vacca, A., Gulino, A. and subunits of coatomer. J. Cell Biol. 179, 209-217. Screpanti, I. (2008). Notch signaling and diseases: an evolutionary journey from a Momand, J., Zambetti, G. P., Olson, D. C., George, D. and Levine, A. J. (1992). The simple beginning to complex outcomes. Biochim. Biophys. Acta 1782, 489-497. mdm-2 oncogene product forms a complex with the p53 protein and inhibits p53- Tao, L., Roberts, A. L., Dunphy, K. A., Bigelow, C., Yan, H. and Jerry, D. J. (2010). mediated transactivation. Cell 69, 1237-1245. Repression of mammary stem/progenitor cells by P53 is mediated by Notch and Montes de Oca Luna, R., Wagner, D. S. and Lozano, G. (1995). Rescue of early separable from apoptotic activity. Stem Cells 29, 119-127. embryonic lethality in mdm2-deficient mice by deletion of p53. Nature 378, 203-206. Vikhanskaya, F., Colella, G., Valenti, M., Parodi, S., D’Incalci, M. and Broggini, M. Mukherjee, A., Veraksa, A., Bauer, A., Rosse, C., Camonis, J. and Artavanis-Tsakonas, (1999). Cooperation between p53 and hMLH1 in a human colocarcinoma cell line in S. (2005). Regulation of Notch signalling by non-visual beta-arrestin. Nat. Cell Biol. 7, response to DNA damage. Clin. Cancer Res. 5, 937-941. 1191-1201. Vogelstein, B., Lane, D. and Levine, A. J. (2000). Surfing the p53 network. Nature 408, Picksley, S. M. and Lane, D. P. (1993). The p53-mdm2 autoregulatory feedback loop: a 307-310. paradigm for the regulation of growth control by p53? BioEssays 15, 689-690. Weng, A. P., Ferrando, A. A., Lee, W., Morris, J. P. T., Silverman, L. B., Sanchez- Raafat, A., Bargo, S., Anver, M. R. and Callahan, R. (2004). Mammary development Irizarry, C., Blacklow, S. C., Look, A. T. and Aster, J. C. (2004). Activating mutations and tumorigenesis in mice expressing a truncated human Notch4/Int3 intracellular of NOTCH1 in human T cell acute lymphoblastic leukemia. Science 306, 269-271. domain (h-Int3sh). Oncogene 23, 9401-9407. Wu, G., Lyapina, S., Das, I., Li, J., Gurney, M., Pauley, A., Chui, I., Deshaies, R. J. Raafat, A., Zoltan-Jones, A., Strizzi, L., Bargo, S., Kimura, K., Salomon, D. and and Kitajewski, J. (2001). SEL-10 is an inhibitor of notch signaling that targets notch Callahan, R. (2007). Kit and PDGFR-alpha activities are necessary for Notch4/Int3- for ubiquitin-mediated protein degradation. Mol. Cell. Biol. 21, 7403-7415.

Journal of Cell Science induced tumorigenesis. Oncogene 26, 662-672. Wu, L., Aster, J. C., Blacklow, S. C., Lake, R., Artavanis-Tsakonas, S. and Griffin, J. Raafat, A., Lawson, S., Bargo, S., Klauzinska, M., Strizzi, L., Goldhar, A. S., Buono, D. (2000). MAML1, a human homologue of Drosophila mastermind, is a transcriptional K., Salomon, D., Vonderhaar, B. K. and Callahan, R. (2009). Rbpj conditional co-activator for NOTCH receptors. Nat. Genet. 26, 484-489. knockout reveals distinct functions of Notch4/Int3 in mammary gland development and Yang, Y., Lorick, K. L., Jensen, J. P. and Weissman, A. M. (2005). Expression and tumorigenesis. Oncogene 28, 219-230. evaluation of RING finger proteins. Methods Enzymol. 398, 103-112. Robbins, J., Blondel, B. J., Gallahan, D. and Callahan, R. (1992). Mouse mammary Zhao, L. Y., Liu, J., Sidhu, G. S., Niu, Y., Liu, Y., Wang, R. and Liao, D. (2004). tumor gene int-3: a member of the notch gene family transforms mammary epithelial Negative regulation of p53 functions by Daxx and the involvement of MDM2. J. Biol. cells. J. Virol. 66, 2594-2599. Chem. 279, 50566-50579.