A Dissertation Entitled Brain Insulin-Like Growth Factor 1 Receptor and Insulin Receptor in Metabolism and Reproduction by Mengj

A Dissertation

entitled

Brain Insulin-Like Growth Factor 1 Receptor and Insulin Receptor in Metabolism and

Reproduction

Mengjie Wang

Submitted to the Graduate Faculty as partial fulfillment of the requirements for the

Doctor of Philosophy Degree in Biomedical Science

______Dr. Jennifer W. Hill, Committee Chair

______Dr. Beata Lecka-Czernik, Committee Member

______Dr. Edwin Sanchez, Committee Member

______Dr. David Giovannucci, Committee Member

______Dr. Joshua Park, Committee Member

______Dr. Cyndee Gruden, Dean College of Graduate Studies

The University of Toledo

August 2019

This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of

Brain Insulin-Like Growth Factor 1 Receptor and Insulin Receptor in Metabolism and Reproduction by

Mengjie Wang

Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Doctor of Philosophy Degree in Biomedical Sciences

The University of Toledo

August 2019

Insulin-like growth factor 1 (IGF-1) and insulin exert biological effects through highly homologous tyrosine kinase receptors, which are ubiquitously expressed in rodents. During the last two decades, substantial progress has been made in understanding the role of IGF-1 and insulin signaling in the brain. Major progress has been made in identifying differences of IGF-1 and insulin signaling in the brain and understanding the phenotypic discrepancies of disruptions of the IGF-1 receptors

(IGF1Rs) and insulin receptors (IRs) in the brain. Metabolic diseases such as obesity and diabetes are global public health crises. Moreover, perturbations of metabolism cause various reproductive diseases such as abnormal puberty onset, irregular estrus cycle, altered ovarian function, infertility and reproductive system cancers. Thus, understanding and deciphering brain IGF1R and IR signaling are crucial to current research and crucial for potential therapeutic interventions for metabolic and reproductive diseases.

Neurons are the fundamental units of the brain and carry out distinct functions, which raises another challenge -- understanding the role of a given subset of neurons.

Two subsets of neurons-leptin receptor (LepRb) neuron and kisspeptin (Kiss1) neuron

iii have drawn my attention due to their distinct activities in metabolism and reproduction respectively. Current technique Cre/loxP system enables conditional suppression of gene expression in distinct subsets of neurons of interest. We used this technique to generate transgenic mice to study the role of IGF1R and IR signaling in LepRb neurons and Kiss1 neurons. Chapter 1 gives a review of metabolic and reproductive function of IGF1R and

IR, and a central control of metabolism and reproduction by LepRb neurons and Kiss1 neurons.

By characterizing reproductive and metabolic phenotype of mice lacking IGF1Rs and/or IRs exclusively in LepRb neurons (IGF1RLepRb mice and IGF1R/IRLepRb mice), we found that IGF1RLepRb and IGF1R/IRLepRb mice experienced growth retardation, delayed puberty and impaired fertility. Male mice had decreased gonadotropin and testosterone levels, impaired testicular histology, suggesting direct disruptions of hypothalamic-pituitary-gonadal axis. Interestingly, female reproductive hormones were normal at 4 weeks of age, while IGF1R/IRLepRb showed elevated gonadotropin and decreased follicle counts compared to female IGF1RLepRb or control mice. The decreased serum growth hormone (GH) and IGF-1 levels in male IGF1RLepRb mice demonstrates communication between LepRb neurons and the GH/IGF-1 axis. Our findings highlight the importance of IGF1R in LepRb neurons in the regulation of body growth, puberty and fertility (Chapter 2).

In Chapter 3, we found female IGF1RLepRb mice had decreased body weight and food intake accompanied by increased VO2, physical activity, and thermogenic gene expression in brown adipose tissue (BAT). These effects were sexually dimorphic;

IGF1R signaling was not critical in regulating body weight, food intake or glucose

iv homeostasis in male mice. Interestingly, IGF1R/IRLepRb mice showed dramatically increased fat mass percentage and insulin insensitivity compared to either IGF1RLepRb or control mice. In sum, loss of IGF1R in LepRb neurons confers resistance to obesity due to increased energy expenditure (EE), showing IGF1R signaling is obesogenic. These effects diminished in IGF1R/IRLepRb mice due to decreased EE and physical activity and increased lipid storage in BAT, suggesting IR signaling in LepRb neurons has an overall protective effect against obesity. Thus, our findings provide novel evidence that IGF1R and IR signaling in LepRb neurons interact and provide counterbalancing effects on the regulation of body composition and insulin sensitivity.

Kiss1 neurons express LepRbs; however, we have shown that leptin’s effects on puberty in mice do not require Kiss1 neurons. But we do not know whether the effects of

IGF1R and IR signaling require Kiss1 neurons. To answer this question, we have now generated transgenic mice lacking IGF1Rs and/or IRs exclusively in Kiss1 neurons

(IGF1RKiss1 mice and IGFR/IRKiss1 mice) (Chapter 4). We found that IGF1RKiss1 mice experienced decreased body weight, body length, delayed pubertal development and decreased litter size. Surprisingly, these parameters were comparable between the

IGF1RKiss1 and IGF1R/IRKiss1 mice. These results indicate IGF1R signaling in Kiss1 neurons is the major driver of effects on body weight, body length and adult fertility.

Notably, IGF1R/IRKiss1 mice had significantly increased fat mass, decreased physical activity and disrupted glucose homeostasis, which suggest IGF1R and IR may have compensatory effects in the regulation of fat mass, physical activity and glucose homeostasis. In summary, IGF1R and IR signaling in Kiss1 neurons have unique and cooperative roles in regulating metabolic and reproductive functions.

The reproductive axis is linked to nutritional status. Previous chapters demonstrated that undernutrition (decreased food intake and body weight) was associated with reproductive dysfunctions, in Chapter 5 we discussed the role of overnutrition in reproduction. Recent work shows that gut microbial dysbiosis contributes to the risk of obesity in children whose mothers consume a high fat diet during both gestation and lactation or gestation alone. Obesity predisposes children to developing early puberty.

However, to date, no study has examined how maternal high-fat-diet (MHFD) during lactation regulates pubertal timing, and fertility of children. Here, we found MHFD during lactation markedly altered the gut microbiota of dams and offspring. This outcome was associated with juvenile obesity, early puberty, and irregular estrous cycles. We also found that MHFD induced early puberty may be mediated by increased IGF-1 signaling.

Moreover, MHFD during lactation disrupted glucose and energy homeostasis.

Remarkably, permitting coprophagia between MHFD and maternal normal chow offspring successfully reversed early puberty and insulin insensitivity. Our data suggest that microbial reconstitution may prevent or treat early puberty and insulin insensitivity.

In summary, this dissertation 1) dissected the crucial role of IGF1R and IR signaling in metabolism and reproduction in distinct subsets of neurons; 2) demonstrated

IGF1R signaling in both LepRb and Kiss1 neurons plays a dominant role in the regulation of puberty, fertility and growth; 4) IGF1R and IR signaling in both LepRb neurons and

Kiss1 neurons have compensatory roles in the regulation of body composition and glucose homeostasis; 5) finally, demonstrated MHFD during lactation is crucial to metabolic and reproductive health of offspring, which is mediated via modulation of gut microbiota.

Dedicated to those who are dedicated to the cause of Medicine.

Acknowledgements

I would like to express my sincere gratitude to the College of Medicine and Life

Sciences and the Department of Physiology and Pharmacology for letting me fulfill my dream of being a Ph.D. student here. To my committee, Dr. Beata Lecka-Czernik, Dr.

Edwin Sanchez, Dr. David Giovannucci, and Dr. Joshua Park, I am extremely grateful for your assistance and suggestions throughout my projects. To the staff at the Department of

Physiology and Pharmacology, thank you for helping me preparing everything for my graduation. Most of all, I am fully indebted to Dr. Jennifer W. Hill, my principal investigator, for her wisdoms, patience, enthusiasm, and encouragement and for pushing me farther than I thought I could go.

To all my friends, Latrice, Erin, Shermal, Yetunde and Alisha for helping me survive all the stress and not letting me give up, thank you. I am grateful to my father,

Xicheng Wang and my mother Qiaoling Li for their unconditional love, unending support and encouragement. I also thank my parents-in-law Anying Zhang and Wenwen Sun for helping us taking care of my son. I am grateful to my husband, Youjie Zhang, for letting me share life, love and parenthood with a wonderful man like you.

Lastly, thank you to my son Noah for choosing me and allowing me to be his mom. I love him more with each passing day.

Table of Contents

Abstract ...... iii

Acknowledgements ...... v

Table of Contents ...... vi

List of Figures ...... ix

List of Abbreviations ...... xii

List of Symbols ...... xv

1 Literature Review...... 1

1.1 Insulin-like growth factor 1 (IGF-1) receptor (IGF1R) signaling and functions

in metabolism and reproduction ...... 1

1.2 Insulin Receptor (IR)…………...... 5

1.3 Leptin receptor (LepRb)-expressing neurons and functions in metabolism and

reproduction …………...... 7

1.4 Kisspeptin neurons and functions in reproduction and metabolism ...... 12

1.5 The gut microbiota dysbiosis in offspring health ...... 18

1.6 References ...... 22

2 IGF-1 Receptors and Insulin Receptors in LepRb Neurons Impact Puberty,

Fertility and Body Growth ...... 35

2.1 Abstract…...... 35

2.2 Introduction ...... 36 vi

2.3 Materials and Methods ...... 39

2.4 Results…… ...... 46

2.5 Discussion...... 61

2.6 References ...... 66

3 IGF-1 and Insulin Receptors Have Diverging Roles in Energy and Glucose

Homeostasis in Leptin Responsive Neurons ...... 75

3.1 Abstract…...... 75

3.2 Introduction ...... 76

3.3 Materials and Methods… ...... 78

3.4 Results…… ...... 80

3.5 Discussion...... 91

3.6 References ...... 96

4 Unique Role of IGF-1 Receptors and Insulin Receptors in Kisspeptin Neurons in

Reproduction and Metabolism ...... 101

4.1 Abstract…...... 101

4.2 Introduction ...... 102

4.3 Materials and Methods ...... 105

4.4 Results…… ...... 111

4.5 Discussion...... 128

4.6 References ...... 130

5 Fecal Microbes Reversed Insulin Resistance and Early Puberty Induced by

Maternal High-fat-diet during Lactation ...... 135

5.1 Abstract…...... 135

vii

5.2 Introduction ...... 135

5.3 Materials and Methods ...... 138

5.4 Results…… ...... 143

5.5 Discussion...... 162

5.6 References ...... 168

6 Summary……...... 175

Appendices ...... 177

A Mouse primers for measurement of gene expression …………..…………...…177

viii

List of Figures

1-1 Sequence and structural similarities of insulin-family proteins, insulin, IGF-1 and

IGF-2 ...... 2

1-2 Similar signaling cascades involved with neuroprotection for insulin-like peptides

and sex hormones ...... 3

1-3 Structure of leptin receptor isoforms ...... 9

1-4 Major structural features of human kisspeptins, the products of the Kiss1 gene .. 13

1-5 Kisspeptin projections to GnRH neurons in adult female mice ...... 14

1-6 A schematic representation of Kiss1 signaling in the forebrain of the mouse ...... 15

1-7 Schematic representation of the interaction of systemic metabolic cues with

Kisspeptin (KP), orexigenic, and anorexigenic neurons ...... 17

1-8 Factors shaping the neonatal microbiome ...... 20

2-1 Disrupted IGF1R expression and/or IR signaling in in IGF1RLepRb and

IGF1R/IRLepRb mice ...... 47

2-2 Delayed puberty in IGF1RLepRb and IGF1R/IRLepRb mice ...... 50

2-3 Impaired fertility in IGF1RLepRb and IGF1R/IRLepRb female mice...... 53

2-4 Impaired fertility in IGF1RLepRb and IGF1R/IRLepRb male mice...... 54

2-5 Impaired fertility under high-fat-diet feeding and advanced reproductive ageing in

IGF1RLepRb mice ...... 56

2-6 Decreased body growth and hormone changes in IGF1RLepRb and IGF1R/IRLepRb

mice ...... 58

2-7 Bone phenotype changes in IGF1RLepRb mice ...... 60

3-1 Body weight and composition changes in IGF1RLepRb and IGF1R/IRLepRb mice .. 83

3-2 Altered energy homeostasis in IGF1RLepRb and IGF1R/IRLepRb female mice ...... 85

3-3 Altered energy homeostasis in IGF1RLepRb and IGF1R/IRLepRb male mice ...... 86

3-4 Glucose intolerance in female IGF1RLepRb mice and insulin insensitivity in female

IGF1R/IRLepRb mice ...... 88

3-5 Insulin insensitivity in male IGF1R/IRLepRb mice ...... 90

4-1 Decreased IGF1R and IR expression in IGF1RKiss and IGF1RKiss mice ...... 113

4-2 Divergent role of IGF1R and IR signaling in Kiss1 neurons in regulating energy

homeostasis in female mice ...... 115

4-3 Role of IGF1R and IR signaling in Kiss1 neurons in regulating energy

homeostasis in male mice ...... 117

4-4 Insulin insensitivity in female IGF1R/IRKiss1 mice ...... 118

4-5 Glucose intolerance in male IGF1R/IRKiss1 mice ...... 120

4-6 Body growth in IGF1RKiss1 and IGF1R/IRKiss1 Mice ...... 121

4-7 Delayed pubertal development in IGF1RKiss1 and IGF1R/IRKiss1 mice...... 123

4-8 Decreased littersize and changes of LH and LH/FSH ratio in IGF1RKiss1 and

IGF1R/IRKiss1 female mice ...... 125

4-9 Decreased pregnancy rate and changes of LH and LH/FSH ratio in IGF1RKiss and

IGF1R/IRKiss male mice ...... 127

5-1 MHFD during Lactation significantly altered the gut microbiota in dams ...... 145

5-2 MHFD offspring demonstrated increased body weight and fat mass which were

associated with alterations in the gut microbiota composition ...... 149

5-3 Co-housing MHFD with NCD offspring successfully reversed early puberty in

MHFD-co offspring ...... 152

5-4 Dynamic change of the gut microbiota in offspring and co-housing reversed early

puberty was positively correlated bacterial richness...... 154

5-5 MHFD induced microbiota dysbiosis and advanced puberty were associated with

increased hypothalamic and liver IGF-1 protein expression and

hyperinsulinemia…………………………………………………………..……156

5-6 Co-housing MHFD with NCD offspring increased food intake and decreased

respiratory exchange ratio in NCD-co offspring ...... 159

5-7 Co-housing MHFD with NCD offspring increased food intake and decreased

respiratory exchange ratio in NCD-co offspring ...... 161

List of Abbreviations

AgRP...... Agouti-related protein AKT ...... Protein kinase B ARC ...... Arcuate nucleus AUC ...... Area under curve AVPV ...... Anteroventral periventricular nucleus

BAT ...... Brown adipose tissue

DAG ...... Diacylglycerol DDREADs ...... Designer receptors exclusively activated by designer drugs DMH ...... Dorsomedial hypothalamus

E...... Estradiol ERK ...... RAS-extracellular signal-related kinase

FIRIGKO ...... Fat-specific IGF1R and IR knockout FMT ...... Fecal microbiota transplantation FOXO ...... Forkhead box FSH ...... Follicle-stimulating hormone

GH ...... Growth hormone GnRH ...... Gonadotropin-releasing hormone GPR54/Kiss1R ...... G-protein coupled receptor 54/ Kisspeptin receptor GS3K ...... Glycogen synthase 3 kinase GTT ...... Glucose tolerance test

HFD ...... High-fat-diet HPG ...... Hypothalamic-pituitary-gonadal

IGF-1...... Insulin-like growth factor 1 IGF1R ...... Insulin-like growth factor 1 receptor IGF-2 ...... Insulin-like growth factor 2 IHH ...... idiopathic hypogonadotrophic hypogonadism IP3 ...... Inositol triphosphate IR ...... Insulin receptor IRS ...... Insulin receptor substrate IRS-2 ...... Insulin receptor substrate 2 xii

ITT ...... Insulin tolerance test

Kir ...... Inward-rectifier potassium channel KIRKO……………...Kisspeptin-specific insulin receptor knockout KNDy ...... Kisspeptin/neuronkininB/dynorphin KO ...... Knockout Kp ...... Kisspeptin

LepR ...... Leptin receptor LH ...... Luteinizing hormone LHA ...... Lateral hypothalamic area

MHFD ...... Maternal high-fat-diet MHFD-co ...... Co-housed MHFD offspring MIGIRKO ...... Muscle-specific IGF1R and IR knockout MMP-9 ...... Matrix metalloproteinase-9 mTOR ...... Mammalian target of rapamycin

NCD ...... Normal chow diet NCD-co ...... Co-housed NCD offspring NF-κB ...... Nuclear factor Κb NKB ...... Neurokinin B NPY ...... Neuropeptide Y ob/ob ...... Leptin gene OTUs...... Operational Taxonomic Units

P ...... Progesterone PCoA...... Principal coordinate analysis PCOS ...... Polycystic ovarian syndrome PI3K ...... Phosphoinositide 3-kinase PIP2 ...... Phosphatidylinositol biphosphate PKC ...... Protein kinase C PLC ...... Phospholipase C PMv ...... Central premammillary nucleus POMC ...... Proopiomelanocortin PPARγ ...... peroxisome proliferator-activated receptor gamma PVN ...... Paraventricular nucleus

RER ...... Respiratory exchange ratio

SCFAs ...... Short-chain fatty acid SF-1 ...... Steroidogenic factor 1

T...... Testosterone TRPC ...... Transient receptor potential channel xiii

VMN ...... Ventromedial hypothalamic nucleus

W0 ...... Day of delivery W10 ...... 10 weeks-old W3 ...... Day of weaning

xiv

List of Symbols

℃ ...... Degree Celsius g ...... gram kcal...... kilocalories kg ...... kilogram mg ...... milligram μl ...... microliter

Chapter 1

Literature review

1.1 Insulin-like growth factor 1 (IGF-1) receptor (IGF1R) signaling and functions in metabolism and reproduction

IGF-1 biology

IGF-1 is a 70-amino acid polypeptide hormone that is encoded by the IGF1 gene

[1]. The growth hormone (GH)/IGF-1 axis plays important roles in various physiologic processes including growth [2], glucose homeostasis [3] and anabolic effects [4].

Circulating IGF-1, primarily produced from liver, is a primary mediator of the effects of

GH. Production of IGF-1 is stimulated by GH and can be influenced by the following factors: insulin levels, nutrition level and body mass index, and disease state [5].

IGF-1 shares sequence and structural similarities with insulin [6] (Figure 1-1).

The structural conservation is due to the fact that proinsulin, IGF-1 and IGF-2 evolved from a single precursor molecule [7]. IGF-2 actions have been poorly characterized, but related roles have been determined for fetus development and cerebral protection [8, 9].

IGF-1’s primary action is mediated by binding to cell surface receptors tyrosine kinases:

IGF-1 receptor (IGF1R), insulin receptor (IR), and IGF-1/insulin hybrid receptor [10].

Figure 1-1 Sequence and structural similarity of insulin-family proteins, insulin, IGF-1 and IGF-2. (A) Sequence comparison: residual similarity between all three proteins is indicated with light blue, between IGFs in green, between insulin and IGF-1 in orange, and between insulin and IGF-2 in yellow. Amino-acids that belong to the same amino acid group are considered to be similar. (B-D) Structures of (B) insulin, (C) IGF-1, and (D) IGF-2, comparing the residues involved in the hydrophobic core. In insulin, the β chain is shown in black and the α chain in orange. The spatial positions of the residues in the hydrophobic core are very similar in all three proteins. IGF-1, insulin-like growth factor 1; IGF-2, insulin-like growth factor 2. (Figure adapted with permission from [6])

IGF1R structure and signaling

Two α subunits and two β subunits make up the IGF1R. The α chains are located extracellularly, while the β subunits span the membrane and are responsible for intracellular signal transduction upon ligand stimulation [11]. In response to ligand binding, the α chains induce the tyrosine autophosphorylation of the β chains of IGF1R, which subsequently triggers a cascade of intracellular signaling [12, 13]. This event provokes the phosphorylation of intracellular proteins known as insulin receptor substrates (IRS). The phosphorylation of the IRS then activates a signal transduction cascade that mediates the intracellular effects of IGF-1 [12, 13]. The binding of IGF-1 to

IGF1R triggers 2 canonical signaling pathways: the phosphoinositide 3-kinase (PI3K)-

AKT and the RAS-extracellular signal-related kinase (ERK) pathways. Signaling through

IGF-1/AKT pathways promotes cell growth in response to the stimulation of growth factors, including insulin and IGF-1 [14-16] (Figure 1-2).

Figure 1-2 Similar signaling cascades involved with neuroprotection for insulin-like peptides and sex hormones. The IR, IGF1R, and insulin-IGF1 hybrid receptor enact their neuroprotection through the MAPK-ERK or PI3K-Akt pathways signaling cascades. Although IGF1R can directly activate the RAS-ERK pathway, both the insulin-like peptide receptors and the estrogen receptor alpha (ERα) firstly interact with insulin receptor substrate 1 (IRS-1) scaffolding proteins. ERα and the androgen receptor (AR) can also directly modulate PI3K-Akt and MAPK-ERK signaling. Both IRS-1 and p85 binding of PI3K are increased with ERα activation, leading to downstream Akt- derived inhibition of glycogen synthase kinase 3 (GSK3) and mammalian target of rapamycin (mTOR). GSK3, specifically, is involved with glycogen synthesis, while both effectors are involved in apoptosis. A similar effect may occur with AR’s ability to modulate p85 binding to PI3K. AR-induced MAPKERK signaling also results in ribosomal S6 kinase (Rsk) expression that can inhibit the pro-apoptosis bcl-2-associated death promoter protein, as well as effects on the ER, GSK3, and the ETS-like transcription factor, ELK1. Solid black arrows indicate downstream interaction. Dashed black arrows represent the influence of kinases or proteins on the cellular environment. Dashed blue arrows represent the binding capabilities of IGF1 and insulin across all three receptor types. (Figure adapted with permission from [16])

IGF1R signaling in metabolism

IGF-1 plays a very significant role in growth, since its action contributes approximately 30% of the adult body size and sustains postnatal development, including metabolic and reproductive functions of both mouse sexes [17-19]. The overarching effect of IGF-1 on metabolism is to provide a signal to cells that adequate nutrients are available to avoid apoptosis, enhance cellular protein synthesis, enable cells to undergo hypertrophy in response to an appropriate stimulus and to allow stimulation of cell division. Therefore, even in cytostatic adult tissues such as neurons and fused skeletal myoblasts, IGF-1 can provide important trophic effects that lead to changes in cellular metabolism [20]. Importantly, since IGF-1’s effects on metabolism are regulated coordinately with insulin in the target tissue, either insulin or IGF-1 may be the primary determinant of these effects [21]. In human studies, lower serum IGF-1 levels were associated with increased waist to hip ratios and with the development of impaired glucose tolerance [22, 23]. In type 1 diabetes, the lack of adequate insulin treatment leads to markedly impaired IGF-1 synthesis from the liver [24]. Consequently, in poorly- controlled adolescent type 1 diabetics, IGF-1 can be too low for optimal growth to be achieved. In type 2 diabetes, multiple changes occur in IGF-1 activity including sensitization to its mitogenic actions in some target tissues [21].

IGF1R signaling in reproduction

Reproduction needs adequate amount of energy [25]. Lack of energy suppresses reproduction in mammals [26, 27]. However, it is unclear how metabolic or hormonal

signals modify the central control of puberty and reproduction in mice. A number of candidate molecules for communicating nutritional status have been proposed including leptin [28], insulin [29] and GH/IGF-1 [30].

Evidence shows that metabolic cues regulate gonadotropin-releasing hormone

(GnRH) neuronal activity via direct regulation at GnRH neuron, or indirect regulation of neurons that make contact with GnRH neurons [25]. For example, deletion of IGF1Rs in

GnRH neurons caused delayed onset of puberty in rodents, suggesting IGF-1 may exert direct effects on GnRH neurons [31]. Leptin may indirectly regulate reproduction via indirect pathways because leptin receptors do not appear to be located on GnRH neurons

[32]. This finding suggests leptin may exert its effects on the GnRH neurons indirectly

[33-35]. However, we do not know how IGF1R signaling in leptin receptor-expressing neurons regulates reproduction.

1.2 Insulin receptor (IR)

Insulin and IR biology

Insulin, produced by beta cells of the pancreatic islets, is an important polypeptide hormone that regulates the anabolic metabolism of the body. In pancreatic β cells, glucose is the primary physiological stimulus for the regulation of insulin synthesis [36]. Like IGF-1, the effects of insulin are initiated by binding to insulin receptor (IR), IGF1R or the hybrid receptors in the cell membrane as shown in Figure 1-

2. IR signaling shares the same PI3K pathway [14] with IGF1R signaling, so IGF1R and

IR may share compensatory roles in regulating various physiological processes.

IR signaling in metabolism

It is well-established that insulin acts on the liver [36]. Its role in the regulation of hepatic glucose production via signaling pathways in the hypothalamus has drawn increasing attention. Intracerebroventricular injection of insulin diminished hepatic glucose output, while blockade of central KATP channels with the sulfonylurea tolbutamide abolished this effect [37]. These findings led to the concept that in addition to regulating body weight homeostasis and reproductive endocrinology, hypothalamic insulin signaling also controls glucose utilization in the periphery. In addition, insulin signaling in hypothalamic neurons has been shown to control hepatic glucose production by decreasing glucose-6-phosphatase and phosphoenolpyruvate kinase expression in the liver [38]. Emerging evidence indicate that insulin in the brain is also a hormonal regulator of energy metabolism [39-41]. For example, intracerebroventricular or intranasal administration of insulin enhances the acute thermoregulatory response to food intake and body weight both in rodents and humans [42-44].

IR signaling in reproduction

Insulin is involved in many aspects of female reproductive functions, such as ovarian steroidogenesis, proliferation, gene expression, and the central control of reproduction [29, 45-47]. Hypo- or hyperinsulinemia are frequently coupled with disturbed GnRH/LH pulses and surge release patterns [48]. When the IRs were knocked out of GnRH neurons [49], pituitary [50], or theca interstitial cells of the ovary [51], all three models had partially restored fertility. However, the importance of insulin as a

regulator of GnRH/LH pulses remains to be fully elucidated, as the effects of insulin are difficult to tease apart from the role of other signals such as IGF-1. For example, in diabetic male rats, LH pulse frequency was reduced by 56% and pulse amplitude by 54% compared to non-diabetic controls. These deficits could be completely reversed by insulin treatment [52]. Similar findings were also reported in streptozotocin-induced diabetic male lambs [53]. However, the central role of insulin in regulating GnRH/LH pulses remains controversial. Miller and colleagues [54] found that infusion of insulin into the third ventricle could enhance pulsatile LH secretion in male sheep, but another group failed to see these effects in the growth-restricted, hypogonadotropic lamb after central injection of insulin into the lateral ventricle [55]. Furthermore, in this male diabetic sheep model, the magnitude of the effect of insulin infusion on LH pulse frequency was less than that of peripheral insulin [54], suggesting that insulin alone may not account for the diabetes-induced deficit in GnRH/LH pulsatile secretion. These findings imply IGF-1 and insulin share important roles in the regulation of reproductive functions.

1.3 Leptin receptor (LepRb)-expressing neurons and functions in metabolism and reproduction

Leptin biology

Leptin, a hormone derived from adipose tissue, was originally discovered in mice with a homozygous mutation of the leptin gene (ob/ob). These ob/ob mice were massively obese [56]. Leptin is considered as an anti-obesity hormone [57-59], as circulating leptin levels reflect the amount of energy stored in fat and changes in caloric

intake [60, 61]. Administration of leptin to rodents leads to decreased food intake and increased energy expenditure [62]. In addition, weight loss after peripheral or central leptin administration is restricted to adipose tissue, with no loss of lean mass [62].

However, high endogenous leptin levels in humans and other obese mammals failed to prevent obesity [63]. Hyperleptinemia is indicative of leptin resistance, which may play a role in the development of obesity [58, 59]. Indeed, obesity promotes multiple cellular processes that attenuate leptin signaling (referred to as “cellular leptin resistance”), which can subsequently exacerbate the extent of weight gain [64].

Mechanisms underlying leptin resistance may include dysregulation of leptin synthesis and/or secretion, abnormalities of brain leptin transport, and abnormalities of leptin receptors and/or post-receptor signaling [65].

Leptin receptor and signaling pathway

Leptin mediates its effects by binding to specific leptin receptors (LepRs) expressed in the brain [66-70] as well as in peripheral tissues [71]. Alternative splicing generates several isoforms of LepRs (Figure 1-3). The short LepR isoforms (LepRa,

LepRc, LepRd and LepRe) play an important role in transporting leptin across the blood– brain barrier [72], while the long isoform (LepRb) mediates signal transduction and is strongly expressed in the hypothalamus. An increasing amount of evidence shows the

LepRb is critical in the regulation of energy homeostasis and neuroendocrine function

[73-75].

The binding of leptin to the LepRb receptor activates several signaling pathways.

For example, the janus kinase-signal transducer and activator of transcription-3 (JAK-

STAT3) has been shown to be important for regulating energy homeostasis [76], while

PI3K-AKT pathway is important for regulating both food intake and glucose homeostasis

[77]. Other pathways, including Raf-mitogen-activated protein kinase (Raf-MAPK), are under investigation [78].

Figure 1-3 Structure of leptin receptor isoforms. Lep (Ob)-Rb contains the longest intracellular domain, which is crucial for leptin signaling. Ob-Ra, Ob-Rc, and Ob-Rd contain only short cytoplasmic domains. Ob-Re is truncated at position 830. Box 1 is a JAK docking site, boxes 2 and 3 are STAT docking sites. (Figure adapted with permission from [79])

The role of LepRb neurons in metabolism

LepRb expression is enriched in many nuclei of the hypothalamus, including the arcuate nucleus (ARC), ventromedial hypothalamic nucleus (VMN), dorsomedial hypothalamic nucleus (DMN), lateral hypothalamic area (LHA), paraventricular nucleus

(PVN) and central premammillary nucleus (PMv) [66-70]. Leptin, via binding LepRb in the hypothalamus, activates a complex neural circuit composed of anorexigenic and orexigenic neuropeptides that control food intake [69, 80, 81]. For example, within the

ARC, multiple neuronal populations including those expressing agouti-related protein

(AgRP), neuropeptide Y (NPY), and proopiomelanocortin (POMC) are essential for food intake and energy homeostasis [69, 80, 81]. In addition, LepRb neurons in VMN [68] and

DMN [70] are related to neuronal circuits that control energy homeostasis. The transcription factor steroidogenic factor 1(SF-1) in the VMN directs transcriptional programs relevant to coordinated control of energy homeostasis, especially after excess caloric intake [68]. Injection of leptin into the DMN activates sympathetic outflow to brown adipose tissue (BAT) increasing thermogenesis [70].

Recent evidence also shows that growth hormone receptor-leptin neurocircuitry in

ARC, DMN and LHA plays an important role in the regulation of glucose metabolism more generally [66]. Besides energy homeostasis, we have found that PI3K signaling in

LepRb neurons of the PVN also plays an essential role in growth, which is independent from insulin signaling [82]. Since insulin and IGF-1 signaling may have compensatory effects in the regulation of metabolism, we studied the role of IGF1R and/or IR signaling in LepRb neurons in metabolism (Chapter 3).

The role of LepRb neurons in reproduction

Reproduction requires adequate amount of energy. In response to fasting, serum leptin levels were decreased, triggering the neuroendocrine response to acute energy deprivation [60, 83]. The subsequent responses include decreasing reproductive hormone levels which causes subfertility and infertility (an energy-requiring process), decreasing thyroid hormone levels that slow metabolic rate, and decreasing IGF-1 levels that may slow growth-related processes in both mice and humans [60, 84]. The interactions between leptin and the growth hormone (GH)/IGF-1 are more important in rodents than humans since patients with congenital leptin deficiency have normal linear growth, unlike mice with growth retardation [84, 85]. In response to high-fat-diet (HFD) feeding, mice exhibited impaired hypothalamic-pituitary-ovarian functions, including fewer ovulated oocytes and fewer pups per litter [86]. The alteration of insulin and leptin signaling may be linked to the HFD-induced reproductive dysfunction [86-88].

Insulin signaling in the ovary and pituitary stimulates only the PI3K pathway

[89], which overlaps with the LepRb signaling. The mechanism by which leptin triggers

PI3K activity is thought to be via phosphorylation of insulin receptor substrate-2 (IRS-2)

[90, 91]. IRS-2 is expressed in hypothalamic sites responsive to leptin and related to metabolic control, including the arcuate nucleus and the VMN of the hypothalamus [92].

Surprisingly, one recent study has shown that mice with inactivation of IRS-2 specifically in LepRb neurons are fertile, but whether these mice display regular puberty onset, cyclicity and sex hormone levels has not been reported [93]. We previously found that knockout PI3K in LepRb neuronscaused infertility, however this effect was independent

of insulin signaling. These findings indicate that rather than IR signaling, the IGF1R signaling may play a central role in the regulation of reproductive functions in mice [82].

More details are presented in Chapter 2.

1.4 Kisspeptin neurons and functions in reproduction and metabolism

Kisspeptin biology and molecular mechanism

Kisspeptin, encoded by the Kiss1 gene, was initially identified as a suppressor of metastasis [94, 95]. The discovery of kisspeptin as a critical regulator of puberty came about in 2003 when it was discovered that some individuals with a congenital GnRH deficiency known as idiopathic hypogonadotrophic hypogonadism (IHH) have a mutation in Kiss1 [96, 97]. Evidence later identified kisspeptin as one of the critical regulators for both puberty onset and maintenance of normal reproductive functions in mammals [96-

98].

Figure 1-4 shows that different kisspeptins are generated by the cleavage from a common precursor, the prepro-kisspeptin. The central 54-amino acid region is kisspeptin-

54 (Kp-54). Expression of the Kiss1 gene and the gene encoding its cognate receptor, the

G-protein coupled receptor 54 (GPR54, also called Kiss1R) has been detected in the brain and peripheral tissues, including the pancreas, liver, small intestine, pituitary, and placenta [95, 99, 100].

Figure 1-4 Major structural features of human kisspeptins, the products of the Kiss1 gene. Different kisspeptins are generated by the cleavage from a common precursor, the prepro-kisspeptin. The prepro-kisspeptin contains 145 amino acids, with a 19-amino acid signal peptide and a central 54-amino acid region, kisspeptin-54 (Kp-54; formerly termed as metastin). Further cleavage of metastin generates kisspeptins of lower molecular weight: kisspeptin-14 (Kp-14), Kp-13, and Kp-10. (Figure adapted with permission from [101])

Both direct and indirect communication between Kiss1 and GnRH neurons have been reported. Evidence support direct communication between kisspeptin and GnRH neurons, since the majority of GnRH neurons express Kiss1R [102, 103] and kisspeptin projects to GnRH neurons [104, 105] (Figure 1-5). Kiss1 neurons coexpress a specific set of neurons in the ARC and these neurons are called kisspeptin/neurokinin B and dynorphin (KDNy) neurons [106]. Recent evidence using (designer receptors exclusively activated by designer drugs) DREADDs/optogenetics have shown conclusively that

KDNy neuron activity drives GnRH pulses [107, 108]. Besides acting directly on GnRH neurons, there is growing evidence to suggest that kisspeptin also acts on intermediary neurons, such as gamma-aminobutyric acid-ergic (GABAergic) cells, to regulate GnRH secretion [109].

Figure 1-5 Kisspeptin projections to GnRH neurons in adult female mice. Confocal stack of 75 images showing a single GnRH neuron (green) with kisspeptin (red) fibers surrounding and apposed to it. Single 370-nm-thick optical sections through the three regions indicated by a, b, and c of the GnRH neuron are given below to demonstrate the close apposition between kisspeptin fibers and GnRH neuron elements. Scale bar, 10 μm. (Figure adapted with permission from [110])

Kiss1 expression and functions in puberty and reproduction

In mammals, kisspeptin is abundantly expressed in two main populations of neurons in the hypothalamus, the ARC and the anteroventral periventricular nucleus

(AVPV) of the forebrain [111-113]. Estrogens are key regulators of kisspeptin expression in pre- and postpubertal female mice [114] and rats [115]. They potently exert inhibitory effects on hypothalamic ARC neurons and stimulatory actions in AVPV neurons. Furthermore, epigenetic regulation of the Kiss1 gene is reported to be involved in estrogen-positive feedback to stimulate GnRH during the pre-ovulatory surge [116], as shown in Figure 1-6.

Figure 1-6 A schematic representation of Kiss1 signaling in the forebrain of the mouse. Kisspeptin stimulates GnRH secretion by a direct effect on GnRH neurons, most of which express the kisspeptin receptor, Kiss1R. Neurons that express Kiss1 mRNA reside in the AVPV and the ARC. Kiss1 neurons in the ARC appear to be involved in the negative feedback regulation of GnRH/LH by sex steroids. The expression of Kiss1 mRNA in the arcuate is inhibited by estradiol (E), progesterone (P), and testosterone (T). These same hormones induce Kiss1mRNA expression in the AVPV, where Kiss1 neurons are thought to be involved in the positive feedback regulation of GnRH/LH. (Figure adapted with permission from [116]).

Puberty is initiated by creating a constant increase in pulsatile release of GnRH from hypothalamus, which activates the downstream elements causing a rise in gonadotropins and sex hormones, gametogenesis, secondary sex characteristics and rapid growth that lead to the achievement of fertility [117]. In primates, mice and rats, an increase in both the number of Kiss1 neurons and the content of Kiss1 mRNA has been reported during juvenile-pubertal transition [102, 112, 118]. Juvenile mice and humans lacking Kiss1 gene or Kiss1R with inactivating kisspeptin receptor mutations fail to enter puberty [96, 97, 119].

Increasing evidence suggests that hypothalamic kisspeptin signaling also plays a critical role in the generation of the pre-ovulatory LH surge, which is necessary for normal fertility [120]. In adult mammalian species including mice [120], rats [121] and humans [122], central and peripheral kisspeptin administration results in a marked rise in plasma LH. This effect is abolished in mice and humans lacking Kiss1R [123, 124].

Kiss1 neurons in metabolism

While most previous studies focused on the role of kisspeptin in reproductive functions, new, controversial evidence suggests Kiss1 neurons may also serve to regulate energy balance. Kiss1 neurons may indirectly regulate metabolic functions via sending afferents to first-order NPY/AgRP and POMC/CART neurons [125, 126] (Figure 1-7).

These “metabolically important” neurons may possess Kiss1R because POMC and NPY have co-expressed with Kiss1R in cells within the ARC [127-129]. Recently, kisspeptin signaling has been revealed to be a significant player in regulating feeding behavior, glucose homeostasis, body composition, and cardiac function [130, 131]. Stengel and colleagues [132] found that central administration of kisspeptin decreases food intake by increasing meal interval in mice. A recent study [133] showed that kisspeptin activates

POMC neurons, whereas NPY neurons are inhibited in mice. In addition, kisspeptin positive fibers have been reported to communicate with POMC neurons, and Kiss1Rs are expressed in these neurons [133]. Taken together, these data suggest that the inhibitory effect of kisspeptin on food intake may be exerted via stimulation of POMC and inhibition of NPY signaling. Tolson and colleagues [131] found that the Kiss1R KO

mice displayed dramatically higher body weight, leptin levels, adiposity, and changes of energy homeostasis, along with strikingly impaired glucose tolerance. Even though the underlying mechanisms of the obesity and glucose impairment in Kiss1R KO mice is unknown, their findings of obesity and reduced energy expenditure in Kiss1R KO mice matches the reported ability of kisspeptin to inhibit NPY and activate POMC cells in situ

[133].

Figure 1-7 Schematic representation of the interaction of systemic metabolic cues with Kisspeptin (KP), orexigenic, and anorexigenic neurons: metabolic cues are secreted by metabolic organs in responses to alterations in metabolic status. Metabolic cues include insulin and glucagon from pancreas, leptin, adiponectin and leptin from adipose tissues, ghrelin from stomach, glucose, fatty acid, cholecystokinin, glucocorticoids, and thyroid hormones, among many others. Alterations in metabolic cues, either directly or indirectly via anorexigenic and orexigenic neurons, modulate KP neuronal activities. KP neurons in turn transfer this information to the HPG axis via gonadotropin-releasing hormone (GnRH) neuronal network. Likewise, orexigenic and anorexigenic neurons can also directly convey current metabolic status related information to GnRH neurons. (Figure adapted with permission from [126])

Our lab has studied the role of insulin and leptin in Kiss1 neurons [134, 135].

However, in our C57BL/6 mice with specific deletions of IRs in Kiss1 neurons, we did not see any changes in body weight, food intake and glucose homeostasis [134]. Xiao and colleagues [135] further ablated both leptin and insulin in Kiss1 neurons and challenged mice with HFD feeding, and found that weight gain, body composition, glucose and insulin tolerance were normal in mice of both genders. Another group found decreased fasting insulin levels in equivalent male mice using a different kisspeptin transgenic line [136]. However, it is still possible that Kiss1 neurons sense other metabolic factors, such as IGF-1 to regulate metabolic functions.

Kiss1 neurons have the potential to serve as the central sensors of metabolic factors that signal to the reproductive axis the presence of stored calories. Based on the above findings, we hypothesized that IGF-1 and/or signaling in Kiss1 neurons may directly regulate reproductive via hypothalamic-pituitary-gonadal axis and indirectly regulate metabolic functions via communications with POMC/CART or NPY/AgRP neurons. We generated mice with specially ablation of IGF1Rs and/or IRs and characterized their reproductive and metabolic phenotypes. More details are present in

Chapter 4.

1.5 The gut microbiota dysbiosis in offspring health

The development of the gut microbiota

The gut microbiota is a complex and dynamic microbial community consisting of several hundreds of different microbes, mainly bacteria (1011-12 bacteria/g of colonic

content, forming 60% of total fecal mass) [137], whose coordinated actions are believed to be important for human life [138]. The gut microbiota influences the growth and differentiation of gut epithelial cells, and plays pivotal roles in the regulation of nutritive, metabolic, immunological, and protective functions [139].

The establishment and development of a stable gut microbiota is considered to consist of two transitions in infancy: first, in the phase from birth to breastfeeding, the gut microbiota is dominant by Bifidobacterium; second, during the weaning period as solid foods are introduced, the adult-type gut microbiota is established with dominance of the phyla Bacteriodetes and Firmicutes [140, 141]. Previous evidence shows that the gut microbiota in humans does not reach a well-balanced host-microbiota symbiotic state until three years of age [140, 141]. However, one recent human study shows that although healthy pre-adolescent children (ages 7-12 years) and adults harbored similar numbers of taxa and functional genes, their composition and functional potential differed significantly [142]. The authors proposed that the gut microbiota in pre-adolescent children may undergo a more prolonged development than previously suspected [142].

Chapter 5 will show the development of the gut microbiota in female offspring.

Window of opportunity for microbiota modulation

Since new evidence shows microbial exposure may start before delivery [143-

145], the factors influencing microbial colonization can be divided into three categories: prenatal factors, which include the placenta, umbilical cord, and amniotic fluid; neonatal factors, which include the mode of delivery and gestational age; and postnatal factors,

which include the genetics of the infant, feeding type (breast milk vs. formula), geographical area, surrounding environment bacteria, family members, host interactions, maternal diet, weaning and drug therapies [146] (Figure 1-8).

We are interested in how maternal diet during lactation influences the gut microbiota and the metabolic and reproductive functions of offspring. Bifidobacterium species (B. breve and B. bifidum) are predominant in the fecal microbiota of infants, and are considered to be beneficial for infants [147]. Breastfeeding was associated with higher levels of Bifidobacterium species [148] while the cessation of breast milk feeding results in increased gut microbiota diversity and faster maturation of gut microbiome, as marked by alterations in the phylum Firmicutes and Bacteroidetes [149].

Figure 1-8 Factors shaping the neonatal microbiome. Maternal vaginal infections or periodontitis can result in bacteria invading the uterine environment. Gut and oral microbiota could be transported through the bloodstream from the mother to the fetus. Delivery mode shapes the initial bacterial inoculum of the newborn. Postnatal factors such as antibiotic use, diet (such as breastfeeding versus formula, and introduction of solid food), genetics of the

infant and environmental exposure further configure the microbiome during early life. As diet diversifies with age, the microbiome gradually shifts toward an adult-like configuration, which is usually reached by age 3. Bacteria associated with the different processes are indicated. (Figure adapted with permission from [150])

Research in humans and animal models suggest that exposure to maternal obesity and high-fat-diet (HFD) increases the risk of obesity and obesity-related diseases in offspring [151-154]. MHFD induces a shift in gut microbial ecology; recent evidence has linked maternal obesity to alterations in the gut microbiota in offspring [155, 156].

However, it is unclear whether MHFD during lactation influences the pubertal development and if it is mediated by gut microbiota dysbiosis.

Modulation of the gut microbiota by co-housing

Mice are coprophagic; co-housed animals transfer the gut microbiota between each other by the fecal-oral route [157]. Co-housing is one of the simplest methods to assess the influence of a complex gut microbiota on a recognized phenotype [158]. Co- housing has been used to test the influence of the microbiota on energy balance regulation. Ridaura and colleagues [157] demonstrated that co-housing obese with lean mice successfully restored a lean phenotype. Buffington and colleagues [159] reported that MHFD-induced impairment of obesity related-social behaviors in offspring could be reversed by co-housing with normal chow diet (NCD) mice. One very recent study [160] showed that co-housing letrozole-induced polycystic ovary syndrome (PCOS) mice with placebo mice improved both reproductive and metabolic PCOS phenotypes. These results suggested that modulation of the gut microbiota may be a potential treatment option for

metabolic and reproductive diseases. In Chapter 5, we discussed if co-housing can reverse metabolic and reproductive dysfunctions induced by MHFD during lactation.

1.6 Reference

1. Jansen, M., et al., Sequence of cDNA encoding human insulin-like growth factor I precursor. Nature, 1983. 306(5943): p. 609-11.

2. Woods, P., et al., Piloting violence and incident reporting measures on one acute mental health inpatient unit. Issues Ment Health Nurs, 2008. 29(5): p. 455-69.

3. Holt, R.I., H.L. Simpson, and P.H. Sonksen, The role of the growth hormone- insulin-like growth factor axis in glucose homeostasis. Diabet Med, 2003. 20(1): p. 3-15.

4. Moller, N., et al., Free fatty acids inhibit growth hormone/signal transducer and activator of transcription-5 signaling in human muscle: a potential feedback mechanism. J Clin Endocrinol Metab, 2009. 94(6): p. 2204-7.

5. Scarth, J.P., Modulation of the growth hormone-insulin-like growth factor (GH- IGF) axis by pharmaceutical, nutraceutical and environmental xenobiotics: an emerging role for xenobiotic-metabolizing enzymes and the transcription factors regulating their expression. A review. Xenobiotica, 2006. 36(2-3): p. 119-218.

6. Papaioannou, A., S. Kuyucak, and Z. Kuncic, Elucidating the Activation Mechanism of the Insulin-Family Proteins with Molecular Dynamics Simulations. PLoS One, 2016. 11(8): p. e0161459.

7. Bayne, M.L., et al., The roles of tyrosines 24, 31, and 60 in the high affinity binding of insulin-like growth factor-I to the type 1 insulin-like growth factor receptor. J Biol Chem, 1990. 265(26): p. 15648-52.

8. Castilla-Cortazar, I., et al., Hepatoprotection and neuroprotection induced by low doses of IGF-II in aging rats. J Transl Med, 2011. 9: p. 103.

9. Garcia-Fernandez, M., et al., Liver mitochondrial dysfunction is reverted by insulin-like growth factor II (IGF-II) in aging rats. J Transl Med, 2011. 9: p. 123.

10. Brooks, A.J. and M.J. Waters, The growth hormone receptor: mechanism of activation and clinical implications. Nat Rev Endocrinol, 2010. 6(9): p. 515-25.

11. De Meyts, P., et al., The insulin-like growth factor-I receptor. Structure, ligand- binding mechanism and signal transduction. Horm Res, 1994. 42(4-5): p. 152-69.

12. Jones, J.I. and D.R. Clemmons, Insulin-like growth factors and their binding proteins: biological actions. Endocr Rev, 1995. 16(1): p. 3-34.

13. LeRoith, D., et al., Molecular and cellular aspects of the insulin-like growth factor I receptor. Endocr Rev, 1995. 16(2): p. 143-63.

14. Benarroch, E.E., Insulin-like growth factors in the brain and their potential clinical implications. Neurology, 2012. 79(21): p. 2148-53.

15. Inoki, K., et al., TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nat Cell Biol, 2002. 4(9): p. 648-57.

16. Huffman, J., C. Hoffmann, and G.T. Taylor, Integrating insulin-like growth factor 1 and sex hormones into neuroprotection: Implications for diabetes. World J Diabetes, 2017. 8(2): p. 45-55.

17. Liu, J.L., S. Yakar, and D. LeRoith, Conditional knockout of mouse insulin-like growth factor-1 gene using the Cre/loxP system. Proc Soc Exp Biol Med, 2000. 223(4): p. 344-51.

18. Stratikopoulos, E., et al., The hormonal action of IGF1 in postnatal mouse growth. Proc Natl Acad Sci U S A, 2008. 105(49): p. 19378-83.

19. Yakar, S., et al., Inhibition of growth hormone action improves insulin sensitivity in liver IGF-1-deficient mice. J Clin Invest, 2004. 113(1): p. 96-105.

20. Aguirre, G.A., et al., Insulin-like growth factor-1 deficiency and metabolic syndrome. J Transl Med, 2016. 14: p. 3.

21. Clemmons, D.R., Metabolic actions of insulin-like growth factor-I in normal physiology and diabetes. Endocrinol Metab Clin North Am, 2012. 41(2): p. 425- 43, vii-viii.

22. Dunger, D., K. Yuen, and K. Ong, Insulin-like growth factor I and impaired glucose tolerance. Horm Res, 2004. 62 Suppl 1: p. 101-7.

23. Martha, S., et al., Study of insulin resistance in relation to serum IGF-I levels in subjects with different degrees of glucose tolerance. Int J Diabetes Dev Ctries, 2008. 28(2): p. 54-9.

24. Maes, M., J.M. Ketelslegers, and L.E. Underwood, Low circulating somatomedin- C/insulin-like growth factor I in insulin-dependent diabetes and malnutrition: growth hormone receptor and post-receptor defects. Acta Endocrinol Suppl (Copenh), 1986. 279: p. 86-92.

25. Wolfe, A., S. Divall, and S. Wu, The regulation of reproductive neuroendocrine function by insulin and insulin-like growth factor-1 (IGF-1). Front Neuroendocrinol, 2014. 35(4): p. 558-72.

26. Helmreich, D.L. and J.L. Cameron, Suppression of luteinizing hormone secretion during food restriction in male rhesus monkeys (Macaca mulatta): failure of naloxone to restore normal pulsatility. Neuroendocrinology, 1992. 56(4): p. 464- 73.

27. Schreihofer, D.A., D.B. Parfitt, and J.L. Cameron, Suppression of luteinizing hormone secretion during short-term fasting in male rhesus monkeys: the role of metabolic versus stress signals. Endocrinology, 1993. 132(5): p. 1881-9.

28. Ahima, R.S., et al., Role of leptin in the neuroendocrine response to fasting. Nature, 1996. 382(6588): p. 250-2.

29. Bruning, J.C., et al., Role of brain insulin receptor in control of body weight and reproduction. Science, 2000. 289(5487): p. 2122-5.

30. Hiney, J.K., et al., Insulin-like growth factor-I activates KiSS-1 gene expression in the brain of the prepubertal female rat. Endocrinology, 2009. 150(1): p. 376-84.

31. Divall, S.A., et al., Divergent roles of growth factors in the GnRH regulation of puberty in mice. J Clin Invest, 2010. 120(8): p. 2900-9.

32. Quennell, J.H., et al., Leptin indirectly regulates gonadotropin-releasing hormone neuronal function. Endocrinology, 2009. 150(6): p. 2805-12.

33. Korner, J., et al., Leptin regulation of Agrp and Npy mRNA in the rat hypothalamus. J Neuroendocrinol, 2001. 13(11): p. 959-66.

34. Leslie, R.A., et al., Appositions between cocaine and amphetamine-related transcript- and gonadotropin releasing hormone-immunoreactive neurons in the hypothalamus of the Siberian hamster. Neurosci Lett, 2001. 314(3): p. 111-4.

35. Vulliemoz, N.R., et al., Central infusion of agouti-related peptide suppresses pulsatile luteinizing hormone release in the ovariectomized rhesus monkey. Endocrinology, 2005. 146(2): p. 784-9.

36. Edgerton, D.S., et al., Insulin's direct effects on the liver dominate the control of hepatic glucose production. J Clin Invest, 2006. 116(2): p. 521-7.

37. Obici, S., et al., Hypothalamic insulin signaling is required for inhibition of glucose production. Nat Med, 2002. 8(12): p. 1376-82.

38. Pocai, A., et al., Hypothalamic K(ATP) channels control hepatic glucose production. Nature, 2005. 434(7036): p. 1026-31.

39. Begg, D.P. and S.C. Woods, The central insulin system and energy balance. Handb Exp Pharmacol, 2012(209): p. 111-29.

40. Plum, L., B.F. Belgardt, and J.C. Bruning, Central insulin action in energy and glucose homeostasis. J Clin Invest, 2006. 116(7): p. 1761-6.

41. Schwartz, M.W., et al., Insulin in the brain: a hormonal regulator of energy balance. Endocr Rev, 1992. 13(3): p. 387-414.

42. Air, E.L., et al., Small molecule insulin mimetics reduce food intake and body weight and prevent development of obesity. Nat Med, 2002. 8(2): p. 179-83.

43. Benedict, C., et al., Intranasal insulin enhances postprandial thermogenesis and lowers postprandial serum insulin levels in healthy men. Diabetes, 2011. 60(1): p. 114-8.

44. Brown, L.M., et al., Intraventricular insulin and leptin reduce food intake and body weight in C57BL/6J mice. Physiol Behav, 2006. 89(5): p. 687-91.

45. Plum, L., M. Schubert, and J.C. Bruning, The role of insulin receptor signaling in the brain. Trends Endocrinol Metab, 2005. 16(2): p. 59-65.

46. Young, J.M. and A.S. McNeilly, Theca: the forgotten cell of the ovarian follicle. Reproduction, 2010. 140(4): p. 489-504.

47. Fontana, R. and S. Della Torre, The Deep Correlation between Energy Metabolism and Reproduction: A View on the Effects of Nutrition for Women Fertility. Nutrients, 2016. 8(2): p. 87.

48. Sliwowska, J.H., et al., Insulin: its role in the central control of reproduction. Physiol Behav, 2014. 133: p. 197-206.

49. DiVall, S.A., et al., Insulin receptor signaling in the GnRH neuron plays a role in the abnormal GnRH pulsatility of obese female mice. PLoS One, 2015. 10(3): p. e0119995.

50. Wu, S., et al., Obesity-induced infertility and hyperandrogenism are corrected by deletion of the insulin receptor in the ovarian theca cell. Diabetes, 2014. 63(4): p. 1270-82.

51. Brothers, K.J., et al., Rescue of obesity-induced infertility in female mice due to a pituitary-specific knockout of the insulin receptor. Cell Metab, 2010. 12(3): p. 295-305.

52. Dong, Q., et al., Pulsatile LH secretion in streptozotocin-induced diabetes in the rat. J Endocrinol, 1991. 131(1): p. 49-55.

53. Bucholtz, D.C., et al., Regulation of pulsatile luteinizing hormone secretion by insulin in the diabetic male lamb. Biol Reprod, 2000. 62(5): p. 1248-55.

54. Miller, D.W., D. Blache, and G.B. Martin, The role of intracerebral insulin in the effect of nutrition on gonadotrophin secretion in mature male sheep. J Endocrinol, 1995. 147(2): p. 321-9.

55. Hileman, S.M., K.K. Schillo, and J.B. Hall, Effects of acute, intracerebroventricular administration of insulin on serum concentrations of luteinizing hormone, insulin, and glucose in ovariectomized lambs during restricted and ad libitum feed intake. Biol Reprod, 1993. 48(1): p. 117-24.

56. Zhang, Y., et al., Positional cloning of the mouse obese gene and its human homologue. Nature, 1994. 372(6505): p. 425-32.

57. Spiegelman, B.M. and J.S. Flier, Adipogenesis and obesity: rounding out the big picture. Cell, 1996. 87(3): p. 377-89.

58. Flier, J.S., Clinical review 94: What's in a name? In search of leptin's physiologic role. J Clin Endocrinol Metab, 1998. 83(5): p. 1407-13.

59. Friedman, J.M. and J.L. Halaas, Leptin and the regulation of body weight in mammals. Nature, 1998. 395(6704): p. 763-70.

60. Chan, J.L., et al., The role of falling leptin levels in the neuroendocrine and metabolic adaptation to short-term starvation in healthy men. J Clin Invest, 2003. 111(9): p. 1409-21.

61. Chan, J.L. and C.S. Mantzoros, Role of leptin in energy-deprivation states: normal human physiology and clinical implications for hypothalamic amenorrhoea and anorexia nervosa. Lancet, 2005. 366(9479): p. 74-85.

62. Halaas, J.L., et al., Physiological response to long-term peripheral and central leptin infusion in lean and obese mice. Proc Natl Acad Sci U S A, 1997. 94(16): p. 8878-83.

63. Maffei, M., et al., Leptin levels in human and rodent: measurement of plasma leptin and ob RNA in obese and weight-reduced subjects. Nat Med, 1995. 1(11): p. 1155-61.

64. Myers, M.G., Jr., et al., Obesity and leptin resistance: distinguishing cause from effect. Trends Endocrinol Metab, 2010. 21(11): p. 643-51.

65. Ahima, R.S. and J.S. Flier, Leptin. Annu Rev Physiol, 2000. 62: p. 413-37.

66. Cady, G., et al., Hypothalamic growth hormone receptor (GHR) controls hepatic glucose production in nutrient-sensing leptin receptor (LepRb) expressing neurons. Mol Metab, 2017. 6(5): p. 393-405.

67. Gittings, W., J. Bunda, and R. Vandenboom, Myosin phosphorylation potentiates steady-state work output without altering contractile economy of mouse fast skeletal muscles. J Exp Biol, 2018. 221(Pt 2).

68. Kim, K.W., et al., Steroidogenic factor 1 directs programs regulating diet- induced thermogenesis and leptin action in the ventral medial hypothalamic nucleus. Proc Natl Acad Sci U S A, 2011. 108(26): p. 10673-8.

69. Lee, J.Y., et al., Loss of cytokine-STAT5 signaling in the CNS and pituitary gland alters energy balance and leads to obesity. PLoS One, 2008. 3(2): p. e1639.

70. Rezai-Zadeh, K., et al., Leptin receptor neurons in the dorsomedial hypothalamus are key regulators of energy expenditure and body weight, but not food intake. Mol Metab, 2014. 3(7): p. 681-93.

71. De Matteis, R., et al., Localization of leptin receptor splice variants in mouse peripheral tissues by immunohistochemistry. Proc Nutr Soc, 1998. 57(3): p. 441- 8.

72. Bjorbaek, C., et al., Expression of leptin receptor isoforms in rat brain microvessels. Endocrinology, 1998. 139(8): p. 3485-91.

73. Elmquist, J.K., et al., Distributions of leptin receptor mRNA isoforms in the rat brain. J Comp Neurol, 1998. 395(4): p. 535-47.

74. Fei, H., et al., Anatomic localization of alternatively spliced leptin receptors (Ob- R) in mouse brain and other tissues. Proc Natl Acad Sci U S A, 1997. 94(13): p. 7001-5.

75. Lee, G.H., et al., Abnormal splicing of the leptin receptor in diabetic mice. Nature, 1996. 379(6566): p. 632-5.

76. Bates, S.H., et al., STAT3 signalling is required for leptin regulation of energy balance but not reproduction. Nature, 2003. 421(6925): p. 856-9.

77. Niswender, K.D., et al., Intracellular signalling. Key enzyme in leptin-induced anorexia. Nature, 2001. 413(6858): p. 794-5.

78. Robertson, S.A., G.M. Leinninger, and M.G. Myers, Jr., Molecular and neural mediators of leptin action. Physiol Behav, 2008. 94(5): p. 637-42.

79. Walduck, A.K. and D. Becher, Leptin, CD4(+) T(reg) and the prospects for vaccination against H. pylori infection. Front Immunol, 2012. 3: p. 316.

80. Elmquist, J.K., et al., Identifying hypothalamic pathways controlling food intake, body weight, and glucose homeostasis. J Comp Neurol, 2005. 493(1): p. 63-71.

81. Elmquist, J.K., C.F. Elias, and C.B. Saper, From lesions to leptin: hypothalamic control of food intake and body weight. Neuron, 1999. 22(2): p. 221-32.

82. Garcia-Galiano, D., et al., PI3Kalpha inactivation in leptin receptor cells increases leptin sensitivity but disrupts growth and reproduction. JCI Insight, 2017. 2(23).

83. Chan, J.L., et al., Differential regulation of metabolic, neuroendocrine, and immune function by leptin in humans. Proc Natl Acad Sci U S A, 2006. 103(22): p. 8481-6.

84. Chan, J.L., et al., Leptin does not mediate short-term fasting-induced changes in growth hormone pulsatility but increases IGF-I in leptin deficiency states. J Clin Endocrinol Metab, 2008. 93(7): p. 2819-27.

85. Farooqi, I.S., et al., Beneficial effects of leptin on obesity, T cell hyporesponsiveness, and neuroendocrine/metabolic dysfunction of human congenital leptin deficiency. J Clin Invest, 2002. 110(8): p. 1093-103.

86. Ma, X., et al., Leptin-Induced CART (Cocaine- and Amphetamine-Regulated Transcript) Is a Novel Intraovarian Mediator of Obesity-Related Infertility in Females. Endocrinology, 2016. 157(3): p. 1248-57.

87. Singireddy, A.V., et al., Neither signal transducer and activator of transcription 3 (STAT3) or STAT5 signaling pathways are required for leptin's effects on fertility in mice. Endocrinology, 2013. 154(7): p. 2434-45.

88. Hohos, N.M. and M.E. Skaznik-Wikiel, High-Fat Diet and Female Fertility. Endocrinology, 2017. 158(8): p. 2407-2419.

89. Wu, S., et al., Reproductive tissues maintain insulin sensitivity in diet-induced obesity. Diabetes, 2012. 61(1): p. 114-23.

90. Niswender, K.D., et al., Insulin activation of phosphatidylinositol 3-kinase in the hypothalamic arcuate nucleus: a key mediator of insulin-induced anorexia. Diabetes, 2003. 52(2): p. 227-31.

91. Burgos-Ramos, E., et al., Chronic central leptin infusion modifies the response to acute central insulin injection by reducing the interaction of the insulin receptor with IRS2 and increasing its association with SOCS3. J Neurochem, 2011. 117(1): p. 175-85.

92. Pardini, A.W., et al., Distribution of insulin receptor substrate-2 in brain areas involved in energy homeostasis. Brain Res, 2006. 1112(1): p. 169-78.

93. Sadagurski, M., et al., IRS2 signaling in LepR-b neurons suppresses FoxO1 to control energy balance independently of leptin action. Cell Metab, 2012. 15(5): p. 703-12.

94. Lee, J.H., et al., KiSS-1, a novel human malignant melanoma metastasis- suppressor gene. J Natl Cancer Inst, 1996. 88(23): p. 1731-7.

95. Ohtaki, T., et al., Metastasis suppressor gene KiSS-1 encodes peptide ligand of a G-protein-coupled receptor. Nature, 2001. 411(6837): p. 613-7.

96. de Roux, N., et al., Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54. Proc Natl Acad Sci U S A, 2003. 100(19): p. 10972-6.

97. Seminara, S.B., et al., The GPR54 gene as a regulator of puberty. N Engl J Med, 2003. 349(17): p. 1614-27.

98. Herbison, A.E., Control of puberty onset and fertility by gonadotropin-releasing hormone neurons. Nat Rev Endocrinol, 2016. 12(8): p. 452-66.

99. Muir, A.I., et al., AXOR12, a novel human G protein-coupled receptor, activated by the peptide KiSS-1. J Biol Chem, 2001. 276(31): p. 28969-75.

100. Gutierrez-Pascual, E., et al., Direct pituitary effects of kisspeptin: activation of gonadotrophs and somatotrophs and stimulation of luteinising hormone and growth hormone secretion. J Neuroendocrinol, 2007. 19(7): p. 521-30.

101. Hu, K.L., et al., Kisspeptin/Kisspeptin Receptor System in the Ovary. Front Endocrinol (Lausanne), 2017. 8: p. 365.

102. Han, S.K., et al., Activation of gonadotropin-releasing hormone neurons by kisspeptin as a neuroendocrine switch for the onset of puberty. J Neurosci, 2005. 25(49): p. 11349-56.

103. Messager, S., et al., Kisspeptin directly stimulates gonadotropin-releasing hormone release via G protein-coupled receptor 54. Proc Natl Acad Sci U S A, 2005. 102(5): p. 1761-6.

104. Decourt, C., et al., Kisspeptin immunoreactive neurons in the equine hypothalamus Interactions with GnRH neuronal system. J Chem Neuroanat, 2008. 36(3-4): p. 131-7.

105. Smith, J.T., et al., Variation in kisspeptin and RFamide-related peptide (RFRP) expression and terminal connections to gonadotropin-releasing hormone neurons in the brain: a novel medium for seasonal breeding in the sheep. Endocrinology, 2008. 149(11): p. 5770-82.

106. Goodman, R.L., et al., Kisspeptin, neurokinin B, and dynorphin act in the arcuate nucleus to control activity of the GnRH pulse generator in ewes. Endocrinology, 2013. 154(11): p. 4259-69.

107. Fergani, C., et al., NKB signaling in the posterodorsal medial amygdala stimulates gonadotropin release in a kisspeptin-independent manner in female mice. Elife, 2018. 7.

108. Han, S.Y., et al., Selective optogenetic activation of arcuate kisspeptin neurons generates pulsatile luteinizing hormone secretion. Proc Natl Acad Sci U S A, 2015. 112(42): p. 13109-14.

109. Pielecka-Fortuna, J., Z. Chu, and S.M. Moenter, Kisspeptin acts directly and indirectly to increase gonadotropin-releasing hormone neuron activity and its effects are modulated by estradiol. Endocrinology, 2008. 149(4): p. 1979-86.

110. Clarkson, J. and A.E. Herbison, Postnatal development of kisspeptin neurons in mouse hypothalamus; sexual dimorphism and projections to gonadotropin- releasing hormone neurons. Endocrinology, 2006. 147(12): p. 5817-25.

111. Gottsch, M.L., et al., A role for kisspeptins in the regulation of gonadotropin secretion in the mouse. Endocrinology, 2004. 145(9): p. 4073-7.

112. Smith, J.T., et al., Regulation of Kiss1 gene expression in the brain of the female mouse. Endocrinology, 2005. 146(9): p. 3686-92.

113. Smith, J.T., et al., Differential regulation of KiSS-1 mRNA expression by sex steroids in the brain of the male mouse. Endocrinology, 2005. 146(7): p. 2976-84.

114. Gottsch, M.L., et al., Regulation of Kiss1 and dynorphin gene expression in the murine brain by classical and nonclassical estrogen receptor pathways. J Neurosci, 2009. 29(29): p. 9390-5.

115. Takase, K., et al., Possible role of oestrogen in pubertal increase of Kiss1/kisspeptin expression in discrete hypothalamic areas of female rats. J Neuroendocrinol, 2009. 21(6): p. 527-37.

116. Oakley, A.E., D.K. Clifton, and R.A. Steiner, Kisspeptin signaling in the brain. Endocr Rev, 2009. 30(6): p. 713-43.

117. Lents, C.A., et al., Central and peripheral administration of kisspeptin activates gonadotropin but not somatotropin secretion in prepubertal gilts. Reproduction, 2008. 135(6): p. 879-87.

118. Stephens, S.B., et al., Estrogen Stimulation of Kiss1 Expression in the Medial Amygdala Involves Estrogen Receptor-alpha But Not Estrogen Receptor-beta. Endocrinology, 2016. 157(10): p. 4021-4031.

119. d'Anglemont de Tassigny, X., et al., Hypogonadotropic hypogonadism in mice lacking a functional Kiss1 gene. Proc Natl Acad Sci U S A, 2007. 104(25): p. 10714-9.

120. Clarkson, J., et al., Kisspeptin-GPR54 signaling is essential for preovulatory gonadotropin-releasing hormone neuron activation and the luteinizing hormone surge. J Neurosci, 2008. 28(35): p. 8691-7.

121. Navarro, V.M., et al., Characterization of the potent luteinizing hormone- releasing activity of KiSS-1 peptide, the natural ligand of GPR54. Endocrinology, 2005. 146(1): p. 156-63.

122. Chan, Y.M., Effects of kisspeptin on hormone secretion in humans. Adv Exp Med Biol, 2013. 784: p. 89-112.

123. Hameed, S., C.N. Jayasena, and W.S. Dhillo, Kisspeptin and fertility. J Endocrinol, 2011. 208(2): p. 97-105.

124. Topaloglu, A.K., et al., Inactivating KISS1 mutation and hypogonadotropic hypogonadism. N Engl J Med, 2012. 366(7): p. 629-35.

125. Backholer, K., et al., Kisspeptin cells in the ewe brain respond to leptin and communicate with neuropeptide Y and proopiomelanocortin cells. Endocrinology, 2010. 151(5): p. 2233-43.

126. Wahab, F., et al., Metabolic Impact on the Hypothalamic Kisspeptin-Kiss1r Signaling Pathway. Front Endocrinol (Lausanne), 2018. 9: p. 123.

127. Lee, D.K., et al., Discovery of a receptor related to the galanin receptors. FEBS Lett, 1999. 446(1): p. 103-7.

128. Manfredi-Lozano, M., et al., Defining a novel leptin-melanocortin-kisspeptin pathway involved in the metabolic control of puberty. Mol Metab, 2016. 5(10): p. 844-857.

129. Ren, H., et al., Gpr17 in AgRP Neurons Regulates Feeding and Sensitivity to Insulin and Leptin. Diabetes, 2015. 64(11): p. 3670-9.

130. Song, W.J., et al., Glucagon regulates hepatic kisspeptin to impair insulin secretion. Cell Metab, 2014. 19(4): p. 667-81.

131. Tolson, K.P., et al., Impaired kisspeptin signaling decreases metabolism and promotes glucose intolerance and obesity. J Clin Invest, 2014. 124(7): p. 3075-9.

132. Stengel, A., et al., Centrally injected kisspeptin reduces food intake by increasing meal intervals in mice. Neuroreport, 2011. 22(5): p. 253-7.

133. Fu, L.Y. and A.N. van den Pol, Kisspeptin directly excites anorexigenic proopiomelanocortin neurons but inhibits orexigenic neuropeptide Y cells by an indirect synaptic mechanism. J Neurosci, 2010. 30(30): p. 10205-19.

134. Qiu, X., et al., Delayed puberty but normal fertility in mice with selective deletion of insulin receptors from Kiss1 cells. Endocrinology, 2013. 154(3): p. 1337-48.

135. Qiu, X., et al., Insulin and Leptin Signaling Interact in the Mouse Kiss1 Neuron during the Peripubertal Period. PLoS One, 2015. 10(5): p. e0121974.

136. Evans, M.C., et al., Evidence that insulin signalling in gonadotrophin-releasing hormone and kisspeptin neurones does not play an essential role in metabolic regulation of fertility in mice. J Neuroendocrinol, 2014. 26(7): p. 468-79.

137. Eckburg, P.B., et al., Diversity of the human intestinal microbial flora. Science, 2005. 308(5728): p. 1635-8.

138. Lozupone, C.A., et al., Diversity, stability and resilience of the human gut microbiota. Nature, 2012. 489(7415): p. 220-30.

139. O'Hara, A.M. and F. Shanahan, The gut flora as a forgotten organ. EMBO Rep, 2006. 7(7): p. 688-93.

140. Yatsunenko, T., et al., Human gut microbiome viewed across age and geography. Nature, 2012. 486(7402): p. 222-7.

141. Palmer, C., et al., Development of the human infant intestinal microbiota. PLoS Biol, 2007. 5(7): p. e177.

142. Hollister, E.B., et al., Structure and function of the healthy pre-adolescent pediatric gut microbiome. Microbiome, 2015. 3: p. 36.

143. Aagaard, K., et al., The placenta harbors a unique microbiome. Sci Transl Med, 2014. 6(237): p. 237ra65.

144. Jimenez, E., et al., Isolation of commensal bacteria from umbilical cord blood of healthy neonates born by cesarean section. Curr Microbiol, 2005. 51(4): p. 270-4.

145. Collado, M.C., et al., Human gut colonisation may be initiated in utero by distinct microbial communities in the placenta and amniotic fluid. Sci Rep, 2016. 6: p. 23129.

146. Milani, C., et al., The First Microbial Colonizers of the Human Gut: Composition, Activities, and Health Implications of the Infant Gut Microbiota. Microbiol Mol Biol Rev, 2017. 81(4).

147. Mikami, K., M. Kimura, and H. Takahashi, Influence of maternal bifidobacteria on the development of gut bifidobacteria in infants. Pharmaceuticals (Basel), 2012. 5(6): p. 629-42.

148. Soto, A., et al., Lactobacilli and bifidobacteria in human breast milk: influence of antibiotherapy and other host and clinical factors. J Pediatr Gastroenterol Nutr, 2014. 59(1): p. 78-88.

149. Stewart, C.J., et al., Temporal development of the gut microbiome in early childhood from the TEDDY study. Nature, 2018. 562(7728): p. 583-588.

150. Tamburini, S., et al., The microbiome in early life: implications for health outcomes. Nat Med, 2016. 22(7): p. 713-22.

151. Thibault, H., et al., Risk factors for overweight and obesity in French adolescents: physical activity, sedentary behavior and parental characteristics. Nutrition, 2010. 26(2): p. 192-200.

152. Gluckman, P.D., et al., Effect of in utero and early-life conditions on adult health and disease. N Engl J Med, 2008. 359(1): p. 61-73.

153. Galliano, D. and J. Bellver, Female obesity: short- and long-term consequences on the offspring. Gynecol Endocrinol, 2013. 29(7): p. 626-31.

154. Williams, L., et al., Animal models of in utero exposure to a high fat diet: a review. Biochim Biophys Acta, 2014. 1842(3): p. 507-519.

155. Ma, J., et al., High-fat maternal diet during pregnancy persistently alters the offspring microbiome in a primate model. Nat Commun, 2014. 5: p. 3889.

156. Galley, J.D., et al., Maternal obesity is associated with alterations in the gut microbiome in toddlers. PLoS One, 2014. 9(11): p. e113026.

157. Ridaura, V.K., et al., Gut microbiota from twins discordant for obesity modulate metabolism in mice. Science, 2013. 341(6150): p. 1241214.

158. Ericsson, A.C. and C.L. Franklin, Manipulating the Gut Microbiota: Methods and Challenges. ILAR J, 2015. 56(2): p. 205-17.

159. Buffington, S.A., et al., Microbial Reconstitution Reverses Maternal Diet-Induced Social and Synaptic Deficits in Offspring. Cell, 2016. 165(7): p. 1762-1775.

160. Torres, P.J., et al., Exposure to a Healthy Gut Microbiome Protects Against Reproductive and Metabolic Dysregulation in a PCOS Mouse Model. Endocrinology, 2019.

Chapter 2

IGF-1 Receptors and Insulin Receptors in LepRb Neurons Impact Puberty, Fertility and Body Growth

2.1 Abstract

Growth and reproduction are tightly linked. Growth hormone (GH) deficiency results in a profound suppression of postnatal growth accompanied by severely delayed puberty and delayed reproductive senescence, while growth hormone excess is correlated with the reverse. The specific mechanism underlying this delay is undefined. Although neurons in the hypothalamus that express LepRb are known to modulate the timing of puberty, previous evidence showed that single deletion of IR in LepRb neurons did not influence body growth and reproductive function in mice. However, whether IGF1R signaling in these neurons influences body growth, pubertal development and adult fertility is unknown. To answer these questions, we created mice lacking IGF1R exclusively in LepRb expressing cells (IGF1RLepRb mice). Because IGF1R and IR signaling overlap, we also generated double knockout mice (IGF1R/IRLepRb mice).

IGF1RLepRb and IGF1R/IRLepRb mice experienced growth retardation, delayed puberty and impaired fertility. Male mice had decreased gonadotropin and testosterone levels, impaired testicular histology, suggesting direct disruptions of hypothalamic-pituitary-

gonadal (HPG) axis. Interestingly, female reproductive hormones were normal at 4 weeks of age, while IGF1R/IRLepRb showed elevated LH and LH/FSH ratio and decreased follicle counts compared to female IGF1RLepRb or control mice. The decreased serum GH and IGF-1 levels in male IGF1RLepRb mice demonstrates communication between LepRb neurons and the GH/IGF-1 axis. Our findings highlight the importance of IGF1R in

LepRb neurons in the regulation of body growth, puberty and fertility. IGF1R/IRLepRb mice also had growth retardation, delayed puberty and impaired fertility.

2.2 Introduction

Energy balance and fertility interact; metabolic dysfunction leads to reproductive deficits such as hypogonadism [1, 2], polycystic ovary syndrome [3, 4], erectile dysfunction [5, 6] and infertility [7, 8]. Given the involvement of the hypothalamus in the management of food intake, energy use, sexual behavior, and fertility, it is not surprising that hypothalamic circuits mediating these functions influence each other [9, 10].

Leptin is an adipose-derived hormone that is transported into the brain [11, 12] to align behaviors and physiologic functions with the body’s energy balance [13-17].

Neurons expressing the long form of the leptin receptor (LepRb) represent the major cellular mediators of leptin action [18-20]. Large numbers of LepRb neurons reside within discrete hypothalamic nuclei including the arcuate nucleus (ARC), ventral medical hypothalamus (VMH), dorsomedial hypothalamus (DMH) and lateral hypothalamic area

(LHA) [21-23]. Hypothalamic LepRb neurons serve important roles in various

physiologic processes including puberty, fertility, energy balance, glucose homeostasis, and bone health [24-30].

Growth hormone (GH) and insulin-like growth factors (IGFs) promote mammalian growth [31, 32], metabolic regulation [33-35] and appetite control [36, 37].

Loss of GH receptors in LepRb neurons disrupted hepatic glucose production in mice

[38]. However, GH also induces IGF-1 production locally in tissues; systemic GH administration significantly increases IGF-1 mRNA levels in the hypothalamus, cerebellum, and hippocampus [39]. GH also causes IGF-1 to be released from liver into the circulation [40]. IGF-1 functions as the major mediator of GH-stimulated somatic growth as well as its anabolic and mitogenic activity [40]. Circulating IGF-1 may cross the brain blood barrier and produce effects on the CNS [41]. It has been difficult to untangle whether the brain effects of GH are direct or indirect via the IGF-1 receptor

(IGF1R).

Targeted deletion of the IGF1R has begun to address some of these questions.

Brain IGF1R knockout mice exhibited growth retardation, glucose intolerance, and infertility [42]. Growth hormone (GH) deficiency results in a profound suppression of postnatal growth accompanied by delayed puberty (of a week or more in mice) and delayed reproductive senescence, while growth hormone excess is correlated with the reverse [43]. The specific mechanism underlying this delay is undefined. Insulin-like growth factor 1 (IGF-1) administration advances pubertal timing while deletion of

IGF1Rs from gonadotropin releasing hormone (GnRH) neurons that control the maturation of the reproductive axis only delays puberty by 3-4 days with normal adult

reproductive function [44]. These findings suggested that upstream neurons responsive to

IGF-1 may alter GnRH neuronal activity and therefore reproductive function.

Insulin and IGF-1 receptors (IR and IGF1R, respectively) each exist as a heterotetramer composed of two α/ß dimers [45]. Interestingly, hybrids consisting of combinations of IR and IGF1R subunits have been reported [46]. IGF-1 and insulin both activate the phosphatidylinositol-3 kinase (PI3K) signaling pathway and therefore may have compensatory effects in the regulation of various physiologic processes. PI3K signaling in LepRb neurons plays an essential role in energy expenditure, growth and reproduction [24]. Indeed, IGF-1 and insulin signaling compensate for each other locally to maintain muscle growth [47] and white and brown fat mass formation [48]. However, it is unknown whether central IGF-1 and insulin play a similar role in the regulation of metabolism and reproduction.

We and our colleagues have previously found that lack of insulin signaling alone in LepRb neurons did not alter body weight, growth, the timing of vaginal opening, or adult reproductive function [24]. This unexpected phenotype led us to hypothesize that

IGF-1 and insulin signaling may play compensatory roles in the regulation of reproduction and metabolism. Here, we generated single deletion of IGF-1 receptors

(IGF1Rs) and double deletions of both IGF1Rs and insulin receptors (IRs) in LepRb neurons mice (termed IGF1RLepRb mice and IGF1R/IR LepRb mice) to dissect the role of

IGF-1 and insulin signaling in the regulation of pubertal development, adult fertility and bone health in both female and male mice.

2.3 Materials and Methods

Animals and genotyping

To generate mice with the IGF-1 receptor (IGF1R) specifically deleted in leptin receptor-expressing neurons, LepR-Cre mice [49] were crossed with IGF1R-floxed mice

[50, 51] and bred to homozygosity for the floxed allele only. The IGF1Rflox/flox mice were designed with loxP sites flanking exon 3. Excision of exon 3 in the presence of Cre recombinase results in a frame shift mutation and produces a premature stop codon.

Littermates only carrying Cre recombinase were used as controls (LepR-Cre). To generate double-knockout of IGF1R and insulin receptor (IR), LepR-Cre mice [49] were crossed with IGF1R-loxed and IR-loxed mice [52] and bred to homozygosity for the floxed alleles only. All mice were on a C57BL/6 background. Where specified, the mice also carried the reporter Ai14 (jax line 007914) [29, 53], in which loxP-flanked STOP cassette prevents transcription of a CAG promoter-driven red fluorescent protein

(tdTomato) inserted into the ROSA26 locus.

Mice were housed in the University of Toledo College of Medicine animal facility at 22°C to 24°C on a 12-hour light/12-hour dark cycle and were fed standard rodent chow

(2016 Teklad Global 16% Protein Rodent Diet, 12% fat by calories; Harlan Laboratories,

Indianapolis, Indiana). On postnatal day (PND) 21, mice were weaned. At the end of the study, all animals were sacrificed by CO2 asphyxiation or by cardiac puncture under 2% isoflurane anesthesia to draw blood. Mice were genotyped using the pairs of primers described in Appendix A. PCR amplification of the IGF-1 receptor floxed (flanked by loxP sites) genomic regions, combined with the detection of the Cre transgene in tailed-

derived DNA were performed (Denville DirectAmpTM Genomic DNA Amplication Kit).

Additional amplification of the insulin receptor floxed genomic regions was performed by Transnetyx, Inc (Cordova, Tennessee) using a real-time PCR-based approach. All procedures were approved by University of Toledo College of Medicine Institutional

Animal Care and Use Committee.

Puberty and reproductive phenotype assessment

Timing of pubertal development was checked daily after weaning by determining vaginal opening (VO) in female mice or balanopreputial separation (BPS) in male mice.

Vaginal cytology was examined by collecting the vaginal lavages from female mice following vaginal opening. First estrus age was determined by the occurrence of two consecutive days with keratinized cells after two previous days with leukocytes [24].

Stages were assessed based on vaginal cytology as described previously [24, 54]. BPS was checked daily from weaning by manually retracting the prepuce with gentle pressure

[55]. After BPS was seen in male mice, each male mouse was paired with one fertile wild-type female for eight nights to evaluate the first date of conception while monitoring daily for copulatory plugs. The paired mice were separated after eight nights, and pregnancy rate, litter size, and interval from mating to birth were recorded. The age of sexual maturation was estimated from the birth of the first litter minus average pregnancy duration for mice (21 days).

At 3 to 4 months of age, we examined adult fertility. Animals were paired with fertile adult wild-type breeders to collect additional data on pregnancy rate, interval from mating to birth, and litter size.

Hormone assays

Submandibular blood was collected at 9:00 to 11:00 AM to detect basal LH, FSH and estradiol levels. LH and FSH were measured via RIA performed by the University of

Virginia Center for Research in Reproduction Ligand Assay and Analysis Core

(Charlottesville, VA). Blood from female mice was collected on diestrus. The assay for

LH had a detection sensitivity of 3.28 pg/ml. The intra-assay and interassay coefficients of variance (CVs) were 4.0% and 8.6%. The assay for FSH had a detection sensitivity of

7.62 pg/ml. The intra-assay and interassay coefficients of variance (CVs) were 7.4% and

9.1%. Serum estradiol was measured by ELISA (Calbiotech, Spring Valley, California) with a sensitivity of 3 pg/mL and intra-assay and interassay CVs of <10%. Serum testosterone was measured by ELISA (Calbiotech, Spring Valley, California) with a sensitivity of 0.1 ng/mL and intra-assay and interassay CVs of <10%. Serum IGF-1 was measured by ELISA (Crystal Chem, Elk Grove Village, IL) with sensitivity of 0.5 to 18 ng/mL and precision intraassay and interassay CVs of <10%. Serum growth hormone was measured by ELISA (Crystal Chem, Elk Grove Village, IL) with a sensitivity range of 0.15 to 9 ng/mL and intraassay and interassay CVs of <10%.

Microcomputed tomography

Dissected right femora and lumbar vertebrae from 5-month-old mice (n =

4/genotype) were immersed in 10% formalin and stored in the dark. To determine the tissue microarchitecture and densitometry, bones were scanned using the μCT-35 system

(Scanco Medical AG, Bruettisellen, Switzerland), as previously described [56]. Scan parameters included 7 ul nominal resolution with the x-ray source operating at 70 kVp, and a current of 113uA. As described previously [56], scans of proximal tibia consisted of 300 slices starting at the growth plate. Images of trabecular bone were segmented at

220 threshold value using per mille scale following manual contouring starting 10 slices below the growth plate and extending to the end of the image stack. Scans of cortical bone at tibia midshaft consisted of 55 slices and images of cortical bone were contoured in the entire image stack and segmented at 260 thresholds using per mille scale. The analyses of the trabecular bone microstructure and the cortical bone parameters were performed using Evaluation Program V6.5-1 (Scanco Medical AG, Bruettisellen,

Switzerland) and conformed to recommended guidelines [57]. All mCT measurements were performed in a blind fashion.

Tissue collection and histology

After blood collection via cardiac puncture under 2% isoflurane anesthesia, ovaries, testes, liver, white adipose tissue (WAT) and brown adipose tissue (BAT) were collected from mice and fixed immediately in 10% formalin overnight and then transferred to 70% ethanol. Then tissues were embedded in paraffin and cut into 5- to 8-

µm sections. Sections were stained by hematoxylin and eosin and then analyzed.

Quantitative real-time PCR

Hypothalamus, liver, BAT and WAT were also removed after mouse under isoflurane anesthesia. Total hypothalamic and liver RNA were extracted from dissected tissues by an RNeasy Lipid Tissue Mini Kit (QIAGEN, Valencia, California), and BAT and WAT RNA were extracted by using TRIzol (Sigma-Aldrich, St. Louis, MO, USA) as described previously [58]. Single-strand cDNA was synthesized by a High-Capacity cDNA Reverse Transcription kit (Applied Biosystems) using random hexamers as primers as listed in Appendix A. Each sample was analyzed in duplicate to measure gene expression level. A 25µM cDNA template was used in a 25µl system in 96-well plates with SYBR Green qPCR SuperMix/ROX (Smart Bioscience Inc, Maumee, Ohio). The reactions were run in an ABI PRISM 7000 sequence detection system (PE Applied

Biosystems, Foster City, California), or a 10µMcDNA template was used in a 10 µl system in 384-well plates with SYBR Green qPCR SuperMix/ROX (Smart Bioscience

Inc, Maumee, Ohio). These reactions were run in a ThermoFisher QuantStudio 5 Real-

Time PCR system (Applied Biosystems, Foster City, California). All data were analyzed using the comparative Ct method (2-ΔΔCt) with glyceraldehyde-3-phosphate dehydrogenase (GADPH) as the housekeeping gene. The mRNA expression in

IGF1RLepRb and IGF1R/IRLepRb versus LepRb-Cre control mice was determined by a comparative cycle threshold method and relative gene copy number was calculated as 2-

ΔΔCt and presented as fold change from the relative mRNA expression of the LepRb-Cre control group. For each sample, the threshold cycle (Ct) of mRNA was measured and

normalized to the average of the housekeeping gene (ΔCt = CtUnknown – CtGAPDH). The fold change of mRNA in the unknown sample relative to LepRb-Cre control group was

-ΔΔCt determined by 2 , where ΔΔCt = ΔCtUnknown −ΔCtControl.

Western blotting

Adult LepRb-Cre, IGF1RLepRb and IGF1R/IRLepRb mice were sacrificed, and hypothalamus, liver, muscle, visceral adipose tissues, and gonads were harvested. To assess insulin signaling, LepRb-Cre, IGF1RLepRb and IGF1R/IRLepRb mice were fasted overnight and injected with i.p. saline or insulin (3U/kg). 15 minutes after injections, hypothalamus and liver were collected. Leptin signaling was assessed using the same method. Mice were fasted overnight and injected with i.p. saline or leptin (2.5ug/g of body weight) and tissues were collected 30 minutes after injection. Tissues were snap- frozen in liquid nitrogen and stored at -80°C until homogenized in radioimmunoprecipitation assay lysis buffer (Millipore, Billerica, Massachusetts) supplemented with protease inhibitor and phosphatase inhibitor (Thermo Fisher

Scientific, Waltham, Massachusetts). After centrifugation, supernatant protein concentrations were determined by BCA protein assay (Thermo Fisher Scientific). Then

30 µg denatured samples were subjected to SDS-PAGE electrophoresis and western blotting.

Primary antibodies used were as follows: IGF1R β subunit (1:1000; Cell signaling, Cat#9750), pAKT (1:1000, Cell signaling, Cat#4070), AKT (1:1000, Cell signaling, Cat#2920). GAPDH (1:1000; Abcam, Cat#ab8245) or β-Actin (:1000, Cell

Abcam, Cat#ab8226) was used as a loading control. Secondary antibodies used were as follows: donkey anti-rabbit-800 (1:10000, LI-COR, P/N 926-32213) and goat anti- mouse-680 (1:10000, LI-COR, P/N 926-68070). A LI-COR odyssey infrared imaging system was used to capture images, and only the contrast and brightness were adjusted for this purpose.

Perfusion and immunohistochemistry

Adult LepRb-Cre, IGF1RLepRb and IGF1R/IRLepRb mice at the age of 3 to 6 months were deeply anesthetized by ketamine and xylazine. To assess insulin signaling, LepRb-

Cre, IGF1RLepRb and IGF1R/IRLepRb mice were fasted overnight and injected with i.p. saline or insulin (3U/kg). 15 minutes after injections, mice were perfused after deeply anesthetized by ketamine and xylazine. Leptin signaling was assessed using the same method. Mice were fasted overnight and injected with i.p. saline or leptin (2.5ug/g of body weight) and mice were perfused 30 minutes after injection. After brief perfusion with a saline rinse, mice were perfused transcardially with 10% formalin for 10 minutes, and the brain was removed. The brain was postfixed in 10% formalin at 4°C overnight and immersed in 10%, 20%, and 30% sucrose at 4°C for 24 hours each. Then 30-µm sections were cut by a sliding microtome into 5 equal serial sections. After rinsing in

PBS, sections were blocked for 2 hours in PBS-T (PBS, Triton X-100, and 10% normal horse serum). Then, samples were incubated for 48 hours at 4°C in PBS-T-containing rabbit anti-IGF1R β antibody (1:1000; Cell signaling, Cat#9750), rabbit anti-pAKT antibody (1:1000, Cell signaling, Cat#4070), goat anti-tdTomato antibody (1:1000;

SICGEN, Cat# AB8181-200). After several washes in PBS, sections were incubated in

PBS-T (Triton X-100 and 10% horse serum) containing secondary antibodies Alexa

Fluor 568 (1:1,000, Thermofisher Scientific, Lot # A-11011) and Alexa Flour 488

(1:1,000, Thermofisher Scientific, Cat. #A-21206) for 2 hours at room temperature.

Finally, sections were washed, mounted on slides, cleared, and coverslipped with fluorescence mounting medium containing DAPI (Vectasheild, Vector laboratories, Inc.

Burlingame, California).

Statistical analysis

Data are presented as means ± SEM. One-way ANOVA was used as the main statistical method to compare the 3 groups, followed by the Tukey multiple comparison test. For body weight, body length, GTTs, and ITTs, Two-way ANOVA was used to compare changes over time between 3 groups. Bonferroni multiple comparison tests were then performed to compare differences among groups. A value of P ≤ 05 was considered to be significant.

2.4 Results

2.4.1 Disruption of IGF1R and/or IR in IGF1RLepRb and IGF1R/IRLepRb mice

IGF1Rβ hypothalamic protein expression was decreased in IGF1RLepRb mice compared to control mice (Figure 2-1A). Activation of phosphorylated AKT (pAKT) protein expression in hypothalamus was measured to evaluate IR signaling and as expected, the expression of pAKT was blunted in IGF1R/IRLepRb mice compared to

controls (Figure 2-1B). We also measured hypothalamic IGF1R, IR and GHR mRNA expression in IGF1RLepRb mice and IGF1R/IRLepRb mice. IGF1RLepRb and IGF1R/IRLepRb mice had decreased mRNA expression in hypothalamus (Figure 2-1C), while only

IGF1R/IRLepRb had decreased IR mRNA in hypothalamus when compared to control mice

(Figure 2-1D).

Figure 2-1 Disrupted IGF1R expression and/or IR signaling in in IGF1RLepRb and IGF1R/IRLepRb mice. (A) Hypothalamic IGF1R protein expression were measured in control (white bar, n=3) and IGF1RLepRb mice (black bar, n=3). (B) Hypothalamic pAKT protein expression was measured in control (white

bar, n=4) and IGF1R/IRLepRb mice to evaluate the IR signaling (black bar, n=4). (C-E) Hypothalamic IGF1R (C), IR (D) and GHR (E) mRNA expression were evaluated in control (white bar, n=8), IGF1RLepRb (black bar, n=8) and IGF1R/IRLepRb (red bar, n=8) mice. Values throughout figure are means ±SEM. For entire figure, *P < 0.05, ** P < 0.01, and *** P < 0.0001, determined by Tukey’s post hoc test following one-way ANOVA for each group.

2.4.2 Delayed Puberty in IGF1RLepRb and IGF1R/IRLepRb mice

Vaginal opening age and balanopreputial separation (BPS) age indicate the onset of puberty in females and males, respectively. Delayed vaginal opening was found in female IGF1RLepRb mice (at 37±1.5 days in IGF1RLepRb compared to 31±1.3 days in control mice) (Figure 2-2A); while delayed BPS was seen in male IGF1RLepRb mice (at

41±1.4 days in IGF1RLepRb compared to 33±1.1 days in control mice) (Figure 2-2I).

These findings suggest that IGF1Rs in LepRb neurons control pubertal development in both female and male mice. First ovulatory age, indicated by the first estrus, was then evaluated by vaginal lavage. Female IGF1RLepRb mice had a delayed first estrus compared to control mice (Figure 2-2B). Estrus cyclicity (Figure 2-2C) and the percentage of time spent in each stage (Figure 2-2D) were comparable. First date of conception was then examined to evaluate sexual maturity in male mice. IGF1RLepRb mice showed delayed sexual maturity compared to control mice (Figure 2-2J). To figure out whether delayed pubertal development was due to the hormone changes, we collected serum samples in mice at 4 weeks of age. Serum levels of LH (Figure 2-2E), FSH (Figure 2-2F), LH/FSH ratio (Figure 2-2G), and estradiol (Figure 2-2H) were comparable in female IGF1RLepRb mice at this time point. IGF1RLepRb male mice had decreased testosterone levels at 4

weeks-old (Figure 2-2K), although LH (Figure 2-2L), FSH (Figure 2-2M) and LH/FSH ratio (Figure 2-2N) were not significantly different from controls.

Female IGF1R/IRLepRb mice showed delayed vaginal opening (38±1.5 days of age in IGF1R/IRLepRb compared to 31±1.3 days in control mice) (Figure 2-2A), but no differences were seen between IGF1RLepRb and IGF1R/IRLepRb mice. First estrus was also delayed in IGF1R/IRLepRb mice compared to control mice, and they entered estrus later than the IGF1RLepRb mice (Figure 2-2B). Estrus cyclicity (Figure 2-2C) and the percent of time spent in each stage (Figure 2-2D) were comparable. 4-week-old IGF1R/IRLepRb female mice showed elevated LH (Figure 2-2E) and LH/FSH ratio (Figure 2-2G), but comparable serum estradiol levels (Figure 2-2H). Interestingly, BPS in IGF1R/IRLepRb was earlier than IGF1RLepRb mice (41±1.4 in IGF1RLepRb, 38±1.4 in IGF1R/IRLepRb compared to 33±1.1 in control mice) (Figure 2-2I). IGF1R/IRLepRb mice showed delayed sexual maturity compared to control mice (Figure 2-2J). No differences were seen in first date of conception between IGF1RLepRb and IGF1R/IRLepRb male mice. 4 week-old

IGF1R/IRLepRb male mice showed comparable serum testosterone levels (Figure 2-2K) and LH (Figure 2-2E) but significantly decreased FSH levels (Figure 2-2M).

Figure 2-2 Delayed puberty in IGF1RLepRb and IGF1R/IRLepRb mice. (A-D) Vaginal opening age (A), first estrus age (B), estrus cycle length (C) and estrus cyclicity (D) were evaluated in female control (white bar, n=13), IGF1RLepRb (black bar, n=12) and IGF1R/IRLepRb (red bar, n=7) mice. (E-G) Serum LH (E), FSH (F), LH/FSH (G) and estradiol (H) levels on diestrus in 4 weeks- old female control (white bar, n=9), IGF1RLepRb (black bar, n=9),

IGF1R/IRLepRb (red bar, n=7) mice. (I-J) Balanopreputial separation age (I) and first date of conception (J) were evaluated in male control (white bar, n=12), IGF1RLepRb (black bar, n=12) and IGF1R/IRLepRb (blue bar, n=5) mice. (K-N) Serum testosterone (K), LH (L), FSH (M) and LH/FSH (N) levels in 4-week-old male control (white bar, n=12), IGF1RLepRb (black bar, n=12) and IGF1R/IRLepRb (blue bar, n=5) mice. Values throughout the figure are means ±SEM. For the entire figure, *P < 0.05, ** P < 0.01, and *** P < 0.0001, determined by Tukey’s post hoc test following one-way ANOVA for each group.

2.4.3 Impaired Fertility in IGF1RLepRb and IGF1R/IRLepRb mice

When the mice were three- to four-month old, we performed fertility tests to evaluate adult reproductive function. Female IGF1RLepRb mice had a decreased pregnancy rate (Figure 2-3A) and litter size (Figure 2-3B) compared to control mice. No changes in

LH levels (Figure 2-3C), FSH (Figure 2-3D), LH/FSH ratio (Figure 2-3E), estradiol levels (Figure 2-3F), or uterus weights (Figure 2-3G) were seen in 2-month-old female mice. Ovarian weights (Figure 2-3H) and ovarian follicle counts (Figure 2-3I) did not differ between female IGF1RLepRb mice and control mice.

Male IGF1RLepRb mice showed impaired reproductive function as indicated by a decreased pregnancy rate (Figure 2-4A) and litter size (Figure 2-4B) compared to control mice. Specially, significantly decreased LH levels (Figure 2-4C) and LH/FSH ratio (Figure 2-4E) were detected in 3-month-old male IGF1RLepRb mice. Even though no differences of testosterone levels (Figure 2-4F) or testes weight were seen (Figure 2-

4G), IGF1RLepRb mice showed increased lumen area (Figure 2-4H) and lumen area/tubule area ratio (Figure 2-4J) compared to control mice in seminiferous tubule cross-sectional analysis, which suggest that IGF1RLepRb mice may have testicular

development problems in sperm competition [59]. Figure 1-4K and L show typical seminiferous tubules in control and IGF1RLepRb mice.

We then evaluated fertility in IGF1R/IRLepRb mice. IGF1R/IRLepRb female mice had a decreased pregnancy rate (Figure 2-3A) and litter size (Figure 2-3B) compared to control mice, while there was no difference between IGF1RLepRb and IGF1R/IRLepRb mice.

We saw no changes in estradiol levels (Figure 2-3F) but found increased LH levels and reduced uterine weights (Figure 2-3C and G) in 3-month-old IGF1R/IRLepRb female mice. When their ovaries were examined, IGF1R/IRLepRb mice showed decreased total number of follicles (Figure 2-3I).

At 4-months-old, IGF1R/IRLepRb male mice showed a decreased pregnancy rate

(Figure 2-4A) and litter size (Figure 2-4B) compared to control mice. In particular, decreased LH levels (Figure 2-4C) and LH/FSH ratio (Figure 2-4E) were seen in 3- month-old male mice. No differences in testosterone levels (Figure 2-4F) or testes weight (Figure 2-4G) were seen among the groups.

Figure 2-3 Impaired fertility in IGF1RLepRb and IGF1R/IRLepRb female mice. (A and B) Pregnancy rate (A) and litter size (B) were measured in 4-month-old female control (white bar, n=12), IGF1RLepRb (black bar, n=16) and IGF1RLepRb (red bar, n=7) mice. (C-F) Serum LH (C), FSH (D), LH/FSH (E) and estradiol (L) levels on diestrus day were measured in 4-month-old female control (white bar, n=9), IGF1RLepRb (black bar, n=9), IGF1R/IRLepRb (red bar, n=7) mice. (G and H) Uterine (G) and ovary weight (H) were measured in 5-month-old female control (white bar, n=4), IGF1RLepRb (black bar, n=4), IGF1R/IRLepRb (red bar, n=4) mice. (I) Follicles counts counted in 5-month-old female control (white bar, n=4), IGF1RLepRb (black bar, n=4), IGF1R/IRLepRb (red bar, n=4) mice. (J and K) Histology of ovaries in 5- month-old female control (J) and IGF1R/IRLepRb (K) mice. Values throughout figure are means ±SEM. For entire figure, *P < 0.05, ** P < 0.01, and *** P < 0.0001, determined by Tukey’s post hoc test following one-way ANOVA for each group.

Figure 2-4 Impaired fertility in IGF1RLepRb and IGF1R/IRLepRb male mice. (A and B) Pregnancy rate (A) and litter size (B) were measured in 4-month-old male control (white bar, n=9), IGF1RLepRb (black bar, n=9), IGF1R/IRLepRb (blue bar, n=4) mice. (C-F) Serum LH (C), FSH (D), LH/FSH (E) and testosterone (F) levels were measured in 4-month-old male control (white bar, n=9), IGF1RLepRb (black bar, n=9), IGF1R/IRLepRb (blue bar, n=4) mice. (G) Testes weight in 5-month-old male control (white bar, n=9), IGF1RLepRb (black bar, n=9), IGF1R/IRLepRb (blue bar, n=4) mice. (H-J) Histology of seminiferous tubule lumen area (H), seminiferous tubule cross-sectional area (I) and lumen area/tubule area ratio (J) were done in 5-month-old male control (white bar, n=4) and IGF1RLepRb (black bar, n=4) mice and analyzed by Image J. (K and L) Histology of testes in 5-month-old female control (K) and IGF1RLepRb (L) mice. Values throughout figure are means ±SEM. For entire figure, *P < 0.05, ** P < 0.01, and *** P < 0.0001, determined by Tukey’s post hoc test following one-way ANOVA for each group.

2.4.4 Impaired fertility under high-fat-diet feeding and advanced reproductive ageing in IGF1RLepRb mice

To understand whether the reproductive deficits were caused by reduced caloric intake, we challenged female mice with high-fat-diet (HFD) feeding from week 8 to 16 and performed fertility tests. We found that neither pregnancy rate nor litter size normalized (Figure 2-5A and B).

Nutrient-sensing pathways, including IGF-1 signaling, play an important role in regulating ageing [60, 61] and controlling both reproductive function and lifespan [62].

We therefore wanted to evaluate whether IGF-1 signaling in LepRb neurons also controls reproductive ageing. To answer this question, we performed fertility tests at 7 months,

10 months, 14 months and 17 months in female mice. We found almost all mice lost reproductive functions at 14-months of age, but pregnancy rate and littersize fell faster in female IGF1RLepRb mice compared to control mice (Figure 2-5C and D). Our results show that loss of IGF-1 receptors in LepRb neurons accelerated reproductive ageing. We also found male mice lost fertility at 14 months in both control and IGF1RLepRb mice

(Figure 2-5C and D), while male IGF1RLepRb mice had lower pregnancy rates at 7 months and 10 months compared to control mice (Figure 2-5C and D).

Figure 2-5 Impaired fertility under high-fat-diet feeding and advanced reproductive ageing in IGF1RLepRb mice. (A and B) Pregnancy rate (A) and litter size (B) were measured in 4-month-old female control (white bar, n=6) and IGF1RLepRb (black bar, n=5) mice fed with high-fat-diet. (C and D) Pregnancy rate (C) and litter size (D) were measured in 4 month-, 7 month-, 10 month-, 14 month- and 17-month-old female control (white bar, n=7) and IGF1RLepRb (black bar, n=7) mice fed with normal chow diet. (E and F) Pregnancy rate (E) and litter size (F) were measured in 4 month-, 7 month-, 10 month-, 14 month- and 17-month-old male control (white bar, n=7) and IGF1RLepRb (black bar, n=7) mice fed with normal chow diet. Values throughout figure are means ±SEM. For entire figure, *P < 0.05, ** P < 0.01, and *** P < 0.0001, determined by Tukey’s post hoc test following one-way ANOVA for each group.

2.4.5 Body growth and Bone phenotype in IGF1RLepRb and IGF1R/IRLepRb mice

To evaluate the effect of IGF-1 signaling in LepRb neurons on growth and bone health, we measured the body length from week 3 to 20. We found that body length in female IGF1RLepRb mice was shorter than control mice from week 3 to 6 (Figure 2-6A).

However, we did not detect any changes of serum levels of IGF-1 and GH at either 4- week-old or 3-month-old female IGF1RLepRb mice (Figure 2-6B and C). These results indicate that the regulatory function of IGF1Rs signaling in LepRb neurons on growth was not due to direct communication with the growth hormone/IGF-1 axis in female mice.

Male IGF1RLepRb mice also had growth retardation compared to control mice

(Figure 2-6D). Notably, the growth retardation in IGF1RLepRb mice was due to significantly decreased levels of IGF-1 and GH at 3-month-old age (Figure 2-6E and F).

Therefore, our findings indicate that central IGF1R signaling plays an important role in regulating body growth in both female and male mice, but only loss of IGF1R in male mice causes direct suppression of the GH/IGF-1 axis.

Female IGF1R/IRLepRb mice showed severe growth retardation compared to

IGF1RLepRb mice (Figure 2-6A), which suggests that both IGF1Rs and IRs are required for normal body growth in female mice. Again, neither IGF1Rs nor IRs signaling alters the growth hormone/IGF-1 axis in female mice.

Male IGF1R/IRLepRb mice showed similar body length (Figure 2-6D) and hormonal changes (Figure 2-6E and F) compared to IGF1RLepRb mice, which indicates that only IGF1R signaling is important in regulating body growth in male mice.

Figure 2-6 Decreased body growth and hormone changes in IGF1RLepRb and IGF1R/IRLepRb mice. (A) Body length curves from week 3 to 20 in female control (open circle, n=9), IGF1RLepRb (filled black squares, n=16), IGF1R/IRLepRb (filled red squares, n=9) mice on standard chow. (B and C) Serum levels of IGF-1 (B) and GH (C) at 4 weeks and 3 months of age in female control (white bar, n=6), IGF1R/IRLepRb (black bar, n=6), IGF1R/IRLepRb (blue bar, n=6) mice. (D) Body length curves from week 3 to 20 in male control (open circle, n=12), IGF1RLepRb (filled black squares, n=12), IGF1R/IRLepRb (filled red squares, n=5) mice on standard chow. (E and F) Serum levels of IGF-1 (E) and GH (F) at 4 weeks and 3 months of age in male control (white bar, n=6), IGF1R/IRLepRb (black bar, n=6) and IGF1R/IRLepRb (blue bar, n=6) mice. Values throughout figure are means ±SEM. For entire figure, *p < 0.05, **p < 0.01, and ***p < 0.0001, determined by Tukey’s post hoc test following one-way ANOVA for each group or by Bonferroni’s multiple comparison test following two-way ANOVA in figure A and D.

2.4.6 Bone phenotype changes in IGF1RLepRb mice

We next examined the bone phenotype of these mice using X-ray microcomputed tomography (µCT) when they reached 5-month of age. Female IGF1RLepRb mice displayed significantly increased bone volume (Figure 2-7A), trabecular numbers

(Figure 2-7B) and decreased trabecular spacing (Figure 2-7C). Even though no changes in bone mineral density (BMD) and tissue mineral density (TMD) were seen (data not shown), the cortical bone volume (Figure 2-7D) and bone area (Figure 2-7E) in female

IGF1RLepRb mice were both elevated compared to control mice. Strength of midshaft evaluated by polar moment of inertia (pMOI) (Figure 2-7F) and resistance to bending across the maximal (Imax/Cmax) (Figure 2-7G) and minimal centroidedge (Imin/Cmin)

(Figure 2-7H) were unexpectedly increased in IGF1RLepRb mice. Figure 2-7I, J, M and N are typical images of trabecular bone and cortical bone in female control and IGF1RLepRb mice.

Male IGF1RLepRb mice displayed very similar phenotype with female mice. Figure

7 K, L, O and P are typical images of male mice. Therefore, IGF1Rs signaling in LepRb neurons may also regulate bone formation in both female and male mice, while only the phenotype changes in males may be associated with suppression of GH/IGF-1 axis.

Surprisingly, loss of only IGF1Rs in LepRb neurons caused abnormal trabecular and cortical bone phenotype, as IGF1R/IRLepRb mice had a normal bone phenotype. No changes were seen in trabecular bone volume (control: 0.15±0.01 mm3; IGF1RLepRb:

0.23±0.02 mm3; IGF1R/IRLepRb: 0.14±0.01 mm3), trabecular numbers (control:

2.61±0.19; IGF1RLepRb: 3.41 ±0.23; IGF1R/IRLepRb: 3.05±0.04), cortical bone volume

(control: 0.22±0.01 mm3; IGF1RLepRb: 0.27±0.01 mm3; IGF1R/IRLepRb: 0.24±0.01 mm3), cortical bone area (control: 0.58±0.01 mm2; IGF1RLepRb: 0.69±0.03 mm2; IGF1R/IRLepRb:

0.64±0.01 mm2). Therefore, IGF1R signaling in LepRb neurons predominantly regulates body growth and bone health in mice.

Figure 2-7 Bone phenotype changes in IGF1RLepRb mice. (A-C) Trabecular bone volume (A), trabecular bone numbers (B) and trabecular bone spacing (C) were measured using µCT in 5-month-old female and male control (white

bar, n=4) and IGF1RLepRb (black bar, n=4). (D-H) Cortical bone volume (D), bone area (E), polar moment of inertia (pMOI) (F), resistance to bending across the maximall (Imax/Cmax) (G) and minimal centroidedge (H) were measured using µCT in 5-month-old female and male control (white bar, n=4), IGF1RLepRb (black bar, n=4), IGF1R/IRLepRb (red bar, n=4) mice. (I- L) Images of trabecular bone and cortical bone in control female (I and J) and male (K and L) mice. (M-P) Images of trabecular bone and cortical bone in IGF1RLepRb female (M and N) and male (O and P) mice. Values throughout figure are means ±SEM. For entire figure, *P < 0.05, ** P < 0.01, and *** P < 0.0001, determined by Tukey’s post hoc test following one-way ANOVA for each group.

2.5 Discussion

IGF-1 and insulin act through related tyrosine kinase receptors whose signals converge on downstream insulin receptor substrate (IRS) proteins [63] and then recruit and activate phosphatidylinositol 3-kinase (PI3K) to promote Akt signaling [64]. Of the

IRS-proteins, IRS2 pathways are known to integrate female reproduction and energy homeostasis, as mice lacking IRS2 have small, anovulatory ovaries with decreased numbers of follicles [65]. Loss of IRS2 in LepRb neurons in mice causes obesity, glucose intolerance and insulin resistance [25], but their reproductive capacity was normal.

Recently, Garcia-Galiano in collaboration with our lab found that deletion of PI3K subunits p110α and p110β in LepRb cells caused delayed puberty and impaired fertility

[24]. To further understand which signaling is dependent on this PI3K pathway, we knocked out IR in LepRb cells in mice. Surprisingly, insulin signaling in LepRb neurons did not influence puberty and fertility [24], which raised the possibility that IGF-1 signaling in LepRb neurons may actually play a more important role in the regulation of puberty and fertility.

Using a set of novel mouse models, we have dissected the role of IGF-1 and insulin signaling in LepRb neurons in the regulation of metabolic and reproductive functions. Notably, we found that loss of IGF1R signaling in LepRb neurons caused advanced reproductive ageing. However, the phenotype of loss of IGF1R was not altered by the addition of IR deletion. This finding indicates that IGF1R signaling in LepRb neurons plays a more dominant role in regulating puberty and fertility in mice.

Our findings may provide insight into the pathogenesis of delayed puberty in the clinic. Delayed puberty has a higher prevalence in boys than in girls [66] and is associated with increased risks of short stature [67], disrupted bone health [68-70], reduced fertility [71, 72] and negative psychosocial outcomes [73, 74]. Our IGF1RLepRb and IGF1R/IRLepRb male mice showed delayed puberty and decreased levels of LH and testosterone, similar to hypogonadotropic hypogonadism in human patients. The delayed onset of puberty in IGF1R/IRLepRb male mice was comparable to IGF1RLepRb male mice, which suggested that IGF-1 signaling in LepRb neurons is key to the regulation of puberty in males. Unexpectedly, IGF1R/IRLepRb female mice had delayed puberty but increased levels of LH and a higher LH/FSH ratio. Increased level of LH is associated with premature ovarian failure [75]. As expected, when these mice were adults, they displayed decreased preovulatory ovarian follicles, which may suggest early reproductive failure. Our findings are also consistent with only IGF1Rs deletions in GnRH neurons or

IRs deletion in GnRH neurons mice [44]. However, as no fertility problems were reported in these two mouse models, LepRb neurons are likely to be upstream neuronal

populations in the control of reproduction. Notably, delayed puberty caused impaired fertility during adulthood in IGF1RLepRb and IGF1R/IRLepRb female and male mice.

Leptin acts to upregulate pro-opiomelanocortin (POMC) expression [76, 77] while downregulating agouti-related protein (AgRP) expression and inhibiting AgRP cell activity [78-80]. Previous work attributed the identity of LepRb cells driving the reproductive phenotype of PI3K subunit p110α knockout mice was believed to be related to the AgRP neuronal population due to its role in leptin’s function [81-83] and the disrupted expression of AgRP mRNA and peptide of p110α knockout mice [24]. The

AgRP neurons have inhibitory actions on the reproductive axis [81-83]. Therefore, high levels of AgRP may have disrupted the reproductive function of PI3K subunit p110α knockout mice. However, this is not the case in our findings. We found POMC mRNA expression in female IGF1R LepRb mice was increased while AgRP expression was comparable. Evidence also suggests that POMC neurons innervate the reproductive circuits in the central nervous system and are well positioned to provide synaptic inputs to GnRH neurons [84, 85]. Consistent with increased POMC expression, we also found food intake was decreased in female IGF1R LepRb mice (Chapter 3). Therefore, the delayed puberty and impaired fertility seen in female IGF1RLepRb mice was not mediated by direct disruptions of HPG axis, but more likely via communications with POMC signaling pathway.

After severe growth retardation, brain IGF1R knockout female and male mice caught up to normal size at around 4 months of age. This growth pattern was similar to what we have seen in the male IGF1RLepRb mice. In female IGF1RLepRb mice, growth

retardation occurs between weeks 3 to 5. Serum IGF-1 in mice lacking IGF1R in the brain was significantly decreased at 4 weeks but increased at 8 weeks and continued to be

30%–40% increased throughout adult life. These findings contrasted with our findings that male IGF1RLepRb mice had decreased GH and IGF-1 levels at 3 months. Our findings may indicate the direct communication between LepRb neurons and the growth hormone/IGF-1 axis in male mice. Pulsatile GH and IGF-1 secretions vary differently between 9:30 am to 12:30 pm in mice [86]. Even though we expected to see decreased levels of GH and IGF-1 in female IGF1RLepRb and IGF1R/IRLepRb mice, the serum samples we collected might fail to reflect the levels in our mice. Similarly, female mice with p110 α deletions in LepRb neurons had decreased body growth at postnatal day 60 but with normal IGF-1 levels [24].

After growth retardation, IGF1RLepRb female mice caught up with control mouse body weight and body growth earlier than IGF1RLepRb male mice. The pattern is consistent with the fact that growth hormone deficiency (GHD) or idiopathic short stature

(ISS) with normal growth hormone in children is more prevalent in boys than girls [87].

The burden of GHD and ISS in children and adolescents is considerable and not limited to short stature [88]. However, the pathogenesis of idiopathic short stature is still unclear.

The severity of GHD and ISS in children and adolescents appears to be variable and individualized, but early identification and growth hormone treatment may lead to fewer complications [88]. Our findings suggest that carrying mutations of the IGF1R gene in

LepRb neurons may provide new knowledge in the pathogenesis of short stature.

The p110α subunit knockout female mice had decreased bone volume and bone mineral density [24]. These findings do not align with what we have found in IGF1RLepRb female and male mice. IGF1RLepRb female and male mice showed increased trabecular bone volume, trabecular numbers, cortical bone area, and bone strength. We speculate that the differences between our mice and the p110α subunit knockout mice are due to the status of puberty. The p110α subunit knockout mice had normal pubertal development; however, in our IGF1RLepRb mice, both female and male mice had significantly delayed puberty. Longitudinal studies of changes in bone mass during growth have confirmed that in girls, the greatest increases in bone mass occur between the ages of 12–15 years, compared with 14–17 years in boys [89]. After reaching a peak between the ages of 25 to

35 years, decline in bone mass is associated with the onset of osteoporosis and fractures in later life [90]. The delayed onset of puberty in IGF1RLepRb mice may postpone the bone mass development-peak and decline, resulting in increased bone volume, strength of midshaft and resistance to bending compared to control mice. In support of this idea, one recent clinical study found that in boys with constitutional delay of growth and puberty, bone turnover can be normal, and bone mineral density can increase in a manner similar to healthy children after adjustment for bone age [91]. Surprisingly, in the GHR knockout male mouse model, the growth and adiposity were normal [38]. Therefore, our findings show that central IGF-1 signaling may play an independent, protective role in bone health.

Insulin also acts as a growth factor to stimulate cell growth, differentiation and survival. While the importance of insulin signaling during development is well established in drosophila [92, 93] and fruit fly [94], we lack of knowledge of how central

insulin signaling controls body growth in mammals. Notably, we found IGF1R/IRLepRb female had significantly decreased body growth from week 6 to 15 when compared to

IGF1RLepRb. Thus, insulin signaling in LepRb neurons also controls body growth.

However, insulin receptor deletions in LepRb neurons alone had no effect on body growth. Therefore, the regulatory effects of insulin signaling on growth in LepRb neurons is dependent on IGF-1 signaling receptors. Bone parameters were normal in

IGF1R/IRLepRb mice. One clinic study reported that increasing adiposity is associated with lower bone mass and bone mineral density [95]. The dramatic change of adiposity only seen in IGF1R/IRLepRb mice might oppose the changes in IGF1RLepRb mice and explain the normal bone µCT results.

Summary

In summary, our findings have dissected distinct physiological roles of IGF1R and IR signaling in LepRb neurons. Central IGF1R signaling plays a crucial role in the control of processes including puberty, fertility, growth and bone health. Our findings extend our understanding of the complex circuitry linking somatic development to reproductive function and provide insight into direct and indirect disruptions of HPG axis and subsequent puberty and fertility.

2.6 References

1. I'Anson, H., et al., Central inhibition of gonadotropin-releasing hormone secretion in the growth-restricted hypogonadotropic female sheep. Endocrinology, 2000. 141(2): p. 520-7.

2. Chughtai, B., et al., Metabolic syndrome and sexual dysfunction. Curr Opin Urol, 2011. 21(6): p. 514-8.

3. Moran, L.J., R.J. Norman, and H.J. Teede, Metabolic risk in PCOS: phenotype and adiposity impact. Trends Endocrinol Metab, 2015. 26(3): p. 136-43.

4. van Houten, E.L. and J.A. Visser, Mouse models to study polycystic ovary syndrome: a possible link between metabolism and ovarian function? Reprod Biol, 2014. 14(1): p. 32-43.

5. Somani, B., S. Khan, and R. Donat, Screening for metabolic syndrome and testosterone deficiency in patients with erectile dysfunction: results from the first UK prospective study. BJU Int, 2010. 106(5): p. 688-90.

6. Corona, G., et al., Erectile dysfunction and central obesity: an Italian perspective. Asian J Androl, 2014. 16(4): p. 581-91.

7. Dallel, S., et al., Liver X Receptors: A Possible Link between Lipid Disorders and Female Infertility. Int J Mol Sci, 2018. 19(8).

8. Sermondade, N., et al., Obesity and increased risk for oligozoospermia and azoospermia. Arch Intern Med, 2012. 172(5): p. 440-442.

9. Hill, J.W., M. Alreja, and C.F. Elias, From precocious puberty to infertility: metabolic control of the reproductive function. Front Endocrinol (Lausanne), 2013. 4: p. 43.

10. Hill, J.W. and C.F. Elias, Neuroanatomical Framework of the Metabolic Control of Reproduction. Physiol Rev, 2018. 98(4): p. 2349-2380.

11. Banks, A.S., et al., Activation of downstream signals by the long form of the leptin receptor. J Biol Chem, 2000. 275(19): p. 14563-72.

12. Banks, W.A., Leptin transport across the blood-brain barrier: implications for the cause and treatment of obesity. Curr Pharm Des, 2001. 7(2): p. 125-33.

13. Ahima, R.S., et al., Distinct physiologic and neuronal responses to decreased leptin and mild hyperleptinemia. Endocrinology, 1999. 140(11): p. 4923-31.

14. Bouret, S.G. and R.B. Simerly, Development of leptin-sensitive circuits. J Neuroendocrinol, 2007. 19(8): p. 575-82.

15. Friedman, J.M. and J.L. Halaas, Leptin and the regulation of body weight in mammals. Nature, 1998. 395(6704): p. 763-70.

16. Myers, M.G., Jr., et al., The geometry of leptin action in the brain: more complicated than a simple ARC. Cell Metab, 2009. 9(2): p. 117-23.

17. Williams, K.W., M.M. Scott, and J.K. Elmquist, From observation to experimentation: leptin action in the mediobasal hypothalamus. Am J Clin Nutr, 2009. 89(3): p. 985S-990S.

18. Chua, S.C., Jr., et al., Transgenic complementation of leptin receptor deficiency. II. Increased leptin receptor transgene dose effects on obesity/diabetes and fertility/lactation in lepr-db/db mice. Am J Physiol Endocrinol Metab, 2004. 286(3): p. E384-92.

19. de Luca, C., et al., Complete rescue of obesity, diabetes, and infertility in db/db mice by neuron-specific LEPR-B transgenes. J Clin Invest, 2005. 115(12): p. 3484-93.

20. Robertson, S.A., G.M. Leinninger, and M.G. Myers, Jr., Molecular and neural mediators of leptin action. Physiol Behav, 2008. 94(5): p. 637-42.

21. Elmquist, J.K., et al., Distributions of leptin receptor mRNA isoforms in the rat brain. J Comp Neurol, 1998. 395(4): p. 535-47.

22. Leshan, R.L., et al., Leptin receptor signaling and action in the central nervous system. Obesity (Silver Spring), 2006. 14 Suppl 5: p. 208S-212S.

23. Scott, M.M., et al., Leptin targets in the mouse brain. J Comp Neurol, 2009. 514(5): p. 518-32.

24. Garcia-Galiano, D., et al., PI3Kalpha inactivation in leptin receptor cells increases leptin sensitivity but disrupts growth and reproduction. JCI Insight, 2017. 2(23).

25. Sadagurski, M., et al., IRS2 signaling in LepR-b neurons suppresses FoxO1 to control energy balance independently of leptin action. Cell Metab, 2012. 15(5): p. 703-12.

26. Plum, L., et al., Enhanced leptin-stimulated Pi3k activation in the CNS promotes white adipose tissue transdifferentiation. Cell Metab, 2007. 6(6): p. 431-45.

27. Bjornholm, M., et al., Mice lacking inhibitory leptin receptor signals are lean with normal endocrine function. J Clin Invest, 2007. 117(5): p. 1354-60.

28. Patterson, C.M., et al., Leptin action via LepR-b Tyr1077 contributes to the control of energy balance and female reproduction. Mol Metab, 2012. 1(1-2): p. 61-9.

29. Borges, B.C., et al., PI3K p110beta subunit in leptin receptor expressing cells is required for the acute hypophagia induced by endotoxemia. Mol Metab, 2016. 5(6): p. 379-391.

30. Motyl, K.J. and C.J. Rosen, Understanding leptin-dependent regulation of skeletal homeostasis. Biochimie, 2012. 94(10): p. 2089-96.

31. Zhou, Y., et al., A mammalian model for Laron syndrome produced by targeted disruption of the mouse growth hormone receptor/binding protein gene (the Laron mouse). Proc Natl Acad Sci U S A, 1997. 94(24): p. 13215-20.

32. Liu, J.P., et al., Mice carrying null mutations of the genes encoding insulin-like growth factor I (Igf-1) and type 1 IGF receptor (Igf1r). Cell, 1993. 75(1): p. 59- 72.

33. Kulkarni, R.N., et al., beta-cell-specific deletion of the Igf1 receptor leads to hyperinsulinemia and glucose intolerance but does not alter beta-cell mass. Nat Genet, 2002. 31(1): p. 111-5.

34. Ueki, K., et al., Total insulin and IGF-I resistance in pancreatic beta cells causes overt diabetes. Nat Genet, 2006. 38(5): p. 583-8.

35. LeRoith, D. and S. Yakar, Mechanisms of disease: metabolic effects of growth hormone and insulin-like growth factor 1. Nat Clin Pract Endocrinol Metab, 2007. 3(3): p. 302-10.

36. Isaksson, O.G., et al., Action of growth hormone: current views. Acta Paediatr Scand Suppl, 1988. 343: p. 12-8.

37. Hasegawa, O., et al., Developmental expression of the growth hormone receptor gene in the rat hypothalamus. Brain Res Dev Brain Res, 1993. 74(2): p. 287-90.

38. Cady, G., et al., Hypothalamic growth hormone receptor (GHR) controls hepatic glucose production in nutrient-sensing leptin receptor (LepRb) expressing neurons. Mol Metab, 2017. 6(5): p. 393-405.

39. Frago, L.M., et al., Growth hormone (GH) and GH-releasing peptide-6 increase brain insulin-like growth factor-I expression and activate intracellular signaling pathways involved in neuroprotection. Endocrinology, 2002. 143(10): p. 4113-22.

40. Laron, Z., Somatomedin-1 (recombinant insulin-like growth factor-1): clinical pharmacology and potential treatment of endocrine and metabolic disorders. BioDrugs, 1999. 11(1): p. 55-70.

41. Coculescu, M., Blood-brain barrier for human growth hormone and insulin-like growth factor-I. J Pediatr Endocrinol Metab, 1999. 12(2): p. 113-24.

42. Kappeler, L., et al., Brain IGF-1 receptors control mammalian growth and lifespan through a neuroendocrine mechanism. PLoS Biol, 2008. 6(10): p. e254.

43. Danilovich, N., et al., Deficits in female reproductive function in GH-R-KO mice; role of IGF-I. Endocrinology, 1999. 140(6): p. 2637-40.

44. Divall, S.A., et al., Divergent roles of growth factors in the GnRH regulation of puberty in mice. J Clin Invest, 2010. 120(8): p. 2900-9.

45. Nakae, J., Y. Kido, and D. Accili, Distinct and overlapping functions of insulin and IGF-I receptors. Endocr Rev, 2001. 22(6): p. 818-35.

46. Benyoucef, S., et al., Characterization of insulin/IGF hybrid receptors: contributions of the insulin receptor L2 and Fn1 domains and the alternatively spliced exon 11 sequence to ligand binding and receptor activation. Biochem J, 2007. 403(3): p. 603-13.

47. O'Neill, B.T., et al., Differential Role of Insulin/IGF-1 Receptor Signaling in Muscle Growth and Glucose Homeostasis. Cell Rep, 2015. 11(8): p. 1220-35.

48. Boucher, J., et al., Impaired thermogenesis and adipose tissue development in mice with fat-specific disruption of insulin and IGF-1 signalling. Nat Commun, 2012. 3: p. 902.

49. DeFalco, J., et al., Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus. Science, 2001. 291(5513): p. 2608-13.

50. Kloting, N., et al., Autocrine IGF-1 action in adipocytes controls systemic IGF-1 concentrations and growth. Diabetes, 2008. 57(8): p. 2074-82.

51. Stachelscheid, H., et al., Epidermal insulin/IGF-1 signalling control interfollicular morphogenesis and proliferative potential through Rac activation. EMBO J, 2008. 27(15): p. 2091-101.

52. Bruning, J.C., et al., A muscle-specific insulin receptor knockout exhibits features of the metabolic syndrome of NIDDM without altering glucose tolerance. Mol Cell, 1998. 2(5): p. 559-69.

53. Madisen, L., et al., A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nat Neurosci, 2010. 13(1): p. 133-40.

54. Torsoni, M.A., et al., AMPKalpha2 in Kiss1 Neurons Is Required for Reproductive Adaptations to Acute Metabolic Challenges in Adult Female Mice. Endocrinology, 2016. 157(12): p. 4803-4816.

55. Qiu, X., et al., Delayed puberty but normal fertility in mice with selective deletion of insulin receptors from Kiss1 cells. Endocrinology, 2013. 154(3): p. 1337-48.

56. Stechschulte, L.A., et al., PPARG Post-translational Modifications Regulate Bone Formation and Bone Resorption. EBioMedicine, 2016. 10: p. 174-84.

57. Bouxsein, M.L., et al., Guidelines for assessment of bone microstructure in rodents using micro-computed tomography. J Bone Miner Res, 2010. 25(7): p. 1468-86.

58. Lecka-Czernik, B., et al., Marrow Adipose Tissue: Skeletal Location, Sexual Dimorphism, and Response to Sex Steroid Deficiency. Front Endocrinol (Lausanne), 2017. 8: p. 188.

59. Montoto, L.G., et al., Postnatal testicular development in mouse species with different levels of sperm competition. Reproduction, 2012. 143(3): p. 333-46.

60. Ashpole, N.M., et al., Growth hormone, insulin-like growth factor-1 and the aging brain. Exp Gerontol, 2015. 68: p. 76-81.

61. Junnila, R.K., et al., The GH/IGF-1 axis in ageing and longevity. Nat Rev Endocrinol, 2013. 9(6): p. 366-376.

62. Templeman, N.M. and C.T. Murphy, Regulation of reproduction and longevity by nutrient-sensing pathways. J Cell Biol, 2018. 217(1): p. 93-106.

63. Valverde, A.M., et al., Molecular mechanisms of insulin resistance in IRS-2- deficient hepatocytes. Diabetes, 2003. 52(9): p. 2239-48.

64. Matsumoto, M. and D. Accili, All roads lead to FoxO. Cell Metab, 2005. 1(4): p. 215-6.

65. Taguchi, A., L.M. Wartschow, and M.F. White, Brain IRS2 signaling coordinates life span and nutrient homeostasis. Science, 2007. 317(5836): p. 369-72.

66. Slap, G.B. and F.M. Biro, Adolescent Medicine. 4th ed. 2008. 56-64.

67. Umlawska, W. and A. Prusek-Dudkiewicz, Growth retardation and delayed puberty in children and adolescents with juvenile idiopathic arthritis. Arch Med Sci, 2010. 6(1): p. 19-23.

68. Cousminer, D.L., et al., Genetically Determined Later Puberty Impacts Lowered Bone Mineral Density in Childhood and Adulthood. J Bone Miner Res, 2018. 33(3): p. 430-436.

69. Butler, T.A. and V.R. Yingling, The effects of delayed puberty on the growth plate. J Pediatr Orthop, 2013. 33(1): p. 99-105.

70. Yingling, V.R. and G. Taylor, Delayed pubertal development by hypothalamic suppression causes an increase in periosteal modeling but a reduction in bone strength in growing female rats. Bone, 2008. 42(6): p. 1137-43.

71. Tang, R.Y., et al., Clinical characteristics of 138 Chinese female patients with idiopathic hypogonadotropic hypogonadism. Endocr Connect, 2017. 6(8): p. 800- 810.

72. Mitchell, A.L., et al., Genetic basis and variable phenotypic expression of Kallmann syndrome: towards a unifying theory. Trends Endocrinol Metab, 2011. 22(7): p. 249-58.

73. Mussen, P.H. and M.C. Jones, Self-conceptions, motivations, and interpersonal attitudes of late- and early-maturing boys. Child Dev, 1957. 28(2): p. 243-56.

74. Siegel, J.M., et al., Body image, perceived pubertal timing, and adolescent mental health. J Adolesc Health, 1999. 25(2): p. 155-65.

75. Sahmay, S., et al., Elevated LH levels draw a stronger distinction than AMH in premature ovarian insufficiency. Climacteric, 2014. 17(2): p. 197-203.

76. Schwartz, M.W., et al., Leptin increases hypothalamic pro-opiomelanocortin mRNA expression in the rostral arcuate nucleus. Diabetes, 1997. 46(12): p. 2119- 23.

77. Thornton, J.E., et al., Regulation of hypothalamic proopiomelanocortin mRNA by leptin in ob/ob mice. Endocrinology, 1997. 138(11): p. 5063-6.

78. Wilding, J.P., et al., Increased neuropeptide-Y messenger ribonucleic acid (mRNA) and decreased neurotensin mRNA in the hypothalamus of the obese (ob/ob) mouse. Endocrinology, 1993. 132(5): p. 1939-44.

79. Schwartz, M.W., et al., Identification of targets of leptin action in rat hypothalamus. J Clin Invest, 1996. 98(5): p. 1101-6.

80. Elias, C.F., et al., Leptin differentially regulates NPY and POMC neurons projecting to the lateral hypothalamic area. Neuron, 1999. 23(4): p. 775-86.

81. Wu, Q., B.B. Whiddon, and R.D. Palmiter, Ablation of neurons expressing agouti-related protein, but not melanin concentrating hormone, in leptin-deficient mice restores metabolic functions and fertility. Proc Natl Acad Sci U S A, 2012. 109(8): p. 3155-60.

82. Sheffer-Babila, S., et al., Agouti-related peptide plays a critical role in leptin's effects on female puberty and reproduction. Am J Physiol Endocrinol Metab, 2013. 305(12): p. E1512-20.

83. Egan, O.K., M.A. Inglis, and G.M. Anderson, Leptin Signaling in AgRP Neurons Modulates Puberty Onset and Adult Fertility in Mice. J Neurosci, 2017. 37(14): p. 3875-3886.

84. Leranth, C., et al., Immunohistochemical evidence for synaptic connections between pro-opiomelanocortin-immunoreactive axons and LH-RH neurons in the preoptic area of the rat. Brain Res, 1988. 449(1-2): p. 167-76.

85. Pimpinelli, F., et al., Presence of delta opioid receptors on a subset of hypothalamic gonadotropin releasing hormone (GnRH) neurons. Brain Res, 2006. 1070(1): p. 15-23.

86. Steyn, F.J., et al., Impairments to the GH-IGF-I axis in hSOD1G93A mice give insight into possible mechanisms of GH dysregulation in patients with amyotrophic lateral sclerosis. Endocrinology, 2012. 153(8): p. 3735-46.

87. Stochholm, K., et al., Incidence of GH deficiency - a nationwide study. Eur J Endocrinol, 2006. 155(1): p. 61-71.

88. Brod, M., et al., Understanding burden of illness for child growth hormone deficiency. Qual Life Res, 2017. 26(7): p. 1673-1686.

89. Theintz, G., et al., Longitudinal monitoring of bone mass accumulation in healthy adolescents: evidence for a marked reduction after 16 years of age at the levels of lumbar spine and femoral neck in female subjects. J Clin Endocrinol Metab, 1992. 75(4): p. 1060-5.

90. Ralston, S.H., The genetics of osteoporosis. QJM, 1997. 90(4): p. 247-51.

91. Krupa, B. and T. Miazgowski, Bone mineral density and markers of bone turnover in boys with constitutional delay of growth and puberty. J Clin Endocrinol Metab, 2005. 90(5): p. 2828-30.

92. Shingleton, A.W., et al., The temporal requirements for insulin signaling during development in Drosophila. PLoS Biol, 2005. 3(9): p. e289.

93. Ruaud, A.F. and C.S. Thummel, Serotonin and insulin signaling team up to control growth in Drosophila. Genes Dev, 2008. 22(14): p. 1851-5.

94. Xu, K.K., et al., Insulin signaling pathway in the oriental fruit fly: The role of insulin receptor substrate in ovarian development. Gen Comp Endocrinol, 2015. 216: p. 125-33.

95. Aguirre, L., et al., Increasing adiposity is associated with higher adipokine levels and lower bone mineral density in obese older adults. J Clin Endocrinol Metab, 2014. 99(9): p. 3290-7.

Chapter 3 IGF-1 and Insulin Receptors Have Diverging Roles in Energy and Glucose Homeostasis in Leptin Responsive Neurons

3.1 Abstract

We have recently shown that deletion of phosphoinositide 3-kinase (PI3K) subunits in leptin receptor (LepRb) neurons decreased body weight, lean mass and fat mass, while increasing food intake, energy expenditure (EE), and physical activity in mice. No differences were seen in the glucose tolerance and insulin sensitivity. Since

IGF1R and IR signaling is known to overlap, we investigated the metabolic effects of simultaneous deletion of both receptors in LepRb neurons. Female IGF1RLepRb mice had decreased body weight and food intake accompanied by increased VO2, physical activity, and thermogenic gene expression in brown adipose tissue (BAT). These effects were sexually dimorphic; IGF1R signaling was not critical in regulating body weight, food intake or glucose homeostasis in male mice. Interestingly, IGF1R/IRLepRb mice showed dramatically decreased lean mass percentage, increased fat mass percentage and insulin insensitivity compared to either IGF1RLepRb and control mice.

In sum, loss of IGF1R in LepRb neurons confers resistance to obesity due to increased energy expenditure, showing IGF1R signaling is obesogenic. These effects diminished in IGF1R/IRLepRb mice due to decreased EE and physical activity and increased lipid storage in BAT, suggesting IR signaling in LepR neurons has an overall protective effect against obesity. Thus, our findings provide novel evidence that IGF1R and IR signaling in LepRb neurons interact and provide counterbalancing effects on the regulation of body composition and insulin sensitivity.

3.2 Introduction

Leptin, secreted in proportion to the mass of adipose tissue, is critical for metabolism and energy balance [1, 2]. Leptin action is primarily mediated by the long form of the leptin receptor (LepRb) expressed in the brain [3-5]. As described in Chapter

2, LepRb neurons are widely expressed in the hypothalamus, including the arcuate nucleus (ARC), ventromedial hypothalamic nucleus (VMN), dorsomedial hypothalamic nucleus (DMN), lateral hypothalamic area (LHA) and ventral premammillary nucleus

(PMN) [6]. Deficiency of leptin results in profound neuroendocrine failure, hyperphagia and autonomic dysfunction [7-9]. In addition to acting on POMC and AgRP neurons, leptin targets LepRb neurons in the LHA, decreasing body weight and food intake and increasing locomotor activity in mice [10]. DMN LepRb neurons may also play crucial roles in the control of energy balance by leptin [11].

The growth hormone (GH)/insulin-like factor 1 (IGF-1) axis plays important roles in growth and metabolism [12]. Hypothalamic growth hormone releasing hormone

(GHRH) neurons are glucose responsive, increasing activity in response to hypoglycemia

[13]. Previous findings showed that GHR signaling in LepRb neurons regulates glucose metabolism irrespective of feeding [14]. Growth hormone receptors (GHRs) and IGF-1 receptors (IGF1Rs) are present in the ARC where GHRH neurons reside [14, 15]. IGF-1 is the major mediator of GH-stimulated somatic growth, as well as a mediator of GH- independent anabolic responses in many cells and tissues [16]. For example, IGF-1 has

GH-independent effects on embryonic growth and reproductive function, which are not seen in GH- or GHR-deficient animals [16]. Thus, IGF1R in hypothalamic LepRb neuronal subsets of the ARH, DMH and LHA are likely to regulate glucose homeostasis.

Phosphatidylinositol-3 kinase (PI3K) signaling in LepRb neurons plays an essential role in energy expenditure, growth and reproduction [17]. Disrupting PI3K p110α and p110 β subunits produced a lean phenotype in mice due to increased energy expenditure, locomotor activity and thermogenesis [17]. IGF-1 and insulin both activate

PI3K signaling pathway and may have compensatory effects in the regulation of various physiologic processes [18]. Surprisingly, the disruption of IR signaling alone in LepRb neurons failed to recapitulate the metabolic phenotype of mice with deletions of PI3K in

LepRb neurons [17], suggesting IGF1R signaling may play important roles in regulating energy homeostasis in mice. Therefore, we generated mice lacking IGF1Rs and/or IRs specifically in LepRb neurons (IGF1RLepRb mice and IGF1R/IRLepRb mice) to study the role of IGF1R and IR in the regulation of glucose and energy homeostasis.

3.3 Materials and Methods

Animals and genotyping

To generate mice with IGF1Rs specifically deleted in LepRb neurons, LepR-Cre mice [19] were crossed with IGF1R-floxed mice [20, 21] and bred to homozygosity for the floxed allele only. The IGF1Rflox/flox mice were designed with loxP sites flanking exon

3. Excision of exon 3 in the presence of Cre recombinase results in a frame shift mutation and produces a premature stop codon. Littermates only carrying Cre recombinase were used as controls (LepR-Cre). To generate double-knockouts of IGF1Rs and IRs, LepR-

Cre mice [19] were crossed with IGF1R-loxed and IR-loxed mice [22] and bred to homozygosity for the floxed alleles only. All mice were on a C57BL/6 background.

Where specified, the mice also carried the reporter Ai14 (jax line 007914) [23], in which loxP-flanked STOP cassette prevents transcription of a CAG promoter-driven red fluorescent protein (tdTomato) inserted into the ROSA26 locus.

Mice were housed in the University of Toledo College of Medicine animal facility at 22°C to 24°C on a 12-hour light/12-hour dark cycle and were fed standard rodent chow

(2016 Teklad Global 16% Protein Rodent Diet, 12% fat by calories; Harlan Laboratories,

Animal Care and Use Committee.

Body weight and composition assessment

Body weight was measured weekly from week 3 to 20. Body composition was assessed by nuclear magnetic resonance (NMR) (minispec mq7.5; Bruker Optics,

Billerica, Massachusetts) to determine the percentage of fat mass, lean mass and body fluid [24].

Glucose tolerance test (GTT) and insulin tolerance test (ITT)

Glucose tolerance tests (GTTs) and insulin tolerance tests (ITTs) were performed as described previously [24]. For GTTs, after a 6-hour fast, mice were injected with dextrose (2g/kg ip). Tail blood glucose was measured using a veterinary glucometer

(AlphaTRAK; Abbott Laboratories, Abbott Park, Illinois) before and 15, 30, 45, 60, 90, and 120 minutes after injection. For ITT, after a 3-hour fast, mice were injected with recombinant insulin (0.75 U/kg ip). Tail blood glucose was measured again at specified time points.

Indirect calorimetry

We performed indirect calorimetry in mice at the age of 3 to 4 months in a

Calorimetry Module (CLAMS; Columbus Instruments, Columbus, Ohio) as described previously [25]. Adult (14- to 16-week old) IGF1RLepRb, IGF1R/IRLepRb and age matched control LepRb-cre (n=7-11/genotype) males and females were weighed and then individually placed into the sealed chambers with free access to food and water. The study was carried out in an experimentation room set at 21°C-23°C with 12-hour- light/dark cycles. The metabolic assessments were carried out continuously for 72 hours after 24 hours of adaptation. The consumption of oxygen (VO2) and production of carbon dioxide (VCO2) in each chamber were sampled sequentially for 1 minute in a 20-minute interval, and the motor activity was recorded every second in x and z dimensions.

Respiratory exchange ratio (RER) was calculated as VCO2/VO2, and energy expenditure

(EE) was calculated based on the formula: EE = 3.91 × [(VO2) + 1.1 × (VCO2)]/1000.

3.4 Results

3.4.1 Assessment of body weight and composition in IGF1RLepRb and IGF1R/IRLepRb mice

We measured the body weight of the mice from week 3 to 20 to evaluate the effects of single deletion of IGF1Rs in LepRb neurons on energy balance. IGF1RLepRb female mice have decreased body weights compared to control mice before week 5

(Figure 3-1A). Next, body composition was assessed using NMR. Lack of IGF1Rs in leptin responsive neurons did not change body fat mass or lean mass composition in

female mice (Figure 3-1B and C). Interestingly, food intake was found to be significantly decreased in IGF1RLepRb female mice (Figure 3-1D). No changes in body weight or body composition were seen in IGF1RLepRb male mice (Figure 3-1E, F and G).

IGF1RLepRb male mice had comparable food intake (Figure 3-1H). Our findings suggest that IGF1R signaling is required for normal body weight and food intake in female mice.

Female IGF1R/IRLepRb mice showed mildly decreased body weights compared to both control and IGF1RLepRb mice (Figure 3-1A). Lack of either IRs [17] or IGF1Rs did not change body composition. Surprisingly, we found simultaneous loss of both IGF1Rs and IRs in LepRb neurons caused a dramatic increase in fat mass percentage (Figure 3-

1B) and decrease in lean mass percentage (Figure 3-1C) in female mice. The compensatory effects of IGF1R and IR in regulating body composition was also seen in male IGF1R/IRLepRb mice as indicated by the dramatic changes in fat mass percentage

(Figure 3-1F) and lean mass percentage (Figure 3-1G). These findings suggest compensatory effects of IGF1R and IR in LepRb neurons in regulating body composition in mice. Food intake was marginally decreased in female IGF1R/IRLepRb mice (Figure 3-

1D). But no difference was seen between female IGF1RLepRb mice and IGF1R/IRLepRb mice, suggesting IGF1R signaling in LepRb neurons mainly regulates food intake in female mice.

Figure 3-1 Body weight and composition changes in IGF1RLepRb and IGF1R/IRLepRb mice. (A) Body weight curves from week 3 to 20 in female control (open circle, n=13), IGF1RLepRb (filled black squares, n=16), IGF1R/IRLepRb (filled red squares, n=9) mice. (B and C) Body fat mass percentage and lean mass percentage in 2-month-old female control (white bar, n=13), IGF1RLepRb (black bar, n=16), IGF1R/IRLepRb (red bar, n=9) mice. (D) Food intake per day in 3-month-old female control (white bar, n=9), IGF1RLepRb (black bar, n=16), IGF1R/IRLepRb (red bar, n=9) mice. (E) Body weight curves from week 3 to 20 in male control (open circle, n=12), IGF1RLepRb (filled black squares, n=12), IGF1R/IRLepRb (filled red squares, n=5) mice. (F and G) Body fat mass percentage (F) and lean mass percentage (G) in 2-month-old male control (white bar, n=12), IGF1RLepRb (black bar, n=12), IGF1R/IRLepRb (red bar, n=5) mice. (H) Food intake per day in 3-month-old male control (white bar, n=12), IGF1RLepRb (black bar, n=12), IGF1R/IRLepRb (red bar, n=5) mice. Values in all figures are means ±SEM, *p < 0.05, **p < 0.01, and ***p < 0.0001, determined by Tukey’s post hoc test following one-way ANOVA for each group or by Bonferroni’s multiple comparison test following two-way ANOVA in A and E.

3.4.2 Assessment of energy homeostasis in female IGF1RLepRb and IGF1R/IRLepRb mice

We next evaluated energy homeostasis in IGF1RLepRb and IGF1R/IRLepRb mice.

LepRb We found female IGF1R mice had increased VO2 (Figure 3-2A), VCO2 (Figure 3-

2B), energy expenditure (EE) (Figure 3-2D) and physical activity (Figure 3-2E).

However, RER was decreased in IGF1RLepRb mice (Figure 3-2C). Transcripts adrenoceptor Beta 3 (ADRB3), cell death activator (Cidea) and PR-domain containing 16

(PRDM16) associated with EE were increased in brown adipose tissue (BAT) in female

IGF1RLepRb mice compared to control and IGF1R/IRLepRb mice (Figure 3-2F). No differences of BAT weight (Figure 3-2G) or adipocyte morphology were seen in female

IGF1RLepRb mice (Figure 3-2H). Taken together, loss of IGF1Rs in LepRb neurons plays a protective role in regulating energy homeostasis by decreasing body weight and food intake and increasing physical activity in female mice.

LepRb Female IGF1R/IR mice had increased VO2 (Figure 3-2A) and VCO2 (Figure

3-2B) when compared to control mice; however EE (Figure 3-2D) and physical activity

(Figure 3-2E) were decreased when compared to female IGF1RLepRb mice. We found

IGF1R and IR in LepRb neurons contribute to thermogenesis including recruitment of

BAT and whitening of BAT. Female IGF1R/IRLepRb mice had decreased BAT weight

(Figure 3-2G) compared to control mice. Transcripts ADRB3, Cidea, PRDM16 and peroxisome proliferator-activated receptor γ (PPARγ) were not altered. Increased droplet area (Figure 3-2H) and lipid storage (Figure 3-2J) within BAT were observed in Female

IGF1R/IRLepRb mice. The higher RER ratio seen in female IGF1R/IRLepRb mice (Figure 3-

2C) was consistent with their dramatically increased fat mass percentage, suggesting less fat oxidation; a value of 1.00 or above in the RER is indicative of carbohydrate serving as the predominant fuel source rather than fat oxidation. Overall, the additional loss of IR signaling in LepRb neurons promotes obesity in female mice as opposed to the beneficial effects of loss of IGF1R signaling.

3.4.3 Assessment of energy homeostasis in male IGF1RLepRb and IGF1R/IRLepRb mice

LepRb Male IGF1R mice had increased VO2 (Figure 3-3A), VCO2 (Figure 3-3B), and RER (Figure 3-3C) when compared to control mice; however, no change was seen in EE (Figure 3-3D). Physical activity was decreased in male IGF1RLepRb mice when compared to control mice (Figure 3-3E). Similar to the findings in females, loss of

IGF1R reduces obesity in male mice.

LepRb Male IGF1R/IR mice had increased VO2 (Figure 3-3A), VCO2 (Figure 3-

3B), and RER (Figure 3-3C) when compared to control mice. We also observed that VO2

(Figure 3-3A) and EE (Figure 3-3D) in male IGF1RLepRb mice were lower than

LepRb IGF1R/IR mice, while VCO2 (Figure 3-3B) and RER (Figure 3-3C) in male

IGF1RLepRb mice were higher than IGF1R/IRLepRb mice. Our results suggest both IGF1R and IR are essential in the regulation of energy homeostasis in male mice. No differences were seen in the expression of ADRB3, Cidea, PRDM16 and PPARγ in BAT, BAT weight or adipocyte morphology (data not shown).

Figure 3-2 Altered energy homeostasis in IGF1RLepRb and IGF1R/IRLepRb female mice. (A-E) VO2 (A), VCO2 (B), respiratory exchange ratio (RER) (C), energy expenditure (EE) (D) and ambulatory activity (E) in 3-month-old female control (open circle and white bar, n=13), IGF1RLepRb (filled black square and black bar, n=12) and IGF1R/IRLepRb (filled red square and red bar, n=7) mice. (F) Relative expression of thermogenesis markers as measured by quantitative PCR in 5-month-old female control (white bar, n=8), IGF1RLepRb (black bar, n=8) and IGF1R/IRLepRb (red bar, n=8) mice. (G) Brown adipose tissue (BAT) weight in 5-month-old female control (white bar, n=9), IGF1RLepRb (black bar, n=9), IGF1R/IRLepRb (red bar, n=7) mice. (H) Droplet area in BAT were measured in 5-month-old female control (white bar, n=4) and IGF1R/IRLepRb (black bar, n=4) mice and analyzed by Image J. (I and J) Sliced and HE-stained paraffin-embedded brown adipose tissue in 5-month-old female control, IGF1RLepRb and IGF1R/IRLepRb mice. Values throughout figure are means ±SEM. For entire figure, *P < 0.05, ** P < 0.01, and *** P < 0.0001, determined by Tukey’s post hoc test following one-way ANOVA for each group.

Figure 3-3 Altered energy homeostasis in IGF1RLepRb and IGF1R/IRLepRb male Mice. (A-E) VO2 (A), VCO2 (B), RER (C), EE (D) and physical activity (E) in 3- month-old male control (open circle and white bar, n=13), IGF1RLepRb (filled black square and black bar, n=12) and IGF1R/IRLepRb (filled red square and

red bar, n=7) mice. (F) Relative expression of thermogenesis markers as measured by quantitative PCR in 5-month-old male control (white bar, n=6), IGF1RLepRb (black bar, n=6) and IGF1R/IRLepRb (red bar, n=6) mice. Values throughout figure are means ±SEM. For entire figure, *P < 0.05, ** P < 0.01, and *** P < 0.0001, determined by Tukey’s post hoc test following one-way ANOVA for each group.

3.4.4 Blood Glucose Regulation in IGF1RLepRb and IGF1R/IRLepRb female mice

To determine whether loss of IGF1Rs and/or IRs in LepRb neurons causes increased risk of diabetes, we evaluated glucose homeostasis in these mice. Female

IGF1RLepRb mice had abnormal glucose tolerance at 30 min and 45 min during the glucose tolerance test (GTT) (Figure 3-4A), though area under curve (AUC) was not significantly increased. Insulin tolerance in female IGF1RLepRb mice was normal (Figure

3-4C). Serum levels of insulin (data not shown), C-peptide (data not shown), insulin/C- peptide ratio (Figure 3-4F) and insulin sensitivity as calculated by the homeostatic model assessment for insulin resistance (HOMA-IR) (Figure 3-4G) were comparable between

IGF1RLepRb female mice and control mice. Interestingly, female IGF1RLepRb mice showed decreased fasting glucose (Figure 3-4D), suggestive of an impaired hepatic gluconeogenic pathway. Indeed, when we measured mRNA expression of gene markers in liver, we found decreased (glucose 6-phosphatase) G6PC and increased TNF-α mRNA expressions (Figure 3-4E). Therefore, IGF1R signaling in LepRb neurons regulates the hepatic gluconeogenic pathway in female mice to permit normal glucose tolerance and normal fasting glucose.

Female IGF1R/IRLepRb mice displayed insulin insensitivity as indicated by an insulin tolerance test (Figure 3-4A and C). In contrast to IGF1RLepRb mice, increased

fasting glucose (Figure 3-4D) was seen in IGF1R/IRLepRb mice. No significant changes seen in serum levels of insulin (data not shown), C-peptide (data not shown), HOMA-IR

(Figure 3-4G) or the insulin/C-peptide ratio (P=0.06) (Figure 3-4F) in female

IGF1R/IRLepRb mice compared to both control and IGF1RLepRb mice. Our findings suggest that both IGF1R and IR in LepRb neurons are required for normal insulin sensitivity in female mice.

Figure 3-4 Glucose intolerance in female IGF1RLepRb mice and insulin insensitivity in female IGF1R/IRLepRb mice. (A) Glucose tolerance test (GTT) and area under the curve (AUC) of 3-month-old female control (open circle and white bar, n=10), IGF1RLepRb (filled black square and black bar, n=14) and IGF1R/IRLepRb (filled red square and red bar, n=9) mice. (B) Baseline glucose levels in 3-month-old female control (white bar, n=10), IGF1RLepRb (black bar, n=14) and IGF1R/IRLepRb (red bar, n=9) mice. (C) Insulin tolerance test (ITT) and AUC of in 3-month-old female control (open circle and white bar, n=10), IGF1RLepRb (filled black square and black bar, n=9) and IGF1R/IRLepRb (filled red square and red bar, n=9) mice. (D) 16 hour- fasting glucose levels in 3-month-old female control (white bar, n=7), IGF1RLepRb (black bar, n=8) and IGF1R/IRLepRb (red bar, n=5) mice. (E) Relative expression of thermogenesis markers in BAT as measured by quantitative PCR in 5-month-old female control (white bar, n=8), IGF1RLepRb (black bar, n=8) and IGF1R/IRLepRb (red bar, n=8) mice. (F and G) Insulin to C-peptide ratio (F) and HOMA-IR (G) in 3-month-old female control (white bar, n=6), IGF1RLepRb (black bar, n=6 and IGF1R/IRLepRb (red bar, n=6) mice. Values throughout the figure are means ±SEM. For entire figure, *p < 0.05, **p < 0.01, and ***p < 0.0001, determined by Bonferroni’s Multiple Comparison Test following one-way ANOVA for each group or time point in A, C, I and K; or determined by Tukey’s post hoc test following one-way ANOVA for each group.

3.4.5 Blood Glucose Regulation in IGF1RLepRb and IGF1R/IRLepRb male mice

Male IGF1RLepRb mice had comparable glucose tolerance (Figure 3-5A) and insulin sensitivity (Figure 3-5B). The only significant difference seen in male

IGF1RLepRb mice were decreased fasting glucose levels (Figure 3-5F). Serum levels of insulin (Figure 3-5G), C-peptide (data not shown), insulin/C-peptide (data not shown) and HOMA-IR (Figure 3-5H) were comparable between IGF1RLepRb and control mice.

Male IGF1R/IRLepRb mice exhibited normal glucose tolerance (Figure 3-5A and

B). Consistent with female mice, the male IGF1R/IRLepRb mice also displayed insulin insensitivity with increased AUC (Figure 3-5D and E). Comparable fasting glucose was seen in IGF1R/IRLepRb mice (Figure 3-5F). Serum levels of insulin (Figure 3-5G), C-

peptide (data not shown), insulin/C-peptide (data not shown) and HOMA-IR (Figure 3-

5H) were comparable between IGF1R/IRLepRb b and control mice. Overall, the significant changes in insulin sensitivity in male IGF1R/IRLepRb mice indicate overlapping effects between IGF1Rs and IRs in LepRb neurons that regulate insulin sensitivity.

Figure 3-5 Insulin insensitivity in male IGF1R/IRLepRb mice. (A) GTT (A) and AUC of in 3-month-old female control (open circle and white bar, n=13), IGF1RLepRb (filled black square and black bar, n=6) and IGF1R/IRLepRb (filled red square and red bar, n=9) mice. (B) Baseline glucose levels in 3- month-old female control (white bar, n=6), IGF1RLepRb (black bar, n=6) and IGF1R/IRLepRb (red bar, n=6) mice. (C) GTT (A) and AUC of in 3-month- old female control (open circle and white bar, n=13), IGF1RLepRb (filled black square and black bar, n=6) and IGF1R/IRLepRb (filled red square and red bar, n=9) mice. (D) 16hr-fasting glucose levels in 3-month-old female control (white bar, n=6), IGF1RLepRb (black bar, n=6) and IGF1R/IRLepRb (red bar, n=6) mice. (E) Relative expression of thermogenesis markers as measured by quantitative PCR in 5-month-old male control (white bar, n=8), IGF1RLepRb (black bar, n=8) and IGF1R/IRLepRb (red bar, n=8) mice. (F and G) Insulin (F) and HOMA-IR (G) in 3-month-old female control (white bar, n=9), IGF1RLepRb (black bar, n=6) and IGF1R/IRLepRb (red bar, n=9) mice. Values throughout figure are means ±SEM. For entire figure, *p < 0.05, **p < 0.01, and ***p < 0.0001, determined by Bonferroni’s Multiple Comparison Test following one-way ANOVA for each group or time point in A, C, I and K; or determined by Tukey’s post hoc test following one-way ANOVA for each group.

3.5 Discussion

Brain has been considered as an insulin-sensitive organ since IR and their signaling pathways have been identified in several regions of the brain [26]. IR signaling is recognized as important for neuronal development, glucoregulation, feeding behavior, and body weight as well as cognitive processes [27]. Brüning and colleagues [28] created mice with a neuron-specific disruption of the IRs (NIRKO mice). NIRKO mice had increased food intake, impaired glucose tolerance and reproduction but surprisingly no differences in brain development or neuronal survival [28]. As the IGF1R and IR signaling overlap, IGF1R and IR may have compensatory roles in the regulation of brain development.

IGF-1 signaling is essential for normal growth and brain development [29]. In developing brain, IGF-1 signaling exerts pleiotropic actions to promote the proliferation, maturation, survival, and/or growth of neural cells through interacting with IGF1R [30].

Kappeler and colleagues [31] created mice with deletions of IGF1Rs in the brain

(bIGF1RKO+/- mice) and found that initially normal body growth was progressively retarded in bIGF1RKO+/- mice compared to controls, suggesting that the endocrine growth regulation during development was disturbed. GH expression per milligram of pituitary and serum IGF-1 level were comparable to controls at age of 10 day. But at age of 20 days, they both significantly fell compared to controls [31]. Thus, their finding indicates that the developmental IGF-1 signaling in the brain selectively determines somatotropic plasticity, regulates GH and IGF-1 secretion, and thereby control adult glucose homeostasis and energy balance [31].

LepRbs are ubiquitously expressed throughout the developing brain and affects both pre- and post-natal life [32]. The actions of leptin in the developing brain are generally permanent and critical for the establishment of hypothalamic neuroendocrine circuits [32]. Caron and colleagues [33] showed that the expression of LepRbs in ARC of hypothalamus is the key factor in controlling the development of hypothalamic circuits.

Therefore, we speculated that IGF1R and IR in LepRb neurons may exert compensation during development to affect the metabolic and reproductive functions in IGF1RKiss1 and

IGF1R/IRKiss1 mice.

To investigate the overlapping signaling created by insulin and IGF-1, several groups have generated mice lacking both IGF1Rs and IRs in peripheral tissues such as fat

and muscle [34, 35]. Boucher and colleagues [35] created mice with a combined tissue specific knockout of the insulin and IGF-1 receptors in fat (FIGIRKO). These FIGIRKO mice had strikingly decreased white and brown fat mass, while energy expenditure was increased despite a >85% reduction in brown fat mass and decreased uncoupling protein

1 expression [35]. Consistent with their findings, brown adipose tissue was decreased in

IGF1R/IRLepRb mice. Our mice also had decreased EE and physical activity, accompanied by decreased brown adipose activity. Only loss of both IGF1R and IR signaling in LepRb neurons caused body fat mass changes in both female and male mice, suggesting IGF-1 and insulin signaling may have compensatory effects in the regulation of body fat mass.

This finding shows the central IGF-1 and insulin signaling have opposite roles in the control of fat mass formation compared to peripheral fat tissue. O’Neill and colleagues

[34] generated mice lacking IGF1Rs and IRs in muscle (MIGIRKO) and found that

IGF1Rs and IRs compensate for each other to maintain muscle growth, such that when both are deleted, the mice display no insulin or IGF-1 signaling in skeletal muscle and have a marked decrease in muscle mass and fiber size. However, these MIGIRKO mice displayed normal glucose and insulin tolerance. In IGF1R/IRLepRb female and male mice, decreased lean muscle mass was accompanied by decreased physical activities. Our findings show that intact central IGF-1 and insulin signaling in LepRb neurons are both required for normal muscle mass and physical activities. The differences between our

IGF1R/IRLepRb mice and the PI3K double knockout mice [17] raise the possibility that the effects of IGF-1 and insulin signaling may be mediated by the Ras/Raf/MEK/extracelluar signal-regulated kinase pathway, instead of the PI3K-AKT pathway.

Interestingly, we saw several sex differences in glucose tolerance. IGF1RLepRb female mice displayed glucose intolerance but male mice were normal. Human studies also report sex-associated differences in glucose tolerance, with impaired glucose tolerance being more prevalent in women [36-39]. The reason for this difference is unknown. However, one can speculate that less muscle mass in women would decrease insulin-stimulated glucose disposal and account for the observed higher rate of impaired glucose tolerance [40].

Previous studies have shown peripheral IGF-1 signaling does not seem to play a major role in the regulation of glucose homeostasis. MIGIRKO mice had normal glucose tolerance and insulin sensitivity under normal chow or high-fat-diet chow [34]. Similar findings were seen in FIGIRKO mice. At 4 months of age, these FIGIRKO mice also showed normal fed and fasted glucose, insulin levels and glucose tolerance [35]. In addition, mice with disruptions of IGF-1 genes in liver (LID) did not change glucose tolerance [41]. Contrary to peripheral effects, central IGF-1 signaling is required for normal glucose homeostasis. Adult homozygous brain IGF1R knockout mice were markedly glucose intolerant [31]. In this present study, we found female IGF1RLepRb mice have abnormal glucose tolerance at 30 min and 45 min. Our studies have identified one novel neuronal population, LepRb neurons, is partially responsible central IGF-1’s regulatory effects on glucose tolerance. But since the glucose intolerance in our female

IGF1RLepRb mice was milder compared to the brain IGF1R knockout mice, other neurons may be involved in mediating IGF-1’s regulatory effects on glucose tolerance.

IGF-1 plays an important role in maintaining normal carbohydrate metabolism

[41]. Despite low levels of circulating IGF-1, insulin sensitivity in LID mice could be improved by inactivating GH action [42]. These findings suggest GH may regulate glucose homeostasis independent of IGF-1 signaling. Indeed, a mouse model with GHR deletions in LepRb neurons also showed glucose intolerance but normal serum IGF-1 level in male mice [14]. However, in our IGF1RLepRb male mice, glucose tolerance was normal. Brain IGF1R knockout mice had elevated fasting glycemia [31], which is consistent with male IGF1RLepRb mice but contrasts with female IGF1RLepRb mice.

Hepatic gluconeogenesis is one major contributing factor to hyperglycemia, and IGF-1 is reported to enhance hepatic gluconeogenesis [43]. We measured hepatic gluconeogenesis enzyme G6PC mRNA expression; the decreased level of G6PC in female IGF1RLepRb mice may explain why they had hypoglycemia.

Notably, both IGF1R/IRLepRb female and male mice had insulin insensitivity.

Deletion of PI3K in LepRb neurons did not change glucose tolerance or insulin sensitivity [17]. In addition, mice with IR deletion alone in LepRb neurons had normal glucose homeostasis [17]. These findings suggest that IGF-1 and insulin may have compensatory effects in the regulation of insulin sensitivity, which is not mediated by the

PI3K signaling pathway. Evidence suggests that insulin action in agouti-related peptide

(AgRP) neurons is required for suppression of hepatic glucose production [44]. Thus, one may speculate that AgRP-LepRb neuronal circuitry is involved in the physiology of

IGF1R and IR responses and mediate their functions in the control of glucose homeostasis. However, further studies are needed to confirm this possibility.

Summary

To summarize, our findings have dissected distinct roles for IGF1R and IR signaling in LepRb neurons in metabolism. Loss of IGF1R in LepRb neurons confers resistance to obesity due to increased energy expenditure, showing IGF1R signaling is obesogenic. These effects diminished in IGF1R/IRLepRb mice due to decreased EE and physical activity and increased lipid storage in BAT, suggesting IR signaling in LepR neurons has an overall protective effect against obesity. Thus, our findings provide novel evidence that IGF1R and IR signaling in LepRb neurons interact and provide counterbalancing effects on the regulation of body composition and insulin sensitivity.

Our findings extend our understanding of the role of central IGF1R and IR signaling in

LepRb neurons in the control of various processes including growth, energy homeostasis and glucose homeostasis.

3.6 References

1. Schwartz, M.W., et al., Central nervous system control of food intake. Nature, 2000. 404(6778): p. 661-71.

2. Myers, M.G., Jr., et al., Obesity and leptin resistance: distinguishing cause from effect. Trends Endocrinol Metab, 2010. 21(11): p. 643-51.

3. Chua, S.C., Jr., et al., Transgenic complementation of leptin receptor deficiency. II. Increased leptin receptor transgene dose effects on obesity/diabetes and fertility/lactation in lepr-db/db mice. Am J Physiol Endocrinol Metab, 2004. 286(3): p. E384-92.

4. de Luca, C., et al., Complete rescue of obesity, diabetes, and infertility in db/db mice by neuron-specific LEPR-B transgenes. J Clin Invest, 2005. 115(12): p. 3484-93.

5. Robertson, S.A., G.M. Leinninger, and M.G. Myers, Jr., Molecular and neural mediators of leptin action. Physiol Behav, 2008. 94(5): p. 637-42.

6. Scott, M.M., et al., Leptin targets in the mouse brain. J Comp Neurol, 2009. 514(5): p. 518-32.

7. Ahima, R.S., et al., Leptin regulation of neuroendocrine systems. Front Neuroendocrinol, 2000. 21(3): p. 263-307.

8. Hausberg, M., et al., Leptin potentiates thermogenic sympathetic responses to hypothermia: a receptor-mediated effect. Diabetes, 2002. 51(8): p. 2434-40.

9. Ozata, M., I.C. Ozdemir, and J. Licinio, Human leptin deficiency caused by a missense mutation: multiple endocrine defects, decreased sympathetic tone, and immune system dysfunction indicate new targets for leptin action, greater central than peripheral resistance to the effects of leptin, and spontaneous correction of leptin-mediated defects. J Clin Endocrinol Metab, 1999. 84(10): p. 3686-95.

10. de Vrind, V.A.J., et al., Effects of GABA and Leptin Receptor-Expressing Neurons in the Lateral Hypothalamus on Feeding, Locomotion, and Thermogenesis. Obesity (Silver Spring), 2019. 27(7): p. 1123-1132.

11. Rupp, A.C., et al., Specific subpopulations of hypothalamic leptin receptor- expressing neurons mediate the effects of early developmental leptin receptor deletion on energy balance. Mol Metab, 2018. 14: p. 130-138.

12. Giustina, A., G. Mazziotti, and E. Canalis, Growth hormone, insulin-like growth factors, and the skeleton. Endocr Rev, 2008. 29(5): p. 535-59.

13. Stanley, S., et al., Profiling of Glucose-Sensing Neurons Reveals that GHRH Neurons Are Activated by Hypoglycemia. Cell Metab, 2013. 18(4): p. 596-607.

14. Cady, G., et al., Hypothalamic growth hormone receptor (GHR) controls hepatic glucose production in nutrient-sensing leptin receptor (LepRb) expressing neurons. Mol Metab, 2017. 6(5): p. 393-405.

15. Daftary, S.S. and A.C. Gore, The hypothalamic insulin-like growth factor-1 receptor and its relationship to gonadotropin-releasing hormones neurones during postnatal development. J Neuroendocrinol, 2004. 16(2): p. 160-9.

16. Le Roith, D., et al., The somatomedin hypothesis: 2001. Endocr Rev, 2001. 22(1): p. 53-74.

17. Garcia-Galiano, D., et al., PI3Kalpha inactivation in leptin receptor cells increases leptin sensitivity but disrupts growth and reproduction. JCI Insight, 2017. 2(23).

18. Benarroch, E.E., Insulin-like growth factors in the brain and their potential clinical implications. Neurology, 2012. 79(21): p. 2148-53.

19. DeFalco, J., et al., Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus. Science, 2001. 291(5513): p. 2608-13.

20. Kloting, N., et al., Autocrine IGF-1 action in adipocytes controls systemic IGF-1 concentrations and growth. Diabetes, 2008. 57(8): p. 2074-82.

21. Stachelscheid, H., et al., Epidermal insulin/IGF-1 signalling control interfollicular morphogenesis and proliferative potential through Rac activation. EMBO J, 2008. 27(15): p. 2091-101.

22. Bruning, J.C., et al., A muscle-specific insulin receptor knockout exhibits features of the metabolic syndrome of NIDDM without altering glucose tolerance. Mol Cell, 1998. 2(5): p. 559-69.

23. Madisen, L., et al., A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nat Neurosci, 2010. 13(1): p. 133-40.

24. Hill, J.W., et al., Phosphatidyl inositol 3-kinase signaling in hypothalamic proopiomelanocortin neurons contributes to the regulation of glucose homeostasis. Endocrinology, 2009. 150(11): p. 4874-82.

25. Mesaros, A., et al., Activation of Stat3 signaling in AgRP neurons promotes locomotor activity. Cell Metab, 2008. 7(3): p. 236-48.

26. Derakhshan, F. and C. Toth, Insulin and the brain. Curr Diabetes Rev, 2013. 9(2): p. 102-16.

27. Blazquez, E., et al., Insulin in the brain: its pathophysiological implications for States related with central insulin resistance, type 2 diabetes and Alzheimer's disease. Front Endocrinol (Lausanne), 2014. 5: p. 161.

28. Bruning, J.C., et al., Role of brain insulin receptor in control of body weight and reproduction. Science, 2000. 289(5487): p. 2122-5.

29. Wrigley, S., D. Arafa, and D. Tropea, Insulin-Like Growth Factor 1: At the Crossroads of Brain Development and Aging. Front Cell Neurosci, 2017. 11: p. 14.

30. O'Kusky, J. and P. Ye, Neurodevelopmental effects of insulin-like growth factor signaling. Front Neuroendocrinol, 2012. 33(3): p. 230-51.

31. Kappeler, L., et al., Brain IGF-1 receptors control mammalian growth and lifespan through a neuroendocrine mechanism. PLoS Biol, 2008. 6(10): p. e254.

32. Bouret, S.G., Neurodevelopmental actions of leptin. Brain Res, 2010. 1350: p. 2- 9.

33. Caron, E., et al., Distribution of leptin-sensitive cells in the postnatal and adult mouse brain. J Comp Neurol, 2010. 518(4): p. 459-76.

34. O'Neill, B.T., et al., Differential Role of Insulin/IGF-1 Receptor Signaling in Muscle Growth and Glucose Homeostasis. Cell Rep, 2015. 11(8): p. 1220-35.

35. Boucher, J., et al., Impaired thermogenesis and adipose tissue development in mice with fat-specific disruption of insulin and IGF-1 signalling. Nat Commun, 2012. 3: p. 902.

36. Glumer, C., et al., Prevalences of diabetes and impaired glucose regulation in a Danish population: the Inter99 study. Diabetes Care, 2003. 26(8): p. 2335-40.

37. Sicree, R.A., et al., Differences in height explain gender differences in the response to the oral glucose tolerance test- the AusDiab study. Diabet Med, 2008. 25(3): p. 296-302.

38. van Genugten, R.E., et al., Effects of sex and hormone replacement therapy use on the prevalence of isolated impaired fasting glucose and isolated impaired glucose tolerance in subjects with a family history of type 2 diabetes. Diabetes, 2006. 55(12): p. 3529-35.

39. Williams, J.W., et al., Gender differences in the prevalence of impaired fasting glycaemia and impaired glucose tolerance in Mauritius. Does sex matter? Diabet Med, 2003. 20(11): p. 915-20.

40. Basu, R., et al., Effects of age and sex on postprandial glucose metabolism: differences in glucose turnover, insulin secretion, insulin action, and hepatic insulin extraction. Diabetes, 2006. 55(7): p. 2001-14.

41. Yakar, S., et al., Liver-specific igf-1 gene deletion leads to muscle insulin insensitivity. Diabetes, 2001. 50(5): p. 1110-8.

42. Yakar, S., et al., Inhibition of growth hormone action improves insulin sensitivity in liver IGF-1-deficient mice. J Clin Invest, 2004. 113(1): p. 96-105.

43. Vijayakumar, A., et al., Biological effects of growth hormone on carbohydrate and lipid metabolism. Growth Horm IGF Res, 2010. 20(1): p. 1-7.

44. Konner, A.C., et al., Insulin action in AgRP-expressing neurons is required for suppression of hepatic glucose production. Cell Metab, 2007. 5(6): p. 438-49.

100

Chapter 4

Unique Role of IGF-1 Receptors and Insulin Receptors in Kisspeptin Neurons in Reproduction and Metabolism

4.1 Abstract

The neuropeptide kisspeptin, encoded by the Kiss1 gene, is critical for puberty and fertility, but the factors that regulate kisspeptin neurons need to be clarified. The anabolic factors insulin and insulin like growth factor-1 (IGF-1) may signal nutritional status to these neurons. Our lab has previously shown that deletion of insulin receptors

(IRs) in Kiss1 neurons delays the initiation of puberty but does not affect adult fertility.

These mice exhibited no change in body weight, fat composition, food intake or glucose homeostasis, although another group found decreased fasting insulin levels in equivalent male mice using a different kisspeptin transgenic line. To test whether IGF-1 action specifically in Kiss1 neurons affects fertility or energy homeostasis, we have now generated transgenic mice lacking IGF-1 receptors (IGF1Rs) exclusively in Kiss1 neurons (IGF1RKiss1 mice). In addition, because IGF1R and IR signaling induce overlapping activation of the (Phosphoinositide 3-kinase) PI3K-Akt pathway, we generated mice with deletions of both IGF1Rs and IRs in Kiss1 neurons (IGF1R/IRKiss1 mice). We found that IGF1RKiss1 mice experienced decreased body weight, body length,

101

delayed pubertal development and decreased litter size. Surprisingly, these parameters were comparable between the IGF1RKiss1 and IGF1R/IRKiss1 mice. These results indicate

IGF1R signaling in Kiss1 neurons is the major driver of effects on body weight, body length and adult fertility. Notably, IGF1R/IRKiss1 mice had significantly increased fat mass, decreased physical activity and disrupted glucose homeostasis, which suggest

IGF1R and IR may have compensatory effects in the regulation of fat mass, physical activity and glucose homeostasis. In summary, IGF1R and IR signaling in Kiss1 neurons have unique and cooperative roles in regulating metabolic and reproductive functions.

4.2 Introduction

Kisspeptin (encoded by the Kiss1 gene) signaling was identified as one of the critical regulators for both puberty onset and maintenance of normal reproductive functions in mammals [1, 2]. Kiss1 neurons are mainly located in two regions of hypothalamus, one in the anteroventral periventricular nucleus (AVPV) and the other in the arcuate nucleus (ARC) [3, 4]. Kisspeptin exerts its effects on the hypothalamic– pituitary–gonadal (HPG) axis by acting in the hypothalamus as a neuropeptide essential for stimulation of gonadotropin-releasing hormone (GnRH) neurons [5, 6].

Reproduction requires adequate amount of energy stores [7]. Kiss1 neurons have been previously hypothesized to serve as the primary transmitters of metabolic signals from periphery to GnRH neurons [7-9]. Several studies have documented a clear impact of conditions of undernutrition or metabolic stress on Kiss1 expression in the hypothalamus. Mice subjected to fasting displayed a reduction in hypothalamic Kiss1

102

mRNA levels, which preceded the decline in GnRH expression [10]. Similarly, chronic subnutrition during puberty reduced Kiss1 mRNA levels in the ARC in female rats [11].

Furthermore, repeated central injections of kisspeptin to female rats with arrested puberty due to chronic subnutrition restored pubertal progression despite the persistent caloric restriction [12].

Important metabolic signals for reproduction include insulin [13-15], IGF-1 [14,

16] and leptin [17, 18]. In particular, brain IR signaling regulates metabolic and reproductive functions [13]. However, mice lacking IRs in GnRH neurons display normal puberty and reproductive function [14]. Our lab has previously shown that deletion of IRs in Kiss1 neurons delays the initiation of puberty but does not affect adult fertility. These mice exhibited no change in body weight, fat composition, food intake or glucose homeostasis [15], although another group found decreased fasting insulin levels in equivalent male mice using a different kisspeptin transgenic line [19]. LepRb colocalize with Kiss1 neurons [20]; however, we have shown that leptin’s effects on puberty in mice do not require Kiss1 neurons [21]. This indicates that leptin and kisspeptin may have independent ways to regulate puberty. Our studies of the role of IGF1R signaling in

LepRb neurons indicated that IGF1R plays a predominant role in the control of puberty and fertility in both female and male mice (Chapter 2). Moreover, deletion of IGF1Rs in

GnRH neurons resulted in a 3-day delay in pubertal onset [14]. These evidences highlight the importance of central IGF1R signaling in the regulation of reproduction. However, we do not know the role of Kiss1 neuron IGF1R signaling in reproduction.

103

IGF-1 and insulin act through related tyrosine kinase receptors whose signals converge on their downstream insulin receptor substrate (IRS) proteins [22], which then recruit and activate phosphatidylinositol 3-kinase (PI3K) to promote Akt signaling [23].

This fact can have important physiological consequences. O’Neill and colleagues generated a double knockout of IGF1R and IR mouse model of muscle (MIGIRKO) [24].

Single deletion of IGF1R showed decreased body weight and severe muscle atrophy while loss of IR caused 9% loss of lean mass [24]. IGF1R and IR compensate for each other to maintain muscle growth, such that when both are deleted, the mice displayed no insulin or IGF-1 signaling in skeletal muscle and have a marked decrease in muscle mass and fiber size [24]. Both IGF1Rs and IRs are homodimer receptors and hybrid receptors consisting one-half IGF1R and one-half IR also present at the cell surface [25].

Therefore, IGF-1 and insulin signaling may have compensatory roles in the regulation of reproduction. Therefore, our first hypothesis is that IGF1R and IR signaling in Kiss1 neurons jointly regulate puberty and fertility.

Kisspeptin’s regulatory effect on metabolic functions may be mediated by communication with pro-opiomelanocortin (POMC) / amphetamine regulated transcript

(CART) and neuropeptide Y (NPY) / agouti-related peptide (AGRP) neurons which also reside in the ARC of hypothalamus [26-29]. Kisspeptin signaling has also been implicated in regulating glucose homeostasis and body weight control [30]. Therefore, we also wanted to test whether IGF1R and/or IR signaling in Kiss1 neurons may play a role in regulating metabolic functions via communications with POMC/CART and

NPY/AgRP neurons. To test our hypotheses, we characterized the reproductive and

104

metabolic functions of mice lacking only IGF1Rs specifically in Kiss1 neurons

(IGF1RKiss1 mice) and mice lacking both IGF1Rs and IRs (IGF1R/IRKiss1 mice).

4.3 Materials and Methods

Animals and genotyping

To generate mice with the IGF1Rs specifically deleted in Kiss1 neurons, Kiss-Cre mice [31] were crossed with IGF1R-loxed mice [32, 33] and bred to homozygosity for the floxed allele only. The IGF1Rflox/flox mice were designed with loxP sites flanking exon

3. Excision of exon 3 in the presence of Cre recombinase results in a frame shift mutation and produces a premature stop codon. Littermates only carrying loxP sites were used as controls. To generate IGF1R/IRKiss1 mice, Kiss-Cre mice [31] were crossed with IGF1R- loxed and IR-loxed mice [34] and bred to homozygosity for the floxed allele only. All mice were on C57BL/6 background. Where specified, the mice also carried the

Gt(ROSA)26Sor locus-inserted enhanced green fluorescent protein (EGFP) gene

[B6.129-Gt(ROSA)26Sortm2Sho/J; The Jackson Laboratory, Bar Harbor, Maine], serving as a reporter under the control of Cre recombinase expression.

Mice were housed in the University of Toledo College of Medicine animal facility at 22°C to 24°C on a 12-hour light/12-hour dark cycle and were fed standard rodent chow

(2016 Teklad Global 16% Protein Rodent Diet, 12% fat by calories; Harlan Laboratories,

105

described in Appendix A. PCR amplification of the IGF-1 receptor floxed (flanked by loxP sites) genomic regions, combined with the detection of the Cre transgene in tailed- derived DNA were performed (Denville DirectAmpTM Genomic DNA Amplication Kit).

Animal Care and Use Committee.

Puberty and reproductive phenotype assessment

Timing of pubertal development was checked daily after weaning by determining vaginal opening (VO) in female mice or balanopreputial separation (BPS) in male mice.

Stages were assessed based on vaginal cytology as described previously [35, 36]. BPS was checked daily from weaning by manually retracting the prepuce with gentle pressure

[15]. After BPS was seen in male mice, each male mouse was paired with one fertile wild-type female for eight nights to evaluate the first date of conception while monitoring daily for copulatory plugs. The paired mice were separated after eight nights, and pregnancy rate, litter size, and interval from mating to birth were recorded. The age of sexual maturation was estimated from the birth of the first litter minus average pregnancy duration for mice (21 days).

106

Tissue collection and histology

µm sections. Sections were stained by hematoxylin and eosin and then analyzed.

Quantitative real-time PCR

Hypothalamus, liver, BAT and WAT were also removed after LepRb-Cre,

IGF1RLepRb and IGF1R/IRLepRb mice were decapitated. Total hypothalamic and liver RNA were extracted from dissected tissues by an RNeasy Lipid Tissue Mini Kit (QIAGEN,

Valencia, California), and BAT and WAT RNA were extracted by using TRIzol (Sigma-

Aldrich, St. Louis, MO, USA) as described previously [37]. Single-strand cDNA was synthesized by a High-Capacity cDNA Reverse Transcription kit (Applied Biosystems) using random hexamers as primers as listed in Appendix A. Each sample was analyzed in duplicate to measure gene expression level. A 25µM cDNA template was used in a 25µl system in 96-well plates with SYBR Green qPCR SuperMix/ROX (Smart Bioscience Inc,

Maumee, Ohio). The reactions were run in an ABI PRISM 7000 sequence detection

107

system (PE Applied Biosystems, Foster City, California). Or a 10µMcDNA template was used in a 10 µl system in 384-well plates with SYBR Green qPCR SuperMix/ROX

(Smart Bioscience Inc, Maumee, Ohio). These reactions were run in a ThermoFisher

QuantStudio 5 Real-Time PCR system (Applied Biosystems, Foster City, California). All data were analyzed using the comparative Ct method (2-ΔΔCt) with glyceraldehyde-3- phosphate dehydrogenase (GADPH) as the housekeeping gene. The mRNA expression in

IGF1RLepRb and IGF1R/IRLepRb versus LepRb-Cre control mice was determined by a comparative cycle threshold method and relative gene copy number was calculated as 2-

ΔΔCt and presented as fold change of the relative mRNA expression of the LepRb-Cre control group. For each sample, the threshold cycle (Ct) of mRNA was measured and normalized to the average of the housekeeping gene (ΔCt = CtUnknown – CtGAPDH). The fold change of mRNA in the unknown sample relative to LepRb-Cre control group was

-ΔΔCt determined by 2 , where ΔΔCt = ΔCtUnknown −ΔCtControl.

Hormone assays

Submandibular blood was collected at 9:00 to 11:00 AM to detect basal LH, FSH and estradiol levels. LH and FSH were measured via RIA performed by the University of

Virginia Center for Research in Reproduction Ligand Assay and Analysis Core

(Charlottesville, VA). Blood from female mice was collected on diestrus. The assay for

LH had a detection sensitivity of 3.28 pg/ml. The intra-assay and interassay coefficients of variance (CVs) were 4.0% and 8.6%. The assay for FSH had a detection sensitivity of

108

7.62 pg/ml. The intra-assay and interassay coefficients of variance (CVs) were 7.4% and

9.1%.

Serum estradiol was measured by ELISA (Calbiotech, Spring Valley, California) with a sensitivity of 3 pg/mL and intra-assay and interassay CVs of <10%. Serum testosterone was measured ELISA (Calbiotech, Spring Valley, California) with a sensitivity of 0.1 ng/mL and intra-assay and interassay CVs of <10%. Serum IGF-1 was measured by ELISA (Crystal Chem, Elk Grove Village, IL) with sensitivity of 0.5 to 18 ng/mL and precision intraassay and interassay CVs of <10%. Serum growth hormone was measured by ELISA (Crystal Chem, Elk Grove Village, IL) with a sensitivity range of 0.15 to 9 ng/mL and intraassay and interassay CVs of <10%.

Western blotting

Adult control, IGF1RKiss and IGF1R/IRKiss mice were sacrificed, and hypothalamus, liver, muscle, visceral adipose tissues, and gonads were harvested. Tissues were snap-frozen in liquid nitrogen and stored at -80°C until homogenized in radioimmunoprecipitation assay lysis buffer (Millipore, Billerica, Massachusetts) supplemented with protease inhibitor and phosphatase inhibitor (Thermo Fisher

Scientific, Waltham, Massachusetts). After centrifugation, supernatant protein concentrations were determined by BCA protein assay (Thermo Fisher Scientific). Then

30 µg denatured samples were subjected to SDS-PAGE electrophoresis and western blotting. Insulin was administered via Primary antibodies used were as follows: IGF1R β subunit (1:1000; Cell signaling, Cat#9750), pAKT (1:1000, Cell signaling, Cat#4070),

109

AKT (1:1000, Cell signaling, Cat#2920). GAPDH (1:1000; Abcam, Cat#ab8245) or β-

Actin (:1000, Cell Abcam, Cat#ab8226) was used as a loading control. Secondary antibodies used were as follows: donkey anti-rabbit-800 (1:10000, LI-COR, P/N 926-

32213) and goat anti-mouse-680 (1:10000, LI-COR, P/N 926-68070). LI-COR odyssey infrared imaging system was used to capture images, and only the contrast and brightness were adjusted for this purpose.

Perfusion and immunohistochemistry

Adult male mice and female mice at diestrus at the age of 3 to 6 months were deeply anesthetized by ketamine and xylazine. After brief perfusion with a saline rinse, mice were perfused transcardially with 10% formalin for 10 minutes, and the brain was removed. The brain was postfixed in 10% formalin at 4°C overnight and immersed in

10%, 20%, and 30% sucrose at 4°C for 24 hours each. Then 30-µm sections were cut by a sliding microtome into 5 equal serial sections. After rinsing in PBS, sections were blocked for 2 hours in PBS-T (PBS, Triton X-100, and 10% normal horse serum). Then, samples were incubated for 48 hours at 4°C in PBS-T-containing rabbit anti-IGF1R β antibody (1:1000; Cell signaling, Cat#9750), rabbit anti-pAKT antibody (1:1000, Cell signaling, Cat#4070), goat anti-tdTomato antibody (1:1000; SICGEN, Cat# AB8181-

200). After several washes in PBS, sections were incubated in PBS-T (Triton X-100 and

10% horse serum) containing secondary antibodies Alexa Fluor 568 (1:1,000,

Thermofisher Scientific, Lot # A-11011) and Alexa Flour 488 (1:1,000, Thermofisher

Scientific, Cat. #A-21206) for 2 hours at room temperature. Finally, sections were

110

washed, mounted on slides, cleared, and coverslipped with fluorescence mounting medium containing DAPI (Vectasheild, Vector laboratories, Inc. Burlingame,

California).

Statistical analysis

4.4 Results

4.4.1 Confirmation of Mouse Model

To verify that the IGF1R gene was excised in Kiss1-expressing neurons, PCR was performed on DNA from different tissues. As expected, a 390-bp band indicating gene deletion was produced only from the hypothalamus but not in ovary, testis or liver

(Figure 4-1A and B).

Hypothalamic IGF1R protein expression was significantly decreased in

IGF1RKiss1 mice when compared to control mice (Figure 4-1C). IR signaling was evaluated by activation of pAKT after insulin administration. As expected, AKT phosphorylation was decreased in IGF1R/IRKiss1 mice when compared to control mice

111

(Figure 4-1D). At the mRNA level, hypothalamic IGF1R (Figure 4-1E), IR (Figure 4-

1F) and Kiss1 gene (Figure 4-1G) mRNA expression trended lower in IGF1RKiss1 mice and IGF1R/IR Kiss1 mice; however this was not significant (n=6).

112

Figure 4-1 Decreased IGF1R and IR expression in IGF1RKiss1 and IGF1RKiss1 mice. (A and B) Hypothalamus IGF1R protein expression were measured in control (white bar, n=4) and IGF1RKiss1 mice (black bar, n=4). (C) Hypothalamus IGF1R protein expression were measured in control (white bar, n=4) and IGF1RKiss1 mice (black bar, n=4). (D) Hypothalamus pAKT protein expression were measured in control (white bar, n=4) and IGF1R/IRKiss1 mice to evaluate the IR signaling (black bar, n=4). (E-G) Hypothalamus IGF1R (A), IR (B) and Kiss1 (C) mRNA expression were evaluated in control (white bar, n=6), IGF1RKiss1 (black bar, n=6) and IGF1R/IRKiss1 (red bar, n=6) mice. Values throughout figure are means ±SEM. For entire figure, *P < 0.05, ** P < 0.01, and *** P < 0.0001, determined by Tukey’s post hoc test following one-way ANOVA for each group.

4.4.2 Assessment of Energy Homeostasis

Female IGF1RKiss1 mice had mildly decreased body weight compared to control mice (Figure 4-2A). However, we did not see changes in fat mass (Figure 4-2B) or lean mass (Figure 4-2C) percentage. IGF1RKiss1 female mice showed decreased food intake

(Figure 4-2D), which may explain why these mice had decreased body weight. To further understand the role of IGF-1 and insulin signaling in energy homeostasis, we performed indirect calorimetry in these mice. Female IGF1RKiss1 mice showed increased

VO2 (Figure 4-2E), energy expenditure (EE) (Figure 4-2G) and physical activity

(Figure 4-2H), suggesting that loss of IGF1R signaling in Kiss1 neurons improved regulation of energy homeostasis. We then measured anorexigenic and orexigenic signals such as POMC, AgRP and NPY mRNA expression in hypothalamus. We found anorexigenic POMC mRNA was significantly increased in female IGF1RKiss1 mice

(Figure 4-2I), which may explain why these mice had decreased food intake. Our results suggest that the regulatory effects of IGF1R signaling in Kiss1 neurons in energy homeostasis may be mediated by POMC signaling in hypothalamus. To examine how

113

brown adipose tissue (BAT) contributes to energy homeostasis in female IGF1RKiss1 mice, BAT weight, gene expression and histological analysis were examined. Weight and histological changes of BAT were comparable in all groups (data not shown). However,

ADRB3 gene mRNA expression, a marker of sympathetic system activity, was increased in IGF1RKiss1 female mice compared to controls (Figure 4-2J). Thermogenic markers peroxisome proliferator-activated receptor gamma (PPARγ) and Cidea were also increased in IGF1RKiss1 female mice (Figure 4-2J). Our results indicate that IGF1R signaling in Kiss1 neurons likely regulates energy homeostasis via communication with

POMC signaling and activation of the sympathetic system activity.

The additional deletion of IRs did not cause changes in body weight between female IGF1RKiss1 and IGF1R/IRKiss1 mice (Figure 4-2A), which indicates that IGF1R signaling plays a dominant role in the regulation of body weight. Lack of either IGF1Rs or IRs did not change body composition, but, surprisingly, simultaneous loss of both

IGF1Rs and IRs in Kiss1 neurons caused a dramatic increase of fat mass percentage

(Figure 4-2B). No differences were seen in lean mass percentage (Figure 4-2C) or food intake in IGF1R/IRKiss1 mice. These findings suggest that IGF1R and IR signaling may have compensatory role in the regulation of Kiss1 neurons to regulate body fat mass composition. There were no differences in VO2 (Figure 4-2E), respiratory exchange ratio

(RER) (Figure 4-2F) or energy expenditure (EE) (Figure 4-2G) in female IGF1R/IRKiss1 mice compared to controls or IGF1RKiss1 mice. Female IGF1R/IRKiss1 mice had significantly decreased physical activity (Figure 4-2H) compared to IGF1RKiss1 mice, suggesting IR signaling in Kiss1 neurons has a detrimental role in the regulation of

114

energy homeostasis compared to IGF1R signaling via reduced locomotion. We did not see changes in thermogenesis-related genes expression in hypothalamus (Figure 4-2I) or

BAT (Figure 4-2J).

115

Figure 4-2 Divergent role of IGF1R and IR signaling in Kiss1 neurons in regulating energy homeostasis in female mice. (A) Body weight curves of female control (open circle, n=13), IGF1RKiss1 (filled black squares, n=6) and IGF1R/IRKiss1 (filled red squares, n=9) mice on standard chow. (B-C) Fat mass percentage and (C) lean mass percentage in 2-month-old female control (white bar, n=13), IGF1RKiss1 (black bar, n=6) and IGF1R/IRKiss1 (red bar, n=9) mice by NMR. (D) Daily food intake in 4-month-old female control (white bar, n=13), IGF1RKiss1 (black bar, n=6) and IGF1R/IRKiss1 (red bar, n=9) mice. (E-H) VO2 (E), respiratory exchange ratio (RER) (F), energy expenditure (EE) (G) and physical activity (H) in 4-month-old female control (open circle and white bar, n=13), IGF1RKiss1 (filled black square and black bar, n=6) and IGF1R/IRKiss1 (filled red square and red bar, n=9) mice. (I) Relative expression of POMC, AgRP and NPY in hypothalamus as measured by quantitative PCR in female control (white bar, n=6), IGF1RKiss1 (black bar, n=6) and IGF1R/IRKiss1 (red bar, n=6) mice. (J) Relative expression of thermogenesis markers in BAT as measured by quantitative PCR in female control (white bar, n=6), IGF1RKiss1 (black bar, n=6) and IGF1R/IRKiss1 (red bar, n=6) mice. Values throughout figure are means ±SEM. For entire figure, *p < 0.05, **p < 0.01, and ***p < 0.0001, determined by Bonferroni’s Multiple Comparison Test following one-way ANOVA for each group or time point in A; or determined by Tukey’s post hoc test following one-way ANOVA for each group.

Male IGF1RKiss1 mice had decreased body weight (Figure 4-3A), comparable fat mass percentage (Figure 4-3B), mildly decreased food intake (Figure 4-3D), increased

Kiss1 VO2 (Figure 4-3E and F) and EE (Figure 4-3I and J). Male IGF1R mice had increased RER (Figure 4-3G and H) and physical activity (Figure 4-3K and L). Male

IGF1R/IRKiss1 mice had increased physical activity during daytime compared to both control and IGF1RKiss1 mice (Figure 4-3K and L). These findings were consistent with our findings in female mice. IR signaling in Kiss1 neurons did not regulate energy homeostasis [15]. It appears that IGF1R and IR signaling can each maintain normal RER,

EE and physical activity as only the male IGF1R/IRKiss1 mice have profound changes in these parameters.

116

Figure 4-3 Role of IGF1R and IR signaling in Kiss1 neurons in regulating energy homeostasis in male mice. (A) Body weight curves of male control (open circle, n=12), IGF1RKiss1 (filled black squares, n=6) and IGF1R/IRKiss1 (filled red squares, n=7) mice on standard chow. (B-C) Fat mass percentage and (C) lean mass percentage in 2-month-old male control (white bar, n=12), IGF1RKiss1 (black bar, n=6) and IGF1R/IRKiss1 (blue bar, n=7) mice by NMR. (D) Daily food intake in 4-month-old male control (white bar, n=12), IGF1RKiss1 (black bar, n=6) and IGF1R/IRKiss1 (blue bar, n=7) mice. (E-H) VO2 (E), respiratory exchange ratio (RER) (F), energy expenditure (EE) (G) and physical activity (H) in 4-month-old male control (white circle and white bar, n=12), IGF1RKiss1 (filled black square and black bar, n=4) and IGF1R/IRKiss1 (filled blue square and blue bar, n=7) mice. Values throughout figure are means ±SEM. For entire figure, *p < 0.05, **p < 0.01, and ***p < 0.0001, determined by Bonferroni’s Multiple Comparison Test following one-way ANOVA for each group or time point in A; or determined by Tukey’s post hoc test following one-way ANOVA for each group.

117

4.4.3 Blood Glucose Regulation

The effects of IGF1Rs and/or IRs in Kiss1 neurons on glucose homeostasis were tested in 3-month-old mice. Female IGF1RKiss1 mice have normal glucose tolerance and insulin sensitivity as indicated in glucose tolerance test (GTT) and area under the curve

(AUC) (Figure 4-4A) and insulin tolerance test (ITT) and AUC (Figure 4-4B). IR signaling in Kiss1 neurons did not influence glucose homeostasis [15]. IGF1Rs in Kiss1 neurons alone did not influence glucose tolerance, but lack of both IGF1Rs and IRs caused insulin insensitivity (Figure 4-4B), suggesting the specific compensatory effects in the regulation of insulin sensitivity. Baseline glucose (Figure 4-4E), fasting glucose

(Figure 4-4F), serum insulin (Figure 4-4G) and C-peptide (Figure 4-4H) were all similar.

118

Figure 4-4 Insulin insensitivity in female IGF1R/IRKiss1 mice. (A and B) Glucose tolerance test (GTT) and area under curve (AUC) (A) and insulin tolerance test (ITT) and area under curve (AUC) (B) in 3-month-old female control (open circle and white bar, n=13), IGF1RKiss1 (filled black square and black bar, n=6) and IGF1R/IRKiss1 (filled red square and red bar, n=7) mice. (C-F) Baseline glucose levels (C), 16hr-fasting glucose levels (D), insulin (E) and C-peptide ratio (F) in 3-month-old female control (white bar, n=6-11), IGF1RKiss1 (black bar, n=4) and IGF1R/IRKiss1 (red bar, n=4-7) mice. Values throughout figure are means ±SEM. For entire figure, *p < 0.05, **p < 0.01, and ***p < 0.0001, determined by Bonferroni’s Multiple Comparison Test following one-way ANOVA for each group or time point in A, C, I and K; or determined by Tukey’s post hoc test following one-way ANOVA for each group.

Like the females, male IGF1RKiss1 mice had normal glucose tolerance (Figure 4-

5A) and insulin sensitivity (Figure 4-5B). Baseline glucose (Figure 4-5E) was found elevated in male IGF1RKiss1 mice compared to control mice (Figure 4-5E) but no differences were seen in fasting glucose (Figure 4-5F), serum insulin (Figure 4-5G) and

C-peptide levels (Figure 4-5H).

Surprisingly, sex-associated differences were seen in IGF1R/IRKiss1 mice. Male

IGF1R/IRKiss1 mice had glucose intolerance with normal insulin sensitivity (Figure 4-5A and B). Elevated C-peptide was seen in male IGF1R/IRKiss1 mice compared to control mice, suggesting elevated insulin production (Figure 4-5H). Thus, IGF1R signaling alone in Kiss1 neurons does not control glucose homeostasis, but IGF1R and IR signaling may cooperatively regulate insulin release in males.

119

Figure 4-5 Glucose intolerance in male IGF1R/IRKiss1 mice. (A and B) GTT and AUC (A) and ITT and B in 3-month-old male control (open circle and white bar, n=12), IGF1RKiss1 (filled black square and black car, n=6) and IGF1R/IRKiss1 (filled red square and red bar, n=6) mice. (C-F) Baseline glucose levels (C), 16hr-fasting glucose levels (D), insulin (E) and C-peptide ratio (F) in 3- month-old female control (white bar, n=4-10), IGF1RKiss1 (black bar, n=4-5) and IGF1R/IRKiss1 (red bar, n=3-5) mice. Values throughout figure are means ±SEM. For entire figure, *p < 0.05, **p < 0.01, and ***p < 0.0001, determined by Bonferroni’s Multiple Comparison Test following one-way ANOVA for each group or time point in A, C, I and K; or determined by Tukey’s post hoc test following one-way ANOVA for each group.

4.4.4 Body growth

IGF-1 is one of the most important regulators of body growth. Therefore, we measured the body length from week 3 to 24. We found that body length in IGF1RKiss1 and IGF1R/IRKiss1 female mice were shorter than the control mice (Figure 4-6A).

However, as no differences were seen between IGF1RKiss1 and IGF1R/IRKiss1 female

120

mice, these findings suggested IGF1R in Kiss1 neurons predominantly control body growth in female mice. Male IGF1RKiss1 and IGF1R/IRKiss1 mice also had decreased body length compared to control mice (Figure 4-6C), but the effects were mild compared to female mice. No differences were seen in the serum IGF-1 levels in both female and male mice (Figure 4-6B and D).

Figure 4-6 Body growth in IGF1RKiss1 and IGF1R/IRKiss1 Mice. (A) Body length curves from week 3 to 24 in female control (open circle, n=13), IGF1RKiss1 (filled black square, n=6) and IGF1R/IRKiss1 (filled red square, n=9) mice. (B) Serum levels of IGF-1 at 3 months of age in 3-month-old female control (white bar, n=6), IGF1RKiss1 (black bar, n=6) and IGF1R/IRKiss1 (red bar, n=6) mice. (C) Body length curves from week 3 to 24 in male control (open circle, n=12), IGF1RKiss1 (filled black square, n=6) and IGF1R/IRKiss1 (filled blue square, n=8) mice. (D) Serum levels of IGF-1 at 3 months of age in male control (white bar, n=5), IGF1RKiss1 (black bar, n=4) and IGF1R/IRKiss1 (blue bar, n=4) mice. Values throughout figure are means ±SEM. For entire figure, *p < 0.05, **p < 0.01, and ***p < 0.0001, determined by Bonferroni’s Multiple Comparison Test following one-way ANOVA for each group or time point in A and C; or determined by Tukey’s post hoc test following one-way ANOVA for each group.

121

4.4.5 Assessments of Pubertal Development

Pubertal development was also evaluated in both female and male mice. Delayed vaginal opening age (Figure 4-7A) and first estrus age (Figure 4-7B) were see in female

IGF1RKiss1 mice compared to control mice. Surprisingly, serum luteinizing hormone (LH)

(Figure 4-7E) and follicle-stimulating hormone (FSH) levels (Figure 4-7F) of 4-week- old female IGF1RKiss1 mice were increased. These changes characterized one of the subtypes of delayed puberty seen in human patients, called hypergonadotropic hypogonadism, instead of the most common subtype hypogonadotropic hypogonadism.

Estrus cycle length (Figure 4-7C) and time spent in each estrus cycle stage (Figure 4-

7D) were comparable between adult IGF1RKiss1 and control mice. Female IGF1R/IRKiss1 mice also had delayed vaginal opening age (Figure 4-7A) and first estrus age (Figure 4-

7B); no differences were seen between IGF1RKiss1 mice and IGF1R/IRKiss1 mice, suggesting IGF1Rs signaling in Kiss1 neurons plays a dominant role in regulating pubertal development.

Male IGF1RKiss1 mice displayed delayed pubertal development, as indicated by balanopreputial separation age (Figure 4-7G) and decreased LH (Figure 4-7H) and FSH

(Figure 4-7I) levels at 4-weeks of age. Male IGF1R/IRKiss1 mice also had delayed pubertal development (Figure 4-7G), but there was no difference between IGF1RKiss1 mice and IGF1R/IRKiss1 mice.

122

Figure 4-7 Delayed pubertal development in IGF1RKiss1 and IGF1R/IRKiss1 mice. (A- D) Vaginal opening age (A), first estrus age (B), estrus cycle length (C) and days spent in each estrus cycle stage (D) in female control (white bar, n=12), IGF1RKiss1 (black bar, n=6) and IGF1R/IRKiss1 (red bar, n=9) mice. (E and F) Serum LH (D) and FSH (E) levels on diestrus in 4 weeks-old female control (white bar, n=9), IGF1RKiss1 (black bar, n=7), IGF1R/IRKiss1 (red bar, n=6) mice. (G) Balanopreputial separation age in male control (white bar, n=12), IGF1RKiss1 (black bar, n=6) and IGF1R/IRKiss1 (blue bar, n=8) mice. (H and I) Serum LH (H) and FSH (I) in 4 weeks-old male control (white bar, n=6), IGF1RKiss1 (black bar, n=6), IGF1R/IRKiss1 (blue bar, n=5) mice. Values throughout figure are means ±SEM. For entire figure, *p < 0.05, **p < 0.01, and ***p < 0.0001, determined by Tukey’s post hoc test following one-way ANOVA for each group.

123

4.4.6 Assessments of Adult Fertility

To further evaluate the adult reproductive functions, we did fertility tests in both female and male mice. Even though the overall pregnancy rate in all female groups were comparable (Figure 4-8A), the litter size was decreased in IGF1RKiss1 mice (Figure 4-

8B), and the interval from pairing to birth in IGF1RKiss1 mice was longer compared to control (Figure 4-8C). LH (Figure 4-8E) and FSH (Figure 4-8F) levels were higher in

3-month-old IGF1RKiss1 mice which was consistent with the findings in 4-week-old mice.

No differences were seen the copulatory plugs numbers (Figure 4-8D), estradiol levels

(Figure 4-8G), ovary weight (Figure 4-8H), uterine weight (Figure 4-8I) and histological analysis of the ovary. Female IGF1R/IRKiss1 mice showed similar phenotype compared to IGF1RKiss1 mice, suggesting IGF1R signaling in Kiss1 neurons plays a dominant role in the regulation of adult fertility as well as pubertal timing.

124

Figure 4-8 Decreased littersize and changes of LH and LH/FSH ratio in IGF1RKiss1 and IGF1R/IRKiss1 female mice. (A-D) Pregnancy rate (A), littersize (B), interval from pairing to birth (C) and copulatory plugs (D) in 4-month-old female control (white bar, n=12), IGF1RKiss1 (black bar, n=6) and IGF1R/IRKiss1 (red bar, n=9) mice. (E-G) Serum LH (E), LH/FSH (F) and estradiol (G) levels on diestrus in 3- to 4-month-old female control (white

125

bar, n=12), IGF1RKiss1 (black bar, n=6) and IGF1R/IRKiss1 (red bar, n=9) mice. (H) Uterine and ovary weight in 5-month-old female control (white bar, n=6), IGF1RKiss1 (black bar, n=6) and IGF1R/IRKiss1 (red bar, n=6) mice. (I) Ovarian follicle numbers in 5-month-old female control (white bar, n=6), IGF1RKiss1 (black bar, n=6) and IGF1R/IRKiss1 (red bar, n=6) mice. (J-L) Sliced and HE-stained paraffin-embedded ovaries in 5-month-old female control (J), IGF1RKiss1 (K) and IGF1R/IRKiss1 (L) mice. Values throughout figure are means ±SEM. For entire figure, *p < 0.05, **p < 0.01, and ***p < 0.0001, determined by Tukey’s post hoc test following one-way ANOVA for each group.

Male IGF1RKiss1 mice had decreased pregnancy rate (Figure 4-9A), accompanied by decreased LH (Figure 4-9E), LH/FSH ratio (Figure 4-9F) and testosterone (Figure 4-

9G) levels. These findings were consistent with what we had found in 4-week-old male

IGF1RKiss1 mice. We further performed testis histological studies and analyzed the seminiferous tubule cross-sectional parameters. Even though the tubule area (Figure 4-

9I) was comparable, there was trend towards increased lumen area (Figure 4-9H). As a result, the lumen area/tubule area ratio was increased in IGF1RKiss1 mice (Figure 4-9J), possibly indicating reduced spermatogenesis [38]. Figure 4-9 K and L are histological images of control and IGF1RKiss1 mice. Male IGF1R/IRKiss1 mice showed a similar phenotype compared to IGF1RKiss1 mice. Again, these data suggest IGF1R signaling in

Kiss1 neurons plays a dominant role in the regulation of adult fertility.

126

Figure 4-9 Decreased pregnancy rate and changes of LH and LH/FSH ratio in IGF1RKiss1 and IGF1R/IRKiss1 male mice. (A-D) Pregnancy rate (A), littersize (B), interval from pairing to birth (C) and copulatory plugs (D) in 4-month-old male control (white bar, n=12), IGF1RKiss1 (black bar, n=6) and

127

IGF1R/IRKiss1 (blue bar, n=8) mice. (E-G) Serum LH (E), LH/FSH (F) and testosterone (G) levels in 3- to 4-month-old male control (white bar, n=12), IGF1RKiss1 (black bar, n=7) and IGF1R/IRKiss1 (blue bar, n=6) mice. (H-J) Analysis of histological testes seminiferous tubule cross-sectional lumen area (H), tubule area (I) and lumen area/tubule area ratio (J) in 5-month-old male control (white bar, n=6), IGF1RKiss1 (black bar, n=4) and IGF1R/IRKiss1 (blue bar, n=4) mice. (K and L) Sliced and HE-stained paraffin-embedded testes in 5-month-old male control (K) and IGF1RKiss1 mice (L). Values throughout figure are means ±SEM. For entire figure, *p < 0.05, **p < 0.01, and ***p < 0.0001, determined by Tukey’s post hoc test following one-way ANOVA for each group.

4.5 Discussion

The current study examines the mechanism underlying metabolic control of puberty and fertility by studying the interaction of insulin and IGF1 signaling in Kiss1 neurons. IGF-1 increases at the time of puberty [39]. We found that both IGF1RKiss1 and

IGF1R/IRKiss1 mice had growth retardation and delayed puberty. In contrast, IRKiss1 mice showed normal body growth even though these mice also experience delayed puberty

[15]. Therefore, IGF1R signaling in Kiss1 neurons serves as the link between the somatotropic and gonadotropic axes. IGF-1 mediates the various functions of GH [40].

Mice with global deletions of growth hormone receptors (GHRs) showed about 7 days- delay of vaginal opening compared to controls [41]. Our IGF1RKiss1 and IGF1R/IRKiss1 mice showed about 4 days-delay of vaginal opening compared to controls, suggesting central IGF1R signaling partially mediates GHR’s effects on puberty.

The importance of central IGF1R signaling in the regulation of puberty and fertility has been demonstrated. Brain IGF1Rs knockout mice had delayed puberty and infertility [16]. Mice with IGF1Rs deletions in GnRH neurons had normal fertility [14], showing that IGF1R signaling in other neurons regulates fertility. Further, IGF1R in

128

LepRb neurons is required for normal puberty and fertility (Chapter 2). In this chapter, we showed IGF1RKiss1 mice recap the adult reproductive phenotypes in males and females.

Brain IGF1Rs knockout mice had 20% decreased body weight from the date of birth to week 8, but it normalized thereafter [16]. Our IGF1RKiss1 mice showed 7% mildly decreased body weight in female and male mice at week 8. Given the difference in magnitude of these effects, IGF1R signaling in other neurons is likely to play a role in body weight regulation. These neurons may express leptin receptors [42], as we found that loss of IGF1R signaling in LepRb neurons caused 10% reduction in body weight at week 8 (Chapter 3). Loss of IGF1R signaling in Kiss1 mice caused decreased food intake. The anorexigenic POMC and orexigenic AgRP mRNA expression in the hypothalamus were altered in our knockout mice, supporting the existence of intermediary POMC and AgRP circuits for transmitting IGF-1 and insulin’s actions to

Kiss1 neurons [26].

IGF-1 plays an important role in maintaining a fine balance between GH and insulin and thereby in maintaining normal carbohydrate metabolism [43]. However, peripheral IGF-1 signaling does not seem to play a major role in the regulation of glucose homeostasis [44, 45]. Contrary to peripheral effects, we found IGF1R and IR signaling in

Kiss1 neurons are required for normal insulin sensitivity in female mice and glucose tolerance in male mice, demonstrating that IGF1R and IR signaling in Kiss1 neurons have compensatory effects in the regulation of glucose homeostasis.

129

Summary

Taken together, our findings show the role of IGFR and IR signaling in Kiss1 neurons in the regulation of metabolic and reproductive functions. We found IGF1R signaling in Kiss1 neurons is necessary for well-timed activation of the HPG axis during puberty and adulthood. IGF1R signaling in Kiss1 neurons is also required for normal metabolic functions including body weight, body length, food intake and EE. Notably, the current study demonstrates that IGF1R and IR signaling in Kiss1 neurons have compensatory effects in the regulation of body fat mass composition and glucose homeostasis.

4.6 References

1. Herbison, A.E., Control of puberty onset and fertility by gonadotropin-releasing hormone neurons. Nat Rev Endocrinol, 2016. 12(8): p. 452-66.

2. d'Anglemont de Tassigny, X. and W.H. Colledge, The role of kisspeptin signaling in reproduction. Physiology (Bethesda), 2010. 25(4): p. 207-17.

3. Oakley, A.E., D.K. Clifton, and R.A. Steiner, Kisspeptin signaling in the brain. Endocr Rev, 2009. 30(6): p. 713-43.

4. Clarkson, J., et al., Distribution of kisspeptin neurones in the adult female mouse brain. J Neuroendocrinol, 2009. 21(8): p. 673-82.

5. Kirilov, M., et al., Dependence of fertility on kisspeptin-Gpr54 signaling at the GnRH neuron. Nat Commun, 2013. 4: p. 2492.

6. Wen, S., et al., Embryonic gonadotropin-releasing hormone signaling is necessary for maturation of the male reproductive axis. Proc Natl Acad Sci U S A, 2010. 107(37): p. 16372-7.

7. Fernandez-Fernandez, R., et al., Novel signals for the integration of energy balance and reproduction. Mol Cell Endocrinol, 2006. 254-255: p. 127-32.

130

8. Dungan, H.M., D.K. Clifton, and R.A. Steiner, Minireview: kisspeptin neurons as central processors in the regulation of gonadotropin-releasing hormone secretion. Endocrinology, 2006. 147(3): p. 1154-8.

9. Forbes, S., et al., Effects of ghrelin on Kisspeptin mRNA expression in the hypothalamic medial preoptic area and pulsatile luteinising hormone secretion in the female rat. Neurosci Lett, 2009. 460(2): p. 143-7.

10. Luque, R.M., R.D. Kineman, and M. Tena-Sempere, Regulation of hypothalamic expression of KiSS-1 and GPR54 genes by metabolic factors: analyses using mouse models and a cell line. Endocrinology, 2007. 148(10): p. 4601-11.

11. Roa, J., et al., The mammalian target of rapamycin as novel central regulator of puberty onset via modulation of hypothalamic Kiss1 system. Endocrinology, 2009. 150(11): p. 5016-26.

12. Castellano, J.M., et al., Changes in hypothalamic KiSS-1 system and restoration of pubertal activation of the reproductive axis by kisspeptin in undernutrition. Endocrinology, 2005. 146(9): p. 3917-25.

13. Bruning, J.C., et al., Role of brain insulin receptor in control of body weight and reproduction. Science, 2000. 289(5487): p. 2122-5.

14. Divall, S.A., et al., Divergent roles of growth factors in the GnRH regulation of puberty in mice. J Clin Invest, 2010. 120(8): p. 2900-9.

15. Qiu, X., et al., Delayed puberty but normal fertility in mice with selective deletion of insulin receptors from Kiss1 cells. Endocrinology, 2013. 154(3): p. 1337-48.

16. Kappeler, L., et al., Brain IGF-1 receptors control mammalian growth and lifespan through a neuroendocrine mechanism. PLoS Biol, 2008. 6(10): p. e254.

17. Hill, J.W., et al., Direct insulin and leptin action on pro-opiomelanocortin neurons is required for normal glucose homeostasis and fertility. Cell Metab, 2010. 11(4): p. 286-97.

18. Qiu, X., et al., Insulin and Leptin Signaling Interact in the Mouse Kiss1 Neuron during the Peripubertal Period. PLoS One, 2015. 10(5): p. e0121974.

19. Evans, M.C., et al., Evidence that insulin signalling in gonadotrophin-releasing hormone and kisspeptin neurones does not play an essential role in metabolic regulation of fertility in mice. J Neuroendocrinol, 2014. 26(7): p. 468-79.

131

20. Smith, J.T., et al., KiSS-1 neurones are direct targets for leptin in the ob/ob mouse. J Neuroendocrinol, 2006. 18(4): p. 298-303.

21. Donato, J., Jr., et al., Leptin's effect on puberty in mice is relayed by the ventral premammillary nucleus and does not require signaling in Kiss1 neurons. J Clin Invest, 2011. 121(1): p. 355-68.

22. Valverde, A.M., et al., Molecular mechanisms of insulin resistance in IRS-2- deficient hepatocytes. Diabetes, 2003. 52(9): p. 2239-48.

23. Matsumoto, M. and D. Accili, All roads lead to FoxO. Cell Metab, 2005. 1(4): p. 215-6.

24. O'Neill, B.T., et al., Differential Role of Insulin/IGF-1 Receptor Signaling in Muscle Growth and Glucose Homeostasis. Cell Rep, 2015. 11(8): p. 1220-35.

25. Slaaby, R., et al., Hybrid receptors formed by insulin receptor (IR) and insulin- like growth factor I receptor (IGF-IR) have low insulin and high IGF-1 affinity irrespective of the IR splice variant. J Biol Chem, 2006. 281(36): p. 25869-74.

26. Fu, L.Y. and A.N. van den Pol, Kisspeptin directly excites anorexigenic proopiomelanocortin neurons but inhibits orexigenic neuropeptide Y cells by an indirect synaptic mechanism. J Neurosci, 2010. 30(30): p. 10205-19.

27. Manfredi-Lozano, M., et al., Defining a novel leptin-melanocortin-kisspeptin pathway involved in the metabolic control of puberty. Mol Metab, 2016. 5(10): p. 844-857.

28. Nestor, C.C., et al., Optogenetic Stimulation of Arcuate Nucleus Kiss1 Neurons Reveals a Steroid-Dependent Glutamatergic Input to POMC and AgRP Neurons in Male Mice. Mol Endocrinol, 2016. 30(6): p. 630-44.

29. Sanz, E., et al., Fertility-regulating Kiss1 neurons arise from hypothalamic POMC-expressing progenitors. J Neurosci, 2015. 35(14): p. 5549-56.

30. Wolfe, A. and M.A. Hussain, The Emerging Role(s) for Kisspeptin in Metabolism in Mammals. Front Endocrinol (Lausanne), 2018. 9: p. 184.

31. Cravo, R.M., et al., Characterization of Kiss1 neurons using transgenic mouse models. Neuroscience, 2011. 173: p. 37-56.

32. Stachelscheid, H., et al., Epidermal insulin/IGF-1 signalling control interfollicular morphogenesis and proliferative potential through Rac activation. EMBO J, 2008. 27(15): p. 2091-101.

132

33. Kloting, N., et al., Autocrine IGF-1 action in adipocytes controls systemic IGF-1 concentrations and growth. Diabetes, 2008. 57(8): p. 2074-82.

34. Bruning, J.C., et al., A muscle-specific insulin receptor knockout exhibits features of the metabolic syndrome of NIDDM without altering glucose tolerance. Mol Cell, 1998. 2(5): p. 559-69.

35. Garcia-Galiano, D., et al., PI3Kalpha inactivation in leptin receptor cells increases leptin sensitivity but disrupts growth and reproduction. JCI Insight, 2017. 2(23).

36. Torsoni, M.A., et al., AMPKalpha2 in Kiss1 Neurons Is Required for Reproductive Adaptations to Acute Metabolic Challenges in Adult Female Mice. Endocrinology, 2016. 157(12): p. 4803-4816.

37. Lecka-Czernik, B., et al., Marrow Adipose Tissue: Skeletal Location, Sexual Dimorphism, and Response to Sex Steroid Deficiency. Front Endocrinol (Lausanne), 2017. 8: p. 188.

38. Yamane, T., et al., Deficiency of spermatogenesis and reduced expression of spermatogenesis-related genes in prefoldin 5-mutant mice. Biochem Biophys Rep, 2015. 1: p. 52-61.

39. Cole, T.J., et al., The relationship between Insulin-like Growth Factor 1, sex steroids and timing of the pubertal growth spurt. Clin Endocrinol (Oxf), 2015. 82(6): p. 862-9.

40. Laron, Z., Insulin-like growth factor 1 (IGF-1): a growth hormone. Mol Pathol, 2001. 54(5): p. 311-6.

41. List, E.O., K.T. Coschigano, and J.J. Kopchick, Growth hormone receptor/binding protein (GHR/BP) knockout mice: a 3-year update. Mol Genet Metab, 2001. 73(1): p. 1-10.

42. Ajuwon, K.M., et al., The regulation of IGF-1 by leptin in the pig is tissue specific and independent of changes in growth hormone. J Nutr Biochem, 2003. 14(9): p. 522-30.

43. Yakar, S., et al., Liver-specific igf-1 gene deletion leads to muscle insulin insensitivity. Diabetes, 2001. 50(5): p. 1110-8.

44. O'Neill, B.T., et al., Insulin and IGF-1 receptors regulate FoxO-mediated signaling in muscle proteostasis. J Clin Invest, 2016. 126(9): p. 3433-46.

133

45. Boucher, J., et al., Impaired thermogenesis and adipose tissue development in mice with fat-specific disruption of insulin and IGF-1 signalling. Nat Commun, 2012. 3: p. 902.

134

Chapter 5 Fecal Microbes Reversed Insulin Resistance and Early Puberty Induced by Maternal High-fat-diet during Lactation

5.1 Abstract

Recent work shows that gut microbial dysbiosis contributes to the risk of obesity in children whose mothers consume a high fat diet during both gestation and lactation or gestation alone. Obesity predisposes children to developing precocious puberty.

However, to date, no study has examined how MHFD during lactation regulates the gut microbiota, pubertal timing, and fertility of children. Here, we found MHFD during lactation markedly altered the gut microbiota of dams and offspring. This outcome was associated with juvenile obesity, early puberty, and irregular estrous cycles. We also found that MHFD induced early puberty may be mediated by increased IGF-1 signaling.

Moreover, MHFD during lactation disrupted glucose and energy homeostasis.

5.2 Introduction

135

Puberty marks the passage to adulthood and sexual maturity. Precocious puberty, or early puberty, can cause short stature [1] and social and emotional problems [2], while increasing the risk of diabetes [3], cardiovascular disease [4], breast cancer [5], and all- cause mortality [6]. Worldwide, precocious puberty affects 20 per 10,000 girls per year

[7-9]. Childhood obesity increases the risks of early puberty, especially in girls [10,

11]. In the obese state, insulin receptor signaling increases gonadotropin and sexual hormone secretion [12], which may lead to early puberty and infertility. Maternal nutrition may also play a causal role in the development of obesity [13, 14] and the age of menarche in offspring [15, 16].

During the past decade, increasing attention has focused on the effects of the gut microbiota on energy homeostasis and obesity [17-20]. Emerging evidence shows maternal high-fat-diet (MHFD) shifts the gut microbial ecology in mothers, promoting maternal obesity and gut microbiota dysbiosis in offspring [21, 22]. Although multiple factors can influence the gut microbiome in children, such as mode of delivery, breastfeeding or formula feeding, use of antibiotics, introduction of solid foods, and cessation of nursing [23-25], two recent human studies [26, 27] emphasize that breastfeeding plays a dominant role in the maturation of the gut microbiota.

The complex composition of breast milk and its dynamic changes during nursing cause a striking difference in the health of breast-fed and formula-fed infants [28].

Breastfeeding results in lower risks of inflammatory bower disease [29] and type 1 diabetes [30] during early life, with a reduced risk of type 2 diabetes [31] and overweight/obesity [32] in later life. Bifidobacteria predominate in both breast- and

136

formula-fed infants [33, 34], but the gut microbiota of breast-fed infants include more than two fold the numbers of Bifidobacterium cells when compared to formula-fed newborns [35]. Among Bifidobacteria, Bifidobacterium breve, B. infantis and B. bifidum are typical of breast-fed infants, whereas B. fragilis is typically isolated from formula-fed infants at 1 month of age [26, 36]. Breast-fed infants carry a more stable and uniform microbial population when compared to formula-fed babies [37]. Interestingly, supplementing breast feeding with small amounts of formula lead to a more formula-fed- like spectrum of microbiota [38]. Dietary supplementation between the first and second year of life eliminates such differences between breast- and formula-fed infants, producing a microbiota profile similar to the adult in composition and richness [39].

The gut microbiota of children develops in a dynamic process that reaches a stable state that reflects the adult microbiota shortly after weaning [40, 41]. The stability of the gut microbiota of children influences their health in adulthood [42]. Lower microbial diversity may reduce circulating estrogens by decreasing estrogen deconjugation [43, 44]. These findings imply that the gut microbiota in childhood may alter pubertal maturation. Therefore, our first objective was to study whether MHFD during lactation alters the gut microbiota in offspring. We hypothesized that manipulating the gut microbiota specifically in this phase can alter metabolism and puberty.

Mice are coprophagic, so co-housed family members share gut microbes through the fecal-oral route [45]. Co-housing can reveal a causal relationship between the gut microbiota dysbiosis and host health. For example, Ridaura and colleagues demonstrated that co-housing obese with lean mice restored a lean phenotype [45]. Buffington and

137

colleagues reported that co-housing with normal chow diet (NCD) mice reversed the social deficits of the obese offspring of MHFD mice [46]. Further, co-housing letrozole- induced polycystic ovary syndrome (PCOS) mice with placebo mice improved both reproductive and metabolic PCOS phenotypes [47]; notably, these findings suggest that modifying the gut microbiota may treat reproductive diseases. However, little is known about the effect of co-housing on puberty. Therefore, we tested whether co-housing

MHFD with NCD offspring can reverse their metabolic and reproductive deficits.

5.3 Materials and Methods

Animals

All mice were on a C57BL/6 background and were obtained from Jackson

Laboratories (#000664). Mice were housed in the University of Toledo College of

Medicine and Life Sciences animal facility at 22°C to 24°C on a 12-hour light/12-hour dark cycle and had access to food and water ad libitum. At 8 weeks-old age, females were paired with C57BL/6 adult males to produce subject offspring. On the day of delivery, females were put on either standard rodent chow (NCD) (2016 Teklad Global 16%

Protein Rodent Diet, 12% fat by calories; Harlan Laboratories, Indianapolis, Indiana) or high-fat-diet (HFD) consisting of 60% kcal from fat and 20% kal from carbohydrates

(Research Diets, #D12492). On postnatal day (PND) 21, pups were weaned and all were fed standard rodent chow. At the end of the study, all animals were sacrificed by CO2 asphyxiation or by cardiac puncture under 2% isoflurane anesthesia to draw blood. All

138

procedures were approved by University of Toledo College of Medicine Animal Care and

Use Committee.

Metabolic phenotype assessment

Pups body weight was measured weekly from week 3 to 12. Body length was measured week 3 to 12 under 2% isoflurane anesthesia, which is defined as the distance from nose to the base of the tail. Body composition was assessed monthly by nuclear magnetic resonance (minispec mq7.5; Bruker Optics, Billerica, Massachusetts) to determine the percentage of fat mass, as described previously [48]. Glucose tolerance tests (GTTs) and insulin tolerance tests (ITTs) were performed as described previously

[48]. In brief, after a 6-hour fast, mice were injected with dextrose (2g/kg ip). Tail blood glucose was measured using a veterinary glucometer (AlphaTRAK; Abbott Laboratories,

Abbott Park, Illinois) before and 15, 30, 45, 60, 90, and 120 minutes after injection. For

ITTs, after a 3-hour fast, mice were injected with recombinant insulin (0.75 U/kg ip). Tail blood glucose was measured again at specified time points. Food intake and indirect calorimetry were measured in mice at the age of 3 to 4 months in a Calorimetry Module

(CLAMS; Columbus Instruments, Columbus, Ohio) as described previously [49].

Puberty and reproductive phenotype assessment

Timing of pubertal development was checked daily after weaning by determining vaginal opening (VO) in female mice. Vaginal cytology was examined by collecting the vaginal lavages from female mice following vaginal opening. First estrus age was determined by the occurrence of two consecutive days with keratinized cells after two

139

previous days with leukocytes [50]. Stages were assessed based on vaginal cytology as described previously [50, 51]. At 3 to 4 months of age, we examined adult fertility. Each female mouse was paired with one fertile wild-type male for eight nights while monitoring daily for copulatory plugs. The paired mice were separated after eight nights, and pregnancy rate, litter size, and interval from mating to birth were recorded. The age of sexual maturation was estimated from the birth of the first litter minus average pregnancy duration for mice (21 days).

Hormone assays

Blood collection from the submandibular vein was performed in 3-week-old and

5- month-old mice. Serum insulin was measured by ELISA (Crystal Chem, Elk Grove

Village, IL) with a sensitivity range of 0.1 to 12.8 ng/mL and intra-assay and interassay

CVs of <10%. Serum IGF-1 was measured by ELISA (Crystal Chem, Elk Grove Village,

IL) with sensitivity of 0.5 to 18 ng/mL and precision intraassay and interassay CVs of

<10%. Serum growth hormone was measured by ELISA (Crystal Chem, Elk Grove

Village, IL) with a sensitivity range of 0.15 to 9 ng/mL and intraassay and interassay CVs of <10%.

16s rRNA gene sequencing

Collection of fecal contents Fecal samples were collected from 6 dams per group at the day of delivery (week 0, W0) and weaning (week 3, W3). Fecal samples were collected from offspring (N = 16 for NCD offspring, N = 8 for NCD-co offspring, N = 16

140

for HFD offspring and N = 8 for MHFD-co offspring) at week 3 and week 10 (W10).

Fecal samples were frozen immediately after collection and stored at -80°C.

Microbiotal 16S rRNA analysis

DNA extraction and Quantification Fecal DNA was extracted from one piece of feces using QIAamp PowerFecal DNA Kit (Qiagen) followed by manufacture’s protocol.

For the elution step, 50µl of low TE buffer (0.1mM EDTA, Tris-HCl buffer, 10mM, pH8.5) was used instead of AE buffer of the kit. DNA concentration was measured by

NanoDrop spectrophotometer (ThermoFisher Scientific, Waltham, MA), and then diluted to be 5ng/µl in low TE buffer to proceed the PCR library preparation.

16S PCR library preparation, Clean-up, Normalization, and Pooling We followed

Illumina User Guide: 16S Metagenomic Sequencing Library Preparation-Preparing 16S

Ribosomal RNA Gene Amplicons for the Illumina MiSeq System (Illumina, San Diego,

CA,Part # 15044223 Rev. B). The 16S rRNA gene targeting V3-V4 region was amplified by the primers: 5'

TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG and 5'

GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGT

WTCTAAT. For index PCR, Nextera XT index Kit (Illumina, San Diego, CA) was used to attach dual indices and adapters. Platinum™ Taq DNA Polymerase (ThermoFisher

Scientific, Waltham, MA) was used in 25 µl PCR volume. Each 2.5 µl of 5ng/µl DNA was added on 1st PCR (target PCR), and 2.5µl of purified 1st PCR product was added on

2nd PCR (index PCR). T100TM thermal cycler (BioRad, Hercules, CA) was used, and

141

cycling conditions were followed by 16S rRNA gene Metagenomic Sequencing User

Guide. Each concentration of purified index PCR products was measured using a Qubit dsDNA HS Assay kit with Qubit 3.0 fluorometer (Agilent, Santa Clara, CA). Each 4nM amplicon was pooled equally, and then the pooled library was checked on a 2100

Bioanalyzer (Agilent) for the expected product size. Following the Illumina MiSeq

System User Guide, a 10pM denatured and diluted library was mixed with a 10pM PhiX control spike-in to be 15% PhiX by volume. Then, it was loaded in the Illumina MiSeq

V3 flow cell kit with 2X300 cycles.

Quality Filtering, OTU Picking and Data Analysis Raw 16S sequencing data was processed and analyzed using a bioinformatics pipeline of multiple software including

USEARCH [52], Quantitative Insights Into microbial Ecology (QIIME) software package

(version 1.9.1) [53] and linear discriminant analysis effect size (LEfSe) [54]. Raw paired- end reads were merged to create consensus sequences and then quality filtered using

USEARCH (version 9). Chimeric sequences were identified and filtered using QIIME combined with the USEARCH (version 6) algorithm. Open reference operational taxonomic units (OTUs) were subsequently picked using QIIME combined with the

USEARCH (version 6) algorithm, and taxonomy assignment was performed using

Greengenes [55] as the reference database. Using a series of QIIME pipelines, alpha- and beta-diversity analyses were performed using a BIOM formatted OTU table. Chao1 was used as the algorithm to calculate the alpha-diversity, and two-sample nonparametric t- test (i.e. Monte Carlo permutations) was used to calculate the p-value. The analysis of similarities (ANOSIM) statistical method was used to calculate the p-value of the beta-

142

diversity. Taxonomic features with different abundance were further summarized using

LEfSe (https://huttenhower.sph.harvard.edu/galaxy/) for group comparisons.

Mann-Whitney U test was performed to compare the alpha diversity and relative abundance of species between two groups. Multiple group comparisons were made using a Kruskal-Wallis test with Bonferroni correction. Correlations between the relative abundance of microbiota species and phenotypes were assessed by Pearson’s correlation tests. P < 0.05 was used as statistical significance. The P values obtained were adjusted for multiple comparisons by the false discovery rate (FDR) method with a corresponding q-value threshold of 0.05. Tests were performed using SPSS 23 and GraphPad Prism.

Statistical analysis

Data are presented as means ± SEM. One-way ANOVA was used as the main statistical method to compare 4 groups, followed by the Tukey multiple comparison test.

For GTT and ITT, two-way ANOVA was used to compare changes over time between 4 groups. Bonferroni multiple comparison tests were then performed to compare differences among groups. Chi-square was used to analyze pregnancy rates. A value of P

≤ 0.05 was considered to be significant.

5.4 Results

5.4.1 MHFD during lactation alters the gut microbiota in dams

To investigate how MHFD during lactation contributes to establishing the microbiome of offspring, we fed new mothers either a high-fat diet (60% calories from

143

fat) or normal (NCD) diet (12% calories from fat) from the day of delivery (W0) to weaning (W3). We collected fecal samples and performed targeted ampliﬁcation and sequencing of the 16S rRNA gene, followed by clustering of sequences into OTUs and coupling with phylogenetic principal coordinate analysis (PCoA) (Figure 5-1A).

Previous human [56-58] and animal [59-62] studies indicate that HFD and obesity during pregnancy plus lactation increase both α-diversity and β-diversity of the gut microbiota.

As expected, nonphylogenetic richness metrics showed that HFD dams demonstrated higher bacterial richness at W3 compared to W0 (observed OTUs, P < 0.05), and a phylogenetic richness metric showed a similar trend (Faith’s phylogenetic diversity, P =

0.078; Figure 5-1B). In addition, after MHFD during lactation the gut microbiota of

MHFD and NCD dams clustered separately by unweighted UniFrac PCoA analysis at W3

(Figure 5-1C). Thus, MHFD during lactation increased both α-diversity and β-diversity of the gut microbiota of dams.

144

145

Figure 5-1 MHFD during lactation significantly altered gut microbiota in dams. (A) Schematic of the mouse model illustrating the timeline of feeding strategies, reproductive and metabolic phenotype evaluations, and fecal sampling. (B) Alpha diversity comparisons in fecal samples of dams with NCD or MHFD at the day of delivery (W0, birth of offspring) and weaning of offspring (W3, 3-week-old of offspring) based on observed OTUs and phylogenetic richness as determined by 16s rRNA sequencing analysis. MHFD during the breastfeeding phase significantly increased microbial richness in dams compared to NCD. (C) Unweighted UniFrac PCoA plot representing gut microbiota composition changes between W0 and W3 in dams with NCD or MHFD. (D) Bar chart showing the proportion of Actinobacteria, Bacteroidetes, Firmicutes, and Verrucomicrobia at the phylum level in fecal samples of W0 and W3 dams with NCD or MHFD. At W3, MHFD dams had significantly decreased levesl of Bacteroidetes (Kruskal-Wallis test with FDR correction, P < 0.05) and nearly significantly increased levels of Firmicutes (Kruskal-Wallis test with FDR correction, P = 0.06), compared with W3 NCD dams. (E) Changes in the abundance of 15 genera with significant differences between W0 and W3 with NCD or MHFD. Value are the mean of each group. Number of mice per group: NCD dams, n=6; and MHFD dams, n=6.

Unlike NCD dams, MHFD dams at W3 had a lower Bacteroidetes proportion (P

< 0.05) and a marginally higher Fimicutes proportion (P = 0.06) (Figure 5-1D), resulting in an increased Firmicutes to Bacteroidetes (F/B) ratio. We also found a decreased

Actinobacteria proportion and increased Verrucomicrobia proportion in MHFD dams at

W3, compared to W0 (P < 0.05) (Figure 5-1D). To determine which unique group of microbes changed, we further evaluated the composition at the bacterial family level.

Remarkably, the abundance of Bifidobacteriaceae, Lactobacillaceae and

Anaeroplasmataceae decreased only in MHFD mice at W3 when compared to W0 (P <

0.05) (Figure 5-1E). These findings agree with previous findings that Bifidobacteriaceae and Lactobacillaceae protect against obesity [63-65]. In addition, unlike NCD dams,

MHFD dams had a decreased abundance of Rikenellaceae and S24-7 (P < 0.05; Figure

146

5-1E). Instead, Planococcaceae, Enterococcaceae, Streptococcaceae,

Clostridiales|unclassified, Clostridiaceae, Dehalobacteriaceae, Pepstreptococcaceae,

Ruminococcaceae, Enterobacteriaceae and Verrucomicrobiaceae (P < 0.05) showed increased abundance in MHFD dams at W3 when compared to NCD dams (Figure 5-

1E). These results highlight the importance of MHFD during lactation in the normal gut microbial ecology and establish a causal link between maternal diet and the gut microbiota. MHFD during lactation strongly intervened to shape the gut microbiota and alter the composition of bacterial phyla.

5.4.2 MHFD during lactation causes juvenile obesity and alters the gut microbiota in offspring at W3

We next evaluated energy homeostasis in the offspring at W3. As expected,

MHFD offspring showed significantly increased body weight (Figure 5-2A) and length

(Figure 5-2B) when compared to NCD offspring. The obese phenotype resulted from an increased fat mass percentage (Figure 5-2C). Surprisingly, the bacterial richness did not differ between NCD and MHFD offspring at W3 (Figure 5-2E). However, the β-diversity of MHFD offspring diverged from NCD offspring at this time point (Figure 5-2F).

Consistent with the findings in MHFD dams (Figure 5- 1D), MHFD offspring at W3 demonstrated significantly decreased Bacteroidetes (P < 0.05) and an increased

Firmicutes to Bacteroidetes ratio (Figure 5-2G). Therefore, MHFD during lactation altered the gut microbiota in both dams and their offspring and led to early obesity in the offspring.

147

At W3, most changes in the bacterial families of MHFD offspring resembled the changes in MHFD dams compared to controls (Figure 5-1E), such as decreased abundances of Bifidobacteriaceae, Rikenellaceae, S24-7 and Turicibacteraceae, but increased Bacillaceae, Streptococcaceae, Dehalobacteriaceae, Peptostreptococcaceae and Ruminococcaceae (P < 0.05) (Figure 5- 2H). These results suggest that the dam plays a large role in establishing and influencing the gut microbiota in offspring. The differences in Turicibacteraceae and Bacillaceae (P < 0.05) were exceptions (Figure 5-

2H), showing that the environment also influences gut microbial composition after birth.

To determine the contribution of altered bacterial families to phenotypic changes, we performed Pearson correlation analysis (Figure 5-2I). One family,

Dahalobacteriaceae, strongly correlated with body weight (r = 0.542, P < 0.001). In addition, Dehalobacteriaceae (r = 0.535, P < 0.001), Peptostreptococcaceae (r = 0.485, P

< 0.01) and Ruminococcaceae (r = 0.390, P < 0.05) positively correlated with body length, whereas Rikenellaceae (r = -0.467, P < 0.01) and Turicibacteraceae (r = -0.389, P

< 0.05) negatively correlated with body length. Two families, Streptococcaceae (r =

0.437, P < 0.01) and Peptostrptococcaceae (r = 0.528, P < 0.001) positively correlated with fat mass percentage, whereas Rikenellaceae negatively but strongly correlated with fat mass percentage (r = -0.617, P < 0.001). No correlation was seen in family

Bificobacteriaceae, S24-7, or Bacillaceae.

148

Figure 5-2 MHFD offspring demonstrated increased body weight and fat mass which were associated with alterations in the gut microbiota composition. (A-B) Body weight and length in MHFD (n=24) or NCD (n=24) offspring at W3. (C-D) NMR analysis showing body composition changes in MHFD (n=24) or NCD (n=24) offspring at W3. (E) Alpha diversity comparisons in fecal samples of MHFD (n=24) and NCD (n=23) offspring at W3 based on observed OTUs and phylogenetic richness as determined by 16s rRNA sequencing analysis. (F) Unweighted UniFrac

149

PCoA plot representing gut microbiota composition changes in MHFD (n=24) and NCD (n=23) offspring at W3. (G) Bar chart showing the proportion of Verrucomicrobia, Actinobacteria, Bacteroidetes and Firmicutes at the phylum level in fecal samples of MHFD and NCD offspring at W3. (H) Boxplots showing 9 genera belong to the phyla of Verrucomicrobia, Actinobacteria, Bacteroidetes and Firmicutes with significant differences in abundance between MHFD and NCD offspring at W3 (Kruskal-Wallis test with FDR correction, P < 0.05). (I) Heatmap of the association between the abundance of the differential enriched genera and body composition of mice at W3 (total n=40-42). Red denoted a positive correlation, blue a negative correlation, and white no association. Levels of statistical significance were analyzed by Pearson’s r correlation; *P < 0.05 and **P < 0.01 with FDR correction.

5.4.3 Co-housing reversed early puberty induced by MHFD during lactation

To determine whether MHFD during lactation causes early puberty in female offspring, we examined pubertal timing in both MHFD and NCD offspring. We used age of vaginal opening as an indicator of the onset of puberty. We found that vaginal opening age in MHFD offspring occurred 3 to 4 days earlier than NCD offspring (P <

0.05) (Figure 5-3A). We then evaluated age of first estrus of the mice by vaginal lavage.

MHFD offspring had an earlier first estrus age compared to NCD offspring (P < 0.01)

(Figure 5-3B). Figure 5-3E shows representative estrus cycles. Estrus cycle length was longer in MHFD offspring when compared to NCD offspring (P < 0.01) (Figure 5-3C), because of a longer time spent showing estrus- (P < 0.001) and metestrus/diestrus-like cytology (P < 0.05) (Figure 5-3D). Our data show that MHFD during lactation caused early puberty.

To test whether early puberty causes impaired fertility, we performed fertility testing in mice at 3-month-of age. MHFD offspring demonstrated a trend toward reduced fertility (Figure 5-3F) (P = 0.07), whereas the litter size (Figure 5-3G), plug number

150

(Figure 5-3H) or interval from paring to birth (Figure 5- 3I) did not differ between NCD and MHFD offspring.

We co-housed MHFD (MHFD-co) with NCD (NCD-co) offspring to test if microbial reconstitution could reverse the early puberty and irregular estrous cycles.

Remarkably, co-housing MHFD with NCD offspring restored the normal age of vaginal opening (at 34.13 ± 1.81 days in MHFD-co offspring compared to 35.50 ± 2.98 days in

NCD-co offspring) (Figure 5-3A). Co-housing did not change the timing of first estrus age (Figure 5-3B). While we did not see any effect of co-housing on fertility (data not shown) or estrus cycle length (Figure 5-3C), the time exhibiting estrus-like cytology shortened (4.00 ± 1.73 days in MHFD-co compared to 5.75 ± 1.39 days in MHFD offspring; Figure 5-3D).

151

Figure 5-3 Co-housing MHFD with NCD offspring successfully reversed early puberty in MHFD-co offspring. (A-D) Vaginal opening age (A), first estrus age (B), estrus cycle length (C) and time spent in each estrus stage (D) were evaluated in NCD (n=12), NCD-co (co-housed NCD) (n=7), MHFD (n=12) and MHFD-co (co-housed MHFD) (n=8) offspring. (E) Examples of estrus cycle in NCD, NCD-co, MHFD and MHFD-co offspring. (F-I) Pregnancy rate, litter size, plugs number, and interval from pairing to birth were shown in NCD (n=15) and MHFD (n=16) offspring.

5.4.4 Co-housing reversed early puberty via increasing bacterial richness

We next analyzed the fecal samples of offspring at W3 and W10 to evaluate the long-term effect on their gut microbiota. Before we started the co-housing experiment

(W3), the α-diversity in all four groups, NCD, NCD-co, MHFD and MHFD-co did not

152

differ (Figure 5-4A). However, MHFD offspring at W10 had lower bacterial richness and phylogenetic richness compared to NCD offspring (MHFD vs. NCD; P = 0.14, and P

= 0.028 respectively) (Figure 5-4A). Remarkably, after co-housing with NCD offspring, the bacterial richness increased in MHFD offspring, as indicated by the observed OTUs and Faith’s phylogenetic diversity (MHFD vs. MHFD-co; P = 0.056, and P = 0.028 respectively). These results indicate that altered bacterial richness likely led to the phenotypic changes and effect of co-housing.

The unweighted UniFrac PCoA analysis showed dynamic changes in offspring during the co-housing experiment (Figure 5-4B). Compared to W3, offspring at W10 had less variation in the bacterial richness (Figure 5-4A) and a more clustered distribution

(Figure 5-4B), suggesting that the gut microbiota in offspring were in a more mature state at W10 compared to W3. MHFD during lactation influenced the gut microbiota in the offspring at W10 (Figure 5-4B). Accordingly, the composition analysis at W10 showed comparable abundances of Rikenellaceae, S24-7, Bacillaceae, Streptococcaceae,

Dehalobacteriaceae, Peptostreptococcaceae and Ruminococcaceae, but not

Turicibacteraceae (Figure 5-4C).

We next asked whether co-housing reversed early puberty by regulating gut bacterial richness. Specifically, we wanted to know whether lower bacterial richness led to an earlier age of vaginal opening. We performed a correlation study between vaginal opening age and α-diversity (Figure 5-4D). Indeed, vaginal opening age was strongly and positively associated with bacterial richness at W10 (r = 0.494, P = 0.005 for observed OTUs; r = 0.430, P = 0.016 for phylogenetic diversity), but not at W3 (Figure

153

5-4D). We did not see any composition changes contributing to the regulatory effects of co-housing at W10 (data not shown). Our data suggest an important role for gut microbiotal maturation in pubertal development. Overall, these data demonstrate that the dysbiosis induced by MHFD during lactation leads to early pubertal onset. Moreover, microbial reconstitution by co-housing reversed early puberty. Therefore, our data suggest that gut microbiota dysbiosis can play a causal role in the development of early puberty.

Figure 5-4 Dynamic change of gut microbiota in offspring and co-housing reversed early puberty and positively correlated with bacterial richness. (A)

154

Alpha diversity comparisons in fecal samples of NCD (n=12), NCD-co (n=8), MHFD (n=13), MHFD-co (n=8) offspring from W3 to 10-week-old (W10), based on observed OTUs and phylogenetic richness as determined by 16s rRNA sequencing analysis. (B) Unweighted UniFrac PCoA plot representing gut microbiota composition changes between W3 and W10 in NCD (n=12), NCD-co (n=8), MHFD (n=13), MHFD-co (n=8) offspring. (C) Change in the abundance of 9 genera with significant differences at W3 in NCD (n=12), NCD-co (n=8), MHFD (n= 13), MHFD-co (n=8) offspring from W3 to W10. Values are the mean of each group. (D) Correlations between vaginal opening age (VO) and alpha diversity as measured by observed OTUs and phylogenetic richness (total n=31).

5.4.5 MHFD induced gut microbiota dysbiosis and advanced puberty may be mediated by modulation of IGF-1 and insulin signaling

To figure out how MHFD induced gut microbiotal dysbiosis and advanced puberty, we measured insulin-like growth factor 1 (IGF-1), growth hormone (GH), insulin and estradiol levels. Hypothalamic and hepatic IGF-1 protein levels were increased in MHFD offspring compared to NCD offspring at 3 weeks of age (Figure 5-

5A and B), suggesting that MHFD during lactation increased both central and peripheral

IGF-1 protein expression in offspring. However, we did not see any changes of serum

IGF-1 (Figure 5-5C), GH (Figure 5-5D) and estradiol (Figure 5-5F) between MHFD and NCD offspring at 3 weeks of age. Notably, MHFD offspring had elevated serum insulin levels compared to NCD offspring (Figure 5-5C). There were no changes in 5- month-old serum IGF-1 (Figure 5-5G), insulin (Figure 5-5I) and estradiol (Figure 5-5J) levels among NCD, NCD-co, MHFD and MHFD-co offspring. GH tended to be higher in MHFD offspring compared to NCD offspring. However, this trend was not present in

MHFD-co offspring at 5 months of age (Figure 5-5H).

155

Hypothalamic IGF-1 A 4 *

e 3

n a

h 2

d l

o 1 F

0 NCD MHFD

Hepatic IGF-1

1.5

B * e

g 1.0

l 0.5

o F

0.0 NCD MHFD

C 3 weeks D 3 weeks E 3 weeks F 3 weeks 30 1.0 6 30

)

l )

0.8 l

)

/ m 5 g

/ 20 20

p /

g 0.6

(

l -

0.4 d

u a

F 10 4 10

n s

0.2 I E

0 0.0 3 0 NCD MHFD NCD MHFD NCD MHFD NCD MHFD

G 5 months H 5 months I 5 months J 5 months 30 120 8 15

P=0.06

)

l l

m 12

) /

l 90

/ /

20 g

m 6

p /

( 9

(

i -

l 6

10 d

H u

4 a

s G

30 t

I n

s 3

I E 0 0 2 0 D o D o o o C -c F -c D c D c D o D o D o D o N D H D C - F - C -c F -c C -c F -c C M F N D H D N D H D N D H D N H C M F C M F C M F M N H N H N H M M M

Figure 5-5 MHFD induced microbiota dysbiosis and advanced puberty were associated with increased hypothalamic and liver IGF-1 protein expression and hyperinsulinemia. (A-B) Hypothalamic (A) and hepatic

156

(B) IGF-1 protein expression levels were measured in NCD (n=8 for hypothalamus and n=4 for liver) and MHFD (n=8 for hypothalamus and n=4 for liver) offspring at 3 weeks of age. (C-F) Serum IGF-1 (C), GH (D), insulin (E) and estradiol (F) levels were measured in NCD (n=8 for IGF-1, n=4 for GH, n=10 for insulin and n=10 for estradiol) and MHFD (n=8 for IGF-1, n=7 for GH, n=10 for insulin and n=9 for estradiol) offspring at 3 weeks of age. (G-J) Serum IGF-1 (C), GH (D), insulin (E) and estradiol (F) levels were measured in NCD (n=6 for IGF-1, n=6 for GH, n=6 for insulin and N=6 for estradiol), NCD-co (n=5 for IGF-1, n=6 for GH, n=4 for insulin and n=4 for estradiol), MHFD (n=7 for IGF-1, n=6 for GH, n=5 for insulin and n=6 for estradiol) and MHFD-co (n=5 for IGF-1, n=5 for GH, n=4 for insulin and n=4 for estradiol) offspring at 5 months of age.

5.4.6 Co-housing reversed insulin insensitivity in offspring induced by MHFD during lactation

We next evaluated the long-term effect of MHFD during lactation on glucose and energy homeostasis. MHFD during lactation had long-term effects on body weight

(Figure 5-6A) and fat mass percentage (Figure 5-6C) compared to control offspring.

Consistent with previous findings [66], we found MHFD during lactation led to increased body weight, fat mass and lean mass in offspring at W3, which persisted into adulthood at W10. The regulatory effects of MHFD on body length was gone by W10 (Figure 5-

6B). However, co-housing MHFD with NCD offspring did not reverse body weight or fat mass percentage in MHFD offspring (Figure 5- 6A and C).

MHFD offspring demonstrated hyperinsulinemia at 3 weeks of age (Figure 5-

5E). MHFD during lactation caused glucose intolerance (Figure 5-6E) and insulin insensitivity (Figure 5-6F) in adult MHFD offspring when compared to NCD offspring.

Surprisingly, insulin sensitivity in MHFD offspring improved when we co-housed them with NCD offspring (Figure 5-6E). These findings show that MHFD during lactation

157

disrupts glucose homeostasis in offspring and that microbial transfer may reverse insulin insensitivity.

Pearson correlation analysis revealed that four families of the gut microbiota at

W3, Bacillaceae (r = 0.479, P < 0.01), Streptococcaceae (r = 0.484, P < 0.01),

Dahalobacteriaceae (r = 0.594, P < 0.001) and Peptostrptococcaceae (r = 0.592, P <

0.001) strongly correlated with the area under curve for insulin tolerance test (ITT-AUC), whereas Rikenellaceae negatively correlated with ITT-AUC (r = -0.485, P < 0.01)

(Figure 5-6G). These findings suggest that these altered bacterial families may disrupt insulin sensitivity in offspring at a young age. In addition, we also found

Streptococcaceae and Turicibacteraceae correlated with GTT-AUC at W10 (r = 0.454, P

< 0.01; r = -0.593, P < 0.001 respectively). Even though we did not detect an association between glucose tolerance and bacterial richness (r = 0.091, P = 0.620 for observed

OTUs; r = 0.201, P = 0.270 for Phylogenetic diversity; Figure 5-6H), insulin insensitivity strongly but negatively associated with bacterial richness (r = -0.535, P =

0.002 for observed OTUs; r = -0.561, P = 0.001 for Phylogenetic diversity; Figure 5-6I).

158

Figure 5-6 Co-housing MHFD with NCD offspring improved insulin insensitivity in MHFD-co offspring. (A-B) Body weight and length in NCD (n=16), NCD- co (n=8), MHFD (n=16), MHFD-co (n=8) offspring at W10. (C-D) NMR analysis showing body composition changes in NCD (n=16), NCD-co (n=8), MHFD (n=16), MHFD-co (n=8) offspring at W10. (E) Glucose tolerance test (GTT) and area under curve (AUC) in NCD (n=11), NCD-co (n=8), MHFD (n=12), MHFD-co (n=8) offspring at W10. (F) Insulin tolerance test (ITT) and AUC in NCD (n=11), NCD-co (n=8), MHFD (n=12), MHFD-co (n=8) offspring at W10. (G) Heatmap of the association between the

159

abundance of the differential enriched genera and body composition of mice at W3 and W10 (total n=39). Red denoted a positive correlation, blue a negative correlation, and white no association. Levels of statistical significance were analyzed by Pearson’s r correlation; *P < 0.05, **P < 0.01 and ***P < 0.01 with FDR correction. (H) Correlations between the area under curve of GTT and alpha diversity as measured by observed OTUs and phylogenetic richness (total n=39). (I) Correlations between the area under curve of ITT and alpha diversity as measured by observed OTUs and phylogenetic richness (total n=39).

5.4.7 Co-housing NCD with MHFD offspring demonstrated detrimental effects in increasing food intake and decreasing respiratory exchange ratio (RER)

MHFD offspring had increased food intake (Figure 5-7A) and physical activity

(Figure 5-7E) when compared to NCD offspring during adulthood. Water intake (Figure

5-7B), O2 consumption (Figure 5-7C), and heat production did not differ (Figure 5-7D).

In contrast to the previous beneficial effect on insulin sensitivity, co-housing NCD with

MHFD offspring increased their food intake (Figure 5-7A) and decreased their respiratory exchange ratio (data not shown) in adulthood. Probably because increased physical activity accompanied hyperphagia, the overall body weight in NCD-co offspring did not differ from NCD offspring. Overall, we did not find a correlation between energy homeostasis and the gut microbiota in the offspring.

160

Figure 5-7 Co-housing MHFD with NCD offspring increased food intake and decreased respiratory exchange ratio in NCD-co offspring. (A-B) Food intake and water intake in NCD (n=4), NCD-co (n=4), MHFD (n=4), MHFD-co (n=4) offspring at 12 weeks of age. (C-E) O2 consumption, energy expenditure and X-activity in NCD (n=4), NCD-co (n=4), MHFD (n= 4), MHFD-co (n=4) offspring at 12 weeks of age.

161

5.5 Discussion

Treatment of precocious puberty is expensive and can be distressing for children.

Currently, the primary agent to treat central precocious puberty is leuprolide acetate, a

GnRH analog, which must be administered via intramuscular injection every 4 weeks

[67]. Identifying a novel form of treatment for this condition would have a substantial clinical impact. The current studies show lactation is a critical window for influencing metabolic and reproductive development in offspring. MHFD during lactation changed not only the dams’ but also the offspring’s gut microbiota, promoting early obesity and early puberty. Moreover, we found co-housing MHFD with NCD offspring increased bacterial richness, reversed early puberty, and improved insulin sensitivity in MHFD-co offspring. These results raise the possibility that altering the maturation of the gut microbiome may offer a novel method of delaying the onset of puberty.

5.5.1 MHFD during lactation-induced childhood obesity is associated with gut microbiota dysbiosis.

The bacterium Ruminococcus (Firmicutes), known to produce short-chain fatty acids (SCFAs) such as acetate, propionate, and butyrate, increased in the gut microbiota of HFD-induced obese rodents [68, 69] and obese humans [70]. Diet induced obese mice show increased relative abundance of Firmicutes and decreased relative abundance of

Bacteroidetes, and thus an increased Firmicutes-to-Bacteroidetes ratio [71]. Consistent with these results, our study showed MHFD during lactation caused increased relative abundance of Firmicutes and decreased relative abundance of Bacteroidetes in offspring

162

at W3. Ruminococcus has been reported to promote the pathogenesis of diabetes [72].

Increased acetate production in response to HFD leads to activation of the parasympathetic nervous system, which, in turn, promotes increased glucose-stimulated insulin secretion, hyperphagia and obesity [68]. In the present study, we found MHFD during lactation caused increased abundance of Ruminococcaceae, hyperinsulinemia and obesity at W3 and increased food intake and insulin insensitivity during adulthood. Thus, altered SCFAs-related bacteria might explain why MHFD during lactation caused childhood obesity and metabolic dysfunction during adulthood.

Lactobacillus (Firmicutes) and Bifidobacterium (Actinobacteria) have anti- inflammatory effects and are inversely associated with obesity [73]. Compared to infants of normal weight mothers, infants (aged 1 and 6 months) of obese mothers show lower levels of Bifidobacterium spp [74]. MHFD dams showed a lower relative abundance of family Lactobacillaceae and Bifidobacteriaceae at W3 compared to W0 and the family

Bifidobacteriaceae in MHFD offspring were also lower. In addition, a low proportion of

Turicibacter (Firmicutes) was seen in animal models of inflammatory bowel disease [75,

76]. Consistent with previous findings, we found a lower abundance of family

Turicibacteraceae in MHFD offspring compared to NCD offspring at W3 [77, 78]. Thus,

MHFD during lactation might trigger gut microbiota-mediated inflammatory pathways to cause metabolic dysfunctions in offspring.

163

5.5.2 MHFD during lactation-induced early puberty is associated with hyperinsulinemia.

Emerging evidence shows that the gut microbiota, sex hormone levels and reproductive diseases such as polycystic ovarian syndrome are interrelated [79, 80].

However, little is known about the role of gut microbiota in pubertal development.

Childhood obesity, mainly due to excess adiposity, results in an earlier age of onset of puberty in girls [10, 81, 82]. Our study found that the age of vaginal opening in mice was positively associated with bacterial richness at W10. To determine whether the early puberty in our mice resulted from early obesity could be altered by modulation of gut microbiota, we co-housed MHFD with NCD offspring. Notably, this paradigm successfully reversed the early puberty in MHFD offspring, demonstrating a causal link between gut microbiota dysbiosis induced by MHFD during lactation and early puberty.

Excess adiposity is usually accompanied by insulin insensitivity and compensatory hyperinsulinemia [10], which can also reduce hepatic sex hormone binding globulin and subsequently increase bioavailable sex steroids [83], thus contributing to pubertal development. The insulin insensitivity of puberty is exaggerated in obese girls

[84]. Consistent with our findings, MHFD offspring showed hyperinsulinemia in MHFD offspring at W3 and early puberty. It is worthy to note that we found that co-housing modulated insulin sensitivity but not obesity, which suggests that insulin insensitivity instead of obesity may have caused early puberty.

These findings have potential clinical significance. Attention to diet during lactation may reduce the risk of childhood obesity, early puberty and gut microbiota

164

dysbiosis. In addition, antibiotic treatment during this critical lactation period may alter the childhood microbiome [85]. Our findings imply that regulating the gut microbiota during the critical window of lactation may treat MHFD-induced disease.

5.5.3 MHFD during lactation-induced disruptions of glucose and energy homeostasis during adulthood

At the level of bacterial phyla, Firmicutes breaks down polysaccharides to provide an extra source of calories, leading to weight gain and insulin resistance [86].

Indeed, our results showed that insulin insensitivity and glucose intolerance were accompanied by increased phylum Firmicutes in the adult offspring of dams fed HFD during lactation alone Several studies also link obesity and insulin resistance with a lower bacterial diversity [87, 88]. In accord with these findings, we found that insulin insensitivity positively correlates with α-diversity in MHFD offspring at W10.

Microorganisms within the gut microbiota are involved in energy homeostasis by regulating feeding, digestive and metabolic processes [89, 90]. We found co-housing caused increased food intake and decreased energy expenditure in NCD-co offspring, which provides supporting evidence that gut microbiota modulation is associated with energy homeostasis. However, we did not see any correlation between the gut microbiota and parameters of energy homeostasis, perhaps because we collected and analyzed the fecal samples at only a few time points.

165

5.5.4 MHFD induced microbiota dysbiosis and advanced puberty may be mediated by modulation of IGF-1 signaling

Yan and colleagues showed that fecal microbiome transplantation in mice caused increased bone formation and resorption, which was mediated by increased serum IGF-1 levels and liver and adipose tissue IGF-1 production [91]. Antibiotic treatment of conventional mice decreased serum IGF-1 and inhibited bone formation [91]. Increasing attention has been drawn to that central IGF-1 signaling plays an important role in the regulation of sexual maturation and metabolism (Chapter 2, 3 and 4 and [92]).

Therefore, we measured hypothalamic and hepatic IGF-1 and found that MHFD during lactation significantly increased hypothalamic and hepatic IGF-1 protein expression in

MHFD offspring at 3 weeks of age. Our results imply that the gut microbiota are mediators of the effects of MHFD during lactation and that these effects may be occurred through modulation of IGF-1.

Summary

In summary, our study demonstrates that lactation provides a critical window for developing normal metabolic and reproductive functions in offspring. MHFD during lactation shaped the gut microbiota in dams and influenced the maturation of the gut microbiota in offspring. MHFD during lactation caused early obesity and puberty associated with gut microbiota dysbiosis. Notably, our results imply that insulin insensitivity, rather than obesity, promoted MHFD-induced early puberty. Co-housing

MHFD with NCD offspring likely reversed early puberty and insulin insensitivity in

166

MHFD-co offspring by increasing bacterial richness. Thus, the gut microbiome may provide novel therapeutic targets to treat metabolic and reproductive diseases.

5.6 References

1. Carel, J.C., et al., Precocious puberty and statural growth. Hum Reprod Update, 2004. 10(2): p. 135-47.

2. Kim, E.Y. and M.I. Lee, Psychosocial aspects in girls with idiopathic precocious puberty. Psychiatry Investig, 2012. 9(1): p. 25-8.

3. Elks, C.E., et al., Age at menarche and type 2 diabetes risk: the EPIC-InterAct study. Diabetes Care, 2013. 36(11): p. 3526-34.

4. Prentice, P. and R.M. Viner, Pubertal timing and adult obesity and cardiometabolic risk in women and men: a systematic review and meta-analysis. Int J Obes (Lond), 2013. 37(8): p. 1036-43.

5. Bodicoat, D.H., et al., Timing of pubertal stages and breast cancer risk: the Breakthrough Generations Study. Breast Cancer Res, 2014. 16(1): p. R18.

6. Charalampopoulos, D., et al., Age at menarche and risks of all-cause and cardiovascular death: a systematic review and meta-analysis. Am J Epidemiol, 2014. 180(1): p. 29-40.

7. Soriano-Guillen, L., et al., Central precocious puberty in children living in Spain: incidence, prevalence, and influence of adoption and immigration. J Clin Endocrinol Metab, 2010. 95(9): p. 4305-13.

8. Teilmann, G., et al., Prevalence and incidence of precocious pubertal development in Denmark: an epidemiologic study based on national registries. Pediatrics, 2005. 116(6): p. 1323-8.

9. Partsch, C.J. and W.G. Sippell, Pathogenesis and epidemiology of precocious puberty. Effects of exogenous oestrogens. Hum Reprod Update, 2001. 7(3): p. 292-302.

10. Burt Solorzano, C.M. and C.R. McCartney, Obesity and the pubertal transition in girls and boys. Reproduction, 2010. 140(3): p. 399-410.

167

11. Li, W., et al., Association between Obesity and Puberty Timing: A Systematic Review and Meta-Analysis. Int J Environ Res Public Health, 2017. 14(10).

12. DiVall, S.A., et al., Insulin receptor signaling in the GnRH neuron plays a role in the abnormal GnRH pulsatility of obese female mice. PLoS One, 2015. 10(3): p. e0119995.

13. Bartha, J.L., et al., Ultrasound evaluation of visceral fat and metabolic risk factors during early pregnancy. Obesity (Silver Spring), 2007. 15(9): p. 2233-9.

14. Cnattingius, S., et al., High birth weight and obesity--a vicious circle across generations. Int J Obes (Lond), 2012. 36(10): p. 1320-4.

15. Lawn, R.B., D.A. Lawlor, and A. Fraser, Associations Between Maternal Prepregnancy Body Mass Index and Gestational Weight Gain and Daughter's Age at Menarche: The Avon Longitudinal Study of Parents and Children. Am J Epidemiol, 2018. 187(4): p. 677-686.

16. Deardorff, J., et al., Maternal pre-pregnancy BMI, gestational weight gain, and age at menarche in daughters. Matern Child Health J, 2013. 17(8): p. 1391-8.

17. Baothman, O.A., et al., The role of Gut Microbiota in the development of obesity and Diabetes. Lipids Health Dis, 2016. 15: p. 108.

18. Cornejo-Pareja, I., et al., Importance of gut microbiota in obesity. Eur J Clin Nutr, 2018.

19. Murugesan, S., et al., Gut microbiome production of short-chain fatty acids and obesity in children. Eur J Clin Microbiol Infect Dis, 2018. 37(4): p. 621-625.

20. White, N.D., Gut Microbiota and Obesity: Potential Therapeutic Targets and Probiotic Treatment. Am J Lifestyle Med, 2016. 10(2): p. 104-106.

21. Galley, J.D., et al., Maternal obesity is associated with alterations in the gut microbiome in toddlers. PLoS One, 2014. 9(11): p. e113026.

22. Ma, J., et al., High-fat maternal diet during pregnancy persistently alters the offspring microbiome in a primate model. Nat Commun, 2014. 5: p. 3889.

23. Martin, R., et al., Early-Life Events, Including Mode of Delivery and Type of Feeding, Siblings and Gender, Shape the Developing Gut Microbiota. PLoS One, 2016. 11(6): p. e0158498.

168

24. Tanaka, M. and J. Nakayama, Development of the gut microbiota in infancy and its impact on health in later life. Allergol Int, 2017. 66(4): p. 515-522.

25. Yasmin, F., et al., Cesarean Section, Formula Feeding, and Infant Antibiotic Exposure: Separate and Combined Impacts on Gut Microbial Changes in Later Infancy. Front Pediatr, 2017. 5: p. 200.

26. Stewart, C.J., et al., Temporal development of the gut microbiome in early childhood from the TEDDY study. Nature, 2018. 562(7728): p. 583-588.

27. Baumann-Dudenhoeffer, A.M., et al., Infant diet and maternal gestational weight gain predict early metabolic maturation of gut microbiomes. Nat Med, 2018. 24(12): p. 1822-1829.

28. Le Huerou-Luron, I., S. Blat, and G. Boudry, Breast- v. formula-feeding: impacts on the digestive tract and immediate and long-term health effects. Nutr Res Rev, 2010. 23(1): p. 23-36.

29. Klement, E., et al., Breastfeeding and risk of inflammatory bowel disease: a systematic review with meta-analysis. Am J Clin Nutr, 2004. 80(5): p. 1342-52.

30. Cardwell, C.R., et al., Breast-feeding and childhood-onset type 1 diabetes: a pooled analysis of individual participant data from 43 observational studies. Diabetes Care, 2012. 35(11): p. 2215-25.

31. Owen, C.G., et al., Does breastfeeding influence risk of type 2 diabetes in later life? A quantitative analysis of published evidence. Am J Clin Nutr, 2006. 84(5): p. 1043-54.

32. Shields, L., et al., Breastfeeding and obesity at 21 years: a cohort study. J Clin Nurs, 2010. 19(11-12): p. 1612-7.

33. Harmsen, H.J., et al., Analysis of intestinal flora development in breast-fed and formula-fed infants by using molecular identification and detection methods. J Pediatr Gastroenterol Nutr, 2000. 30(1): p. 61-7.

34. Fallani, M., et al., Determinants of the human infant intestinal microbiota after the introduction of first complementary foods in infant samples from five European centres. Microbiology, 2011. 157(Pt 5): p. 1385-92.

35. Drago, L., et al., Microbiota network and mathematic microbe mutualism in colostrum and mature milk collected in two different geographic areas: Italy versus Burundi. ISME J, 2017. 11(4): p. 875-884.

169

36. Penders, J., et al., Factors influencing the composition of the intestinal microbiota in early infancy. Pediatrics, 2006. 118(2): p. 511-21.

37. Bezirtzoglou, E., A. Tsiotsias, and G.W. Welling, Microbiota profile in feces of breast- and formula-fed newborns by using fluorescence in situ hybridization (FISH). Anaerobe, 2011. 17(6): p. 478-82.

38. Mackie, R.I., A. Sghir, and H.R. Gaskins, Developmental microbial ecology of the neonatal gastrointestinal tract. Am J Clin Nutr, 1999. 69(5): p. 1035S-1045S.

39. Adlerberth, I. and A.E. Wold, Establishment of the gut microbiota in Western infants. Acta Paediatr, 2009. 98(2): p. 229-38.

40. Mermer, H., et al., [Postoperative use of antibiotics in septoplasty cases: is it really necessary?]. Kulak Burun Bogaz Ihtis Derg, 2014. 24(1): p. 17-20.

41. Rodriguez, J.M., et al., The composition of the gut microbiota throughout life, with an emphasis on early life. Microb Ecol Health Dis, 2015. 26: p. 26050.

42. Lee, Y.Y., et al., Gut microbiota in early life and its influence on health and disease: A position paper by the Malaysian Working Group on Gastrointestinal Health. J Paediatr Child Health, 2017. 53(12): p. 1152-1158.

43. Flores, R., et al., Fecal microbial determinants of fecal and systemic estrogens and estrogen metabolites: a cross-sectional study. J Transl Med, 2012. 10: p. 253.

44. Huang, G., et al., Genistein prevention of hyperglycemia and improvement of glucose tolerance in adult non-obese diabetic mice are associated with alterations of gut microbiome and immune homeostasis. Toxicol Appl Pharmacol, 2017. 332: p. 138-148.

45. Ridaura, V.K., et al., Gut microbiota from twins discordant for obesity modulate metabolism in mice. Science, 2013. 341(6150): p. 1241214.

46. Buffington, S.A., et al., Microbial Reconstitution Reverses Maternal Diet-Induced Social and Synaptic Deficits in Offspring. Cell, 2016. 165(7): p. 1762-1775.

47. Torres, P.J., et al., Exposure to a Healthy Gut Microbiome Protects Against Reproductive and Metabolic Dysregulation in a PCOS Mouse Model. Endocrinology, 2019.

48. Hill, J.W., et al., Phosphatidyl inositol 3-kinase signaling in hypothalamic proopiomelanocortin neurons contributes to the regulation of glucose homeostasis. Endocrinology, 2009. 150(11): p. 4874-82.

170

49. Mesaros, A., et al., Activation of Stat3 signaling in AgRP neurons promotes locomotor activity. Cell Metab, 2008. 7(3): p. 236-48.

50. Garcia-Galiano, D., et al., PI3Kalpha inactivation in leptin receptor cells increases leptin sensitivity but disrupts growth and reproduction. JCI Insight, 2017. 2(23).

51. Torsoni, M.A., et al., AMPKalpha2 in Kiss1 Neurons Is Required for Reproductive Adaptations to Acute Metabolic Challenges in Adult Female Mice. Endocrinology, 2016. 157(12): p. 4803-4816.

52. Edgar, R.C., Search and clustering orders of magnitude faster than BLAST. Bioinformatics, 2010. 26(19): p. 2460-1.

53. Caporaso, J.G., et al., QIIME allows analysis of high-throughput community sequencing data. Nat Methods, 2010. 7(5): p. 335-6.

54. Segata, N., et al., Metagenomic biomarker discovery and explanation. Genome Biol, 2011. 12(6): p. R60.

55. DeSantis, T.Z., et al., Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol, 2006. 72(7): p. 5069-72.

56. Koren, O., et al., Host remodeling of the gut microbiome and metabolic changes during pregnancy. Cell, 2012. 150(3): p. 470-80.

57. Collado, M.C., et al., Distinct composition of gut microbiota during pregnancy in overweight and normal-weight women. Am J Clin Nutr, 2008. 88(4): p. 894-9.

58. Santacruz, A., et al., Gut microbiota composition is associated with body weight, weight gain and biochemical parameters in pregnant women. Br J Nutr, 2010. 104(1): p. 83-92.

59. Turnbaugh, P.J., et al., Diet-induced obesity is linked to marked but reversible alterations in the mouse distal gut microbiome. Cell Host Microbe, 2008. 3(4): p. 213-23.

60. Mann, P.E., K. Huynh, and G. Widmer, Maternal high fat diet and its consequence on the gut microbiome: A rat model. Gut Microbes, 2018. 9(2): p. 143-154.

171

61. Li, W., et al., Memory and learning behavior in mice is temporally associated with diet-induced alterations in gut bacteria. Physiol Behav, 2009. 96(4-5): p. 557-67.

62. Mujico, J.R., et al., Changes in gut microbiota due to supplemented fatty acids in diet-induced obese mice. Br J Nutr, 2013. 110(4): p. 711-20.

63. An, H.M., et al., Antiobesity and lipid-lowering effects of Bifidobacterium spp. in high fat diet-induced obese rats. Lipids Health Dis, 2011. 10: p. 116.

64. Yin, Y.N., et al., Effects of four Bifidobacteria on obesity in high-fat diet induced rats. World J Gastroenterol, 2010. 16(27): p. 3394-401.

65. Million, M., et al., Comparative meta-analysis of the effect of Lactobacillus species on weight gain in humans and animals. Microb Pathog, 2012. 53(2): p. 100-8.

66. Vogt, M.C., et al., Neonatal insulin action impairs hypothalamic neurocircuit formation in response to maternal high-fat feeding. Cell, 2014. 156(3): p. 495- 509.

67. Carel, J.C., et al., Consensus statement on the use of gonadotropin-releasing hormone analogs in children. Pediatrics, 2009. 123(4): p. e752-62.

68. Perry, R.J., et al., Acetate mediates a microbiome-brain-beta-cell axis to promote metabolic syndrome. Nature, 2016. 534(7606): p. 213-7.

69. Li, M., et al., Gut carbohydrate metabolism instead of fat metabolism regulated by gut microbes mediates high-fat diet-induced obesity. Benef Microbes, 2014. 5(3): p. 335-44.

70. Rahat-Rozenbloom, S., et al., Evidence for greater production of colonic short- chain fatty acids in overweight than lean humans. Int J Obes (Lond), 2014. 38(12): p. 1525-31.

71. Ley, R.E., et al., Obesity alters gut microbial ecology. Proc Natl Acad Sci U S A, 2005. 102(31): p. 11070-5.

72. Krych, L., et al., Gut microbial markers are associated with diabetes onset, regulatory imbalance, and IFN-gamma level in NOD mice. Gut Microbes, 2015. 6(2): p. 101-9.

73. Forsythe, P. and J. Bienenstock, Immunomodulation by commensal and probiotic bacteria. Immunol Invest, 2010. 39(4-5): p. 429-48.

172

74. Collado, M.C., et al., Effect of mother's weight on infant's microbiota acquisition, composition, and activity during early infancy: a prospective follow-up study initiated in early pregnancy. Am J Clin Nutr, 2010. 92(5): p. 1023-30.

75. Rossi, G., et al., Comparison of microbiological, histological, and immunomodulatory parameters in response to treatment with either combination therapy with prednisone and metronidazole or probiotic VSL#3 strains in dogs with idiopathic inflammatory bowel disease. PLoS One, 2014. 9(4): p. e94699.

76. Jones-Hall, Y.L., A. Kozik, and C. Nakatsu, Correction: Ablation of tumor necrosis factor is associated with decreased inflammation and alterations of the microbiota in a mouse model of inflammatory bowel disease. PLoS One, 2015. 10(4): p. e0125309.

77. Liu, W., et al., Diet- and Genetically-induced Obesity Produces Alterations in the Microbiome, Inflammation and Wnt Pathway in the Intestine of Apc(+/1638N) Mice: Comparisons and Contrasts. J Cancer, 2016. 7(13): p. 1780-1790.

78. Jiao, N., et al., Gut microbiome may contribute to insulin resistance and systemic inflammation in obese rodents: a meta-analysis. Physiol Genomics, 2018. 50(4): p. 244-254.

79. Charalampakis, V., et al., Polycystic ovary syndrome and endometrial hyperplasia: an overview of the role of bariatric surgery in female fertility. Eur J Obstet Gynecol Reprod Biol, 2016. 207: p. 220-226.

80. Lindheim, L., et al., Alterations in Gut Microbiome Composition and Barrier Function Are Associated with Reproductive and Metabolic Defects in Women with Polycystic Ovary Syndrome (PCOS): A Pilot Study. PLoS One, 2017. 12(1): p. e0168390.

81. Hollister, E.B., et al., Structure and function of the healthy pre-adolescent pediatric gut microbiome. Microbiome, 2015. 3: p. 36.

82. Bau, A.M., et al., Is there a further acceleration in the age at onset of menarche? A cross-sectional study in 1840 school children focusing on age and bodyweight at the onset of menarche. Eur J Endocrinol, 2009. 160(1): p. 107-13.

83. Poretsky, L., et al., The insulin-related ovarian regulatory system in health and disease. Endocr Rev, 1999. 20(4): p. 535-82.

84. Pilia, S., et al., The effect of puberty on insulin resistance in obese children. J Endocrinol Invest, 2009. 32(5): p. 401-5.

173

85. Koenig, J.E., et al., Succession of microbial consortia in the developing infant gut microbiome. Proc Natl Acad Sci U S A, 2011. 108 Suppl 1: p. 4578-85.

86. Meadows, R., Gut bacteria may override genetic protections against diabetes. PLoS Biol, 2011. 9(12): p. e1001215.

87. Le Chatelier, E., et al., Richness of human gut microbiome correlates with metabolic markers. Nature, 2013. 500(7464): p. 541-6.

88. Turnbaugh, P.J., et al., A core gut microbiome in obese and lean twins. Nature, 2009. 457(7228): p. 480-4.

89. Bliss, E.S. and E. Whiteside, The Gut-Brain Axis, the Human Gut Microbiota and Their Integration in the Development of Obesity. Front Physiol, 2018. 9: p. 900.

90. Fetissov, S.O., Role of the gut microbiota in host appetite control: bacterial growth to animal feeding behaviour. Nat Rev Endocrinol, 2017. 13(1): p. 11-25.

91. Yan, J., et al., Gut microbiota induce IGF-1 and promote bone formation and growth. Proc Natl Acad Sci U S A, 2016. 113(47): p. E7554-E7563.

92. Daftary, S.S. and A.C. Gore, IGF-1 in the brain as a regulator of reproductive neuroendocrine function. Exp Biol Med (Maywood), 2005. 230(5): p. 292-306.

174

Chapter 6

Summary

The reproductive axis is linked to nutritional status. Undernutrition including decreased food consumption and body weight causes delayed puberty and impaired fertility, while overnutrition causes advanced puberty and impaired fertility. Important metabolic signals for reproduction include insulin and IGF-1. In particular, brain IGF1R and IR signaling regulates metabolic and reproductive functions. Neurons are the fundamental units of the hypothalamus and carry out distinct neuroendocrine functions including puberty, fertility, energy homeostasis and glucose homeostasis. The leptin and kisspeptin projects are examples of subnutrition induced by disruption of brain IGF1R and IR signaling in specific neurons causes reproductive and metabolic dysfunctions.

LepRb neurons plays a major role in the regulation of puberty, fertility, energy balance and glucose homeostasis, linking metabolic cues and the control of multiple neuroendocrine axes. As we discussed, IGF1R and IR signaling shared downstream PI3K pathway. Our collaborators have generated mice lacking PI3K in LepRb neurons showed delayed puberty, impaired fertility, growth retardation and increased energy expenditure

[1]. To test if these effects were mainly mediated by the upstream IR signaling, they

175

further generated mice with deletions of IRs in LepRb neurons (IRLepRb mice) [1].

However, none of the reproductive and metabolic dysfunctions were dependent on IR signaling. Notably, our IGF1RLepRb mice recaptured the delayed puberty, impaired fertility, growth retardation and increased energy expenditure seen in mice lacking PI3K.

Interestingly, we further found that IGF1R and IR signaling in LepRb neurons interact and provide counterbalancing effects on the regulation of body composition and insulin sensitivity. Here, we summarized the reproductive and metabolic phenotype in IRLepRb mice, IGF1RLepRb mice and IGF1R/IRLepRb mice:

Comparison of reproductive and metabolic dysfunctions in IRLepRb mice, IGF1RLepRb mice and IGF1R/IRLepRb mice. Female Male IRLepRb IGF1RLepRb IGF1R/IRLepRb IRLepRb IGF1RLepRb IGF1R/IRLepRb Puberty → ↓ ↓ → ↓↓ ↓ Fertility → ↓ ↓ → ↓ ↓ Steroid hormone unclear → → → ↓ → Gonadotropin unclear → ↑ → ↓ → Body weight → ↓ ↓↓ → → → Food intake → ↓ ↓ → → → Energy → ↑ ↓ → → ↓ expenditure Physical activity → ↑ ↓ → → ↓ Glucose → ↓ → → → → tolerance Insulin unclear → ↓ → → ↓ sensitivity Body length → ↓ ↓↓ → ↓ ↓ Bone health unclear ↓ → → ↓ unclear Serum GH and unclear → → → ↓ ↓ IGF-1

Kiss1 neurons express LepRbs; however, we have shown that leptin’s effects on puberty in mice do not require Kiss1 neurons. But we do not know whether the effects of

IGF1R and IR signaling require Kiss1 neurons. Kiss1 neurons have been previously

176

hypothesized to serve as the primary transmitters of metabolic signals from periphery to

GnRH neurons and HPG axis, which primarily control puberty onset and fertility. Our lab has generated mice lacking IR in Kiss1 neurons (IRKiss1 mice) [2]. Here, we have generated mice lacking IGF1R and/or IR in Kiss1 neurons (IGF1RKiss1 mice and

IGF1R/IR Kiss1 mice). We compared the reproductive and metabolic dysfunctions in

IRKiss1 mice, IGF1RKiss1 mice and IGF1R/IR Kiss1 mice:

Comparison of reproductive and metabolic dysfunctions in IRKiss1 mice, IGF1RKiss1 mice and IGF1R/IR Kiss1 mice. Female Male IRKiss1 IGF1RKiss1 IGF1R/IRKiss1 IRKiss1 IGF1RKiss1 IGF1R/IRKiss1 Puberty ↓ ↓↓ ↓↓ ↓ ↓↓ ↓↓ Fertility → ↓ ↓ → ↓ ↓ Body weight → ↓ ↓ → ↓ ↓ Body length → ↓ ↓ → ↓ ↓ Fat mass → → ↑↑ → → ↑↑ Food intake → ↓ → → → → Energy → ↑ ↑ → ↑ ↑↑ expenditure Physical → ↑ ↓ → ↑ ↓ activity Glucose → → → → → ↓ tolerance Insulin → → ↓ → → → sensitivity

Some effects seen in Kiss1 neurons were similar to what we have found in LepRb neurons, however other effects were different, suggesting that the role of brain IGF1R and IR signaling in the regulation of reproductive and metabolic functions was neuron- specific.

After discussing the relationship between undernutrition (decreased food intake) and delayed puberty, we wanted to test if overnutrition would advance puberty. It is

177

known that MHFD during lactation induces metabolic dysfunctions including obesity and glucose intolerance, however, we do not know if lactation is the critical window for puberty onset. We gave new mice mothers HFD from the date they delivered and started breastfeeding until we weaned their pups and a second group of new mice mothers with normal chow diet for the same amount of time. We found MHFD offspring had early puberty and obesity, increased food intake and disruptions of glucose and energy homeostasis. Our study demonstrates that lactation provides a critical window for developing normal metabolic and reproductive functions in offspring. Emerging evidence shows that HFD promotes the development of early obesity and gut microbiota dysbiosis.

Therefore, we collected fecal samples, profiled the gut microbiota and found that MHFD during lactation may influence metabolic and reproductive health of offspring via modulation of gut microbiota.

Taken together, this dissertation discusses the relationship between reproduction and metabolism from different angle of view, provides understanding of brain IGF1R and

IR signaling in the regulation of metabolism and reproduction and identifies microbiome as a new link between metabolism and reproduction.

The work reported here has accomplished the following: 1) We dissected the role of IGF1R and IR signaling in LepRb neurons in puberty, fertility and body growth by generating and charactering transgenic IGF1RLepRb and IGF1R/IRLepRb mice in both sexes. 2) We deciphered the role of IGF1R and IR signaling in LepRb neurons in body weight, food intake, energy homeostasis and glucose homeostasis in IGF1RLepRb and

178

IGF1R/IRLepRb in both sexes. 3) We characterized both metabolic and reproductive phenotype in IGF1RKiss1 and IGF1R/IRKiss1 mice in both sexes. 4) We explored the influence of MHFD during lactation on the metabolic and reproductive health of offspring in female mice. We also explored potential mechanism, preventive or therapeutic way to treat metabolic and reproductive dysfunctions.

By achieving these objectives, we conclude that 1) brain IGF1R and IR signaling are crucial to various physiological processes including puberty, fertility, growth, body weight, energy homeostasis and energy homeostasis; 2) IGF1R signaling in both LepRb neurons and Kiss1 neurons plays a dominant role in the regulation of puberty, fertility and growth; 3) IGF1R and IR signaling in LepRb neurons control gonadotropin levels and ovarian follicle counts; 4) IGF1R and IR signaling in both

LepRb neurons and Kiss1 neurons have compensatory roles in the regulation of body composition and glucose homeostasis; 5) IGF1R and IR signaling in LepRb neurons interact and provide counterbalancing effects on the regulation of body composition and insulin sensitivity; 6) MHFD during lactation led to early puberty and irregular reproductive cycles in female mice which was mediated by modulation of gut microbiota.

Microbial reconstitution may prevent or treat early puberty and insulin insensitivity.

References

1. Garcia-Galiano, D., et al., PI3Kalpha inactivation in leptin receptor cells increases leptin sensitivity but disrupts growth and reproduction. JCI Insight, 2017. 2(23).

2. Qiu, X., et al., Delayed puberty but normal fertility in mice with selective deletion of insulin receptors from Kiss1 cells. Endocrinology, 2013. 154(3): p. 1337-48.

179

Appendix A

Mouse primers for measurement of gene expression

Primer Sequence 5’-3’ IGF-1R forward CTTCCCAGCTTGCTACTCTAGG IGF-1R reverse CAGGCTTGCAATGAGACATGGG IGF-1R delta TGAGACGTAGCGAGATTGCTGTA IGF-1R p1 TTATGCCTCCTCTCTTCATC IGF-1R p2 CTTCAGCTTTGCAGGTGCACG IGF-1R p3 ATGACCCAGGGGAGGCTGTGTA IR forward TGCACCCCATGTCTGGGACCC IR reverse GCCTCCTGAATAGCTGAGACC IR delta TCTATCATGTGATCAATGATTC IR p1 CTGTTCGGAACCTGATGAC IR p2 TCTATCATGTGATCAATGATTC IR p3 ATACCAGAGCATAGGAG Leptin receptor forward ACCTGTTCCACGCACAGTCACA Leptin receptor reverse AGCTGGCCAAATCTCAGAGCTGC Cre recombinase forward CGACCAAGTGACAGCAATGCT Cre recombinase reverse GGTGCTAACCAGCGTTTTCGT POMC forward GAGGCCACTGAACATCTTTGTC POMC reverse GCAGAGGCAAACAAGATTGG NPY forward TAGGTAACAAACGAATGGGG NPY reverse ATGATGAGATGAGATGTGGG AgRP forward AGGGCATCAGAAGGCCTGACCA AgRP reverse CTTGAAGAAGCGGCAGTAGCAC GHR forward GGGGGTCTGGACTGGGGAGCTG GHR reverse GCGCTGAACTGGACCCTGCTGAAT UCP1 forward GGATGGTGAACCCGACAACT UCP1 reverse AACTCCGGCTGAGAAGATCTTG ADRB3 forward TCGACATGTTCCTCCACCAA

180

ADRB3 reverse GATGGTCCAAGATGGTGCTT Cidea forward AGGGAGGGACCTTAGGGAAT Cidea reverse CCAAGTCCAGCTTGGTGAAT PRDM16 forward CCTAACTTTCCCCACTCCCTCTA PRDM16 reverse GCTCAGCCTTGACCAGCAA PPARγ forward AGCCGTGACCACTGACAACGAG PPARγ reverse GCTGCATGGTTCTGAGTGCTAAG G6PC forward GGCTCACTTTCCCCATCAGG G6PC reverse ATCCAAGTGCGAAACCAAACAG Pepck forward CCCACTGGGAACACAAACTT Pepck reverse CCTTTCTTCTCTTTGGATGATCT IL-6 forward CTGCAAGAGACTTCCATCCAGTT IL-6 reverse GAAGTAGGGAAGGCCGTGG TNF-α forward CCCTCACACTCAGATCATCTTCT TNF-α reverse GCTACGACGTGGGCTACAG Kiss1peptin forward AGCTGCTGCTTCTCCTCTGT Kiss1peptin reverse GCATACCGCGATTCCTTTT

181