DOCSLIB.ORG

Original Article OPCML Is Frequently Methylated in Human Colorectal Cancer and Its Restored Expression Reverses EMT Via Downregulation of Smad Signaling

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Original Article OPCML Is Frequently Methylated in Human Colorectal Cancer and Its Restored Expression Reverses EMT Via Downregulation of Smad Signaling Am J Cancer Res 2015;5(5):1635-1648 www.ajcr.us /ISSN:2156-6976/ajcr0005675 Original Article OPCML is frequently methylated in human colorectal cancer and its restored expression reverses EMT via downregulation of smad signaling Chunhong Li1,3*, Liping Tang2*, Lijuan Zhao1*, Lili Li4, Qian Xiao1, Xinrong Luo1, Weiyan Peng1, Guosheng Ren1,3, Qian Tao1,4, Tingxiu Xiang1 1Molecular Oncology and Epigenetics Laboratory, 2Department of Gastroenterology, The First Affiliated Hospital of Chongqing Medical University, Chongqing 400016, China; 3Department of Endocrine and breast Surgery, The First Affiliated Hospital of Chongqing Medical University, Chongqing 400016, China; 4Cancer Epigenetics Laboratory, Department of Clinical Oncology, Sir YK Pao Center for Cancer and Li Ka Shing Institute of Health Sciences, The Chinese University of Hong Kong and CUHK Shenzhen Research Institute, Hong Kong, China. *Equal contributors. Received January 8, 2015; Accepted April 15, 2015; Epub April 15, 2015; Published May 1, 2015 Abstract: Emerging evidence has indicated that the expression of OPCML gene is frequently altered in a variety of cancers. We previously demonstrated that the OPCML gene is a target of epigenetic inactivation and its gene product exhibits tumor-suppressive properties. However, little is known regarding the effects and mechanisms of OPCML in colon cancer. We show that the loss or downregulation of OPCML is associated with its promoter hyper- methylation. Methylation of the OPCML promoter was detected in all tumors and tumor-adjacent tissues, but lower methylation in normal colon tissues. The drug-induced release of epigenetic silencing was able to restore OPCML expression and the re-expression led to the suppression of cell growth. Furthermore, the increase in OPCML expres- sion reversed a partial epithelial-to-mesenchymal (EMT)-like transition. Cell migration and invasiveness were also inhibited in response to OPCML upregulation. These actions were mediated through the inactivation of TGFβ-Smad signaling pathways. In addition, OPCML expression was associated with two upstream nuclear receptors (ERRa and RORa). Altogether, our study reveals OPCML as a potential tumor suppressor gene epigenetically silenced in colon cancer. Our study will help to elucidate the anti-invasive mechanisms of OPCML and establish new chemotherapeu- tic strategies for human colon cancer. Keywords: Tumor suppressor, OPCML, methylation, cancer Introduction sis using colonoscopy is viewed as the gold standard for colorectal cancer detection [8], Colorectal cancer (CRC) is the third most com- Most detections reveal distant metastatic dis- mon malignancy in the United States and the ease at the time of presentation [8]. Therefore, second most common cause of cancer death there is an urgent need for highly specific and despite diagnostic and treatment advances [1]. highly sensitive biomarkers, and new therapeu- In China, the incidence of colon cancer and tic strategies. mortality rate increases annually [2]. Epigenetic Emerging evidence has revealed that the aber- changes mainly involved the methylation of rant promoter methylation of some tumor sup- CpG islands in the promoters of tumor suppres- pressor genes (TSGs), such as AKR1B1, sor genes, causing gene silencing and the CHST10, ELOVL4, SOX5, STK33, and ZNF304 occurrence of tumors [3, 4]. In the clinical set- are good early biomarkers and potential thera- ting, demethylation drugs have been used to peutic targets for colon cancer [9]. In addition, treat some types of tumors [5, 6]. The key to OPCML gene, located on 11q25, may have cancer treatment lies in its early detection and potential as a biomarker and therapeutic tar- diagnosis [7]. Although a pathological diagno- get. OPCML belongs to a member of the IgLON OPCML methylation in colorectal cancer Table 1. List of primers used in this study The goal of the current study was to Primer Sequence (5’-3’) size (bp) investigate the roles and mechanisms of OPCML in colon cancer. We found meth- p21-sense TGGAGACTCTCAGGGTCGAAA ylation of the OPCML gene promoter in p21-antisense GGCGTTTGGAGTGGTAGAAATC 65 most of colon tumors, OPCML induced p53-sense TCAACAAGATGTTTTGCCAACTG G0/G1 cell cycle arrest and apoptosis in p53-antisense ATGTGCTGTGACTGCTTGTAGATG 118 colon cancer cells, changed cell morphol- TGFB1-sense TGTACAACAGCACCCGCGAC ogy and the expression of EMT markers TGFB1-antisense GAGAGCAACACGGGTTCAGG 214 [20], resulting in the inhibition of in vitro TGFB2-sense ACAGCACCAGGGACTTGCTC cell motility and invasiveness through TGFB2-antisense CGTTGTTCAGGCACTCTGGC 280/364 the inactivation of Smad signaling path- TGFB3-sense CAACGGTGATGACCCACGTC ways [21, 22]. Our study provides evi- TGFB3-antisense CTCATTCCGCTTAGAGCTGG 320 dence that OPCML acts as tumor sup- Smad2-sense CCATCTTGCCATTCACGC pressor in CRC and is an important nega- Smad2-antisense TCTTCCTGCCCATTCTGC 106 tive regulator of EMT. Smad3-sense AGTCTCCCAACTGTAACCA Materials and methods Smad3-antisense GGTAGACAGCCTCAAAGC 147 Smad4-sense CAGAGAACATTGGATGGGAG Cell lines, plasmids and tissue samples Smad4-antisense CCAGGTGATACAACTCGTTC 197 RORa-sense CACGACGACCTCAGTAAC Two colon cancer cell lines used (SW480, RORa-antisense CGAACAGTAGGGAAAGAA 186 LoVo) were kindly provided by Prof. ERRa-sense GTGGGCGGCAGAAGTACAAG Tongchuan He (The University of Chicago ERRa-antisense GGTCAAAGAGGTCACAGAGGGT 234 Medical Center, Chicago, Illinois, USA). N-cad-sense CAGGTTTGGAATGGGACAGT Plasmid pcDNA-OPCML was constructed by cloning the amplified entire coding N-cad-antisense TCCAGTAGGATCTCCGCCAC 480 region of OPCML into pCDNA3.1(+) and Ecad-sense CCTCCGTTTCTGGAATCCAA sequenced for verification. Colon tissues Ecad-antisense GTTCTCTATCCAGAGGCTCT 282 were obtained from patients treated by VIM-sense TGCCAACCTTTACAGACCTA primary surgery at the First Affiliated VIM-antisense CTCATCTCCCTCCTCACTCA 390 Hospital Surgery Department of Chong- β-catenin-sense TGTATGAGTGGGAACAGGGATT qing Medical University (Chongqing, β-catenin-antisense GCCAAACGCTGGACATTAGT 190 China). All samples were evaluated and β-actin-sense GTCTTCCCCTCCATCGTG subjected to histological diagnosis by β-actin-antisense AGGGTGAGGATGCCTCTCTT 114 expert pathologists. All patients provided OPCML-sense GGGTCTGTGGGTACCTGTTC informed consent. The samples were OPCML-antisense TATGGACCACTTGTCATTCC 280 stored at the Chongqing Medical Uni- versity tissue bank until use. This study was approved through the Instituti- family [10], and is a glycosylphosphatidylinosi- onal Review Board of Chongqing Medical Uni- tol (GPI)-anchored cell adhesion-like molecule. versity. OPCML is involved in cell growth, invasion, and Establishing stable cell lines metastasis and is closely related to tumorigen- esis [11]. OPCML is widely expressed in normal Cells were plated in six-well plates. pcDNA- infant and adult tissues, but it exhibits gene OPCML or pcDNA3.1(+) was then transfected promoter methylation and reduced expression into 70% confluent SW480 and LoVo cells using in multiple cancers [12-15], including ovarian Lipofectamine 2000 reagent (Lipofectamine cancer, bladder cancer, nasopharyngeal carci- 2000 Reagent, Invitrogen, CA, USA), according noma, cervical carcinoma, and hepatocellular to the manufacturer’s protocols. After transfec- carcinoma [13, 16-19]. However, the relation- tion, cells were grown in a nonselective growth ship between OPCML and the occurrence and medium for 48 h after which the medium was development of colon cancer has not been replaced with a selection medium containing reported, and any potential mechanisms relat- 400 μg/ml G418 (Invitrogen/Gibco). After 14 ed to CRC have not been elucidated. days, individual colonies were isolated and cul- 1636 Am J Cancer Res 2015;5(5):1635-1648 OPCML methylation in colorectal cancer Figure 1. OPCML is downregulated in CRC speci- mens. A, B. OPCML mRNA expression level was as- sayed. C. Quantitative RT-PCR showed OPCML ex- pression in five paired tissue samples. tured. Meanwhile, total RNA from the transfect- 5×buffer, 0.5 μl dNTPs, 0.25 μl RII, 0.5 μl RTase ed cells was treated with DNase I, and analyzed (RNA reverse transcriptase), and 0.75 μl ddH2O. by RT-PCR and western blot to confirm the The PCR reaction steps were as follows: 42°C expression of OPCML in stable cells. for 1 h, 70°C for 15 min, 4°C for 10 min. Reverse transcription-PCR was performed in a Analysis of Oncomine data total reaction volume of 10 μl using Go-Taq (Promega, Madison, WI, USA), including 2 μl The Oncomine database tool (http://www.onco- cDNA, 1.6 μl 5×PCR buffer, 0.4 μl 25 mM MgCl2, mine.org) was used to analyze the mRNA 0.6 μl forward primer, 0.6 μl reverse primer, expression of OPCML in human colon cancer 0.05 μl DNA polymerase and 4.75 μl ddH2O, samples compared to normal colon tissue sam- with glyceraldehyde-3-phosphate dehydroge- ples. The threshold search value used for this nase (GAPDH) as a control. Primers used are study was a p-value of 0.05. listed in Table 1. The PCR program consisted of an initial denaturation at 95°C for 2 min, fol- Semiquantitative RT-PCR and quantitative re- lowed by 32 cycles (for genes) or 23 cycles (for verse transcription polymerase chain reaction GAPDH, glyceraldehyde-phosphate dehydroge- analysis (qRT-PCR) nase) of the following: 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s, with a final elongation Total RNA was isolated from tissues and cells at 72°C for 5 min. Agarose gel electrophoresis using Trizol reagent (Invitrogen, USA) according (120 V, 25 min) was performed using a 2% aga- to the manufacturer’s instructions.
Load more

Recommended publications
  • Hearing Aging Is 14.1±0.4% GWAS-Heritable
    medRxiv preprint doi: https://doi.org/10.1101/2021.07.05.21260048; this version posted July 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-NC 4.0 International license . Predicting age from hearing test results with machine learning reveals the genetic and environmental factors underlying accelerated auditory aging Alan Le Goallec1,2+, Samuel Diai1+, Théo Vincent1, Chirag J. Patel1* 1Department of Biomedical Informatics, Harvard Medical School, Boston, MA, 02115, USA 2Department of Systems, Synthetic and Quantitative Biology, Harvard University, Cambridge, MA, 02118, USA +Co-first authors *Corresponding author Contact information: Chirag J Patel [email protected] Abstract With the aging of the world population, age-related hearing loss (presbycusis) and other hearing disorders such as tinnitus become more prevalent, leading to reduced quality of life and social isolation. Unveiling the genetic and environmental factors leading to age-related auditory disorders could suggest lifestyle and therapeutic interventions to slow auditory aging. In the following, we built the first machine learning-based hearing age predictor by training models to predict chronological age from hearing test results (root mean squared error=7.10±0.07 years; R-Squared=31.4±0.8%). We defined hearing age as the prediction outputted by the model on unseen samples, and accelerated auditory aging as the difference between a participant’s hearing age and age. We then performed a genome wide association study [GWAS] and found that accelerated hearing aging is 14.1±0.4% GWAS-heritable.
    [Show full text]
  • Serum Cell-Free DNA Methylation of OPCML and HOXD9 As a Biomarker That May Aid in Differential Diagnosis Between Cholangiocarcin
    Wasenang et al. Clinical Epigenetics (2019) 11:39 https://doi.org/10.1186/s13148-019-0634-0 RESEARCH Open Access Serum cell-free DNA methylation of OPCML and HOXD9 as a biomarker that may aid in differential diagnosis between cholangiocarcinoma and other biliary diseases Wiphawan Wasenang1,2, Ponlatham Chaiyarit3, Siriporn Proungvitaya1,4 and Temduang Limpaiboon1,4* Abstract Background: Cholangiocarcinoma (CCA) is a fatal cancer of the bile duct epithelial cell lining. The misdiagnosis of CCA and other biliary diseases may occur due to the similarity of clinical manifestations and blood tests resulting in inappropriate or delayed treatment. Thus, an accurate and less-invasive method for differentiating CCA from other biliary diseases is inevitable. Methods: We quantified methylation of OPCML, HOXA9,andHOXD9 in serum cell-free DNA (cfDNA) of CCA patients and other biliary diseases using methylation-sensitive high-resolution melting (MS-HRM). Their potency as differential biomarkers between CCA and other biliary diseases was also evaluated by using receiver operating characteristic (ROC) curves. Results: The significant difference of methylation levels of OPCML and HOXD9 was observed in serum cfDNA of CCA compared to other biliary diseases. Assessment of serum cfDNA methylation of OPCML and HOXD9 as differential biomarkers of CCA and other biliary diseases showed the area under curve (AUC) of 0.850 (0.759–0.941) for OPCML which sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and accuracy were 80.00%, 90.00%, 88.88%, 81.81%, and 85.00%, respectively. The AUC of HOXD9 was 0.789 (0.686–0.892) with sensitivity, specificity, PPV, NPV, and accuracy of 67.50%, 90.00%, 87.09%, 73.46%, and 78.75%, respectively.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Bioinformatics Tools for the Analysis of Gene-Phenotype Relationships Coupled with a Next Generation Chip-Sequencing Data Processing Pipeline
    Bioinformatics Tools for the Analysis of Gene-Phenotype Relationships Coupled with a Next Generation ChIP-Sequencing Data Processing Pipeline Erinija Pranckeviciene Thesis submitted to the Faculty of Graduate and Postdoctoral Studies in partial fulfillment of the requirements for the Doctorate in Philosophy degree in Cellular and Molecular Medicine Department of Cellular and Molecular Medicine Faculty of Medicine University of Ottawa c Erinija Pranckeviciene, Ottawa, Canada, 2015 Abstract The rapidly advancing high-throughput and next generation sequencing technologies facilitate deeper insights into the molecular mechanisms underlying the expression of phenotypes in living organisms. Experimental data and scientific publications following this technological advance- ment have rapidly accumulated in public databases. Meaningful analysis of currently avail- able data in genomic databases requires sophisticated computational tools and algorithms, and presents considerable challenges to molecular biologists without specialized training in bioinfor- matics. To study their phenotype of interest molecular biologists must prioritize large lists of poorly characterized genes generated in high-throughput experiments. To date, prioritization tools have primarily been designed to work with phenotypes of human diseases as defined by the genes known to be associated with those diseases. There is therefore a need for more prioritiza- tion tools for phenotypes which are not related with diseases generally or diseases with which no genes have yet been associated in particular. Chromatin immunoprecipitation followed by next generation sequencing (ChIP-Seq) is a method of choice to study the gene regulation processes responsible for the expression of cellular phenotypes. Among publicly available computational pipelines for the processing of ChIP-Seq data, there is a lack of tools for the downstream analysis of composite motifs and preferred binding distances of the DNA binding proteins.
    [Show full text]
  • Down-Regulated Expression of OPCML Predicts an Unfavorable
    Xing et al. BMC Cancer (2017) 17:268 DOI 10.1186/s12885-017-3203-y RESEARCHARTICLE Open Access Down-regulated expression of OPCML predicts an unfavorable prognosis and promotes disease progression in human gastric cancer Xiangbin Xing1*†, Weibin Cai2†, Sanmei Ma3†, Yongfei Wang3, Huijuan Shi4, Ming Li1,3, Jinxia Jiao1,3, Yang Yang1,3, Longshan Liu5, Xiangliang Zhang6 and Minhu Chen1* Abstract Background: OPCML belongs to the IgLON family of Ig domain–containing GPI-anchored cell adhesion molecules and was recently found to be involved in carcinogenesis, while its role in gastric cancer remains unclear. Methods: We assessed expression and biological behavior of OPCML in gastric cancer. Results: OPCML expression was markedly reduced in tumor tissues and cancer cell lines. Decreased OPCML expression had a significant association with unfavorable tumor stage (p = 0.007) and grading (p < 0.001). Furthermore, the results revealed that OPCML was an independent prognostic factor for overall survival in gastric cancer (p = 0.002). In addition, ectopic expression of OPCML in cancer cells significantly inhibited cell viability (p < 0.01) and colony formation (p < 0.001), arrest cell cycle in G0/G1 phase and induced apoptosis, and suppressed tumor formation in nude mice. The alterations of phosphorylation status of AKT and its substrate GSK3β, up- regulation of pro-apoptotic regulators including caspase-3, caspase-9 and PARP, and up-regulation of cell cycle regulator p27, were implicated in the biological activity of OPCML in cancer cells. Conclusion: Down-regulated OPCML expression might serve as an independent predictor for unfavorable prognosis of patients, and the biological behavior supports its role as a tumor suppressor in gastric cancer.
    [Show full text]
  • Original Article Genome-Wide Comparison of DNA Methylation Between Sinonasal Squamous Cell Carcinomas and Paired Normal Mucosa Tissues
    Int J Clin Exp Med 2018;11(9):9493-9501 www.ijcem.com /ISSN:1940-5901/IJCEM0064416 Original Article Genome-wide comparison of DNA methylation between sinonasal squamous cell carcinomas and paired normal mucosa tissues Zheng Yang1,2, Yang Zhang1,2, Hongbo Xu1,2, Junwei Huang1,2, Wei Guo1,2, Zhigang Huang1,2 1Department of Otolaryngology Head and Neck Surgery, Beijing Tongren Hospital, Capital Medical University, Beijing, P.R. China; 2Key Laboratory of Otolaryngology Head and Neck Surgery of Ministry of Education, Beijing, P.R. China Received March 16, 2017; Accepted May 3, 2018; Epub September 15, 2018; Published September 30, 2018 Abstract: Epigenetic regulation is an important player in the tumorigenesis, progression, and prognosis of various tumors, but its role in sinonasal squamous cell carcinomas has not been well addressed. The objective of this study was to investigate the genome-wide DNA methylation in the sinonasal squamous cell carcinoma tissues. DNA meth- ylation in CpG islands and promoters was investigated in 7 sinonasal squamous cell carcinomas and paired normal mucosa tissues using a DNA Methylation CpG Island Plus Promoter Array. A total of 12207 differentially methylated sites were observed between tumor tissues and normal mucosa tissues. Sixteen sites containing 9 genes were sig- nificantly different at P<0.01. Of the 9 genes, 3 genes (PTPRN2, NLRP8, and GRIN3B) were hypomethylated and 6 genes (TACC2, LOC404266, RASL10A, HOXD9, OPCML, CNPY1) were hypermethylated in the sinonasal squamous cell carcinomas compared to the paired normal mucosa tissues. The categorizations, the gene network, and the protein interaction network of these 9 aberrantly methylated genes were further analyzed.
    [Show full text]
  • Evaluation of a Functional Epigenetic Approach to Identify Promoter Region Methylation in Phaeochromocytoma and Neuroblastoma
    Endocrine-Related Cancer (2008) 15 777–786 Evaluation of a functional epigenetic approach to identify promoter region methylation in phaeochromocytoma and neuroblastoma Caroline D E Margetts1, Mark Morris1,2, Dewi Astuti1,2, Dean C Gentle1,2, Alberto Cascon3, Fiona E McRonald1,2, Daniel Catchpoole4, Mercedes Robledo3, Hartmut P H Neumann5, Farida Latif1, 2 and Eamonn R Maher1,2 1Department of Medical and Molecular Genetics, Institute of Biomedical Research and 2Cancer Research UK Renal Molecular Oncology Research Group, University of Birmingham School of Medicine, Edgbaston, Birmingham B15 2TT, UK 3Hereditary Endocrine Cancer Group, Department of Human Genetics, Centro Nacional de Investigaciones Oncologicas, and ISCIII Center for Biomedical Research on Rare Diseases (CIBERER), Madrid, Spain 4The Tumour Bank, The Children’s Hospital at Westmead, Locked Bag 4001, Westmead, New South Wales 2145, Australia 5Department of Nephrology, Albert-Ludwigs-University, Freiburg, Germany (Correspondence should be addressed to E R Maher; Email: [email protected]) Abstract The molecular genetics of inherited phaeochromocytoma have received considerable attention, but the somatic genetic and epigenetic events that characterise tumourigenesis in sporadic phaeochromocytomas are less well defined. Previously, we found considerable overlap between patterns of promoter region tumour suppressor gene (TSG) hypermethylation in two neural crest tumours, neuroblastoma and phaeochromocytoma. In order to identify candidate biomarkers and epigenetically inactivated TSGs in phaeochromocytoma and neuroblastoma, we characterised changes in gene expression in three neuroblastoma cell lines after treatment with the demethylating agent 5-azacytidine. Promoter region methylation status was then determined for 28 genes that demonstrated increased expression after demethylation. Three genes HSP47, homeobox A9 (HOXA9) and opioid binding protein (OPCML) were methylated in O10% of phaeochromocytomas (52, 17 and 12% respectively).
    [Show full text]
  • Human OBCAM/OPCML Antibody
    Human OBCAM/OPCML Antibody Monoclonal Mouse IgG1 Clone # 341723 Catalog Number: MAB27771 DESCRIPTION Species Reactivity Human Specificity Detects human OBCAM on direct ELISAs and Western blots. In direct ELISAs and Western blots, this antibody does not cross­react with recombinant human (rh) ALCAM, rhBCAM, rhEpCAM, rhNCAM, recombinant mouse (rm) MAdCAM, rmOCAM, or rmNCAM­L1. Source Monoclonal Mouse IgG1 Clone # 341723 Purification Protein A or G purified from hybridoma culture supernatant Immunogen Mouse myeloma cell line NS0­derived recombinant human OBCAM Gly28­Asn322 Accession # Q14982 Formulation Lyophilized from a 0.2 μm filtered solution in PBS with Trehalose. See Certificate of Analysis for details. *Small pack size (­SP) is supplied as a 0.2 μm filtered solution in PBS. APPLICATIONS Please Note: Optimal dilutions should be determined by each laboratory for each application. General Protocols are available in the Technical Information section on our website. Recommended Sample Concentration Western Blot 1 µg/mL Recombinant Human OBCAM (Catalog # 2777­CM) PREPARATION AND STORAGE Reconstitution Reconstitute at 0.5 mg/mL in sterile PBS. Shipping The product is shipped at ambient temperature. Upon receipt, store it immediately at the temperature recommended below. *Small pack size (­SP) is shipped with polar packs. Upon receipt, store it immediately at ­20 to ­70 °C Stability & Storage Use a manual defrost freezer and avoid repeated freeze­thaw cycles. l 12 months from date of receipt, ­20 to ­70 °C as supplied. l 1 month, 2 to 8 °C under sterile conditions after reconstitution. l 6 months, ­20 to ­70 °C under sterile conditions after reconstitution. BACKGROUND OBCAM (Opioid­binding cell adhesion molecule, also known as OPCML) is a member of the IgLON family of cell adhesion molecules.
    [Show full text]
  • Gene Network Effects on Brain Microstructure and Intellectual Performance Identified in 472 Twins
    8732 • The Journal of Neuroscience, June 20, 2012 • 32(25):8732–8745 Behavioral/Systems/Cognitive Gene Network Effects on Brain Microstructure and Intellectual Performance Identified in 472 Twins Ming-Chang Chiang,1,2 Marina Barysheva,2 Katie L. McMahon,3 Greig I. de Zubicaray,4 Kori Johnson,3 Grant W. Montgomery,5 Nicholas G. Martin,5 Arthur W. Toga,2 Margaret J. Wright,5 Paul Shapshak,6 and Paul M. Thompson2 1Department of Biomedical Engineering, National Yang-Ming University, Taipei, 112, Taiwan, 2Laboratory of Neuro Imaging, Department of Neurology, University of California, Los Angeles School of Medicine, Los Angeles, California 90095-7334, 3Centre for Advanced Imaging and 4School of Psychology, University of Queensland, Brisbane, St. Lucia, Queensland 407, Australia, 5Queensland Institute of Medical Research, Brisbane, Queensland 4029, Australia, and 6Division of Infectious Disease and International Medicine, Department of Medicine and Department of Psychiatry and Behavioral Medicine, University of South Florida Morsani College of Medicine, Tampa General Hospital, Tampa, Florida 33606 A major challenge in neuroscience is finding which genes affect brain integrity, connectivity, and intellectual function. Discovering influential genes holds vast promise for neuroscience, but typical genome-wide searches assess approximately one million genetic variants one-by-one, leading to intractable false positive rates, even with vast samples of subjects. Even more intractable is the question of which genes interact and how they work together to affect brain connectivity. Here, we report a novel approach that discovers which genes contribute to brain wiring and fiber integrity at all pairs of points in a brain scan. We studied genetic correlations between thousands of points in human brain images from 472 twins and their nontwin siblings (mean age: 23.7 Ϯ 2.1 SD years; 193 male/279 female).Wecombinedclusteringwithgenome-widescanningtofindbrainsystemswithcommongeneticdetermination.Wethenfiltered the image in a new way to boost power to find causal genes.
    [Show full text]
  • Single Cell Analysis of the Effects of Developmental Lead (Pb) Exposure on the Hippocampus
    bioRxiv preprint doi: https://doi.org/10.1101/860403; this version posted November 29, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Title Single cell analysis of the effects of developmental lead (Pb) exposure on the hippocampus. Authors Kelly M. Bakulski1*, John F. Dou1, Robert C. Thompson2, Christopher Lee1, Lauren Y. Middleton1, Bambarendage P. U. Perera1, Sean P. Ferris2, Tamara R. Jones1, Kari Neier1, Xiang Zhou1, Maureen A. Sartor1,2, Saher S. Hammoud2, Dana C. Dolinoy1, Justin A. Colacino1 Affiliations 1School of Public Health, University of Michigan, Ann Arbor, MI, USA 2Medical School, University of Michigan, Ann Arbor, MI, USA *Corresponding author Acknowledgements The mouse exposure study was supported by the NIEHS TaRGET II Consortium award to the University of Michigan (U01 ES026697). The sequencing experiment was supported by the NIEHS Michigan Center on Lifestage Environmental Exposures and Disease (M-LEEaD; P30 ES017885). Mr. Dou and Dr. Bakulski were supported by NIH grants (R01 ES025531, R01 ES025574, R01 AG055406, R01 MD013299). Dr. Colacino was supported by NIEHS (R01 ES028802). Dr. Perera was supported by NIEHS (T32 ES007062) and Dr. Neier was supported NIEHS (T32 ES007062) and by NICHD (T32 HD079342). 1 bioRxiv preprint doi: https://doi.org/10.1101/860403; this version posted November 29, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Pathway and Network Analysis for Mrna and Protein Profiling Data
    Pathway and network analysis for mRNA and protein profiling data Bing Zhang, Ph.D. Professor of Molecular and Human Genetics Lester & Sue Smith Breast Center Baylor College of Medicine [email protected] VU workshop, 2016 Gene expression DNA Transcription Transcriptome Transcriptome RNA mRNA decay profiling Translation Proteome Protein Proteome Protein degradation profiling Phenotype Networks VU workshop, 2016 Overall workflow of gene expression studies Biological question Experimental design Microarray RNA-Seq Shotgun proteomics Image analysis Reads mapping Peptide/protein ID Signal intensities Read counts Spectral counts; Intensities Data Analysis Experimental Hypothesis validation VU workshop, 2016 Data matrix Samples probe_set_id HNE0_1 HNE0_2 HNE0_3 HNE60_1 HNE60_2 HNE60_3 1007_s_at 8.6888 8.5025 8.5471 8.5412 8.5624 8.3073 1053_at 9.1558 9.1835 9.4294 9.2111 9.1204 9.2494 117_at 7.0700 7.0034 6.9047 9.0414 8.6382 9.2663 121_at 9.7174 9.7440 9.6120 9.7581 9.7422 9.7345 1255_g_at 4.2801 4.4669 4.2360 4.3700 4.4573 4.2979 1294_at 6.3556 6.2381 6.2053 6.4290 6.5074 6.2771 Genes 1316_at 6.5759 6.5330 6.4709 6.6636 6.6438 6.4688 1320_at 6.5497 6.5388 6.5410 6.6605 6.5987 6.7236 1405_i_at 4.3260 4.4640 4.1438 4.3462 4.3876 4.6849 1431_at 5.2191 5.2070 5.2657 5.2823 5.2522 5.1808 1438_at 7.0155 6.9359 6.9241 7.0248 7.0142 7.0971 1487_at 8.6361 8.4879 8.4498 8.4470 8.5311 8.4225 1494_f_at 7.3296 7.3901 7.0886 7.2648 7.6058 7.2949 1552256_a_at 10.6245 10.5235 10.6522 10.4205 10.2344 10.3144 1552257_a_at 10.3224 10.1749 10.1992 10.2464 10.2191
    [Show full text]
  • Inactivating Mutations and X-Ray Crystal Structure of the Tumor Suppressor OPCML Reveal Cancer-Associated Functions
    ARTICLE https://doi.org/10.1038/s41467-019-10966-8 OPEN Inactivating mutations and X-ray crystal structure of the tumor suppressor OPCML reveal cancer-associated functions James R. Birtley1,6,7, Mohammad Alomary2,7, Elisa Zanini2, Jane Antony 2, Zachary Maben1, Grant C. Weaver 1, Claudia Von Arx2, Manuela Mura2, Aline T. Marinho2, Haonan Lu 2, Eloise V.N. Morecroft2,3, Evdoxia Karali2, Naomi E. Chayen 4, Edward W. Tate 3, Mollie Jurewicz1, Lawrence J. Stern 1,8, Chiara Recchi 2,8 & Hani Gabra 2,5,8 1234567890():,; OPCML, a tumor suppressor gene, is frequently silenced epigenetically in ovarian and other cancers. Here we report, by analysis of databases of tumor sequences, the observation of OPCML somatic missense mutations from various tumor types and the impact of these mutations on OPCML function, by solving the X-ray crystal structure of this glycoprotein to 2.65 Å resolution. OPCML consists of an extended arrangement of three immunoglobulin-like domains and homodimerizes via a network of contacts between membrane-distal domains. We report the generation of a panel of OPCML variants with representative clinical mutations and demonstrate clear phenotypic effects in vitro and in vivo including changes to anchorage- independent growth, interaction with activated cognate receptor tyrosine kinases, cellular migration, invasion in vitro and tumor growth in vivo. Our results suggest that clinically occurring somatic missense mutations in OPCML have the potential to contribute to tumorigenesis in a variety of cancers. 1 Department of Pathology, University of Massachusetts Medical School, Worcester, MA 01655, USA. 2 Ovarian Cancer Action Research Centre, Department of Surgery and Cancer, Imperial College London, Du Cane Road, London W12 0NN, UK.
    [Show full text]