bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 TITLE 2 Translational adaptation to heat stress is mediated by 5-methylcytosine RNA modification in 3 Caenorhabditis elegans 4 5 AUTHORS 6 Isabela Cunha Navarro1,2, Francesca Tuorto3,4,5, David Jordan1,2, Carine Legrand3, Jonathan 7 Price1,2, Fabian Braukmann1,2, Alan Hendrick6, Alper Akay1,2,7, Annika Kotter8, Mark Helm8, 8 Frank Lyko3, Eric A. Miska1,2,9* 9 10 AFFILIATION 11 1. Gurdon Institute, University of Cambridge, Cambridge, CB2 1QN, UK 12 2. Department of Genetics, University of Cambridge, Cambridge, CB2 3EH, UK 13 3. Division of Epigenetics, DKFZ-ZMBH Alliance, German Cancer Research Centre, 14 Heidelberg, Germany 15 4. Division of Biochemistry, Mannheim Institute for Innate Immunoscience (MI3), Medical 16 Faculty Mannheim, Heidelberg University, Mannheim, Germany 17 5. Center for Molecular Biology of Heidelberg University (ZMBH), DKFZ-ZMBH 18 Alliance, Heidelberg, Germany 19 6. Storm Therapeutics Limited, Moneta Building, Babraham Research Campus, Cambridge, 20 CB22 3AT, UK 21 7. School of Biological Sciences, University of East Anglia, Norwich, NR4 7TJ, UK 22 8. Institute of Pharmacy and Biochemistry, Johannes Gutenberg-University Mainz, 55128 23 Mainz, Germany 24 9. Wellcome Sanger Institute, Wellcome Genome Campus, Cambridge, CB10 1SA, UK 25 26 27 *To whom correspondence should be addressed: [email protected] 28 29 30 31 32 33 34 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

35 ABSTRACT 36 Methylation of carbon-5 of cytosines (m5C) is a post-transcriptional nucleotide modification 37 of RNA found in all kingdoms of life. While individual m5C-methyltransferases have been 38 studied, the impact of the global cytosine-5 methylome on development, homeostasis and stress 39 remains unknown. Here, using Caenorhabditis elegans, we generated the first organism devoid 40 of m5C in RNA, demonstrating that this modification is non-essential. We determined the 41 localisation and enzymatic specificity of m5C sites in RNA in vivo and showed that animals 42 devoid of m5C are sensitive to temperature stress. At the molecular level, we showed that loss 43 of m5C specifically impacts decoding of leucine and proline thus reducing the translation 44 efficiency of transcripts enriched in these amino acids. Finally, we found translation of leucine 45 UUG codons to be the most strongly affected upon heat shock, suggesting a role of m5C tRNA 46 wobble methylation in the adaptation to heat stress. 47 48 49 INTRODUCTION

50 First described in 1958 (Amos & Korn, 1958), the methylation of carbon-5 of cytosines (m5C) 51 in RNAs is now known to be a conserved modification in biological systems. m5C has been 52 detected in tRNAs, rRNAs, mRNAs and non-coding RNAs, and is catalyzed by m5C RNA- 53 methyltransferases that are encoded in genomes from bacteria to humans (Boccaletto et al., 54 2017). In humans, m5C formation in RNA is catalysed by the tRNA aspartic acid MTase 1 55 (TRDMT1), also referred as DNMT2, as well as by members of the NOP2/Sun domain family 56 of proteins, which contains seven members (NSUN1-7) (reviewed in (García-Vílchez, Sevilla, 57 & Blanco, 2019). 58 59 In the last few years m5C has been implicated in a variety of molecular roles, according 60 to its presence in different RNA classes. Reports published thus far showed that m5C 61 methylation of tRNAs is catalyzed by NSUN2, NSUN3, NSUN6 and DNMT2. NSUN2 62 mediates the methylation of positions C48-50 in several cytoplasmic tRNAs and position C34 63 of tRNA Leu-CAA (Blanco et al., 2014; Brzezicha et al., 2006; Khoddami & Cairns, 2013; 64 Martinez et al., 2012; Motorin & Grosjean, 1999; Squires et al., 2012; Tuorto et al., 2012). 65 Additionally, a recent report has demonstrated that NSUN2 is imported into the matrix of 66 mammalian mitochondria, where it catalyses m5C methylation of positions 48-50 in several 67 mitochondrial tRNAs (Van Haute et al., 2019). Loss of NSUN2-mediated tRNA methylation bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

68 has been shown to promote cleavage by angiogenin and accumulation of tRNA fragments that 69 interfere with the translation machinery (Blanco et al., 2016, 2014; Flores et al., 2016). Despite 70 using a DNA methyltransferase-like catalytic mechanism (Jurkowski et al., 2008), DNMT2 71 possesses targeting specificity towards position C38 of tRNAs Asp, Gly and Val (Goll et al., 72 2006; Schaefer et al., 2010). Similarly to NSUN2, DNMT2-mediated methylation was found 73 important for protection of tRNAs from stress-induced cleavage in Drosophila and mice 74 (Schaefer et al., 2010; Tuorto et al., 2015). At the translational level, it has been shown to 75 facilitate charging of tRNA Asp and discrimination between Asp and Glu near-cognate codons, 76 thus controlling the synthesis of Asp-rich sequences and promoting translational fidelity 77 (Shanmugam et al., 2015; Tuorto et al., 2015). The m5C methyltransferase NSUN3 methylates 78 exclusively mitochondrial tRNA Met-CAU at the wobble position (C34). This position is 79 further modified into f5C by the dioxygenase ALKBH1 (Haag et al., 2016; Nakano et al., 2016; 80 Van Haute et al., 2016), and facilitates the recognition of AUA and AUG codons as methionine 81 in the mitochondria (Takemoto et al., 2009). Lack of tRNA Met-CAU C34 modification has 82 been shown to affect mitochondrial translation rates in human fibroblasts (Van Haute et al., 83 2016). NSUN6 shows targeting specificity towards position C72 at the 3′-end of the acceptor 84 stem of tRNAs Cys and Thr (Haag et al., 2015). Functionally, m5C methylation at position 72 85 was shown to promote a slight enhancement of thermal stability in tRNAs (J. Li et al., 2018). 86 87 m5C methylation in rRNA is mediated by NSUN1, NSUN4 and NSUN5. NSUN1 (yeast 88 nop2) methylates C2870 in yeast 25S rRNA. While NSUN1 is an essential gene in all 89 organisms studied thus far, reports focusing on the yeast homologue provided contradictory 90 results regarding the phenotypes observed in organisms lacking its catalytic activity (Bourgeois 91 et al., 2015; Sharma, Yang, Watzinger, Kötter, & Entian, 2013). A similar phenomenon has 92 been observed for NSUN4, a mitochondrial rRNA m5C methyltransferase with targeting 93 capability towards C911 of 12S mt-rRNA in mice (Cámara et al., 2011; Metodiev et al., 2014; 94 Spåhr, Habermann, Gustafsson, Larsson, & Hallberg, 2012; Yakubovskaya et al., 2012). 95 NSUN4 acts in complex with MTERF4 for assembly of small and large mitochondrial 96 ribosome subunits, however m5C catalysis occurs in an MTERF4-independent manner and 97 does not seem to be essential (Metodiev et al., 2014). NSUN5 has been shown to methylate 98 position C2278 in yeast 25S rRNA (Schosserer et al., 2015; Sharma et al., 2013). Loss of 99 NSUN5-mediated methylation induces conformational changes in the ribosome and 100 modulation of translational fidelity, favouring the recruitment of stress-responsive mRNAs into 101 polysomes and promoting lifespan enhancement in yeast, flies and nematodes (Schosserer et bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

102 al., 2015). In mice, Nsun5 knockout causes reduced body weight and reduced protein synthesis 103 in several tissues (Heissenberger et al., 2019). Finally, NSUN7 has been shown to methylate 104 eRNAs associated to targets of the metabolic activator PGC-1α, enhancing eRNA stability and 105 upregulating PGC-1α target genes (Aguilo et al., 2016). 106 107 Several methods have been used to investigate the presence of m5C in coding 108 transcripts. However, a general consensus on the abundance, distribution and relevance of this 109 mark in mRNAs has not yet been achieved, as the number of putative mRNA m5C sites varies 110 up to 1,000-fold between studies (David et al., 2017; Huang, Chen, Liu, Gu, & Zhang, 2019; 111 Legrand et al., 2017; Q. Li et al., 2017; Squires et al., 2012; Tang et al., 2015; Yang et al., 112 2017; Zhang et al., 2012). Recently, further mechanistic insights into potential functions of 113 m5C in coding transcripts have been proposed through the identification of the reader proteins 114 ALYREF and YBX1. These proteins have been shown to bind m5C sites in mRNAs to 115 modulate nuclear-cytoplasm transport and mRNA stability, respectively (Chen et al., 2019; 116 Yang et al., 2017). Pathogenic mutations in humans have been mapped to genes involved in 117 the m5C pathway, indicative of the relevance of studying the basic molecular features behind 118 this modification (Abbasi-Moheb et al., 2012; Haag et al., 2016; Khan et al., 2012; 119 Khosronezhad, Golam, & Jorsarayi, 2015; Khosronezhad, Hosseinzadeh Colagar, & 120 Mortazavi, 2015; Komara, Al-Shamsi, Ben-Salem, Ali, & Al-Gazali, 2015; Martinez et al., 121 2012; Nakano et al., 2016; Ren, Zhong, Ding, Chen, & Jing, 2015; Van Haute et al., 2016). 122 Although previous studies have explored the roles of m5C methyltransferases individually, 123 none of them has focused on establishing a simultaneous systematic description of these 124 enzymes, of their specificity, or of their potential molecular and genetic interactions, in any 125 organism. While it is clear that m5C can exert distinct roles in a wide variety of molecular 126 contexts, it remains unclear how the m5C methylome acts as a whole to sustain development. 127 Here we used Caenorhabditis elegans as a model to study the genetic requirements and 128 molecular functions of the m5C pathway in a whole organism. We produced the first animal 129 strain devoid of detectable levels of this modification and used this genetic tool to determine 130 the localisation of m5C sites and their impact on physiology and stress. 131 132 133 RESULTS 134 135 m5C and its derivatives are non-essential RNA modifications in C. elegans bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

136 To identify potential m5C RNA methyltransferases in C. elegans, we performed a BLAST 137 analysis and found that the open reading frames W07E6.1, Y48G8AL.5, Y39G10AR.21 and 138 Y53F4B.4 are putative homologues of the human genes NSUN1, NSUN2, NSUN4 and 139 NSUN5, respectively (Figure 1A). Knockdown of these genes through RNAi by feeding 140 revealed that nsun-1 is an essential gene, as 100% of the animals that had this gene silenced 141 from the first larval stage developed into sterile adults (Supplementary Figure 1A-B). We 142 could not find homologous genes of of NSUN3, NSUN6, NSUN7 or DNMT2. m5C RNA 143 methyltransferases utilise two conserved cysteine residues for the methyl group transfer, one 144 of which (TC-Cys) is required for the covalent adduct formation, and the other (PC-Cys) for 145 the release of the substrate following m5C catalysis (King & Redman, 2002). Using CRISPR- 146 Cas9, we introduced mutations converting the TC-Cys into alanine in nsun-1 (mj473), nsun-2 147 (mj458) and nsun-4 (mj457). These mutants, as well as a previously reported knockout mutant 148 of nsun-5 (tm3898), are viable and produce viable progeny, suggesting that the individual 149 activity of m5C methyltransferases is not essential for the viability of C. elegans (Figure 1B, 150 Supplementary Figure 1C-D). In addition, these results suggest that the essential role played 151 by NSUN-1 in fertility (Supplementary Figure 1A-B) relies on non-catalytic functions of this 152 protein. 153 154 To investigate epistatic interactions among nsun genes in C. elegans, we performed 155 genetic crosses between the individual mutants, and produced a quadruple mutant in which all 156 nsun genes are predicted to be inactive. This strain was viable and fertile, and was termed 157 noNSUN. To confirm whether the introduced mutations resulted in catalytic inactivation, and 158 to rule out the existence of additional unknown m5C RNA methyltransferases, we performed 159 mass spectrometry analyses in total RNA from the mutant strains, and confirmed that m5C is 160 no longer detectable in this genetic background (Figure 1C; lower limit of detection 316 161 pg/ml). We additionally quantified the m5C metabolic derivative 2′-O-methyl-5- 162 hydroxymethylcytosine (hm5Cm) and found that this modification is not present either in nsun- 163 2 or noNSUN mutants (Figure 1D). We therefore conclude that m5C and its derivatives are not 164 essential for C. elegans viability under laboratory conditions. Furthermore, we showed that 165 NSUN-2 is the main source of m5C (88% of total levels), and that hm5Cm sites exclusively 166 derive from NSUN-2 targets in C. elegans. 167 168 It has been proposed that some RNA modifications may act in a combinatorial manner, 169 providing compensatory effects to each other (Hopper & Phizicky, 2003). This prompted us to bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

170 investigate whether complete loss of m5C would significantly interfere with the levels of other 171 RNA modifications. We performed a mass spectrometry analysis to quantify 15 different 172 modifications in total RNA and found no significant differences between wild type and 173 noNSUN samples (Figure 1E). While we acknowledge the sensitivity limitations of such a 174 measurement performed in total RNA, taken together, the undetectable levels of m5C and lack 175 of obvious changes to other modifications analysed establish the noNSUN strain as a highly 176 specific genetic tool for the study of m5C distribution and function in vivo. 177 178 The m5C methylome of C. elegans 179 Schosserer et al. demonstrated that position C2381 of 26S rRNA is methylated at carbon-5 by 180 NSUN-5 in C. elegans, being involved in lifespan modulation (Schosserer et al., 2015). 181 Nevertheless, the m5C methylome of this organism remained to be determined. We therefore 182 used the noNSUN strain as a negative control for whole-transcriptome bisulfite sequencing 183 (WTBS) analysis (Legrand et al., 2017), aiming to determine the localisation of m5C sites in 184 C. elegans RNA at single nucleotide resolution. 185 186 We identified C5 methylation at positions C2982 and C2381 of 26S cytoplasmic rRNA 187 and positions C628 and C632 of 18S mitochondrial rRNA (Figure 2A). Using alignment to 188 rRNA of different organisms we found that position C2982 is a conserved NSUN1 target 189 (Sharma et al., 2013), while C2381, as previously reported, is a conserved NSUN5 target 190 (Schosserer et al., 2015; Sharma et al., 2013). We further confirmed the specificity of these 191 sites using a targeted bisulfite sequencing (BS-seq) approach in individual mutants 192 (Supplementary Figure 2A, B). Interestingly, other groups had previously identified adjacent 193 modified sites in mt-rRNA in mice, however the methylation of only one of the positions was 194 shown to be dependent on NSUN4 activity, while the other was interpreted as a 4- 195 methylcytosine site (Metodiev et al., 2014). In the case of C. elegans, both positions are NSUN- 196 dependent (Figure 2A). In addition, we could not detect m4C in wild type C. elegans total 197 RNA by mass spectrometry, suggesting the occurrence of m5C in both positions in this 198 organism (data not shown). 199 200 We found 40 positions to be methylated in stoichiometry higher than 50% in tRNAs, 201 the majority of which being detected in leucine and proline isoacceptors (Figure 2B-C). As 202 anticipated for NSUN2 targeting, modified positions are found in the variable loop region 203 (positions 48, 49, 50), with cytoplasmic tRNA Leu-CAA carrying an additional modification bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

204 at the wobble position (C34) (Blanco et al., 2014; Burgess, David, & Searle, 2015). Using 205 targeted BS-seq, we demonstrated that NSUN-2 is indeed responsible for both C34 and C48 206 methylation in tRNA-Leu (Supplementary Figure 2C). Surprisingly, we detected a position 207 showing very high non-conversion ratio in an NSUN-independent manner (Figure 2B). In this 208 case, the sequenced reads are identical to a 3′-fragment of tRNA Leu-CAA-2-1, apart from a 209 C-T single nucleotide polymorphism. We predict that converted reads (bearing a T) would 210 align to tRNA Leu-CAA-1-1, while non-converted (bearing a C) would align to tRNA Leu- 211 CAA-2-1. Therefore, we treated this position as a probable alignment artefact. 212 213 Contrasting with what was observed for tRNAs and rRNAs, methylation of mRNAs in 214 C. elegans is rare and in much lower stoichiometry. Lowering the non-conversion threshold 215 from 50% to 25-40%, we detected 188 positions that remained unconverted after bisulfite 216 treatment exclusively in wild type samples, i.e. putative m5C sites (Figure 2D, x axis). Using 217 the same thresholds to probe for likely artefacts revealed 88 positions that remained 218 unconverted exclusively in noNSUN samples, i.e. non-conversion was only 46% less frequent 219 (Figure 2D, y axis). It is also noteworthy that positions remaining reproducibly highly 220 unconverted equally in wild type and noNSUN samples are more frequent in mRNAs, when 221 compared to tRNAs and rRNAs (Figure 2A-B, D). In summary, we found no evidence of a 222 widespread distribution of m5C in coding transcripts. While our data does not completely rule 223 out the existence of m5C methylation in mRNAs, it certainly demonstrates that this mark cannot 224 be detected in high stoichiometry in C. elegans, as observed in tRNAs and rRNAs. 225 226 Finally, we attempted to identify m5C sites in small RNAs in our dataset. Given that 227 the fractionation used in this protocol aimed to enrich for tRNAs (60-80 nt), we could not detect 228 microRNA reads in abundance for confident analysis. Nevertheless, we found high NSUN- 229 dependent non-conversion rates (>80%) in five non-coding RNAs (approximately 60 nt long) 230 previously identified in C. elegans (Lu et al., 2011; Xiao et al., 2012). Secondary structure 231 predictions suggest that the methylated sites are often present in a “hinge-like” context, or on 232 the base of a stem-loop (Supplementary Figure 3). Further experiments will be required to 233 determine the functionality of these m5C sites. 234 235 NSUN-4 is a multisite-specific tRNA/rRNA-methyltransferase in the mitochondria of C. 236 elegans bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

237 Interestingly, we also found the mitochondrial tRNA Met-CAU to be methylated at a very high 238 rate (94.7%) (Figure 3A). Supporting our findings, previous articles also indicated the 239 detection of this modified site in Ascaris suum and C. elegans (Nakano et al., 2016; Watanabe 240 et al., 1994). This was unexpected, as previous reports have shown that this position is 241 methylated by NSUN3 (Haag et al., 2016; Nakano et al., 2016; Van Haute et al., 2016). As C. 242 elegans does not have an NSUN3 homologue, this implies that mitochondrial tRNAs can be 243 modified by alternative enzymes. 244 245 A BLAST analysis of the human NSUN3 methyltransferase domain against the C. 246 elegans proteome showed higher similarity to NSUN-4 (29.93% identity), followed by NSUN- 247 2 (26.13% identity) (data not shown). Moreover, we observed that, among human NSUN 248 genes, NSUN3 and NSUN4 share the highest percentage of similarity (Figure 3B). Using a 249 targeted BS-seq approach, we probed the methylation status of position C34 in mitochondrial 250 tRNA Met-CAU from wild type, nsun-2 and nsun-4 strains. Our results indicate that NSUN-4 251 is responsible for the catalysis of m5C in this position in C. elegans (Figure 3C). 252 253 NSUN-4 is the only mitochondrial rRNA m5C methyltransferase identified to date. To 254 confirm that the previously reported role of NSUN4 is also conserved in C. elegans, we 255 performed targeted BS-seq in 18S mitochondrial rRNA, and found that methylation of 256 positions C628 and C632, as well as C631, is mediated by NSUN-4 (Figure 3D). Notably, 257 methylation of position C631 was also detected by WTBS, however in reduced stoichiometry 258 (23.5% in wild type vs. 0.04% in noNSUN). Taken together, our results show that NSUN-4 is 259 a multisite-specific tRNA/rRNA mitochondrial methyltransferase in nematodes. 260 261 Loss of m5C leads to temperature-sensitive developmental and reproductive phenotypes 262 The individual or collective introduction of mutations in nsun genes failed to induce noticeable 263 gross abnormal phenotypes. We therefore performed a more extensive characterisation of the 264 mutant strains using a live imaging-based phenotypic analysis (Akay et al., 2019). As a proxy 265 for reduced fitness, we chose to analyse the number of viable progeny and occurrence of 266 developmental delay (growth rate, as measured by body length). 267 In comparison to wild type animals, we observed a reduction in body length in all mutant 268 strains, which persists throughout development and into adulthood. This difference is greater 269 in noNSUN animals, especially as this strain transitions from L4 stage to young adulthood bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

270 (Figure 4A). In addition, the noNSUN strain showed a 25% reduction in brood size, which is 271 comparable to what is observed in nsun-1 and nsun-5 individual mutants (Figure 4B). 272 273 C. elegans stocks can be well maintained between 16 °C and 25 °C, being most 274 typically kept at 20 °C. To gain insights into how the loss of m5C impacts development under 275 different environmental conditions, wild type and noNSUN animals were cultured at 25 °C for 276 three generations and subjected to automated measurements. As shown in Figure 4C, the 277 reproductive phenotype previously observed in the noNSUN strain (Figure 4B) is significantly 278 aggravated at this temperature. More specifically, a reduction of 14% in brood size at 20 °C is 279 worsened to 62.5% at 25 °C. This suggests that the phenotypes arising from loss of m5C are 280 temperature-sensitive, pointing towards an involvement of this modification in the adaptation 281 to environmental changes. 282 283 284 Loss of m5C impacts decoding efficiency of leucine and proline codons 285 To explore the impact of temperature stress in the absence of m5C while avoiding the 286 confounding effect introduced by differences in brood size, we performed further experiments 287 using an acute heat shock treatment. To investigate whether the observed phenotypes are linked 288 to abnormalities in protein translation rates, we quantified the polysomal fraction in wild type 289 and noNSUN adult animals subject to heat shock at 27 °C for 4 hours, and found no significant 290 differences (Figure 5A). 291 292 To gain insights into transcriptional and translational differences resulting from the loss 293 of m5C, we performed transcriptomic and ribosome profiling analyses. The latter allows the 294 quantification of active translation by deep-sequencing of the mRNA fragments that are 295 protected from nuclease digestion due to the presence of ribosomes (ribosome protected 296 fragments - RPFs). RPFs showed the expected 3 nt periodicity along the coding domain 297 sequences of mRNA, with the majority of reads in frame to the CDS start site (Supplementary 298 Figure 4A and 4B). Furthermore, RNASeq and riboSeq counts of genes showed high 299 correlation, and variation in the gene counts could be attributed to the difference in samples 300 analysed (Supplementary Figure 4C, 4D and 4E). Loss of m5C did not greatly impact the 301 nature of the heat stress response, as most differentially transcribed and translated genes upon 302 heat stimulus showed agreement, or very subtle differences between wild type and noNSUN 303 strains (Supplementary Figure 5). We found that differentially transcribed genes upon loss of bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

304 m5C are mainly involved in cuticle development, while differentially translated genes are 305 enriched in components of the cuticle and ribosomes, as well as RNA-binding proteins 306 (Supplementary Figure 6). 307 308 We then evaluated genome-wide codon occupancy during translation elongation and 309 found that loss of m5C leads to increased ribosome occupancy at leucine and proline codons. 310 More specifically, upon heat shock Leu-UUG codons showed the highest ribosome density 311 observed in the noNSUN strain, suggesting that translation of this codon is slowed upon heat 312 stress in the absence of m5C (Figure 5B). Interestingly, as shown in our WTBS analysis, 313 leucine and proline are the most frequently methylated tRNA isoacceptors in C. elegans 314 (Figure 2B). In addition, tRNA Leu-CAA, responsible for decoding of UUG codons, is the 315 only cytoplasmic tRNA bearing an m5C-modified wobble position (Figure 2C). Corroborating 316 these findings, we found translation efficiency of leucine and proline-enriched genes to be 317 significantly reduced in the noNSUN strain. This effect is more pronounced in leucine-rich 318 genes and is observed in both temperatures tested, becoming more pronounced as transcripts 319 get more enriched in this amino acid (Figure 5C, Supplementary Figure 7). Finally, we found 320 that translationally affected leucine-enriched genes are mainly involved in mitochondrial 321 functions, while proline-enriched genes are involved in anatomical development (Figure 5D). 322 323 324 DISCUSSION 325 Chemical modifications of RNA occur in organisms from all kingdoms of life and are often 326 highly conserved throughout evolution, as is the case of the methylation of carbon-5 in 327 cytosines (Boccaletto et al., 2017). While this is the first report of an animal completely devoid 328 of m5C, our results add to the growing body of evidence showing that several RNA 329 modifications are individually not required for development under controlled conditions 330 ((O’Connor, Leppik, & Remme, 2018), reviewed in (Sharma & Lafontaine, 2015) and (Hopper 331 & Phizicky, 2003)). In vitro-transcribed rRNA and tRNA, i.e. non-modified, can be 332 successfully used for ribosomal assembly and reconstituted translation assays (Cload, Liu, 333 Froland, & Schultz, 1996; Green & Noller, 1999; Khaitovich, Tenson, Kloss, & Mankin, 1999; 334 Semrad & Green, 2002), suggesting that modifications are often not essential for the basic roles 335 executed by these non-coding RNAs in translation. Our results reignite a recurrent question in 336 the epitranscriptomics field: why are so many of these chemical marks extensively conserved 337 throughout evolution and, yet, organisms seem to develop normally in their absence? bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

338 Ribonucleoside modifications occur in an overwhelming diversity and, in some cases, are 339 likely to (i) exert subtle molecular effects, (ii) act in a combinatorial manner with other 340 modifications or (iii) be the result of relaxed enzymatic specificity (Jackman & Alfonzo, 2013; 341 Phizicky & Alfonzo, 2010). 342 343 Our results suggest an RNA methylation-independent essential role for NSUN-1 in 344 germline development. Overall, Nop2p/Nol1/NSUN1 has been shown to be an essential gene 345 also in yeast, mice and Arabidopsis (Burgess et al., 2015; De Beus, Brockenbrough, Hong, & 346 Aris, 1994; Kosi et al., 2015; Sharma et al., 2013). In Saccharomyces cerevisiae, temperature- 347 sensitive alleles, depletion of Nop2p, and mutations in catalytic residues, all cause defective 348 rRNA processing and lower levels of 60S ribosomal subunits, supporting the idea that these 349 molecular phenotypes are linked to reduced methylation (Hong, Brockenbrough, Wu, & Aris, 350 1997; Hong, Wu, Brockenbrough, Wu, & Aris, 2001; Sharma et al., 2013). In contrast, 351 Bourgeois et al (Bourgeois et al., 2015) reported that loss of m5C in position 2870 of helix 89 352 of 25S rRNA had no effect on ribosome synthesis, nor does it cause a phenotype. Therefore, 353 the role NSUN-1-mediated m5C sites remain to be determined. A similar phenomenon has been 354 observed in NSUN4 mutant mice and Dim1 mutant yeast, where the presence of the enzyme, 355 rather than its catalytic activity, is required for viability (26,63,64). It has been suggested that 356 the essential binding of certain rRNA methyltransferases represents a quality control step in 357 ribosome biogenesis, committing rRNA to methylation during the maturation process (D. L. 358 Lafontaine, Preiss, & Tollervey, 1998). 359 360 Taking advantage of the noNSUN strain as a tool to increase the confidence of WTBS 361 analysis, we produced the first comprehensive list of m5C sites throughout C. elegans 362 transcriptome. Using a targeted approach, we showed that NSUN-4 has both rRNA and tRNA 363 targeting capabilities in the mitochondria. It has been suggested that NSUN4 lacks an RNA 364 recognition domain and would, therefore, need a binding partner in order to achieve targeting 365 (Cámara et al., 2011). Crystal structure analyses showed that the MTERF4-NSUN4 complex 366 forms a positively charged path along the sides of MTERF4, which extends into the active site 367 of NSUN4. This structure was found likely to be responsible for targeting this 368 methyltransferase to rRNA in the mitochondria, thus providing the sequence specificity for 369 RNA binding (Spåhr et al., 2012; Yakubovskaya et al., 2012). Nevertheless, genetic evidence 370 suggests that NSUN4 methylates rRNA independently of MTERF4 in mice (Metodiev et al., 371 2014). C. elegans has a MTERF4 homologue (K11D2.5), and most residues involved in the bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

372 interaction between NSUN4 and MTERF4 are conserved or show convergent evolution, 373 suggesting that this interaction could occur in this organism (Spåhr et al., 2012). More 374 experiments will be required to clarify the mechanisms through which NSUN-4 shows 375 multisite targeting capabilities in the nematode. 376 377 In humans, NSUN3-mediated methylation at position 34 of mitochondrial tRNA Met- 378 CAU is further modified by the dioxygenase ALKBH1 to form f5C (Haag et al., 2016; Nakano 379 et al., 2016). Additional analysis, such as specific isolation of tRNA Met-CAU using DNA 380 probes, have been previously used in C. elegans RNA and successfully confirmed the presence 381 of f5C in this organism (Nakano et al., 2016). As f5C reacts as an unmodified cytosine upon 382 sodium bisulfite treatment, it was surprising to detect such high levels of non-conversion (95%) 383 in the present study. Previous studies tackling this question explored differential methods for 384 the detection of f5C, such as reduced bisulfite sequencing (RedBS-Seq), f5C chemically assisted 385 bisulfite sequencing (fCAB-Seq) and LC/MS of isolated mt-tRNA Met-CAU. Their results 386 indicate that 35-100% of tRNA Met- CAU molecules are f5C-modified, while the whole 387 population is at least m5C-modified (Haag et al., 2016; Kawarada et al., 2017; Van Haute et 388 al., 2016). As we used a sequencing-based method that does not select for precursors or mature 389 tRNAs, it is possible that our results are biased towards the detection of primary transcripts or 390 precursor molecules, which may not have been oxidised by ALKBH1 yet. 391 392 Using the noNSUN strain as a negative control and as a proxy for methylation-derived 393 non-conversion of cytosines, we investigated the presence of m5C in coding transcripts. Several 394 reports have supported the idea that m5C is a common mRNA modification (Amort et al., 2017; 395 David et al., 2017; Squires et al., 2012; Yang et al., 2017). Results derived from BS-seq can be 396 influenced by several sources of artefacts, such as incomplete deamination, protection due to 397 secondary structures, presence of other modifications, protein binding, sequencing errors, 398 among others (summarized in (Legrand et al., 2017)). Given these technical drawbacks, the 399 noNSUN strain represented an unprecedentedly stringent negative control, which allowed for 400 exclusive detection of highly specific methylation. Despite the detection of several positions 401 with 20-30% NSUN-dependent non-conversion, we detected a similar number of positions 402 with NSUN-independent non-conversion at these rates, which we interpret as false positives. 403 This poses a statistical challenge on the interpretation of such non-converted positions as 404 methylated. Our main conclusion, therefore, is that the data does not provide evidence for 405 widespread or high stoichiometry m5C methylation of coding transcripts in C. elegans. This is bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

406 in agreement with earlier work using chromatography (Adams & Cory, 1975; Desrosiers, 407 Ronald Friderici, Karen Rottman, 1974; Salditt-Georgieff et al., 1976) and other reports that 408 have detected very few or no m5C methylated sites in eukaryotes by BS-seq (Edelheit, 409 Schwartz, Mumbach, Wurtzel, & Sorek, 2013; Legrand et al., 2017). 410 411 While the absence of m5C in RNA did not give rise to overt phenotypes under standard 412 laboratory conditions, a more detailed analysis of the mutants revealed developmental and 413 fertility defects. In nature, where the environmental conditions vary greatly, such genotypes 414 might be selected against in a wild population. In fact, previous studies have shown that levels 415 of several RNA modifications, including m5C, are responsive and can react dynamically to a 416 wide range of environmental challenges, such as toxicants, starvation and heat shock, thus 417 potentially supporting organismal adaptation (C. T. Y. Chan et al., 2010; van Delft et al., 2017). 418 In agreement with this idea, we observed a temperature-dependent aggravation of reproductive 419 phenotypes in m5C-deficient C. elegans. 420 421 Despite the fact that our ribosome profiling analysis was performed in a mutant strain 422 lacking m5C in all types of RNAs, the effect observed on translational speed was strikingly 423 specific. The strongest effect was observed in UUG codons, which are dependent on the only 424 tRNA modified at the wobble position, tRNA Leu-CAA. Chan et al. (C. T. Y. Chan et al., 425 2012) found that m5C level specifically at position 34 of tRNA Leu-CAA is upregulated upon 426 oxidative stress in yeast. The presence of this modification was shown to enhance translation 427 efficiency of a UUG-rich luciferase reporter construct, as trm4Δ (NSUN2 homologue mutant) 428 cells showed significantly lower levels of reporter activity, especially under oxidative stress. 429 The biological relevance of these findings was linked to an abnormally high frequency of UUG 430 codons in transcripts of specific ribosomal protein paralogues. Our results suggest that the 431 genes potentially affected by slowed translation of leucine codons are involved in the electron 432 transport chain (Figure 5C). Interestingly, a recent report demonstrated that NSUN2 mutant 433 cells show differential expression of mitochondrial genes, and contain less-active mitochondria 434 upon stress induced by sodium arsenite treatment (Gkatza et al., 2019). 435 436 In summary, our work reveals the biology and mechanism of m5C deposition in 437 C. elegans, providing a list of high-confidence m5C sites in the nematode’s transcriptome, as 438 well as their enzymatic specificity. While this RNA modification is not essential for viability 439 under laboratory conditions, its presence is associated with increased fitness at a higher bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

440 temperature, and enhanced translational efficiency of leucine and proline codons. The most 441 pronounced effect was observed for UUG codons exclusively upon heat shock, suggesting a 442 role of m5C tRNA wobble methylation in the adaptation to heat stress (Figure 6). 443 444 445 MATERIALS AND METHODS 446 447 Genetics 448 C. elegans strains were grown and maintained as described in Brenner (Brenner, 1974). The 449 strains were kept at 20 °C, unless otherwise indicated. HB101 strain Escherichia coli was used 450 as food source (Caenorhabditis Genetics Center, University of Minnesota, Twin Cities, MN, 451 USA). Bristol N2 was used as the wild type strain. 452 453 Gene silencing by RNAi 454 Empty vector, nsun-1 (W07E6.1), nsun-2 (Y48G8AL.5), nsun-4 (Y39G10AR.21), and nsun-5 455 (Y53F4B.4) bacterial feeding clones were kindly provided by Prof. Julie Ahringer’s lab 456 (Kamath et al., 2003). Single colonies were inoculated in LB-Ampicillin 100 μg/ml and 457 cultured for 8 h at 37 °C. Bacterial cultures were seeded onto 50 mm NGM agar plates 458 containing 1 mM IPTG and 25 μg/ml Carbenicillin at a volume of 200 μl of bacterial culture 459 per plate, and left to dry for 48 hours. 50 synchronized L1 larvae were placed onto RNAi plates 460 and left to grow until adult stage. Adults were scored for fertility (presence of embryos in the 461 germline). 462 463 CRISPR-Cas9 gene editing 464 CRISPR-Cas9 gene editing was performed as in Paix et al (Paix, Folkmann, Rasoloson, & 465 Seydoux, 2015). Briefly, injection mixes were prepared in 5 mM Tris pH 7.5 as follows: 20 μg 466 of tracrRNA (Dharmacon), 3.2 μg of dpy-10 crRNA (Dharmacon), 200 ng of dpy-10 467 homologous recombination template (Sigma Aldrich), 8 μg of target gene gRNA (Dharmacon), 468 1.65 μg of homologous recombination template (Sigma), up to a volume of 11.5 μl. The mix 469 was added to 10 μg of Cas9 (Dharmacon) to a final volume of 15 μl, and incubated at 37 °C 470 for 15 min. For the creation of nsun catalytic mutants, a homologous recombination template 471 bearing a point mutation to convert the catalytic cysteine into alanine while creating a 472 restriction site for HaeIII was co-injected. Following incubation, the mix was immediately 473 micro-injected into the germline of N2 young adults. After injection, animals were left to bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

474 recover in M9 medium, then transferred to individual plates and left to recover overnight at 475 20 °C. Successful injections led to the hatch of dumpy and roller animals. From positive plates, 476 96 animals were individualized for self-fertilization and genotyped for the relevant alleles. 477 Same process was performed with F2s, until a homozygous population was isolated. Each 478 strain was backcrossed at least three times with the wild type strain. 479 480 RNA extraction (Mass spectrometry and WTBS) 481 The strains of interest (N2 and noNSUN) were grown in 90 mm plates until gravid adult stage, 482 washed three times with M9 and pelleted by centrifugation at 2000 rpm for 2 minutes. Gravid 483 adults were resuspended in 4 ml of bleaching solution (final concentration 177 mM NaOH, 177 484 mM NaOCl solution - free chlorine 4–4.99%) and vortexed vigorously for 7 minutes. 485 Recovered embryos were washed four times to remove any traces of bleach and left to hatch 486 in ml of M9 for 24 h at 20 °C in a rotating wheel. Synchronised L1 starved larvae were used 487 for RNA extraction. Independent triplicates were obtained from three different generations. 488 Nematodes were washed thoroughly in M9 to remove bacterial residue, and pelleted in RNAse- 489 free tubes at 2000 rpm for 2 min. 500-1000 μl of TRIsure (Bioline) and 100 μl of zirconia beads 490 were added and the samples were subjected to three cycles of 6,500 rpm with 20 sec breaks on 491 Precellys to crack open the animals. 100 μl of chloroform were added to the tubes, which were 492 then shaken vigorously for 15 sec and incubated at room temperature for 3 min. Samples were 493 centrifuged at 12,000 x g for 15 min at 4 °C and the aqueous phase of the mixture was carefully 494 recovered and transferred to a fresh RNAse-free tube. RNA was precipitated with 500 μl of 495 cold isopropanol at room temperature for 10 min and then centrifuged at 12,000 x g for 15 min 496 at 4 °C. The supernatant was carefully removed, the pellet was washed and vortexed with 1 ml 497 of 75% ethanol and centrifuged at 7,500 x g for 5 min at 4 °C. RNA pellet was air-dried, 498 dissolved in the appropriate volume of DEPC-treated water and the concentration, 260/280 and 499 260/230 ratios were measured by Nanodrop. RNA integrity was evaluated in the Agilent 2200 500 Tapestation system. 501 502 RNA mass spectrometry 503 Up to 10 μg of RNA was digested by adding 1 μl digestion enzyme mix per well in a digestion 504 buffer (4 mM Tris-HCl pH 8, 5 mM MgCl2, 20 mM NaCl) in a total volume of up to 100 μl. 505 The digestion enzyme mix was made by mixing benzonase (250 U/μl, Sigma Aldrich), 506 phosphodiesterase I from Crotalus adamanteus venom (10mU/μl, Sigma Aldrich) and 507 Antarctic phosphatase (5 U/μl, NEB) in a ratio of 1:10:20. The reaction was incubated bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

508 overnight at 37 °C. The following day, an equal volume of 13C, 15N-labelled uridine (internal 509 control, previously dephosphorylated; Sigma Aldrich) in 0.1% formic acid was added to each 510 reaction and this was subsequently prepared for LC-MS-MS by filtration through 30 kDa 511 molecular weight cut-o filters (Sigma). 512 Samples were resolved using a Thermo Scientific U3000 UPLC system on a gradient 513 of 2- 98% (0.1% formic acid/acetonitrile) through an Acquity 100mm x 2.1 mm C-18 HSS T3 514 column and analysed on a QExactive-HF Orbitrap High Resolution Mass Spectrometer 515 (ThermoFisher Scientific, IQLAAEGAAPFALGMBFZ) in positive full-scan mode and the 516 results were deconvoluted using the accompanying Xcalibur Software. Nucleosides of interest 517 were identified by both retention times and accurate masses, compared to purified standards 518 and quantified accordingly. 519 520 Whole Transcriptome Bisulfite Sequencing 521 Bisulfite sequencing experiments were performed as previously described in Legrand et al. 522 (Legrand et al., 2017). RNA was fractionated into <200 nt and >200 nt using a modified 523 mirVana miRNA isolation kit (AM1560) protocol. Briefly, 50 μg of RNA in a volume of 80 524 μl were mixed with 400 μl of mirVana lysis/binding buffer and 48 μl of mirVana homogenate 525 buffer and incubated for 5 min at room temperature. Next, 1/3 volume (176 μl) of 100% ethanol 526 was added and thoroughly mixed by inversion, and the mixture was incubated for 20 min at 527 room temperature. After addition of 0.8 μg of Glycoblue, the samples were spun down at 2,500 528 x g for 8 min at 21 °C for precipitation of long RNAs. The supernatant containing the short 529 fraction was transferred to a fresh tube and the RNA pellet was washed in 1 ml of cold 75% 530 ethanol before centrifugation at maximum speed for at least 20 min at 4 °C. The pellet was 531 finally air-dried and resuspended in DEPC-treated water. For short fraction RNA precipitation, 532 800 μl of isopropanol were added to the supernatant and the mixture was incubated at -80 °C 533 for at least 20 min. Next, 20 μg of Glycoblue were added and the mixture was spun down at 534 maximum speed for at least 20 min at 4 °C. The pellet was washed with cold 70% ethanol and 535 air dried before resuspension in DEPC-treated water. Depletion of ribosomal RNA was 536 performed on the short fractions and on half of the long fractions using a Ribo-zero rRNA 537 removal kit (Illumina), according to the supplier’s instructions. The other half of long fractions 538 was processed as Ribo+ samples. RNA was stored at -80 °C until the moment of use. 539 The long fractions (with and without rRNA depletion) were further processed with the 540 NEBNext Magnesium RNA Fragmentation Module (NEB), as described in the manual. 3 min 541 of fragmentation at 94 °C has been established to lead to a peak at approximately 250 nt, bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

542 appropriate for the final 100 bp paired-end sequencing. The fragmented RNA was precipitated 543 using ethanol with 20 μg GlycoBlue at -80 °C for at least 10 min. 544 Samples were treated with TURBO DNase (Ambion) in a final volume of 20 μl, 545 according to the manufacturer’s instructions. DNase-treated samples were bisulfite-converted 546 using an EZ RNA Methylation Kit (Zymo Research), following the manufacturer’s manual. As 547 a final step before library preparation, a stepwise RNA end repair was carried out using T4 548 polynucleotide kinase (TaKaRa). A 3′-dephosphorylation and 5′- phosphorylation reaction was 549 performed using T4 PNK enzyme (TaKaRa). The enzyme was removed by phenol-chloroform 550 purification. Library preparation was done using a NEBNext Small RNA Library Prep Set, 551 according to the manufacturer’s protocol. cDNA was amplified with 12 cycles of PCR and 552 purified using the QIAquick PCR Purification Kit (Qiagen). The libraries were size-selected 553 on a 6% polyacrylamide gel. Compatible barcodes were selected, and samples were pooled in 554 equimolar ratios on multiple lanes in an Illumina HiSeq 2000 platform. A 100 bp paired-end 555 sequencing approach was used. 556 Bioinformatics, statistical analyses and methylation calling were performed as 557 described in Legrand et al. (Legrand et al., 2017), utilising the BisRNA software. Adapters 558 were removed from sequenced reads using Cutadapt version 1.8.1 (with options: --error- 559 rate=0.1 --times=2 --overlap=1 and adapter sequences AGATCGGAAGAGCACACGTCT 560 and GATCGTCGGACTGTAGAACTCTGAAC for forward and reverse reads, respectively 561 (Martin, 2011). Reads were further trimmed of bases with phred quality score <30 on 5' and 3' 562 ends and reads shorter than 25 nucleotides were discarded (Trimmomatic version 0.36) 563 (Bolger, Lohse, & Usadel, 2014). Reads were aligned uniquely using Bsmap (version 2.87, 564 options: -s 12 -v 0.03 -g 0 -w 1000 -S 0 -p 1 -V 1 -I 1 -n 0 -r 2 -u -m 15 -x 1000) (Xi & Li, 565 2009). Reference sequences were downloaded from Gtrnadb (version ce10), Ensembl (release 566 90, version WBcel235) and Arb-Silva (P. P. Chan & Lowe, 2016; Kersey et al., 2016; Lee et 567 al., 2018; Quast et al., 2012). End sequence 'CCA' was appended to tRNA if missing. Bisulfite- 568 identical sequences, where only C>T point differences were present, were merged, keeping the 569 C polymorphism. Similarly to Legrand et al. (Legrand et al., 2017), tRNA sequences were 570 further summarized to the most exhaustive yet unambiguous set of sequences, using sequence 571 similarity matrix from Clustal Omega (Sievers et al., 2011). Methylation calling were 572 performed as described in Legrand et al. (Legrand et al., 2017), utilising the BisRNA software. 573 Methylation frequency was calculated as the proportion of cytosines with coverage higher than 574 10 in three wild type and noNSUN replicates and bisulfite non-conversion ratio higher than bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

575 0.1. The measure for reproducibility was the standard error. Deamination rates were calculated 576 as the count of converted cytosines divided by the sum of converted and non-converted 577 cytosines. This calculation was carried out on nuclear and mitochondrial rRNA. Known 578 methylation sites in rRNA were removed from the calculations. WTBS raw data have been 579 deposited in the Gene Expression Omnibus (GEO) database under the accession number 580 GSE144822. 581 582 Targeted bisulfite sequencing 583 1 μg of total RNA was bisulfite-modified with the EZ RNA Methylation Kit (Zymo Research). 584 Briefly, samples were first treated with DNase I for 30 min at 37 °C in 20 μl volume. The 585 DNAse reaction was stopped and immediately applied to the EZ RNA Methylation Kit (Zymo 586 Research) according to manufacturer’s instructions. Converted RNAs were eluted in 12 μl of 587 distilled water. 588 Reverse transcription was performed with the purified RNA and adaptors were added 589 to the amplicons using reverse oligonucleotides designed for the bisulfite-converted sequences 590 of interest (reverse adaptor sequence: gtctcgtgggctcggagatgtgtataagagacag) and SuperScript III 591 reverse transcriptase (Invitrogen). cDNA was cleaned from any residual RNA with an RNase 592 H treatment at 37 °C for 20 min and then used for PCR amplification and adaptor addition 593 using forward oligonucleotides (forward adaptor sequence: 594 tcgtcggcagcgtcagatgtgtataagagacag). Low annealing temperature (58 °C) was used to 595 overcome high A-T content after bisulfite treatment. 4 μl of PCR product were used for ligation 596 and transformation into TOP10 competent cells using the Zero Blunt TOPO PCR Cloning Kit 597 (Invitrogen) according to the manufacturer’s instructions. Following overnight culture, 24 598 colonies were individually lysed and used for PCR amplification using M13 primers, in order 599 to confirm the presence of the insert at the correct size by DNA electrophoresis. The remaining 600 PCR product (10 clones per condition) was used for Sanger sequencing using T3 primers 601 (Genewiz). 602 603 Automated phenotypical characterisation 604 Viable Progeny 605 Viable progeny refers to the number of progeny able to reach at least the L4 stage within ~4 606 days. Measurements were completed over three 24-h intervals. First, eggs were prepared by 607 synchronisation via coordinated egg-laying. When these animals had grown to the L4 stage, 608 single animals were transferred to fresh plate (day 0). For 3 days, each day (days 1–3), each bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

609 animal was transferred to a new plate, while the eggs were left on the old plate and allowed to 610 hatch and grow for ~ 3 days, after which, the number of animals on each of these plates was 611 counted (Hodgkin & Barnes, 1991) using a custom animal counting program utilising short 612 video recordings. Animals were agitated by tapping each plate four times, after this, 15 frames 613 were imaged at 1 Hz and the maximum projection was used as a background image. Animals 614 were then detected by movement using the difference in the image between each frame and 615 this background image and counted this way for ten additional frames. The final count was 616 returned as the mode of these counts. This system was tested on plates with fixed numbers of 617 animals and was accurate to within 5%, comparable to human precision. Total viable progeny 618 was reported then as the sum for 3 days. Data is censored for animals that crawled off of plates. 619 620 Single Worm Growth Curves 621 Populations of Caenorhabditis elegans were synchronized by coordinated egg laying. Single 622 eggs were transferred to individual wells of a multi-well NGM plate solidified with Gelrite 623 (Sigma). Each well was inoculated with 1 !" of OD 20 E. coli HB101 bacteria (~18 million) 624 and imaged periodically using a camera mounted to a computer controlled XY plotter 625 (EleksMaker, Jiangsu, China) which moved the camera between different wells. Images were 626 captured every ~11 minutes for ~75 hours. Image processing was done in real-time using 627 custom MATLAB scripts, storing both properties of objects identified as C. elegans, and sub 628 images of regions around detected objects. Body length was calculated using a custom 629 MATLAB (Mathworks, Natick MA) algorithm and all other properties were measured using 630 the regionprops function. Growth curves were aligned to egg-hatching time, which was 631 manually determined for each animal. 632 633 Polysome profiling 634 Synchronised populations of the strains of interest (N2 and noNSUN) were grown until adult 635 stage (3 days) in 140 mm NGM agar plates seeded with concentrated E. coli HB101 cultures 636 at 20 °C. Next, the animals were harvested from the plates, transferred to liquid cultures in S- 637 medium supplemented with E. coli HB101, and incubated at 20°C or 27°C for 4h in a shaking 638 incubator at 200 rpm before harvesting. Sample preparation for polysome profiling was 639 adapted from Arnold et al (Arnold et al., 2014). The animals were harvested, washed 3x in cold 640 M9 buffer supplemented with 1 mM cycloheximide and once in lysis buffer (20 mM Tris pH 641 8.5, 140 mM KCl, 1.5 mM MgCl2, 0.5% Nonidet P40, 2% PTE (polyoxyethylene-10- 642 tridecylether), 1% DOC (sodiumdeoxycholate monohydrate), 1 mM DTT, 1 mM bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

643 cycloheximide). The animals were pelleted and as much liquid as possible was removed before 644 the samples were frozen as droplets in liquid nitrogen, using a Pasteur pipette. Frozen droplets 645 were transferred to metallic capsules and cryogenically ground for 25 sec in a mixer (Retsch 646 MM 400 Mixer Mill). The resulting frozen powder was stored at -80 °C until the moment of 647 use. 648 Approximately 250 μl of frozen powder was added to 600 μl of lysis buffer and mixed 649 by gentle rotation for 5 min at 4 °C. The samples were centrifuged at 10,000 x g for 7.5 min, 650 the supernatant was transferred to fresh tubes and the RNA concentration was quantified by 651 Nanodrop. For ribosome footprinting, 400 μl of lysate was treated with 4 μl of DNase I (1 U/μl, 652 Thermo Scientific) and 8 μl of RNase I (100 U/μl, Ambion) for 45 min at room temperature 653 with gentle shaking. 20 μl of RNasin ribonuclease inhibitor (40 U/μl, Promega) was added to 654 quench the reaction when appropriate. The tubes were immediately put on ice and 220 μl of 655 lysate was loaded into 17.5 – 50% sucrose gradients and ultracentrifuged for 2.5 h at 35,000 656 rpm, 4 °C in a Beckman SW60 rotor. In parallel, undigested samples used for polysome 657 profiling were equally loaded into sucrose gradients under the same conditions. Gradient 658 fractions were eluted with an ISCO UA-6 gradient fractionator while the absorbance at 254 nm 659 was continuously monitored. The fraction of polysomes engaged in translation was calculated 660 as the area under the polysomal part of the curve divided by the area below the entire curve. 661 662 Ribosome profiling 663 Sucrose gradient fractions were collected in tubes containing 300 μl of 1 M Tris-HCl pH 7.5, 664 5M NaCl, 0.5 M EDTA, 10% SDS, 42% urea and then mixed by vortexing with 300 μl of 665 Phenol-Chloroform-Isoamylalcohol (PCL, 24:25:1). Fractions corresponding to 80S 666 monosomes were heated for 10 min at 65°C and centrifuged at 16,000 x g for 20 min at room 667 temperature. The upper aqueous phase was transferred to a fresh tube and mixed well with 668 600 μl of isopropanol and 1 μl of Glycoblue for precipitation overnight at -80 °C. RNA was 669 pelleted by centrifugation at 16,000 x g for 20 min at 4 °C and washed in 800 μl of cold ethanol. 670 After supernatant removal, the pellet was left to dry for 1-2 min and then dissolved in 60 μl of 671 RNase-free water. RNA concentration and quality were measured by Nanodrop and 672 Tapestation (2200 Agilent R6K), respectively. 673 A dephosphorylation reaction was performed by adding 7.5 μl T4 polynucleotide kinase 674 (PNK) 10x buffer, 1.5 μl ATP, 1.5 μl RNase OUT, 1.5 μl T4 PNK (TaKaRa) and 3 μl RNase- 675 free water up to a final volume of 75 μl, and incubated for 1.5 h at 37 °C. The enzyme was 676 removed by acid-phenol extraction and the RNA was precipitated with 1/10 volume 3 M bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

677 sodium acetate pH 5.2, 2.5x volume 100% cold ethanol and 1 μl Glycoblue overnight at -80 678 °C. Pelleted RNA was dissolved in RNase-free water. For footprint fragments purification, 679 RNA was denaturated for 3 min at 70 °C and loaded into a 15% polyacrylamide TBE-urea gel 680 alongside a small RNA marker. Gel was run for 1 h at 150 V and stained for 10 min with 681 1:10,000 SYBR Gold in 0.5x TBE. The gel was visualised under UV light and the region 682 between the 20 nt and 30 nt marks (28-32 nt) was excised with a sterile scalpel. The gel band 683 was crushed into small pieces and incubated in 300 μl of 0.3 M RNase-free NaCl solution with 684 2 μl of RNase OUT overnight at 4°C on an Intelli-Mixer (Elmi). The gel slurry was transferred 685 to a 0.45 μm NanoSep MF Tube (Pall Lifesciences) and centrifuged at maximum speed for 5 686 min at 4°C. After overnight precipitation with 30 μl of 3 M sodium acetate pH 5.2, 1 μl 687 Glycoblue and 800 μl 100% ethanol, the RNA was dissolved in RNase-free water. 688 Libraries were prepared using a NEB NEXT Small RNA Library Prep Set for Illumina 689 (Multiplex compatible) E7330 Kit, following the manufacturer’s instructions. cDNA libraries 690 were purified according to the manual, followed by a QIAQuick PCR Purification Kit and a 691 6% polyacrylamide gel, where a band of 150 bp (120 bp adapter + 28-32 footprint fragments) 692 was excised. Gel extraction was performed as described above for footprint fragments 693 purification. Libraries were sequenced at the Genomics and Proteomics Core Facility of the 694 German Cancer Research Centre (DKFZ), Heidelberg. 695 Raw reads were assessed for quality using FastQC and Trimmed for low quality bases 696 and adapter sequences using Trimmomatic (version 0.39, parameters - 697 ILLUMINACLIP:2:30:10 SLIDINGWINDOW:4:20 MINLEN:20) (Bolger et al., 2014). 698 SortMERNA was used to remove any rRNA sequences (Kopylova, Noé, & Touzet, 2012). 699 Remaining reads were uniquely aligned to the C. elegans (WBCel235) reference genome using 700 HISAT2 (version 2.1.0) (Kim, Langmead, & Salzberg, 2015). The longest transcript was 701 chosen for each gene from the WBCel235 reference genome and the CDS for these transcripts 702 was extracted. Reads were length stratified and checked for periodicity, only read lengths 703 showing periodicity over the 3 frames were retained for further analysis (26 bp -30 bp). Reads 704 aligned to the genome were shifted 12 bp from the 5′-end towards the 3′-end (Ingolia, 705 Ghaemmaghami, Newman, & Weissman, 2009). Any reads aligned to the first 10 codons of 706 each gene were then removed and the remaining reads with a 5′ end aligning to a CDS were 707 kept for further analysis (Lecanda et al., 2016). 708 Bulk codon occupancy in the P-Site for each codon was calculated as the number of 709 shifted RPFs assigned to the first nucleotide of the codon. This value was then normalized by 710 the frequency of the counts for the same codon in the +1, +2 and +3 codons relative to the A- bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

711 Site (Stadler & Fire, 2011). Fold changes were then computed as the normalized bulk codon 712 occupancies for noNSUN / wild type. Ribosome occupancy for gene in a sample was calculated 713 as the number of shifted in frame RPFs aligned to the CDS of the gene (not including the first 714 10 codons). These values were inputted into DESeq2 (Love, Huber, & Anders, 2014). Ribo- 715 Seq raw data have been deposited in the Gene Expression Omnibus (GEO) database under the 716 accession number GSE146256. 717 718 RNA sequencing 719 Input RNA was extracted from aliquots from the samples used for polysome profiling and 720 ribosome footprinting. 100 μl of chloroform were added to the tubes, which were then shaken 721 vigorously for 15 sec and incubated at room temperature for 3 min. Samples were centrifuged 722 at 12,000 x g for 15 min at 4 °C and the aqueous phase of the mixture was carefully recovered 723 and transferred to a fresh RNAse-free tube. RNA was precipitated with 500 μl of cold 724 isopropanol at room temperature for 10 min and then centrifuged at 12,000 x g for 15 min at 725 4 °C. The supernatant was carefully removed, the pellet was washed and vortexed with 1 ml of 726 75% ethanol and centrifuged at 7,500 x g for 5 min at 4°C. RNA pellet was air-dried, dissolved 727 in the appropriate volume of DEPC-treated water and the concentration, 260/280 and 260/230 728 ratios were measured by Nanodrop. RNA integrity was evaluated in the Agilent 2200 729 Tapestation system. RNA was depleted of DNA with a TURBO DNA-free kit (Invitrogen), 730 according to the manufacturer’s instructions. Libraries were prepared with 750 ng of starting 731 material using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina, following 732 rRNA depletion using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB). 733 Raw reads were assessed for quality using FastQC (Andrews, 2010) and Trimmed for 734 low quality bases and adapter sequences using Trimmomatic (version 0.39, parameters - 735 ILLUMINACLIP:2:30:10 SLIDINGWINDOW:4:20 MINLEN:25) (Bolger et al., 2014). 736 SortMERNA (Kopylova et al., 2012) was used to remove any reads matching rRNA sequences. 737 Remaining reads were aligned to the C. elegans reference genome (WBCel235) using HISAT2 738 (version 2.1.0, default parameters) (Kim et al., 2015). Read alignments were then counted using 739 HTSeq-count (Anders, Pyl, & Huber, 2015) and gene counts inputted into DESeq2 (Love et 740 al., 2014). RNA-Seq raw data have been deposited in the Gene Expression Omnibus (GEO) 741 database under the accession number GSE146256. 742 743 ACKNOWLEDGEMENTS bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

744 We would like to thank the Gurdon Institute Media Kitchen for their support providing reagents 745 and media. We thank Kay Harnish for his support managing the Gurdon Institute Sequencing 746 Facility. We thank Julie Ahringer’s lab for kindly sharing RNAi bacterial clones. We thank the 747 National Bioresource Project (Tokyo, Japan) for providing the nsun-5 deletion allele. We thank 748 Claudia Flandoli for illustrating our working model. We are grateful for the Miska Laboratory 749 members, especially Kin Man Suen, Eyal Maori and Grégoire Vernaz, for helpful discussions 750 and advice, and Marc Ridyard for laboratory management and maintenance of our nematode 751 collection. 752 753 FUNDING DISCLOSURE 754 This work was funded by grants from Cancer Research UK (C13474/A18583, C6946/A14492) 755 and the Wellcome Trust (104640/Z/14/Z, 092096/Z/10/Z) to E.A.M; Conselho Nacional de 756 Desenvolvimento Científico e Tecnológico (CNPq, Brazil) doctorate scholarship 757 (205589/2014-6) to I.C.N.; Deutsche Forschungsgemeinschaft (SPP1784) to F.L. The funders 758 had no role in study design, data collection and analysis, decision to publish, or preparation of 759 the manuscript. 760 761 COMPETING INTERESTS 762 E.A.M. is a co-founder and director of Storm Therapeutics, Cambridge, UK. A.H. is an 763 employee of Storm Therapeutics, Cambridge, UK. 764 765 REFERENCES 766 767 Abbasi-Moheb, L., Mertel, S., Gonsior, M., Nouri-Vahid, L., Kahrizi, K., Cirak, S., … Kuss, 768 A. W. (2012). Mutations in NSUN2 cause autosomal- Recessive intellectual disability. 769 American Journal of Human Genetics, 90(5), 847–855. 770 https://doi.org/10.1016/j.ajhg.2012.03.021 771 Adams, J. M., & Cory, S. (1975). Modified nucleosides and bizarre 5′-termini in mouse 772 myeloma mRNA. Nature, 255(5503), 28–33. https://doi.org/10.1038/255028a0 773 Aguilo, F., Li, S. De, Balasubramaniyan, N., Sancho, A., Benko, S., Zhang, F., … Walsh, M. 774 J. (2016). Deposition of 5-Methylcytosine on Enhancer RNAs Enables the Coactivator 775 Function of PGC-1α. Cell Reports, 14(3), 479–492. 776 https://doi.org/10.1016/j.celrep.2015.12.043 777 Akay, A., Jordan, D., Navarro, I. C., Wrzesinski, T., Ponting, C. P., Miska, E. A., & Haerty, bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

778 W. (2019). Identification of functional long non-coding RNAs in C. elegans. BMC 779 Biology, 17(1), 14. https://doi.org/10.1186/s12915-019-0635-7 780 Amort, T., Rieder, D., Wille, A., Khokhlova-Cubberley, D., Riml, C., Trixl, L., … Lusser, A. 781 (2017). Distinct 5-methylcytosine profiles in poly(A) RNA from mouse embryonic stem 782 cells and brain. Genome Biology, 18(1), 1. https://doi.org/10.1186/s13059-016-1139-1 783 Amos, H., & Korn, M. (1958). 5-Methyl cytosine in the RNA of Escherichia coli. BBA - 784 Biochimica et Biophysica Acta, 29(2), 444–445. https://doi.org/10.1016/0006- 785 3002(58)90214-2 786 Anders, S., Pyl, P. T., & Huber, W. (2015). HTSeq-A Python framework to work with high- 787 throughput sequencing data. Bioinformatics, 31(2), 166–169. 788 https://doi.org/10.1093/bioinformatics/btu638 789 Arnold, A., Rahman, M. M., Lee, M. C., Muehlhaeusser, S., Katic, I., Gaidatzis, D., … 790 Ciosk, R. (2014). Functional characterization of C. elegans Y-box-binding proteins 791 reveals tissue-specific functions and a critical role in the formation of polysomes. 792 Nucleic Acids Research, 42(21), 13353–13369. https://doi.org/10.1093/nar/gku1077 793 Blanco, S., Bandiera, R., Popis, M., Hussain, S., Lombard, P., Aleksic, J., … Frye, M. 794 (2016). Stem cell function and stress response are controlled by protein synthesis. 795 Nature, 534(7607), 335–340. https://doi.org/10.1038/nature18282 796 Blanco, S., Dietmann, S., Flores, J. V, Hussain, S., Kutter, C., Humphreys, P., … Frye, M. 797 (2014). Aberrant methylation of tRNAs links cellular stress to neuro-developmental 798 disorders. The EMBO Journal, 33(18), 1–20. https://doi.org/10.15252/embj.201489282 799 Boccaletto, P., Machnicka, M. A., Purta, E., Pi˛ Atkowski, P.-L., Zej Bagí Nski, B.-L., 800 Wirecki, T. K., … Bujnicki, J. M. (2017). MODOMICS: a database of RNA 801 modification pathways. 2017 update. Nucleic Acids Research, 46(2), 303–307. 802 https://doi.org/10.1093/nar/gkx1030 803 Bolger, A. M., Lohse, M., & Usadel, B. (2014). Trimmomatic: a flexible trimmer for 804 Illumina sequence data. Bioinformatics, 30(15), 2114–2120. 805 https://doi.org/10.1093/bioinformatics/btu170 806 Bourgeois, G., Ney, M., Gaspar, I., Aigueperse, C., Schaefer, M., Kellner, S., … Motorin, Y. 807 (2015). Eukaryotic rRNA Modification by Yeast 5-Methylcytosine-Methyltransferases 808 and Human Proliferation-Associated Antigen p120. Plos One, 10(7), e0133321. 809 https://doi.org/10.1371/journal.pone.0133321 810 Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics, 77(1), 71–94. 811 Retrieved from bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

812 http://eutils.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&id=4366476&ret 813 mode=ref&cmd=prlinks 814 Brzezicha, B., Schmidt, M., Makałowska, I., Jarmołowski, A., Pieńkowska, J., & 815 Szweykowska-Kulińska, Z. (2006). Identification of human tRNA: m5C 816 methyltransferase catalysing intron-dependent m5C formation in the first position of the 817 anticodon of the pre-tRNA(CAA)Leu. Nucleic Acids Research, 34(20), 6034–6043. 818 https://doi.org/10.1093/nar/gkl765 819 Burgess, A. L., David, R., & Searle, I. R. (2015). Conservation of tRNA and rRNA 5- 820 methylcytosine in the kingdom Plantae. BMC Plant Biology, 15(1), 1–17. 821 https://doi.org/10.1186/s12870-015-0580-8 822 Cámara, Y., Asin-Cayuela, J., Park, C. B., Metodiev, M. D., Shi, Y., Ruzzenente, B., … 823 Larsson, N. G. (2011). MTERF4 regulates translation by targeting the methyltransferase 824 NSUN4 to the mammalian mitochondrial ribosome. Cell Metabolism, 13(5), 527–539. 825 https://doi.org/10.1016/j.cmet.2011.04.002 826 Chan, C. T. Y., Dyavaiah, M., DeMott, M. S., Taghizadeh, K., Dedon, P. C., & Begley, T. J. 827 (2010). A Quantitative Systems Approach Reveals Dynamic Control of tRNA 828 Modifications during Cellular Stress. PLoS Genetics, 6(12), e1001247. 829 https://doi.org/10.1371/journal.pgen.1001247 830 Chan, C. T. Y., Pang, Y. L. J., Deng, W., Babu, I. R., Dyavaiah, M., Begley, T. J., & Dedon, 831 P. C. (2012). Reprogramming of tRNA modifications controls the oxidative stress 832 response by codon-biased translation of proteins. Nature Communications, 3(May). 833 https://doi.org/10.1038/ncomms1938 834 Chan, P. P., & Lowe, T. M. (2016). GtRNAdb 2.0: An expanded database of transfer RNA 835 genes identified in complete and draft genomes. Nucleic Acids Research, 44(D1), D184– 836 D189. https://doi.org/10.1093/nar/gkv1309 837 Chen, X., Li, A., Sun, B.-F., Yang, Y., Han, Y.-N., Yuan, X., … Yang, Y.-G. (2019). 5- 838 methylcytosine promotes pathogenesis of bladder cancer through stabilizing mRNAs. 839 Nature Cell Biology, 21, 978–990. https://doi.org/10.1038/s41556-019-0361-y 840 Cload, S. T., Liu, D. R., Froland, W. A., & Schultz, P. G. (1996). Development of improved 841 tRNAs for in vitro biosynthesis of proteins containing unnatural amino acids. Chemistry 842 & Biology, 3, 1033–1038. Retrieved from 843 https://www.cell.com/action/showPdf?pii=S1074-5521%2896%2990169-6 844 David, R., Burgess, A., Parker, B., Li, J., Pulsford, K., Sibbritt, T., … Searle, I. R. (2017). 845 Transcriptome-wide Mapping of RNA 5-Methylcytosine in Arabidopsis mRNAs and bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

846 non-coding RNAs. The Plant Cell, tpc.00751.2016. https://doi.org/10.1105/tpc.16.00751 847 De Beus, E., Brockenbrough, J. S., Hong, B., & Aris, J. P. (1994). Yeast NOP2 encodes an 848 essential nucleolar protein with homology to a human proliferation marker. Journal of 849 Cell Biology, 127(6 II), 1799–1813. https://doi.org/10.1083/jcb.127.6.1799 850 Desrosiers, Ronald Friderici, Karen Rottman, F. (1974). Identification of Methylated 851 Nucleosides in Messenger RNA from Novikoff Hepatoma Cells. Proceedings of the 852 National Academy of Sciences, 71(10), 3971–3975. Retrieved from 853 https://www.jstor.org/stable/64107?seq=1#metadata_info_tab_contents 854 Edelheit, S., Schwartz, S., Mumbach, M. R., Wurtzel, O., & Sorek, R. (2013). Transcriptome- 855 Wide Mapping of 5-methylcytidine RNA Modifications in Bacteria, Archaea, and Yeast 856 Reveals m5C within Archaeal mRNAs. PLoS Genetics, 9(6), e1003602. 857 https://doi.org/10.1371/journal.pgen.1003602 858 Flores, J. V., Cordero-Espinoza, L., Oeztuerk-Winder, F., Andersson-Rolf, A., Selmi, T., 859 Blanco, S., … Frye, M. (2016). Cytosine-5 RNA Methylation Regulates Neural Stem 860 Cell Differentiation and Motility. Stem Cell Reports, 8. 861 https://doi.org/10.1016/j.stemcr.2016.11.014 862 García-Vílchez, R., Sevilla, A., & Blanco, S. (2019). Post-transcriptional regulation by 863 cytosine-5 methylation of RNA. Biochimica et Biophysica Acta - Gene Regulatory 864 Mechanisms, #pagerange#. https://doi.org/10.1016/j.bbagrm.2018.12.003 865 Gkatza, N. A., Castro, C., Harvey, R. F., Heiß, M., Popis, M. C., Blanco, S., … Frye, M. 866 (2019). Cytosine-5 RNA methylation links protein synthesis to cell metabolism. PLoS 867 Biology, 17(6), e3000297. https://doi.org/10.1371/journal.pbio.3000297 868 Goll, M. G., Kirpekar, F., Maggert, K. A., Yoder, J. A., Hsieh, C., Zhang, X., … Bestor, T. 869 H. (2006). Methylation of tRNA Asp by the DNA Methyltransferase Homolog Dnmt2. 870 Science (New York, N.Y.), 311(January), 395–398. 871 https://doi.org/10.1126/science.1120976 872 Green, R., & Noller, H. F. (1999). Reconstitution of Functional 50S Ribosomes from in Vitro 873 Transcripts of Bacillus stearothermophilus 23S rRNA. Biochemistry, 38(6), 1772–1779. 874 https://doi.org/10.1021/BI982246A 875 Haag, S., Sloan, K. E., Ranjan, N., Warda, A. S., Kretschmer, J., Blessing, C., … Bohnsack, 876 M. T. (2016). NSUN3 and ABH1 modify the wobble position of mt‐tRNAMet to 877 expand codon recognition in mitochondrial translation. Embo J., 35(16), DOI: 878 10.15252/embj.201694885. https://doi.org/10.15252/embj.201694885 879 Haag, S., Warda, A. S., Kretschmer, J., Günnigmann, M. A., Höbartner, C., & Bohnsack, M. bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

880 T. (2015). NSUN6 is a human RNA methyltransferase that catalyzes formation of 881 m5C72 in specific tRNAs. RNA (New York, N.Y.), rna.051524.115-. 882 https://doi.org/10.1261/rna.051524.115 883 Heissenberger, C., Liendl, L., Nagelreiter, F., Gonskikh, Y., Yang, G., Stelzer, E. M., … 884 Schosserer, M. (2019). Loss of the ribosomal RNA methyltransferase NSUN5 impairs 885 global protein synthesis and normal growth. Nucleic Acids Research, 47, 11807–11825. 886 https://doi.org/10.1093/nar/gkz1043 887 Hodgkin, J., & Barnes, T. M. (1991). More is not better: Brood size and population growth in 888 a self-fertilizing nematode. Proceedings of the Royal Society B: Biological Sciences, 889 246(1315), 19–24. https://doi.org/10.1098/rspb.1991.0119 890 Hong, B., Brockenbrough, J. S., Wu, P., & Aris, J. P. (1997). Nop2p is required for pre- 891 rRNA processing and 60S ribosome subunit synthesis in yeast. Molecular and Cellular 892 Biology, 17(1), 378–388. https://doi.org/10.1128/MCB.17.1.378 893 Hong, B., Wu, K., Brockenbrough, J. S., Wu, P., & Aris, J. P. (2001). Temperature sensitive 894 nop2 alleles defective in synthesis of 25S rRNA and large ribosomal subunits in 895 Saccharomyces cerevisiae. Nucleic Acids Research, 29(14), 2927–2937. Retrieved from 896 http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=55797&tool=pmcentrez&re 897 ndertype=abstract 898 Hopper, A. K., & Phizicky, E. M. (2003). tRNA transfers to the limelight. Genes & 899 Development, 17(2), 162–180. https://doi.org/10.1101/gad.1049103 900 Huang, T., Chen, W., Liu, J., Gu, N., & Zhang, R. (2019). Genome-wide identification of 901 mRNA 5-methylcytosine in mammals. Nature Structural & Molecular Biology, 26(5), 902 380–388. https://doi.org/10.1038/s41594-019-0218-x 903 Ingolia, N. T., Ghaemmaghami, S., Newman, J. R. S., & Weissman, J. S. (2009). Genome- 904 wide analysis in vivo of translation with nucleotide resolution using ribosome profiling. 905 Science, 324(5924), 218–223. https://doi.org/10.1126/science.1168978 906 Jackman, J. E., & Alfonzo, J. D. (2013). Transfer RNA modifications: Nature’s 907 combinatorial chemistry playground. Wiley Interdisciplinary Reviews: RNA, 4(1), 35– 908 48. https://doi.org/10.1002/wrna.1144 909 Jurkowski, T. P., Meusburger, M., Phalke, S., Helm, M., Nellen, W., Reuter, G., & Jeltsch, 910 A. (2008). Human DNMT2 methylates tRNA Asp molecules using a DNA 911 methyltransferase-like catalytic mechanism. Rna, 14(1987), 1663–1670. 912 https://doi.org/10.1261/rna.970408.transferase 913 Kamath, R. S., Fraser, A. G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., … Ahringer, J. bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

914 (2003). Systematic functional analysis of the Caenorhabditis elegans genome using 915 RNAi. Nature, 421(6920), 231–237. https://doi.org/10.1038/nature01278 916 Kawarada, L., Suzuki, T., Ohira, T., Hirata, S., Miyauchi, K., & Suzuki, T. (2017). ALKBH1 917 is an RNA dioxygenase responsible for cytoplasmic and mitochondrial tRNA 918 modifications. Nucleic Acids Research, 45(12), 7401–7415. 919 https://doi.org/10.1093/nar/gkx354 920 Kersey, P. J., Allen, J. E., Armean, I., Boddu, S., Bolt, B. J., Carvalho-Silva, D., … Staines, 921 D. M. (2016). Ensembl Genomes 2016: more genomes, more complexity. Nucleic Acids 922 Research, 44(D1), D574–D580. https://doi.org/10.1093/nar/gkv1209 923 Khaitovich, P., Tenson, T., Kloss, P., & Mankin, A. S. (1999). Reconstitution of Functionally 924 Active Thermus aquaticus Large Ribosomal Subunits with in Vitro-Transcribed rRNA. 925 Biochemistry, 9(38(6)), 1780–1788. https://doi.org/10.1021/BI9822473 926 Khan, M. A., Rafiq, M. A., Noor, A., Hussain, S., Flores, J. V., Rupp, V., … Vincent, J. B. 927 (2012). Mutation in NSUN2, which encodes an RNA methyltransferase, causes 928 autosomal-recessive intellectual disability. American Journal of Human Genetics, 90(5), 929 856–863. https://doi.org/10.1016/j.ajhg.2012.03.023 930 Khoddami, V., & Cairns, B. R. (2013). Identification of direct targets and modified bases of 931 RNA cytosine methyltransferases. Nature Biotechnology, 31(5), 458–464. 932 https://doi.org/10.1038/nbt.2566 933 Khosronezhad, N., Golam, S., & Jorsarayi, A. (2015). T26248G-transversion mutation in 934 exon7 of the putative methyltransferase Nsun7 gene causes a change in protein folding 935 associated with reduced sperm motility in asthenospermic men. Reproduction, Fertility 936 and Development, 27, 471–480. https://doi.org/10.1071/RD13371 937 Khosronezhad, N., Hosseinzadeh Colagar, A., & Mortazavi, S. M. (2015). The Nsun7 938 (A11337)-deletion mutation, causes reduction of its protein rate and associated with 939 sperm motility defect in infertile men. Journal of Assisted Reproduction and Genetics, 940 32(5), 807–815. https://doi.org/10.1007/s10815-015-0443-0 941 Kim, D., Langmead, B., & Salzberg, S. L. (2015). HISAT: A fast spliced aligner with low 942 memory requirements. Nature Methods, 12(4), 357–360. 943 https://doi.org/10.1038/nmeth.3317 944 King, M. Y., & Redman, K. L. (2002). RNA methyltransferases utilize two cysteine residues 945 in the formation of 5-methylcytosine. Biochemistry, 41(37), 11218–11225. 946 https://doi.org/10.1021/bi026055q 947 Komara, M., Al-Shamsi, A. M., Ben-Salem, S., Ali, B. R., & Al-Gazali, L. (2015). A Novel bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

948 Single-Nucleotide Deletion (c.1020delA) in NSUN2 Causes Intellectual Disability in an 949 Emirati Child. Journal of Molecular Neuroscience, 57(3), 393–399. 950 https://doi.org/10.1007/s12031-015-0592-8 951 Kopylova, E., Noé, L., & Touzet, H. (2012). SortMeRNA: fast and accurate filtering of 952 ribosomal RNAs in metatranscriptomic data. Bioinformatics, 28(24), 3211–3217. 953 https://doi.org/10.1093/bioinformatics/bts611 954 Kosi, N., Alić, I., Kolačević, M., Vrsaljko, N., Jovanov Milošević, N., Sobol, M., … 955 Mitrečić, D. (2015). Nop2 is expressed during proliferation of neural stem cells and in 956 adult mouse and human brain. Brain Research, 1597, 65–76. 957 https://doi.org/10.1016/j.brainres.2014.11.040 958 Lafontaine, D., Delcour, J., Glasser, a L., Desgrès, J., & Vandenhaute, J. (1994). The DIM1 959 gene responsible for the conserved m6(2)Am6(2)A dimethylation in the 3’-terminal loop 960 of 18 S rRNA is essential in yeast. Journal of Molecular Biology. 961 https://doi.org/10.1006/jmbi.1994.1525 962 Lafontaine, D. L., Preiss, T., & Tollervey, D. (1998). Yeast 18S rRNA dimethylase Dim1p: a 963 quality control mechanism in ribosome synthesis? Molecular and Cellular Biology, 964 18(4), 2360–2370. 965 Lecanda, A., Nilges, B. S., Sharma, P., Nedialkova, D. D., Schwarz, J., Vaquerizas, J. M., & 966 Leidel, S. A. (2016). Dual randomization of oligonucleotides to reduce the bias in 967 ribosome-profiling libraries. Methods, 107, 89–97. 968 https://doi.org/10.1016/j.ymeth.2016.07.011 969 Lee, R. Y. N., Howe, K. L., Harris, T. W., Arnaboldi, V., Cain, S., Chan, J., … Sternberg, P. 970 W. (2018). WormBase 2017: molting into a new stage. Nucleic Acids Research, 46(D1), 971 D869–D874. https://doi.org/10.1093/nar/gkx998 972 Legrand, C., Tuorto, F., Hartmann, M., Liebers, R., Jacob, D., Helm, M., & Lyko, F. (2017). 973 Statistically robust methylation calling for wholetranscriptome bisulfite sequencing 974 reveals distinct methylation patterns for mouse RNAs. Genome Research, 27(9), 1589– 975 1596. https://doi.org/10.1101/gr.210666.116 976 Li, J., Li, H., Long, T., Dong, H., Wang, E.-D., & Liu, R.-J. (2018). Archaeal NSUN6 977 catalyzes m5C72 modification on a wide-range of specific tRNAs. Nucleic Acids 978 Research, 28(47(4)), 2041–2055. https://doi.org/10.1093/nar/gky1236 979 Li, Q., Li, X., Tang, H., Jiang, B., Dou, Y., Gorospe, M., & Wang, W. (2017). NSUN2- 980 Mediated m5C Methylation and METTL3/METTL14-Mediated m6A Methylation 981 Cooperatively Enhance p21 Translation. Journal of Cellular Biochemistry, 118(9), bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

982 2587–2598. https://doi.org/10.1002/jcb.25957 983 Love, M. I., Huber, W., & Anders, S. (2014). Moderated estimation of fold change and 984 dispersion for RNA-seq data with DESeq2. Genome Biology, 15(12), 550. 985 https://doi.org/10.1186/s13059-014-0550-8 986 Lu, Z. J., Yip, K. Y., Wang, G., Shou, C., Hillier, L. D. W., Khurana, E., … Gerstein, M. B. 987 (2011). Prediction and characterization of noncoding RNAs in C. elegans by integrating 988 conservation, secondary structure, and high-throughput sequencing and array data. 989 Genome Research, 21(2), 276–285. https://doi.org/10.1101/gr.110189.110 990 Martin, M. (2011). Cutadapt removes adapter sequences from high-throughput sequencing 991 reads. EMBnet.Journal, 17(1), 10. https://doi.org/10.14806/ej.17.1.200 992 Martinez, F. J., Lee, J. H., Lee, J. E., Blanco, S., Nickerson, E., Gabrie, S., … Gleeson, J. G. 993 (2012). Whole exome sequencing identifies a splicing mutation in NSUN2 as a cause of 994 a Dubowitz-like syndrome. Journal of Medical Genetics, 49(6), 380–385. 995 https://doi.org/10.1136/jmedgenet-2011-100686 996 Metodiev, M. D., Spåhr, H., Loguercio Polosa, P., Meharg, C., Becker, C., Altmueller, J., … 997 Ruzzenente, B. (2014). NSUN4 Is a Dual Function Mitochondrial Protein Required for 998 Both Methylation of 12S rRNA and Coordination of Mitoribosomal Assembly. PLoS 999 Genetics, 10(2), 1–11. https://doi.org/10.1371/journal.pgen.1004110 1000 Motorin, Y., & Grosjean, H. (1999). Multisite-specific tRNA:m5C-methyltransferase (Trm4) 1001 in yeast Saccharomyces cerevisiae: Identification of the gene and substrate specificity of 1002 the enzyme. Rna, 5(8), 1105–1118. https://doi.org/10.1017/S1355838299982201 1003 Nakano, S., Suzuki, T., Kawarada, L., Iwata, H., Asano, K., & Suzuki, T. (2016). NSUN3 1004 methylase initiates 5-formylcytidine biogenesis in human mitochondrial tRNAMet. 1005 Nature Chemical Biology, 12(7), 546–551. https://doi.org/10.1038/nchembio.2099 1006 O’Connor, M., Leppik, M., & Remme, J. (2018). Pseudouridine-Free Escherichia coli 1007 Ribosomes. Journal of Bacteriology, 200(4), e00540-17. 1008 https://doi.org/10.1128/JB.00540-17 1009 Paix, A., Folkmann, A., Rasoloson, D., & Seydoux, G. (2015). High Efficiency, Homology- 1010 Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 1011 Ribonucleoprotein Complexes. Genetics, 201(1), 47–54. 1012 https://doi.org/10.1534/genetics.115.179382 1013 Phizicky, E. M., & Alfonzo, J. D. (2010). Do all modifications benefit all tRNAs? FEBS 1014 Letters, 584(2), 265–271. https://doi.org/10.1016/j.febslet.2009.11.049 1015 Quast, C., Pruesse, E., Yilmaz, P., Gerken, J., Schweer, T., Yarza, P., … Glöckner, F. O. bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1016 (2012). The SILVA ribosomal RNA gene database project: improved data processing 1017 and web-based tools. Nucleic Acids Research, 41(D1), D590–D596. 1018 https://doi.org/10.1093/nar/gks1219 1019 Ren, H. Y., Zhong, R., Ding, X. P., Chen, Z. Y., & Jing, Y. L. (2015). Investigation of 1020 polymorphisms in exon7 of the NSUN7 gene among Chinese Han men with 1021 asthenospermia. Genetics and Molecular Research, 14(3), 9261–9268. 1022 https://doi.org/10.4238/2015.August.10.6 1023 Salditt-Georgieff, M., Jelinek, W., Darnell, J. E., Furuichi, Y., Morgan, M., & Shatkin, A. 1024 (1976). Methyl labeling of HeLa cell hnRNA: a comparison with mRNA. Cell, 7(2), 1025 227–237. https://doi.org/10.1016/0092-8674(76)90022-2 1026 Schaefer, M., Pollex, T., Hanna, K., Tuorto, F., Meusburger, M., Helm, M., & Lyko, F. 1027 (2010). RNA methylation by Dnmt2 protects transfer RNAs against stress-induced 1028 cleavage. Genes and Development, 24(15), 1590–1595. 1029 https://doi.org/10.1101/gad.586710 1030 Schosserer, M., Minois, N., Angerer, T. B., Amring, M., Dellago, H., Harreither, E., … 1031 Grillari, J. (2015). Methylation of ribosomal RNA by NSUN5 is a conserved mechanism 1032 modulating organismal lifespan. Nature Communications, 6, 6158. 1033 https://doi.org/10.1038/ncomms7158 1034 Semrad, K., & Green, R. (2002). Osmolytes stimulate the reconstitution of functional 50S 1035 ribosomes from in vitro transcripts of Escherichia coli 23S rRNA. Rna, 8(4), 401–411. 1036 https://doi.org/10.1017/S1355838202029722 1037 Shanmugam, R., Fierer, J., Kaiser, S., Helm, M., Jurkowski, T. P., & Jeltsch, A. (2015). 1038 Cytosine methylation of tRNA-Asp by DNMT2 has a role in translation of proteins 1039 containing poly-Asp sequences. Cell Discovery, 1, 1–10. 1040 https://doi.org/10.1038/celldisc.2015.10 1041 Sharma, S., & Lafontaine, D. L. J. (2015). “View From A Bridge”: A New Perspective on 1042 Eukaryotic rRNA Base Modification. Trends in Biochemical Sciences, 40(10), 560–575. 1043 https://doi.org/10.1016/j.tibs.2015.07.008 1044 Sharma, S., Yang, J., Watzinger, P., Kötter, P., & Entian, K. D. (2013). Yeast Nop2 and 1045 Rcm1 methylate C2870 and C2278 of the 25S rRNA, respectively. Nucleic Acids 1046 Research, 41(19), 9062–9076. https://doi.org/10.1093/nar/gkt679 1047 Sievers, F., Wilm, A., Dineen, D., Gibson, T. J., Karplus, K., Li, W., … Higgins, D. G. 1048 (2011). Fast, scalable generation of high‐quality protein multiple sequence alignments 1049 using Clustal Omega. Molecular Systems Biology, 7(1), 539. bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1050 https://doi.org/10.1038/msb.2011.75 1051 Spåhr, H., Habermann, B., Gustafsson, C. M., Larsson, N.-G., & Hallberg, B. M. (2012). 1052 Structure of the human MTERF4-NSUN4 protein complex that regulates mitochondrial 1053 ribosome biogenesis. Proceedings of the National Academy of Sciences of the United 1054 States of America, 109(38), 15253–15258. https://doi.org/10.1073/pnas.1210688109 1055 Squires, J. E., Patel, H. R., Nousch, M., Sibbritt, T., Humphreys, D. T., Parker, B. J., … 1056 Preiss, T. (2012). Widespread occurrence of 5-methylcytosine in human coding and 1057 non-coding RNA. Nucleic Acids Research, 40(11), 5023–5033. 1058 https://doi.org/10.1093/nar/gks144 1059 Stadler, M., & Fire, A. (2011). Wobble base-pairing slows in vivo translation elongation in 1060 metazoans. RNA, 17(12), 2063–2073. https://doi.org/10.1261/rna.02890211 1061 Takemoto, C., Spremulli, L. L., Benkowski, L. A., Ueda, T., Yokogawa, T., & Watanabe, K. 1062 (2009). Unconventional decoding of the AUA codon as methionine by mitochondrial 1063 tRNA Met with the anticodon f 5 CAU as revealed with a mitochondrial in vitro 1064 translation system. Nucleic Acids Research, 37(5), 1616–1627. 1065 https://doi.org/10.1093/nar/gkp001 1066 Tang, H., Xiuqin Fan, Junyue Xing, Zhenyun Liu, Bin Jiang, Yali Dou, … Wengong, W. 1067 (2015). NSun2 delays replicative senescence by repressing p27 (KIP1) translation and 1068 elevating CDK1 translation. Aging, 7(12), 1143–1158. 1069 https://doi.org/10.18632/aging.100860 1070 Tuorto, F., Herbst, F., Alerasool, N., Bender, S., Popp, O., Federico, G., … Lyko, F. (2015). 1071 The tRNA methyltransferase Dnmt2 is required for accurate polypeptide synthesis 1072 during haematopoiesis. Embo J, 34(18), 2350–2362. 1073 https://doi.org/10.15252/embj.201591382 1074 Tuorto, F., Liebers, R., Musch, T., Schaefer, M., Hofmann, S., Kellner, S., … Lyko, F. 1075 (2012). RNA cytosine methylation by Dnmt2 and NSun2 promotes tRNA stability and 1076 protein synthesis. Nature Structural & Molecular Biology, 19(9), 900–905. 1077 https://doi.org/10.1038/nsmb.2357 1078 van Delft, P., Akay, A., Huber, S. M., Bueschl, C., Rudolph, K. L. M., Di Domenico, T., … 1079 Balasubramanian, S. (2017). The Profile and Dynamics of RNA Modifications in 1080 Animals. Chembiochem : A European Journal of Chemical Biology, 18(11), 979–984. 1081 https://doi.org/10.1002/cbic.201700093 1082 Van Haute, L., Dietmann, S., Kremer, L., Hussain, S., Pearce, S. F., Powell, C. A., … 1083 Minczuk, M. (2016). Deficient methylation and formylation of mt-tRNAMet wobble bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1084 cytosine in a patient carrying mutations in NSUN3. Nature Communications, 7(May), 1085 12039. https://doi.org/10.1038/ncomms12039 1086 Van Haute, L., Lee, S.-Y., McCann, B. J., Powell, C. A., Bansal, D., Vasiliauskaitė, L., … 1087 Minczuk, M. (2019). NSUN2 introduces 5-methylcytosines in mammalian 1088 mitochondrial tRNAs. Nucleic Acids Research, 47(16), 8720–8733. 1089 https://doi.org/10.1093/nar/gkz559 1090 Watanabe, Y., Tsuruis, H., Ueda, T., Furushimag, R., Takamiyas, S., Kitan, K., … Watanabe, 1091 K. (1994). Primary and Higher Order Structures of Nematode (Ascaris suum) 1092 Mitochondrial tRNAs Lacking Either the T or D Stem*. The Journal of Biological 1093 Chemistry, 269(36), 22902–22906. Retrieved from http://www.jbc.org/ 1094 Xi, Y., & Li, W. (2009). BSMAP: Whole genome bisulfite sequence MAPping program. 1095 BMC Bioinformatics, 10. https://doi.org/10.1186/1471-2105-10-232 1096 Xiao, T., Wang, Y., Luo, H., Liu, L., Wei, G., Chen, X., … Chen, R. (2012). A differential 1097 sequencing-based analysis of the C. elegans noncoding transcriptome. Rna, 18(4), 626– 1098 639. https://doi.org/10.1261/rna.030965.111 1099 Yakubovskaya, E., Guja, K. E., Mejia, E., Castano, S., Hambardjieva, E., Choi, W. S., & 1100 Garcia-Diaz, M. (2012). Structure of the essential MTERF4:NSUN4 protein complex 1101 reveals how an MTERF protein collaborates to facilitate rRNA modification. Structure, 1102 20(11), 1940–1947. https://doi.org/10.1016/j.str.2012.08.027 1103 Yang, X., Yang, Y., Sun, B.-F., Chen, Y.-S., Xu, J.-W., Lai, W.-Y., … Yang, Y.-G. (2017). 1104 5-methylcytosine promotes mRNA export — NSUN2 as the methyltransferase and 1105 ALYREF as an m5C reader. Cell Research, 27(5), 606–625. 1106 https://doi.org/10.1038/cr.2017.55 1107 Zhang, X., Liu, Z., Yi, J., Tang, H., Xing, J., Yu, M., … Wang, W. (2012). The tRNA 1108 methyltransferase NSun2 stabilizes p16INK4 mRNA by methylating the 3′-untranslated 1109 region of p16. Nature Communications, 3, 712. https://doi.org/10.1038/ncomms1692 1110 Zorbas, C., Nicolas, E., Wacheul, L., Huvelle, E., Heurgue-Hamard, V., & Lafontaine, D. L. 1111 (2015). The human 18S rRNA base methyltransferases DIMT1L and WBSCR22- 1112 TRMT112 but not rRNA modification are required for ribosome biogenesis. Molecular 1113 Biology of the Cell. https://doi.org/10.1091/mbc.E15-02-0073 1114 1115 1116 FIGURE LEGENDS 1117 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1118 Figure 1. m5C and its derivatives are non-essential RNA modifications in C. elegans. (A) 1119 Phylogenetic relationship among human and putative nematode NSUN proteins. Unrooted 1120 phylogenetic tree of NSUN homologues in Homo sapiens and C. elegans using entire protein 1121 sequence. Different colours represent each member of the NSUN family: NSUN-1 (red); 1122 NSUN-2 (orange); NSUN-4 (light blue); NSUN-5 (dark blue). Phylogenetic tree reconstructed 1123 using the maximum likelihood method implemented in the PhyML program (v3.0). (B) Mutant 1124 alleles used in this study. CRISPR-Cas9 strategy for creation and screening of catalytically 1125 inactive alleles of nsun-1 (mj473), nsun-2 (mj458) and nsun-4 (mj457). A homologous 1126 recombination template bearing a point mutation to convert the catalytic cysteine into alanine 1127 while creating a restriction site for HaeIII was co-injected. For the study of nsun-5, a 928 bp 1128 deletion allele (tm3898) was used. (C, D) Mass spectrometry quantification of m5C (C) and 1129 hm5Cm (D) levels in total RNA from nsun mutants. RNA was extracted from populations of 1130 L1 animals synchronised by starvation, digested to nucleosides and analysed via LC-MS. A 1131 relative quantification was performed with an external calibration curve of standards, 1132 normalized to the amount of cytidine. 3 independent biological replicates, mean with SEM. 1133 n.d. = not detected. (E) Fold change in total RNA modification levels upon loss of m5C. Fold 1134 changes were calculated by dividing the peak area ratio of noNSUN samples by the one of wild 1135 type samples. The dotted line represents the level where no change in RNA modification levels 1136 was observed. 3 independent biological replicates, mean with SEM; multiple t-tests. 1137 1138 Figure 2. The m5C methylome of C. elegans. (A, B) Site-specific methylation analysis by 1139 whole-transcriptome bisulfite sequencing. Scatter plots show individual cytosines and their 1140 respective non-conversion ratios in rRNAs (A) and tRNAs (B) of wild type and noNSUN 1141 strains; pie chart showing most frequently methylated tRNA isoacceptors. (C) Heatmap 1142 showing non-conversion rates of tRNA positions methylated in stoichiometry higher than 50%. 1143 (D) Site-specific methylation analysis by whole-transcriptome bisulfite sequencing. Scatter 1144 plot shows density of cytosines and their respective non-conversion ratios in mRNAs of wild 1145 type and noNSUN strains. (E) Heatmap showing non-conversion rates of small non-coding 1146 RNA positions methylated in stoichiometry higher than 50%. 3 independent biological 1147 replicates. 1148 1149 Figure 3. NSUN-4 is a multisite-specific tRNA/rRNA methyltransferase in C. elegans. (A) 1150 RNA bisulfite sequencing map for mitochondrial tRNA Met-CAU in wild type (top) and 1151 noNSUN (bottom) strains. Each row represents one sequence read and each column one bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1152 cytosine. Blue squares represent converted cytosines, red squares represent unconverted 1153 cytosines, sequencing mismatches are shown in light blue and gaps are shown in white. 3 1154 independent biological replicates. (B) Percent identity matrix of human NSUN proteins 1155 according to the Clustal Omega multiple alignment tool. Image generated using GraphPad 1156 Prism utilising values generated from alignment analysis. (C, D) Targeted bisulfite-sequencing 1157 heat map showing non-conversion rates of cytosines in mitochondrial tRNA Met-CAU (C) and 1158 mitochondrial 18S rRNA (D). Each row represents one genetic strain analysed and each 1159 column represents one cytosine. 2 independent biological replicates, 10 clones sequenced per 1160 strain, per replicate. 1161 1162 Figure 4. Loss of m5C leads to a temperature-sensitive reproductive phenotype. (A) Body 1163 length of individual nsun mutants throughout development shown as the median length of all 1164 individual animals (n=44,7,7,7,8,8) in ~4 hour windows, error bars indicate the 95% 1165 confidence interval of the median, L1-L4 refers to the larval stages, YA and Ad to young adult 1166 and adult, respectively. (B, C) Viable progeny counts of individual nsun mutants at 20°C (B) 1167 and of noNSUN strain at different environmental temperatures (C). 10 young adult nematodes 1168 of each genotype were allowed to lay eggs for 4 days. Viable progeny was either manually or 1169 automatically counted at young adult stage. Automatic counting was done using using a Matlab 1170 script which processed plate images in real-time. Mean with SEM; One-way ANOVA, Tukey’s 1171 test. 1172 1173 Figure 5. Loss of m5C impacts translation efficiency of leucine and proline codons. (A) 1174 Fraction of polysomal ribosomes quantified from polysome profiles from the wild type and 1175 noNSUN strains subject to a 4 h heat shock at 27°C. ns = non-significant. (B) Log2 fold change 1176 of bulk codon occupancy between wild type and noNSUN at 20°C and 27°C for each codon. 1177 (C) Translation efficiency of leucine-enriched, proline-enriched and random genes in each 1178 sample. (D) Gene ontology enrichment (biological process) of leucine-enriched, proline- 1179 enriched and random genes. 3 biological replicates. 1180 1181 Figure 6. The m5C pathway of C. elegans. Top: The nematode’s genome encodes four m5C- 1182 methyltransferases: NSUN-1, NSUN-2, NSUN-4 and NSUN-5 (here represented in red, 1183 yellow, light blue and dark blue, respectively). In the cytoplasm, NSUN-1 and NSUN-5 modify 1184 one position in rRNA each, while NSUN-2 modifies the variable loop of several tRNAs and 1185 the wobble position of tRNA Leu-CAA. In the mitochondria, NSUN-4 modifies 3 positions in bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1186 rRNA and the wobble position of tRNA Met-CAU. In the wild-type strain, ribosomes move at 1187 regular speed to achieve regular translation efficiency. Bottom: Simultaneous mutation of all 1188 m5C-methyltransferases completely abolishes m5C presence in RNA and leads to 1189 developmental delay and reduced brood size, which is aggravated at higher temperature. In the 1190 noNSUN strain, ribosomes tend to pause at the encounter with leucine and proline codons, 1191 leading to reduced translation efficiency of transcripts enriched in these amino acids. 1192 1193 Supplementary Figure 1 | Referent to Figure 1. Knockdown and mutation of nsun genes. 1194 (A, B) Knockdown of nsun genes through RNAi by feeding. (A) Representative images of wild 1195 type adult animals after silencing of nsun genes via RNAi by feeding. Widefield DIC images 1196 are 10x magnification. (B) Percentage of fertile adults after gene silencing by RNAi. RNAi- 1197 treated animals were scored for fertility (presence of embryos in the germline) at the adult 1198 stage. Mean with SEM. 2 independent experiments, 3 biological replicates each. (C) HaeIII- 1199 treated DNA agarose gel showing genotypes of F1 individuals from heterozygous nsun-1, 1200 nsun-2 and nsun-4 mutants. (D) DNA agarose gel showing genotypes of F1 individuals from a 1201 heterozygous nsun-5 mutant; diagram showing primers used for genotyping of nsun-5 1202 mutation. 1203 1204 Supplementary Figure 2 | Referent to Figure 2. Enzymatic specificity of NSUN proteins 1205 in C. elegans. (A, B, C) Validation of enzymatic specificity of NSUN-2 (A), NSUN-5 (B) and 1206 NSUN-1 (C) by targeted bisulfite-sequencing. Each column represents one cytosine in the 1207 sequence of interest; each line represents one independent clone sequenced. Grey squares 1208 represent unconverted positions; white squares represent converted positions. 1 biological 1209 replicate. 1210 1211 Supplementary Figure 3 | Referent to Figure 2. Predicted secondary structures of m5C 1212 methylated ncRNAs. Red dot indicates the methylated position. Structures predicted by the 1213 Predict a Secondary Structure Web Server (David Mathews Lab, University of Rochester) as 1214 the lowest free energy structures generated using default data. 1215 1216 Supplementary Figure 4 | Referent to Figure 5. Quality assessment of ribosome profiling 1217 data. (A) Number of reads aligning the to the CDS in each frame after length stratification. 1218 The frame of the 5 prime nucleotide is shown. (B) Meta-gene example plot for reads that are 1219 27 bp long showing the number of reads for each base pair of the start of each CDS. They are bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1220 coloured according to the frame of their 5 prime base relative to the CDS. (C) Scatter plots 1221 showing the correlation between counts for RNA-seq and Ribo-seq for each gene in each 1222 sample. (D) PCA plot of RNA-seq counts for the 2000 genes with the highest variance. (E) 1223 PCA plot of Ribo-seq counts for the 2000 genes with the highest variance. 3 biological 1224 replicates. 1225 1226 Supplementary Figure 5 | Referent to Figure 5. Differentially transcribed and translated 1227 genes upon heat shock. Heatmaps and gene ontology enrichment (biological process) analysis 1228 for the comparison between 20°C and 27°C in the wild type and noNSUN samples. Top shows 1229 RNA-seq (scaled normalised expression) and bottom shows Ribo-seq (scaled normalised 1230 RPFs). WT = wild type; 3 biological replicates. 1231 1232 Supplementary Figure 6 | Referent to Figure 5. Differentially transcribed and translated 1233 genes upon loss of m5C. Heatmaps and gene ontology enrichment (biological process) analysis 1234 for the comparison between wild type and noNSUN samples. Top shows RNA-seq (scaled 1235 normalised expression) and bottom shows Ribo-seq (scaled normalised RPFs). WT = wild 1236 type; 3 biological replicates. 1237 1238 Supplementary Figure 7 | Referent to Figure 5. Translation efficiency of leucine and 1239 proline-enriched transcripts. Expanded from Figure 5C, translation efficiencies for genes 1240 with increasing enrichment for proline or leucine codons. 3 biological replicates. bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. FIGURE 1

A B methyltransferase domain NSUN-1 1 439 664 509 221 NSUN5 Cys > Ala GTGC > GGCC

NSUN-5

HaeIII restriction site

NSUN2 NSUN-2 methyltransferase domain

0

NSUN-1 . 9 82 93 0. 1 NSUN-2 1 C310 684

8 0 63 419 0.82 .6 Cys > Ala 4 6 .66 0 0 . 7 79 0.88 GTGC > GGCC NSUN3 4

NSUN6 NSUN-4 NSUN7

NSUN1 NSUN4 methyltransferase domain

NSUN-4 1 C390 464

0.2 158 Cys > Ala GTGC > GGCC

NSUN-5 nsun-5a nsun-5b nsun-5c

tm3898

0.04 C 1.5 D

0.03 ] 1.0 0.02 Cm per C [%] 5 C per [%

5 0.5 hm m 0.01

n.d. n.d. n.d. 0.0 0.00

nsun-1 nsun-2 nsun-4 nsun-5 nsun-1 nsun-2 nsun-4 nsun-5 Wild type noNSUN Wild type noNSUN

E 2.0 1.8

e 1.6

1.4 1.2 1.0 0.8 0.6 Fold change 0.4 noNSUN/wild typ 0.2 0.0

Inosine

Pseudouridine5-methyluridine 3-methylcytosine 1 -methyladenosine6 -methyladenosine -methylguanosine 2'-O-methylcytidine 7 2'-O-methyluridine N N 6 -dimethyladenosine N 7 -trimethylguanosine2 -dimethylguanosine7 -dimethylguanosine 2'-O-methyladenosine 2'-O-methylguanosine 6 -N 2 ,N 2 ,N 2 ,N N N N 2 ,N N bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. FIGURE 2

A B

rRNAs tRNAs 1.0 1.0 Leucine Proline o o Glycine Glutamine Serine

N Alanine N Cysteine 0.5 0.5 C2381 (26S) Isoleucine Glutamate

C2982 (26S) noNSU noNSU Lysine C228 (mt 18S) Methionine C232 (mt 18S) Threonine BS non-conversion rati BS non-conversion rati Valine 0.0 0.0 Aspartate 0.0 0.5 1.0 0.0 0.5 1.0 BS non-conversion ratio BS non-conversion ratio Wild type Wild type

C Non-conversion rate

0 0.5 1.0 Wild type noNSUN

Ile-AAU-48Ile-UAU-48 ys-CUU-48ys-UUU-48 al-AAC-48 Ala-AGC-48Ala-CGC-48Ala-UGC-48Asp-GUC-49Cys-GCA-49Cys-GCA-50Gln-CUG-50Gln-UUG-48Gln-UUG-49Gln-UUG-50Glu-CUC-49Glu-UUC-49Gly-CCC-48Gly-GCC-49Gly-GCC-50Gly-UCC-48 Leu-AAG-48Leu-CAA-34Leu-CAA-48Leu-CAG-48Leu-UAA-48Leu-UAG-48L L Met-CAU-48Pro-AGG-49Pro-AGG-50Pro-CGG-49Pro-CGG-50Pro-UGG-49Pro-UGG-50Ser-CGA-48Ser-CGU-48Ser-UGA-48Thr-AGU-48Thr-UGU-49V

D E mRNAs

1.0 small ncRNAs

Wild type Non-conversion rate noNSUN 0 0.5 1.0 0.5 C38 C28 C51 C37 C38 noNSUN 11.9 ZK596.5 B0334.18F26H F02D10.15F23F12.15 BS non-conversion ratio 0.0 0.0 0.5 1.0 BS non-conversion ratio Wild type bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

FIGURE 3

Percent Identity Matrix A C34 B NSUN2

wild type NSUN6

reads NSUN3

Match NSUN4 Unconverted C Mismatch NSUN7

NSUN1 Percent Identity Matrix

noNSUN NSUN5 20 40 60 80 100

reads NSUN2 NSUN6 NSUN3 NSUN4 NSUN7 NSUN1 NSUN5

Match Unconverted C Mismatch

C D mt-tRNA Met-CAU 18S mt-rRNA

Wild type Wild type Non-conversion Non-conversion nsun-2 ratio nsun-2 ratio

nsun-4 nsun-4 0 50 100 0 50 100

C24 C34 C38 C39 C40 C54 C56 C611 C623 C628 C631 C632 C635 C641 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

FIGURE 4

** A B * * 1200 300 Wild type ** 1000 250 nsun-1 800 nsun-2 200

600 nsun-4 150

nsun-5 400 100 noNSUN

200 Viable progeny 50 Body length (µm)

0 0 0 20 40 60 L1 L2 L3 L4 YA Ad ild type nsun-1 nsun-2 nsun-4 nsun-5 Time post-hatching (hour) W noNSUN

C 20°C 25°C

100 250 ** **** 80 200

60 150

40 100

Viable progeny 20

Viable progeny 50

0 0

ild type ild type W noNSUN W noNSUN 0.8 0 -0.8 A::V A::L A::L C::Y G::K U::Y U U U A A A GC::S CA::T CC::T CG::T CU::T UG::M G GUG::V GUU::V GUC::V CUG::L C U CUU::L UUG::L CUC::L AAA::K A A UUC::F UUU::F CCG::P CCC::P CCU::P CCA::P A UCG::S UCU::S UCA::S UCC::S A A A A UGG::W U U 20oC 27oC C::D G::E U::D G::Q C::H U::H C::N A::I U::N A A A The copyright holder for this preprint this for holder copyright The A A A A A GA::R GG::R UC::I UU::I U A A GCC::A GCG::A GCU::A GCA::A A CGG::R A CGA::R CGC::R CGU::R A A G G UGC::C UGU::C CAA::Q C G GAA::E GGC::G GGU::G GGA::G GGG::G C C A 20oC 27oC 7.5 B t 5.0 n 20 WT 2.5 27 ichme ns r 0.0 20 −2.5 semantic space y No enrichment this version posted March 23, 2020. 2020. 23, March posted version this No En 27 Random genes noNSUN ;

−5.0

8 4 0 ) E T (

s e n e semantic space x space semantic G

m o d n a R 4 0 −4 s C

n º noNSUN 7.5 27 5.0 20

WT 0 type wild

* 2.5

27 60 40 20 Polysome / total ribosomes ribosomes total / Polysome molting cycle culticle development 0.0 20 multicellular organismal process molting cycle, collagen and cuticulin-based cuticle collagen and cuticulin-based cuticle development −2.5 semantic space y 27 noNSUN anatomical structure development

Pro-enriched genes

−5.0

0 8 4

) E T (

s e n e developmental process G

d e h c i r n e

Pro 4 0 semantic space x space semantic −4 6 20 https://doi.org/10.1101/2020.03.21.001735 3 C s

º n WT doi: doi: noNSUN 27 0 20 * 20 electron transport coupled proton transport (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. permission. without allowed No reuse reserved. rights All the author/funder. is review) peer by certified not was (which

−3 electron transport chain 0 type wild ATP metabolic process semantic space y

27 40 20 60

noNSUN

Polysome / total ribosomes ribosomes total / Polysome mitochondrial electron transport, NADH to ubiquinone Leu-enriched genes

−6

0 4 8 0 2 1 3 ) E semantic space x space semantic T (

s e −1 −2 n e G

d e h c i r n e

Leu bioRxiv preprint preprint bioRxiv

A FIGURE 5 FIGURE

D C bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. FIGURE 6

nucleus

NSUN-1

NSUN-2

NSUN-5 UUG NSUN-4

CUG ?

healthy organism regular ribosome speed regular protein synthesis

developmental delay, ribosome pausing reduced reduced brood size at Leu and Pro codons translation efficiency

UUG NSUN-1

CUG NSUN-2

NSUN-5

NSUN-4

nucleus bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

SUPPLEMENTARY FIGURE 1

A B 100 ]

Empty vector nsun-1 nsun-2 50 Fertile adults [%

0

nsun-4 nsun-5 ild type nsun-1 nsun-2 nsun-4 nsun-5 W

C HaeIII-treated F1 from nsun-2+/- HaeIII-treated F1 from nsun-4+/- HaeIII-treated F1 from nsun-1+/-

+/+ -/- +/- -/- +/- +/+ +/- -/- +/+

1273 bp 730 bp 543 bp 443 bp 336 bp 245 bp 228 bp 188 bp 108 bp

F1 from nsun-5+/- D tm3898 +/+ -/- +/- 928 bp deletion NSUN-5 P1 nsun-5a P2 928 bp 2298 bp nsun-5b deletion 1370 bp 1078 bp nsun-5c

P1

P2 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

SUPPLEMENTARY FIGURE 2

A C: 34 48

wild type

nsun-2

B C C: 2381 C: 2982

wild type

wild type

nsun-1

nsun-1

nsun-5

nsun-5 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

SUPPLEMENTARY FIGURE 3

B0334.18 F02D10.15 F26H11.9 Energy -18.2 Energy -19.3 Energy -16.7

A U A C T A C 40 C G C G T G G T G C U A A 30 C C T A 5 U m C A U U G C 40 G C A A G C U G G G T 50 U G A C C C G C C 30 G T T C U C G T C A G T G A U G 5 C 5 G m C U A C A C U G 40 m C 50 20 G U G A C G C G A A U C C C C C A T 30 U G U T G A 20 A G C G U A G U A A G U 60 G C A C C A T 60 A G T G G U A U C C G U G 20 G G C C G G C A G U A T C 50 G U A 10 C G A G T A U A 10 T A U G U A T A C U A C 70 U A A U U C G G C U G C G U 10 U A T 70 U A G G T A U U 60 G G T U G C G U U A T A A T C U U T G U C G T A G U U

80

U U A U U U 30 A C G U G C C G ZK596.5 G C F23F12.15 5 U G G G 40 m C C G Energy -29.9 U C Energy -16.1 A U 40 50 G U A C U U 30 G 60 A G G U C C U U G G U 5 C m C G C U U G A 20 A G G G U U A G G C U 50 C U A U C

U C A A A C U C G U U C G A U U A G A A U A A G C U C U C U 20 C 70 A C U 60 A U U C U G U G G G G G U G U C A U A C U A C G C C G A U C U G A G U U U C C G A U C 70 G G U U G A G A U G U A U 10 U 10 U U 80 U C

Probability >= 99% 99% > Probability >= 95% 95% > Probability >= 90% 90% > Probability >= 80% 80% > Probability >= 70% 70% > Probability >= 60% 60% > Probability >= 50% 50% > Probability bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

SUPPLEMENTARY FIGURE 4

A B

500 30 400

300 20

200

No. reads 10

100 Reads 27bp

0 0 26 28 30 32 −50 -12 0 50 Read length Position Relative to Translation Start

C wild type 20C noNSUN 20C wild type 27C noNSUN 27C

D E

RNA-seq Ribo-seq

●● 3 10 1 2 ●● 2 ●● 3 ●● wt 20C 2 3 ●● wt 27C iance

1 r 5

wt 20C a 1 ● wt 27C ●● ● 1 v ●● 1 2 0 ●● ●● 3 ● ●● 2 2 ● 0 −1 2 1 2 3 3 ●● ●● ● ●● ●● ● 3 ●● 1 ● ● ●● 3 PC2: 20% PC3: 6% variance noNSUN 20C −2 noNSUN 20C 3 ● −5 ● 2 ●● 1 ●● noNSUN 27C −3 noNSUN 27C 1 ●● −5 0 5 10 −6 −3 0 3 PC2: 32% variance PC1: 36% variance bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. SUPPLEMENTARY FIGURE 5

RNA-Seq

TFTF:M07154_1Factor: elt−3; motif: TCTTATCA; match class: 1 2 KEGGKEGG:00280Valine, leucine and isoleucine degradation 1 GO:MFGO:0051879Hsp90 protein binding 0 GO:MFGO:0031072heat shock protein binding −1 GO:MFGO:0004197cysteine−type endopeptidase activity GO:MFGO:0004175endopeptidase activity −2 GO:CCGO:0031428box C/D snoRNP complex GO:CCGO:0005764lysosome GO:CCGO:0000323lytic vacuole GO:BPGO:0019752carboxylic acid metabolic process MIRNAMIRNA:cel−miR−1020−3pcel−miR−1020−3p KEGGKEGG:04212Longevity regulating pathway − worm KEGGKEGG:04142Lysosome KEGGKEGG:01212Fatty acid metabolism KEGGKEGG:00640Propanoate metabolism GO:MFGO:0051082unfolded protein binding GO:MFGO:0016215acyl−CoA desaturase activity GO:MFGO:0004768stearoyl−CoA 9−desaturase activity GO:BPGO:0072330monocarboxylic acid biosynthetic process GO:BPGO:0035967cellular response to topologically incorrect protein GO:BPGO:0035966response to topologically incorrect protein GO:BPGO:0034620cellular response to unfolded protein GO:BPGO:0033559unsaturated fatty acid metabolic process GO:BPGO:0030968endoplasmic reticulum unfolded protein response GO:BPGO:0009408response to heat GO:BPGO:0009266response to temperature stimulus GO:BPGO:0006986response to unfolded protein GO:BPGO:0006636unsaturated fatty acid biosynthetic process GO:BPGO:0006633fatty acid biosynthetic process WT GO:BPGO:0006631fatty acid metabolic process noNSUN 0 1 2 3 4 5 WT noNSUN WT noNSUN -Log10 (P-Value) 20oC 27oC

Ribo-Seq

GO:BPGO:0071310cellular response to organic substance

GO:BPGO:0070887cellular response to chemical stimulus 2 GO:BPGO:0033554cellular response to stress 1 GO:BPGO:0010033response to organic substance 0 −1 evity regulating pathway − multiple species −2 KEGGKEGG:04141Protein processing in endoplasmic reticulum GO:MFGO:0051082unfolded protein binding GO:MFGO:0045735nutrient reservoir activity GO:MFGO:0042302structural constituent of cuticle GO:MFGO:0005319lipid transporter activity GO:MFGO:0005198structural molecule activity GO:CCGO:0032991protein−containing complex GO:CCGO:0005581collagen trimer GO:CCGO:0005576extracellular region GO:BPGO:0035967cellular response to topologically incorrect protein GO:BPGO:0035966response to topologically incorrect protein GO:BPGO:0034976response to endoplasmic reticulum stress GO:BPGO:0034620cellular response to unfolded protein GO:BPGO:0030968endoplasmic reticulum unfolded protein response GO:BPGO:0010876lipid localization GO:BPGO:0009628response to abiotic stimulus GO:BPGO:0009408response to heat GO:BPGO:0009266response to temperature stimulus GO:BPGO:0006986response to unfolded protein GO:BPGO:0006950response to stress WT GO:BPGO:0006869lipid transport noNSUN 0.0 2.5 5.0 7.5 10.0 12.5 WT noNSUN WT noNSUN -Log10 (P-Value) 20oC 27oC bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

SUPPLEMENTARY FIGURE 6

RNA-Seq

GO Term: Molecular Functions

T22B7.7 T25C12.3 0.100 lys−4 spp−17 spp−14 pho−14 0.075 cyp−14A5 structural constituent of cuticle F54E2.1 F54F7.2 rrn−2.1 2 0.050 col−20 1 col−8

F35E12.5 0 0.025 dod−23 smd−1 −1 col−80 0.950 0.975 1.000 1.025 C45B2.1 −2 noNSUN noNSUN wild type wild type 20oC 27oC 27oC 20oC

Ribo-Seq

K07H8.10 spp−14 fasn−1 daf−21 daf−21 ZC395.10 GO Term: Molecular Functions ZC395.10 cr t−1 cr t−1 T25C12.3 6 structural molecule activity nap−1 his−22 his−15 his−11 3 pe rm−2 sip−1 structural constituent of cuticle rpl−11.1 rps−18 0 ubq−1 rpl−35 osm−11 rpl−12 −3 structural constituent of ribosome rpl−4 sqt−3 dod−23 RNA binding ubq−2 −6 pqn−59 −5.0 −2.5 0.0 2.5 col−119 col−140 col−122 col−181 2 rpl−19 K08D12.6 1 vha−12 cgh−1 0 far−2 rps−8 rpl−33 −1 ret−1 rpl−39 −2 noNSUN noNSUN wild type wild type 20oC 27oC 27oC 20oC bioRxiv preprint doi: https://doi.org/10.1101/2020.03.21.001735; this version posted March 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

SUPPLEMENTARY FIGURE 7

2.0

1.5

1.0

0.5 Log2( TE + 1) 0.0 0.5 1 1.5 1.6 1.8 2.1 2.2 2.3 2.4 2.5 2.6 2.7 Leucine Enrichment

10.0

7.5

5.0

2.5 Log2( TE + 1) 0.0 0.5 1 1.5 2 3 3.5 3.7 3.9 4.1 4.3 4.5 4.7 4.9 5 Proline Enrichment 27 20 27 20 nsun WT