Taxonomic, Bioacoustic and Faunistic Data on a Collection of Tettigonioidea from Eastern Congo (Insecta: Orthoptera)

Zootaxa 3785 (3): 343–376 ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2014 Magnolia Press ISSN 1175-5334 (online edition) http://dx.doi.org/10.11646/zootaxa.3785.3.2 http://zoobank.org/urn:lsid:zoobank.org:pub:730A6AE5-C1C1-414E-8AF6-3C38139B5AE1 Taxonomic, bioacoustic and faunistic data on a collection of Tettigonioidea from Eastern Congo (Insecta: Orthoptera)

KLAUS-GERHARD HELLER1,5, CLAUDIA HEMP2, CHUNXIANG LIU3 & MARIANNE VOLLETH4 1Grillenstieg 18, 39120 Magdeburg, Germany 2Department of Animal Ecology and Tropical Biology, Biocenter, University of Würzburg, Am Hubland, 97074 Würzburg, Germany 3Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China 4Department of Human Genetics, Otto von Guericke University, 39120 Magdeburg, Germany 5Corresponding author. E-mail: [email protected]

Abstract

During a 14-day excursion in March 1990, 28 species of tettigonioids were found at Irangi (1º54’S, 28º27’E), ca.100 km north west of Bukavu at Lake Kivu (Democratic Republic of the Congo, formerly Zaire), and at other localities near Bu- kavu. One species —Arantia (Arantia) gracilicercata Heller sp. n. — is new to science, another one—Pantecphyllus helleri Schmidt et al. 2004—was already described as new in a generic revision. All our specimens of the morphologically quite diverse and sexually dimorphic phaneropterine genus Arantia were studied using molecular methods. We propose a new subgenus Arantia (Euarantia) Heller subgen. n. based on relative tegmen width. Songs and stridulatory organs were studied in 9 species. Two phaneropterines, Horatosphaga leggei and Pardalota asymmetrica, showed remarkable calling songs lasting more than 10 s and produced by quite complicated stridulatory movements. The song of the large phaneropterine Zeuneria biramosa is noteworthy because of its unusually low carrier frequency of 3.7 kHz. Based on the exami- nation of other specimens and species, some taxonomic changes are proposed (Phaneropteridae Burmeister, 1838 stat. rev.; Afromecopoda monroviana (Karsch, 1886) stat. rev.; Leproscirtus ebneri Karny, 1919, syn. n., Leproscirtus karschi Karny, 1919, syn. n., Leproscirtus granulosus aptera Karny, 1919, syn. n., all synonyms of Leproscirtus granulosus (Karsch, 1886); Lanistoides Sjöstedt, 1913 stat. rev.; Plastocorypha cabrai Griffini, 1909 stat. n.).

Key words: taxonomy, bioacoustics, stridulatory movement, song, ITS2 gene, histone H3 gene, 16S rRNA gene, 28S rRNA gene, numts

Introduction

While for parts of Africa (South and East) many new studies on at least some groups of Orthoptera are available (see e.g., Naskrecki & Bazelet 2012, Hemp 2013), in other regions no new data have become available since the time the respective countries became independent in the last century. Even if relative recent publications existed, they are often based on material collected during colonial times. One of these regions is the Central African rain forest block in Congo basin. For this huge region only four papers focusing on Orthoptera were published after 1970 (according to Ingrisch & Willemse 2004, updated, and to own literature data, in both search for “Congo”), except for the studies of Schmidt on the pseudophylline genus Pantecphylus (Schmidt et al. 2004, Schmidt 2006a, b). Schmidt studied old material in different museums and used specimens and data collected during our excursion in the year 1990 (see below). Concerning Tettigonioidea, the last new species in the Congo area seems to have been collected in 1961 (Enyaliopsis monsteri; Glenn 1991). Even faunistic and behavioural data are rare, and acoustic recordings do not exist except for the above mentioned Pantecphylus and for Karniella crassicerca (Hemp et al. 2010a), which was also collected during this 1990 excursion. In the following, we present additional orthopterological results from this journey. In spring 1990, a group of four biologists (KGH, MV, Carmen Liegl (Weber), Alois Liegl) made an excursion to the Kivu region of Congo (Zaire) and Rwanda, mainly looking for bats. The area is biogeographically especially interesting because here the

Accepted by D. Rentz: 7 Feb. 2014; published: 4 Apr. 2014 343 fauna of the West-Central African rain forest overlaps with that of the East African highlands. We spent most of the time in the Centre de Recherche en Sciences Naturelles in Irangi (ca. 100 km northwest of Bukavu). The station, according to local information built for and used by the Belgian king or his representatives, still existed at that time in a relative suitable condition. Since we spent only 12 days at this place in the rain forest, our faunal list for Irangi (see Table 1) may be very far from complete. Aim of this study is to provide new faunistic data on the Tettigonioidea from that area, to present information about the songs and to improve the taxonomic situation.

TABLE 1. List of recorded species. Locality Horatosphaga leggei (Kirby, 1909) B C D Pardalota asymmetrica Karsch, 1896 C Monticolaria sp. C Arantia (Arantia) gracilicercata n.sp. A Arantia (Euarantia) congensis Griffini, 1908 A Zeuneria biramosa Sjöstedt, 1929 A Cestromoecha tenuipes (Karsch, 1890) A Tetraconcha sp. A Phaneroptera sparsa Stål, 1856 A Tylopsis brevis Ragge, 1964 B C Oxyaspis congensis Brunner v. Wattenwyl, 1895 A Zabalius apicalis inversus Beier, 1957 A Pantecphylus (P.) helleri Schmidt, Stelzer, Marshall, 2004 A Batodromeus subulo (Karsch, 1893) A Lichenochrus congicus Rehn, 1914 A Afromecopoda preussiana (Karsch, 1891) A cf. Anoedopoda erosa Karsch, 1891 A Leproscirtus granulosus (Karsch, 1886) A Hexacentrus karnyi Griffini, 1909 A Meconematinae indet. A Conocephalus inaequalis Uvarov, 1928 A Conocephalus sp. A Karniella bullata Rehn, 1914 C Karniella crassicerca Hemp, 2010 B D Plastocorypha brevipes Rehn, 1914 A Ruspolia flavovirens (Karny, 1907) A Ruspolia fuscopunctata (Karny, 1907) A

Methods

Determination was mainly made on the basis of literature, but some difficult specimens were also compared to material in the Museum für Naturkunde, Berlin (MfN), The Natural History Museum, London (NHM) and Museum national d’Histoire naturelle, Paris (MNHP). Most specimens are stored in ethanol (dry: CH3293, CH4935–54, 69–73) and deposited in the Collectio Heller (CH) except otherwise stated. The stridulatory file of H. leggei was studied using a scanning electron microscope (Fa. ETEC, Autoscan). In the field sounds were recorded using a cassette tape recorder (Sony WM-D3) with microphone Uher M 645

344 · Zootaxa 3785 (3) © 2014 Magnolia Press HELLER ET AL. (frequency response up to 10 (15) kHz). In the laboratory sound recordings were made with a Racal store-4 DS tape recorder, with microphones Brüel & Kjaer 4133 and 4135 (frequency responses flat up to 40 and 70 kHz respectively). After digitizing the songs on a PC or Apple computer, oscillograms (after filtering) and sound analyses were done using a PC and the software Turbolab and Amadeus (Apple). Wing movements were registered by an opto-electronic device (Helversen & Elsner 1977, modified as in Heller 1988). Song terminology. Calling song: song produced by an isolated male. Syllable: the sound produced by one complete apart (opening hemisyllable) and together (closing hemisyllable) stroke of the wing. Echeme: a first- order assemblage of syllables. Impulse: a simple, undivided, transient train of sound waves (here: the highly damped sound impulse arising as the impact of one tooth of the stridulatory file). Molecular analysis. DNA taxonomy was used to auxiliarily identify Arantia female specimens due to significant sexual dimorphism. Seven specimens of Arantia species and one outgroup Lunidia viridis Hemp, 2010 were involved (Table 2). Both, the specimen of Arantia fasciata (CH7504) and that of Lunidia viridis (CH6817) were collected in TANZANIA: Mount Kilimanjaro, near Kidia, by C. Hemp. Firstly, DNA was extracted from the muscles of one mid leg using the Qiagen DNeasy Blood and Tissue kit following the standard protocol provided by the manufacturer. Then, the 16S rRNA gene, the cytochrome oxidase subunit I gene (cox1), nuclear histone H3 gene (H3), 28S rRNA gene and ITS2 were amplified by polymerase chain reaction (PCR). The following primers were used:16a: 5_-CGC CTG TTT ATC AAA AAC AT-3_ and 16b: 5_- CTCCGGTTTGAACTCAGATCA -3_ for the 16S rDNA (Bybee et al., 2004), LCO1490: (5_-GGT CAA CAA ATC ATA AAG ATA TTG G-3_) and HCO2198 (5_-TAA ACT TCA GGG TGA CCA AAA AAT CA-3_) for the cox1 gene (Folmer et al., 1994), H3fwd: 5_-ATG GCT CGT ACC AAG CAG ACG GC-3_ and H3rev: 5_-ATA TCC TTG GGC ATG ATG GTG AC-3_ for the histone H3 gene (Colgan et al., 1998), Rd4.2a: 5’ CTAGCATGTGYGCRAGTCATTGG 3’ and Rd5b: 5’ CCACAGCGCCAGTTCTGCTTAC 3’ for the 28S rRNA gene (Whiting, 2002), ITS2-F: 5 TGAACATCGACATTTTGAACGCACAT 3 and ITS2-R 5 TTCTTTTCCTCCSCTTAYTRATATGCTTAA 3 for the ITS2 sequence. The reaction was conducted using TaKaRa ExTaq™ (Takara, Dalian, China), with the following cycling conditions: an initial denaturation at 94°C for 3 min, followed by 36 cycles of denaturation at 94°C for 30 s, annealing at 45–60°C for 30 s, and extension at 72°C for 1 min, with a final elongation at 72°C for 6 min after the last cycle. After purification with AxyPrep™ DNA Gel Extraction Kit, most PCR products were directly sequenced, and other fragments were cloned into the pGEM-T Easy vector (Promega, USA) prior to sequencing. The sequences were aligned with the ClustalW (Thompson et al., 1994) software in BioEdit (Hall, 2005). All sequences were deposited in GenBank under the accession numbers given in Table 2. Fragments of the 16S rDNA (482bp), 28 rDNA (443), cox1 (633 bp), H3 (293bp) and ITS2 (313bp) were obtained for the sequence analysis. Evolutionary divergences, which were indicated through pairwise distance between sequences and the mean net distance between species, were conducted in MEGA5 (Tamura et al. 2011). Multiple substitutions were corrected using Kimura’s two-parameter model (Kimura, 1980). The rate variation among sites was modeled with a gamma distribution (shape parameter = 1).

TABLE 2. Taxon sampling with voucher number (#) and GenBank accession number for each gene. taxon Voucher 16S H3 COI 28s ITS2 Lunidia viridis CH6817 KJ620793 KJ620815 KJ620814 KJ620800 KJ620823 Arantia fasciata CH7504 KJ620794 KJ620816 KJ620809 KJ620801 KJ620824 Arantia congensis CH4991 KJ620795 KJ620818 KJ620813 KJ620804 KJ620827 Arantia congensis CH4992 KJ620817 KJ620808 KJ620825 Arantia congensis CH4943 KJ620796 KJ620819 KJ620807 KJ620805 KJ620826 Arantia gracilicercata. CH4939 KJ620797 KJ620822 KJ620810 KJ620806 KJ620829 Arantia gracilicercata CH4994 KJ620798 KJ620820 KJ620811 KJ620802 KJ620828 Arantia gracilicercata CH4998 KJ620799 KJ620821 KJ620812 KJ620803 KJ620830

For occurrence of numts (nuclear mitochondrial DNA segment) of cox1 genes, they were excluded in the phylogenetic analysis. The other four fragments are concatenated for phylogenetic analysis. Bayesian inferences (BI) methods were performed with MrBayes 3.2 (Ronquist & Huelsenbeck, 2003) to reconstruct phylogenetic tree,

TETTIGONIOIDEA FROM EASTERN CONGO Zootaxa 3785 (3) © 2014 Magnolia Press · 345 using the concatenated dataset which was partitioned by gene through the software PartitionFinderV1.1.1_Windows (Lanfear et al., 2012) for the BI searches. Two sets of four Markov chain Monte Carlo (MCMC) were run for 1,000,000 generations and sampled every 100 generations with a burn-in of 25%. Stationarity was thought to be reached until the average standard deviation of split frequencies was less than 0.01. Bayesian posterior probabilities (BPP) were estimated on a 50% majority rule consensus tree of the remaining trees. Sequences were deposited in Genbank with the accession numbers given in Table 2. Localities. In addition to our activity at the Centre de Recherche en Sciences Naturelles in Irangi (“ca.100 km west of Bukavu” on labels, should be better north west instead of west) [A] (13–25.iii. 1990; 1º54’S, 28º27’E; 850 m a.s.l.), we collected some specimens at Poste Patrol (national park Kahuzi Biega) [B] (25.iii. 1990; 2º22’S, 28º25’E) and at Tshivanga (entrance national park Kahuzi Biega near Bukavu) [C] (19. + 26.iii. 1990; 2º22’S, 28º25’E; ca. 2100 m a.s.l.). Outside Congo (Zaire) we found some interesting specimens just across the border in Rwanda, at Nyungwe Forest Reserve near Cyangugu [D] (10. + 29.iii. 1990; 2º30’S, 29º18’E; 2500 m a.s.l.). The vegetation around Irangi is described by Dieterlen (1978). The station at the river Luhovo is situated in tropical rain forest, phytosociologically subgroup Gilbertiodendretalia dewevrei, with an annual mean temperature of 21ºC (absolute extremes in single measurements 16 to 26ºC) at 1.5 m above ground within the forest and a mean annual precipitation of 2600 mm (all data Dieterlen 1978).

Abbreviations. OSF Orthoptera Species File (Eades et al. 2013)

Results

Phaneropteridae

Phaneropteridae Burmeister, 1838 stat. rev.

In contrast to the opinion of Ragge (1968: p.78), we proclaim to re-establish family status for Phaneropteridae. Ragge proposed his idea of a subfamily treatment explicitly based on the work of Ander (1939) who subdivided his superfamily Tettigonioidea into six families, Rhaphidiphoridae, Schizodatylidae, Gryllacrididae, Stenopelmatidae, Prophalangopsidae and Tettigoniidae. Phaneropteridae as a family would not be equivalent to these groups. However, at present these families are considered as belonging to five different superfamilies, with only Gryllacrididae and Stenopelmatidae united in Stenopelmatoidea (see OSF for references). So Ander’s system has considerably changed, and his families are now more or less equal to superfamilies. Ander did not consider any grouping within his Tettigoniidae. Recently, however, the first molecular trees within the Tettigoniidae have been published (e.g., Mugelston et al. 2013) presenting hypotheses about the relationship of the subgroups of Tettigonioidea (Tettigoniidae). This tree supports the assumption of Gorochov (1995: 93) –based on palaeontology that the mainly plant-feeding Phaneropterinae, Pseudophyllinae (except Pterochrozini; Mugelston et al. 2013), Mecopodinae and Phyllophorinae are one natural unit (clade B; Mugelston et al. 2013). Therefore it is appropriate to give this group family status in our opinion, and we suggest to call it Phaneropteridae (with four subfamilies). Both Phaneropteridae and Pseudophyllidae date back to Burmeister (1838), but Phaneropteridae/inae is by far the most important and species-rich group. The remaining bush-cricket subfamilies are considered as subfamilies of Tettigoniidae until more data are available.

Phaneropterinae

Within Phaneropterinae a series of tribes exist, based mainly on Brunner von Wattenwyl’s groups (1878). He used, for example, presence or absence of a coxal spine or/and the shape of the ears in the fore tibia as important diagnostic characters. Ragge (e.g. 1960) and Gorochov (e.g. Gorochov & Kang 2002) expressed doubts several times that these groups represent natural units, but unfortunately nobody proposed better solutions at present. So we will here continue to use Brunner’s characters and his grouping because it seems to be the best (and only) way to group similarly looking genera together.

Horatosphaga leggei (Kirby, 1909)

[B] CH4946–50 3 ♂, 2 ♀; [C] CH4976–7 2 ♂; [D] CH4940–42, 78–81 7 ♂ H. leggei (Fig. 1A) can be easily identified by the broad tegmina and the characteristic venation (Ragge 1960). Its calling song has been already presented as oscillogram by Ragge (1968; male from Uganda, recorded by W.J. Bailey). Song. The characteristic calling song was recorded in the field and in the laboratory. In Fig. 2 a registration of the stridulatory movement is shown. As in the two other available recordings, the animal very slowly changed its position during singing, and this displacement is reflected as a continuous upward change of the baseline (until about the 6th second and continued at the end). It is not connected with the stridulatory movement. Between the 9th and 11th second the amplifier settings were slightly changed manually. The male starts its song (Fig. 2, 3) by slowly opening the wings and beginning with fast, oscillating movements of small amplitude. During opening and closing, sound impulses of similar amplitude are produced (microsyllables A). After a few hundred milliseconds, the oscillating movement stops and the wings are nearly completely closed. During this movement a series of soft impulses are also produced. Then a series of distinct movements follows, again with small amplitude. The series of impulses is less dense than in the first phase, but the impulses produced during the closing movement have larger amplitudes (microsyllables B). During this period (or its end) the wings are more or less gradually opened again. The duration of both parts, but especially of the second, varied greatly between recordings. This alternation is repeated several times (again variable in number), but the impulses produced during the large closing movement become increasingly louder. After some time, at first a second large closing movement is added immediately after the first (at 6–7 s in Fig. 2; Fig. 3), and the period of fast movements becomes shorter, then typically a series of large movements with loud impulses follows (macrosyllables), until after a final short series of fast movements only large closing movements can be observed. During this period, the impulses produced during the opening movements are much softer than that during closing. After some seconds the wing movements become more slowly in rhythm and the sound softer, until the song dies away. Surprisingly the spectral composition of the song is not the same in all parts. During the fast oscillating movements, in the spectrum low frequency components are visible, which are not found in any other part of the song (see Fig. 3, 4) except at the beginning of the large closing movement. Possibly some parts of the tegmina are put into vibration only if the wings are very wide open and the scarper touches the outermost parts of the file. Since nothing is known about the behaviour of the species, it is too early to speculate about a biological significance of the frequency differences. The main sound energy was found in a band at about 10 to 15 kHz. W.J Bailey mentioned (pers. comm.) that puncturing the tegmina would diminish the intensity of the song strongly, but judging from the shape of the spectrum there does not seem to be one single sharply tuned resonator. In the right tegmen, there is no obvious mirror (Fig. 5 B; compare the situation in Zeuneria biramosa Fig. 5 C). The stridulatory file does not show any irregularities (Fig. 5 A). Starting from the outer edge of the tegmen, the teeth (n = 88; one specimen) become broader towards the middle and more narrow again near the articulation.

Pardalotini Brunner von Wattenwyl, 1878

The Central African Pardalotini is a small tribe containing species without a fore coxal spine.

Pardalota asymmetrica Karsch, 1896

[C] CH4953–4, CH4961–64 5 ♂♂, 1 ♀ The mainly black and white coloured animals (with orange markings on legs and pronotum) have a distinctive threatening display (Fig. 1 B). They open the elevated wings to some extent, go down with the head towards the ground and bulge the brightly orange skin of the neck as it is done also by disturbed Acripeza reticulata (Rentz 2010). Possibly they are imitating a wasp or another Hymenopteran (see the wasp-imitating phaneropterine

TETTIGONIOIDEA FROM EASTERN CONGO Zootaxa 3785 (3) © 2014 Magnolia Press · 347 Aganacris for a similar wing coloration; Nickle 2012). This idea is supported by the black antennae, marked with white rings only in large intervals. However, even the nymphs present orange and black colours (Fig. 1 C), so that an own chemical defence should not be completely excluded. The eggs are flat as typical for Phaneropterinae (Bey-Bienko 1954), and relatively oblong (4.7 mm long, 1.8 mm width, 0.9mm thick; one dark brown egg, in ethanol).

FIGURE 1. Habitus. A—Horatosphaga leggei, B—Pardalota asymmetrica, C—Pardalota asymmetrica, ♀ nymph, D— Arantia congensis ♂ CH4991 , E—Arantia congensis ♀ CH4943, F—Arantia congensis ♀ nymph, G—Zeuneria biramosa, H—?Tetraconcha sp. ♀ (A, F photos Alois Liegl).

348 · Zootaxa 3785 (3) © 2014 Magnolia Press HELLER ET AL. FIGURE 2. Oscillograms of stridulatory movements and song [synchronous registration of left tegmen movement (upward deflection represents opening, downward closing) and sound; 15 s sequence]. In the first half of the recording of H. leggei, the stridulatory movement is superimposed by a slight body movement, mimicking a continously increasing opening of the tegmina.

Song: In the field and in the laboratory two different types of song could be heard. The short song (about 0.5–2 s; Fig. 6) was heard quite often, while the complicated long song (8–28 s; 4 complete recordings) was presented only in much larger intervals. At the beginning of the short song an animal typically sings microsyllables by opening the tegmina silently and producing few impulses only during a part of the closing movement. After a variable number of these elements, increasing in amplitude, the animal switches to macrosyllables and during the whole closing movement impulses are produced (Fig. 7 A). The syllable repetition rate decreases only very slightly from 23 to 21 Hz (T > 29ºC). Mostly there are one or a few intermediate syllables in between. At the end of a short song sometimes microsyllabes are added or even another series of micro- and macrosyllables (observed once in a field recording). A long song (Fig. 2) starts with macrosyllables of low amplitude and short duration, but they become quickly longer and louder and remain so for several (up to many) seconds (syllable repetition rate 23 Hz). After some time the animal switches (Fig. 6, 7 B) to another syllable type which looks like a combination of a micro- and a macrosyllable. After a series of impulses one separate impulse (8–10 ms interval) is following. These syllables are repeated for about 2 to 4 s at a repetition rate of 37 Hz. After some intermediate syllables (Fig. 7 C) the final syllable sequence (0.5 to 1 s duration) is enclosed where very loud isolated impulses are produced, similarly as in the microsyllables, but with a much higher intensity, higher movement amplitude and higher repetition rate (55 Hz). The stridulatory file did not show any irregularities.

Odonturini Brunner von Wattenwyl, 1878

The tribe Odonturini should probably contain only the genus Odontura (Grzywacz et al. 2014), although it includes at present another 11 genera in OSF rather than the genus Monticolaria. However, we think Monticolaria represented by the specimen at hand fits well into the tribe in its present understanding.

TETTIGONIOIDEA FROM EASTERN CONGO Zootaxa 3785 (3) © 2014 Magnolia Press · 349 FIGURE 3. Detail of calling song of Horatosphaga leggei. Oscillograms of stridulatory movements and song [synchronous registration of left tegmen movement (upward deflection represents opening, downward closing) and sound; 1.5 s sequence], combined with a sonographic evaluation (2 kHz high pass; T> 25.5ºC).

Monticolaria sp.

[C] CH4874 ♀. Our single female is very similar to females of other Monticolaria species. A present, however, there is not enough information to distinguish it from females of Atlasacris peculiaris Rehn, 1914 with its type locality not far away.

Arantiini Brunner von Wattenwyl, 1878

Brunner von Wattenwyl (1878) established this group for the single genus Arantia Stål. However, the description that indicates conchate tympana on both sides of the fore leg tibia (key, p. 17: “tibia anticae foraminibus rimatis instructae”, p. 136: “Vorderschienen tragen auf beide Seiten sehr verengte, beinahe geschlossene Gehöröffnungen”; p. 137: “spaltenförmige Gehörorgane”), is inconsistent with the Latin diagnosis (p. 136: “foraminibus utrinque vel in latere antico rimatis” =ears slit open on both sides or on the inner one). From the following descriptions of the species it can be seen the diagnosis is correct. A. fasciata (as A. spinulosa) possess open tympana on both sides, but A. rectifolia asymmetrical ones. Brunner von Wattenwyl provided the genus description obviously mainly based on A. fasciata (as A. spinulosa) and restricts the genus to occur in South Africa, although only one species is found there. In his key to genera Chopard (1955) described Arantia as having asymmetric ears: “tympans differents, les externs ouverts, les internes en forme de fente”, as in Karsch (1889): “Foramina der Vorderschienen ungleich” - foramina of the fore tibiae uneven.

350 · Zootaxa 3785 (3) © 2014 Magnolia Press HELLER ET AL. FIGURE 4. Frequency spectra of calling songs. In Horatosphaga leggei, the black line respresents the evaluation of a 50 ms part of the song during the production of microsyllables A, the solid part that of a 50 ms part during the production of macrosyllables (same scale).

TETTIGONIOIDEA FROM EASTERN CONGO Zootaxa 3785 (3) © 2014 Magnolia Press · 351 FIGURE 5. A—Stridulatory file of Horatosphaga leggei (articulation below), B—Base of right tegmen of Horatosphaga leggei, C—Base of right tegmen of Zeuneria biramosa, D—Stridulatory file of Zeuneria biramosa (articulation below). Scales 0.5 mm.

FIGURE 6. Pardalota asymmetrica. Oscillograms of stridulatory movements and song [synchronous registration of left tegmen movement (upward deflection represents opening, downward closing) and sound; 4 s sequence: T> 29ºC].

Accepting the view of Karsch and Chopard, our specimens, showing also the asymmetric condition, can be easily identified as belonging to Arantia (without fore coxal spine and having only very small styli on the subgenital plate, sometimes even missing completely as in A. manca Bolivar 1906). However, during identification we were puzzled because at the first glance it seemed unlikely that our species, looking so differently, should belong to the same genus. After comparing descriptions and pictures it became obvious that Arantia is a quite heterogenous group. Again, Brunner von Wattenwyl (1878, 1891) may not have noticed this variability as he refers in the description of the group to the very broad tegmina, not found even in the type species. To facilitate identification we propose to split the genus in two subgenera based on tegmen width and hind femora curvature.

352 · Zootaxa 3785 (3) © 2014 Magnolia Press HELLER ET AL. FIGURE 7. Pardalota asymmetrica. Detail of short (A) and long (B, C) song (see text). Oscillograms of stridulatory movements and song [synchronous registration of left tegmen movement (upward deflection represents opening, downward closing) and sound; 0.3 s sequence: T> 29ºC].

FIGURE 8. Arantia phylogenetic tree derived from MrBayes inference analysis of four concatenated sequences (16S, 28S, H3, ITS2). The asterisk indicates that BPP value is 100%. Lunidia viridis Hemp, 2010 was used as outgroup.

Subgenus Arantia (habitus see Fig. 9, for example)

Tegmina narrow (below 12 mm width; 7–12 mm), also when considered in relation to the pronotum (see Table 3 for measurements). In general medium-sized species with nearly straight hind tibiae. The cerci of most species of this subgenus (except simplicinervis and hydatinoptera) have a strong internal/dorsal tooth. For most species, males and females (except A. manca) are known.

TETTIGONIOIDEA FROM EASTERN CONGO Zootaxa 3785 (3) © 2014 Magnolia Press · 353 TABLE 3. List of Arantia species and assignment to subgenera (measurements in mm; data from descriptions except *) Hind femur. Tegmen Pronotum Relative tegmen length width Subgenus/species ♂ ♀ length width ♂ ♀ mean. Width/ pronot. ♂/♀ ♂/♀ Arantia angustipennis Chopard, 1954 25.5 37.5 8.7 5.5 1.6 brevipes Chopard, 1954 22.5 22 38 12 7 6.5 6.8 1.8 dentata Saussure, 1899 29 48 10 7.5 1.3 fatidica (Stål, 1873) 28 39 11 5.5 1.8* gestri Griffini, 1906 26.5 42/50 11.8 6.8 6.7 6.75 1.8 gracilicercata n. sp. CH4939** 25.5 38 (7) 5.3 1.3 gracilicercata n. sp. CH4994** 27 43 10.5 6.3 1.7 gracilicercata n. sp. CH4998** 26.5 38 9.0 5.8 1.6 hydatinoptera Karsch, 1889 28 27 49/39 10 8 6 7 1.4 leptocnemis Karsch, 1890 28 28.5 45 7.8/9 7 5.8 6.4 1.3 manca Bolivar, 1906 28 36 7 6 1.2 orthocnemis Karsch, 1890 29 29 11 7.5 7.2 7.35 1.5 s. simplicinervis Karsch, 1889 28 27 44/45 9/11 6.5 6.7 6.6 1.5 simplicinervis curvata Griffini, 1908 29.8 46.8 11 6.6 1.7 Euarantia accrana Karsch, 1889 28 53 13.5 7 1.9 congensis Griffini, 1908 37 51/52 18 7 7.2 7.1 2.6 congensis Griffini, 1908 CH4991** 31 50 17 7 2.4 congensis Griffini, 1908 CH4943** 36 54 19 7.5 2.6 congensis Griffini, 1908 CH4992** 33 48 17.5 6.5 2.7 excelsior Karsch, 1889 26 55 15 8 1.9 fasciata (Walker, 1869) 2.6* syn. atrolineata Brunner v. W. 1891 41 37.5 72/75 24 10 9.9 9.95 2.4 syn. spinulosa Brunner v. W. 1878 34 38 57/64 20 8 8.5 8.25 2.4 gabunensis Brunner v. W. 1891 35 64 19.5 9.3 2.1 incerata Karsch, 1893 25 42 14 7.8 1.9* latifolia Karsch, 1890 32 35 45/48 16.7 7 7.5 7.25 2.3 mammisignum Karsch, 1896 33.5 69 21 9.8 2.1 marmorata Karsch, 1889 37.5 54 22 8 2.8 mauritiana Saussure, 1899 33 60 19 8.5 2.2 melanota Sjöstedt, 1902 37.2 -/52 -/15.8 8 2.0 ovalipennis Chopard, 1954 31 43 16.5 6.5 2.6 rectifolia Brunner v. W. 1878 31 55 15/17 7.8 2.0 regina Karsch, 1889 34 64.5 19 9.5 2.0 retinervis Karsch, 1889 32 31.5 47 14/15 7.5 7.85 7.7 1.9 scurra Karsch, 1896 33 52.5 13.5 7.2 1.9 tigrina Bolivar, 1906 30 56 16 8 2.0 ugandana Rehn, 1914 27 67.5 14 6 2.3

* measured from type photos in OSF, ** own data

Type species Arantia latifolia Karsch, 1890

Tegmina broad (above 12 mm width; 13.5–24 mm). In general large species with stout, curved hind tibiae (see Table 3 for measurements). As far as it is known, male cerci without distinct tooth in the basal half. For many species, however, only one sex is known. The species A. (Euarantia) fasciata (including its synonyms atrolineata and spinulosa) keys out first as the only species with almost closed tibial ears on both sides. The six specimens of our material belong to both subgenera (1 male, two females each). Since in both cases the sexes differ in important characters and it is generally not easy to find out if males and females belong to the same species (Karsch 1889), we made some genetic tests. No unexpected stop codons were found in the coding genes H3 and cox1 and no indel in the alignment of H3. Nonetheless, in the alignment of cox1 sequences, there is one insert in the sequence of the sample CH4943 of Arantia species, indicating the existence of numts in cox1. Consequently, cox1, the potential barcoding marker (Hebert et al. 2003), was excluded as indicated in some previous papers (Song et al. 2008; Moulton et al. 2010). There are 12 indels in the 16s rRNA genes alignment, two indels for the ITS2 sequence alignment and one indel for the 28S rDNA gene alignment The three nuclear fragments present lower sequence variability than 16S rRNA genes as shown in Table 4. For the species Arantia congensis (all our specimens of subgenus Euarantia; see below), the intra-species distances of ITS2 range from 0 to 0.6%, and those of the concatenated data range from 0.1% to 0.3%. For the species Arantia gracilicercata n. sp. (all our specimens of subgenus Arantia; but see below), the intra-species distances of ITS range from 0.3% to 1%, and those of the concatenated data range from 2.6-3.7%. The mean net distances between Arantia species of ITS2 sequences (3.4-9%), and those of the concatenated data (1.8-4.7%) are smaller than the corresponding distance between Arantia species and the outgroup (Table 5, 6). Consequently, ITS2 is a more suitable barcoding marker rather than cox1.

TABLE 4. Comparison of the variability of analyzed genetic markers among members of the Arantia species and outgroup. The numbers of variable and phylogenetically informative sites (variables excluding singletons) were calculated from sequence alignments of Arantia samples and outgroup. Gene/Fragment Sequence (bp) Arantia species and outgroup Variable sites Informative sites 16S 482 138 73 28S 443 5 3 H3 293 24 7 ITS2 315 36 7 Concatenated dataset 1533 203 90

Phylogenetic analysis using MrBayes inference method based on the concatenated dataset resulted in the tree topology shown in Fig. 8. Monophyly of the genus Arantia and of the species A. congensis and A. gracilicercata n. sp. is well supported with 100% BPP. However, the length of the branches in the A. gracilicercata n. sp. part of the tree are much larger than in the A. congensis part, so that several species related to A. gracilicercata n. sp. in our sample cannot be excluded. At the first glance the tree in Fig. 8 does at not support the splitting into two subgenera, but the morphologically isolated position of A. fasciata (see above) makes any conclusions appearing prematurely.

Arantia (Arantia) gracilicercata Heller sp. n.

Holotype: male (CH4939), CONGO (formerly ZAIRE), Centre de Recherche en Sciences Naturelles in Irangi holotype, ca.100 km (north) west of Bukavu [A], MfN Further material: females CH4994, 4998, same locality (in ethanol).

TETTIGONIOIDEA FROM EASTERN CONGO Zootaxa 3785 (3) © 2014 Magnolia Press · 355 TABLE 5. Pairwise distance analysis (A) and the mean net distances between species resulting from concatenated dataset (B). Pairwise distance analysis of concatenated sequences including 16S, 28S, H3 and ITS2 calculated as the proportion of non-matching sites between pairs of sequences. The mean net distances between species are displayed at the top right. Boxes group the different species. A Pairwise distance [1] L. viridis_CH6817 [2] A. fasciata_CH7504 0,087 [3] A._congensis_CH4991 0,097 0,057 [4] A._CH4943 0,100 0,058 0,001 A. congensis [5] A._CH4992 0,079 0,030 0,003 0,007 [6] A._CH4998 0,093 0,054 0,041 0,042 0,020 [7] A._CH4994 0,094 0,057 0,046 0,046 0,018 0,026 A. gracilicercata [8] A._CH4939 0,102 0,053 0,047 0,048 0,015 0,032 0,037 [1] [2] [3] [4] [5] [6] [7] [8]

B mean net distances between species [1] L. viridis [2] A. fasciata 0,087 [3] A. congensis 0,090 0,047 [4] A. gracilicercata 0,081 0,039 0,018 [1] [2] [3] [4]

TABLE 6. Pairwise distance analysis (A) and the mean net distances between species resulted from ITS2 sequences (B). Pairwise distance analysis of ITS2 sequences calculated as the proportion of non-matching sites between pairs of sequences. The mean net distances between species are displayed at the top right. Boxes group the different species. A pairwise distance [1] L. viridis_CH6817 [2] A. fasciata_CH7504 0,100 [3] A. congensis_CH4991 0,082 0,036 [4] A._CH4943 0,082 0,036 0,000 A. congensis [5] A._CH4992 0,089 0,036 0,006 0,006 [6] A._CH4998 0,093 0,040 0,010 0,010 0,016 [7] A._CH4994 0,097 0,036 0,013 0,013 0,020 0,010 A. gracilicercata [8] A._CH4939 0,089 0,036 0,006 0,006 0,013 0,003 0,006 [1] [2] [3] [4] [5] [6] [7] [8 ]

B mean net distances between species [1] L. viridis [2] A. fasciata 0,100 [3] A. congensis 0,082 0,034 [4] A. gracilicercata 0,090 0,034 0,006 [1] [2] [3] [4]

356 · Zootaxa 3785 (3) © 2014 Magnolia Press HELLER ET AL. FIGURE 9. Arantia (Arantia) gracilicercata n. sp. A—Male in lateral view, B—Male pronotum and stridulatory organs, C— Male in dorsal view, D—Male head in frontal view. E, F—Male cerci in lateral and dorsal view, G—Female in lateral view, H—Ovipositor, scale 1 mm.

TETTIGONIOIDEA FROM EASTERN CONGO Zootaxa 3785 (3) © 2014 Magnolia Press · 357 Diagnosis. In the male sex the species can easily be recognised by its long, slender cerci with strong basal tooth. Description. Male (Fig. 9 A, C). Head. Fastigium verticis about half as wide as scapus, sulcate at tip, met from below by conical fastigium frontis, leaving a gap between tips. Antennal sockets strongly margined (as typical for Pseudophyllinae; Rentz 1979) (Fig. 9 D). Scapus large, its distal half slightly inflated. Eyes circular, the diameter at base smaller than further distal. Thorax. Surface of pronotum smooth, without carinae. Fore coxa with a very small blunt spine, directed anteriorly and slightly inwards. At the lower side fore femora with 7 to 9 spinules at inner edge, mid femora with two spinules distally at anterior edge, hind femora with 4-6 spinules at both edges each. All tibiae with few to many spinules on both edges above and below. Hind tibiae slightly curved. Tibial ears in the fore legs anteriorly conchate, posteriorly open. Auditory spiracle very large, but entrance for the most part covered by paranotum. Wings. Tegmina narrow (see Table 3), rounded at tip, with black markings at the very base (Fig. 9 B). Stridulatory vein with about 100 teeth, the intervals between becoming continuously smaller from articulation to edge. Alae slightly longer than fore wings. Colour translucent-green, six white markings at irregular intervals along Media Anterior (sensu Ragge 1955). Venation see Fig. 9 A. Abdomen. Third tergite with a large tubercle, projecting anteriorly into an incision of the second tergite, possibly a gland (see e.g., by Ingrisch 2011). There are no hairs, but some material of unknown provenance covering the top of the successional tergites. Subgenital plate quite short with broad, slightly incised end, without styli. Cerci slightly inward-curved, very long and slender. Dorsally at the end of the basal quarter a strong tooth with a long and inward-curved tip (Fig. 9 E, F). In live specimens cerci probably decussate with the tips directed downwards, and the basal teeth nearly touching each other. Female. Since the females differ in the width of the tegmina from the male (see Fig. 9 G) and there are no species–specific characters except male genitalia, their affiliation to the new species is not beyond doubt (see above, Genetics). Morphology. General habitus as in male. Thorax. At the lower side fore femora with 4 to 5 spinules at inner edge, mid femora unarmed or with two spinules distally at anterior edge, hind femora with 4-6 spinules at both edges each. Wings. Tegmina broader than in male (see Table 3). Upper side of right tegmen with nine veins carrying stridulatory teeth. Abdomen. No gland-like structures at first tergites. However, last tergite dorso-posteriorly with a large protuberance, covered with hairs and an obviously sticky substance, only the most posterior part clean and smooth. Ovipositor (Fig. 9 H) short (4 mm), its edges without teeth or crenulation. Measurements see Table 3. Etymology. Named according to the slender cerci. Song. The male lived many days in captivity, when its song was recorded. During four continuous records (130 minutes combined), in total 28 separated, isolated syllables were registered (Fig. 12; syllable duration ca. 50 ms at 21ºC) with the animal singing at night. Sometimes two syllables followed each other with quite short intervals (4, 8, 13 s observed). For the human ear and the recording equipment, the sound was quite faint. However, the main energy was probably above 15 kHz.

Arantia (Euarantia) congensis Griffini, 1908

CH4943, CH4992 f♀ The species was described by Griffini (1908c; type locality Congo, Bus(s)ira: probably 0º50’S, 19º56’E) as a subspecies of A. melanota Sjöstedt, 1901 (type locality Cameroon, (M)Bonge, probably 4º32’N, 9º06’E) and elevated to species rank by Otte (1997) without comment, possibly because the genital structures have been described being different. Our specimen (Fig. 1 D) differs in this character clearly from A. melanota, but agrees quite well with the description of the cercal structure of A. congensis (see Fig. 10 A, B for our specimen). All other Arantia (Euarantia) species with known males can be definitively excluded since their cercal morphology is different.

358 · Zootaxa 3785 (3) © 2014 Magnolia Press HELLER ET AL. On the second abdominal segment, the male carries a large gland-like structure, a smaller one also on the first. At the posterior end of many tergites (2nd -8th) there is a small spine. The females are characterized by the unusually large, broad-based spines (especially the last two) on both edges of the underside of the hind femur (Fig. 10 C). A. (E.) fasciata has some spines only on the internal edge (Fig. 10 G; Brunner von Wattenwyl 1891, as spinulosa and atrolineata), A. marmorata has only one large spine on both sides (Karsch 1889) on the hind femur (Fig. 10 F). Even the spines (on both edges) of A. melanota (Fig. 10 E) and the male of A. congensis, which are relatively large, are clearly smaller (Fig. 10 D). All other species have only much smaller spines according to the photos in OSF or the descriptions. In addition, male and females differ in colouration of the caudal edge of pronotum (see Fig 1 D, E) and texture of the tegmina. From the genetic similarity, however, we are convinced that the three specimens belong to one species, and give a detailed description of the hitherto unknown female because of these unusually large differences.

FIGURE 10. Characteristics of Arantia (Euarantia) species. A, B—Cerci of Arantia congensis CH4991, A lateral, B dorsal view, scale 1 mm, C-G Hind femora of C—A. congensis ♀ (CH4992), D—A. congensis ♂ (CH4991), E—A. melanota (OSF, source Sweden, Stockholm, Naturhistoriska Riksmuseet), F—A. marmorata (OSF, source Poland, Warszawa, Polish Academy of Science, Museum of the Institute of Zoology), G—A. fasciata (Tanzania, Mt. Kilimanjaro).

Colour. See Fig. 1 E. Head. Fastigium verticis ends in a narrow, finger-like process, about a quarter as wide as scapus, sulcate before the process, met from below by conical, weakly sulcate fastigium frontis, leaving a gap between ends. Antennal sockets strongly margined (considered as typical for Pseudophyllinae; Rentz 1979). Scapus large, its distal half slightly inflated. Eyes circular, the diameter at base smaller than further distal, striped. Thorax. Surface of pronotum smooth, without carinae. Posterior part of disc red (Fig. 11 C). Fore coxa without spine. At the lower side fore femora with 3 to 4 spines at inner edge, mid femora unarmed, hind femora with 6-7 spines at both edges each. All tibiae with few to many spines or spinules on both edges above and below. Hind tibiae distinctly curved. Tibial ears in the fore legs anteriorly conchate, posteriorly open, leg dark coloured in this region. Auditory spiracle very large, but entrance for the most part covered by paranotum. Wings. Tegmina broad (see Table 3), broadly pointed at tip, with black markings at the very base (Fig. 11 A). Upper side of right tegmen with nine veins carrying stridulatory teeth. Alae slightly longer than fore wings. Colour green, with some brown-white markings at vein connections. Venation see Fig. 11 A, B. Abdomen. Subgenital plate comparatively short. Last tergite dorso-posteriorly with a large soft protuberance, covered with hairs, only the most posterior part smooth (not well preserved in the dried specimen). Ovipositor short (4 mm), near the tip at edges and on the surface with spines. Measurements see Table 3.

FIGURE 11. Arantia (Euarantia) congensis A-C female (CH4992). A—Dorsal view; B—Lateral view; C—Pronotum and base of the wings, dorsal view.

Behaviour. During our stay we have taken two photographs which may represent subadult nymphs of this species recognisable by the large spines and the curved hind tibiae. On both images the animals sit with the antennae placed below the body (Fig. 1 F). This behaviour was known only from some South East Asian Holochlorini (Stictophaula spp. Ingrisch 1994; own unpublished observations in other Stictophaula species and Ancylecha fenestrata) and recently also from some East African phaneropterine (genera Gonatoxia, Lunidia, Melidia, Oxyecous, Terpnistria; CH, own unpublished observations).

This tribe contained three genera in 1891 and is characterized by asymmetric tibial ears and a well-developed spine on the fore coxae (Brunner von Wattenwyl, 1891). It is thus quite similar to the Holochlorini mainly distributed in Asia, in which now Brunner von Wattenwyl’s Holochlorae and Psyrae are included (Bey-Bienko, 1954). Future studies have to show if and how Poreuomenini and Holochlorini can be separated and where the African genera included in Holochlorini at present have to be placed (Liu 2011).

Zeuneria Karsch, 1890

Brunner von Wattenwyl (1878) included Zeuneria in Poreuomenini and retained it there (1891) despite Karsch’s idea (1890) to have it in a separate group Zeuneriae. The genus contains four species (see Table 7) and is certainly very closely related to the monotypic Gravenreuthia Karsch, 1892, which is also included in Poreuomenini (Karsch, 1892).

TABLE 7. Measurements of Zeuneria species including own specimens (in mm). species pronotum hind femur source ♂ / ♀ ♂ / ♀ Z. melanopeza Karsch, 1889 7 / 7.2 39.5 / 39 Karsch, 1889, 1890 Z. longicercus Sjöstedt, 1929 - / - 38.5 / - Sjöstedt, 1929 Z. biramosa Sjöstedt, 1929 7 / - 38.5 / - Sjöstedt, 1929 6.6 / 6.15 36,3 / 37 Z. centralis Rehn, 1914 - / 5.2 - / 32 Rehn, 1914

Zeuneria biramosa Sjöstedt, 1929

[A] CH5013–17 5 ♂♂, CH5011–2 3 ♀♀ and some isolated tegmina (3 ♂♂, 1 ♀; CH4988,CH5006–7) The large and colourful species (Fig. 1 G; see OSF for more photographs of our specimens) was quite common at Irangi. It could be identified easily according to the cerci figures of three species (Z. melanopeza, Z. longicercus, Z. biramosa) as given by Sjöstedt (1929). The type and only known specimen (female) of Z. centralis Rehn, 1914 is smaller than our (and all other known) specimens (Table 7). In the male of Z. biramosa, the second abdominal segment is unusually large, carrying on top many glands (?) with hairs. Its posterior edge is curved upwards. Similar structures can be found also on the much smaller first abdominal segment. Song. The calling song was heard only at night. It consisted of single, isolated syllables (Fig. 12) produced at relatively large intervals (in the laboratory 20–30 s). The narrow-banded spectrum has an extraordinarily low peak at 3.7 kHz with a second harmonic of varying intensity at 7.4 kHz (Fig. 4; 500 Hz high pass filter). The peaks in the spectrum at 0.6 and 2 kHz result from continuous background noise. Due to our limited equipment the presence of ultrasonic components cannot be excluded, but the shape of the spectrum below 10 kHz should be correct. The stridulatory file on the underside of the left tegmen showed no irregularities (Fig. 5 D; CH5007: ca. 128 teeth; interval in the middle 65µm) and is in tooth number similar to Zeuneria melanopeza (125 teeth; Leroy 1970). The lower right tegmen shows a large, transparent mirror (Fig. 5 C). Its diameter is slightly larger than in the species Aerotegmina kilimandjarica Hemp with a similarly low-frequent song, but much smaller body size (Heller et al. 2010).

Cestromoecha Karsch, 1893

Before establishing Cestromoecha, Karsch had described the type species (and a second species) under Poreuomena. Cestromoecha seems to differ from Poreuomena mainly and only in the tip of the male abdomen.

TETTIGONIOIDEA FROM EASTERN CONGO Zootaxa 3785 (3) © 2014 Magnolia Press · 361 Therefore it should be included in Poreuomenini, as already suggested by Griffini (1908b: 86) who listed it under Poreuomenae.

Cestromoecha tenuipes (Karsch, 1890)

Comparing the single female with museum material (NHM, MNHP) we (CH) found that it agrees very well with specimens of this species.

Otiaphysini Karsch, 1889

? Tetraconcha sp.

[A] CH5008 ♀ photo only After taking photos the specimen was eaten by ants and only parts of the tegmina remained. From coloration, tegmen shape and its short ovipositor, it (Fig. 1 H) looks similar to T. banzyvilliana, whereas according to the pictures presented in OSF T. fenestrata, stichyrata (tegmen shape) and smaragdina (coloration) can certainly be excluded. Focusing on the short ovipositor, even the tribe Phlaurocentrini Karsch, 1889 with Phlaurocentrum, Buettneria and Leiodontocercus may be possible. Only using the keys in Brunner von Wattenwyl (1891) and Chopard (1955), it is difficult or impossible to determine Tetraconcha by females, because one has first to decide that the ovipositor is (nearly always; Chopard 1955) longer than the pronotum (incorrect) and in a second step that it is shorter.

Phaneropterini Burmeister, 1838

Phaneroptera sparsa Stål, 1856

[A] CH5002 male.

Tylopsidini Brunner von Wattenwyl, 1878

Tylopsis brevis Ragge, 1964

[B] CH4951 ♂, CH4952 ♀, [C] CH4975 ♂ Following Ragge’s key (1964) the specimens were identified as T. brevis with type locality Volcan Nyamlagira in the Kivu region. Song. The calling song of a male (not captured) was recorded in the field near Tshivanga [C] at night. Most often echemes containing four (rarely less) syllables were heard (Fig. 12), the interval between the first and second a little bit larger than during the others. However, a few long continuous syllable series (up to 12 s) with the same syllable interval of about 200 ms (13.5ºC) were also recorded. Each syllable consisted of few impulses similar as in Tylopsis lilifolia (Heller 1988). The stridulatory file contains relatively few teeth (as in Tylopsis lilifolia; Heller 1988).

Pseudophyllinae Burmeister, 1838

The specimens were identified following Beier (1962) except that of Pantecphylus.

Pseudophyllini Burmeister, 1838

Oxyaspis congensis Brunner v. Wattenwyl, 1895

[A] CH3293 ♂ When the animal was active, it held its tegmina more or less vertically (Fig, 13 A). However, during the day, at rest the animal sat motionless with the tegmina flat above the body (Fig. 13 B) like many Asian Pseudophyllini (Heller 1995).

Zabalius apicalis inversus Beier, 1957

[A] CH4990 ♀ During the day, the animal (Fig. 13 C) showed the same cryptic posture as typical for the other Pseudophyllini.

Pantecphylini Brunner von Wattenwyl, 1895

Pantecphylus (Pantecphylus) helleri Schmidt, Stelzer & Marshall, 2004

[A] CH4936 (holotype), CH4937, 2 ♂♂ Schmidt et al. have described several new species in this genus (Schmidt et al. 2004, 2006, 2007). In the Kivu region they described five new species from five males. According to these data a second, morphologically very similar species occurs in Irangi (with the same co-ordinates as [A]), while the locality of our animal is shown at a different place in their map). New studies on more material have to show if the extreme split of the genus (Schmidt et al. 2004, 2006, 2007) has been correct.

TETTIGONIOIDEA FROM EASTERN CONGO Zootaxa 3785 (3) © 2014 Magnolia Press · 363 FIGURE 13. Habitus. A—Oxyaspis congensis, active, B—Oxyaspis congensis, nearly at rest, C—Zabalius apicalis inversus, D—Pantecphylus (P.) helleri, E—Batodromeus subulo, F—Lichenochrus congicus, G—Leproscirtus granulosus ♂, H— Leproscirtus granulosus ♀, I—Karniella crassicerca, J—Plastocorypha ituriana.

364 · Zootaxa 3785 (3) © 2014 Magnolia Press HELLER ET AL. The brilliant blue coloration of the mouth parts (Fig. 13 D) fades to yellow after death. Song. For data on the acoustic behaviour (calling song and defence stridulation) see Heller (1996).

Pleminiini Brunner von Wattenwyl, 1895

Batodromeus subulo (Karsch, 1893)

[A] CH4944, ♂ (Fig. 13 E)

FIGURE 14. A—Subgenital plate of male Lichenochrus congicus. B—Subgenital plate of male Lichenochrus marmoratus (part of photo in OSF; Source: Sweden, Stockholm, Naturhistoriska Riksmuseet (NHRS);. C-F—Subgenital plate of male Leproscirtus granulosus. C ‘ebneri’ syntype, D ‘granulosus’ Barombi-Station, E ‘karschi’ Cameroun MfN_6194, F CH4983; details see text. Scales 1 mm.

FIGURE 15. Oscillograms of the calling songs of pseudophylline, mecopodine and tettigoniid species (Leproscirtus granulosus two males calling; 2 s sequence).

[A] CH4935, ♂ Since this specimen (Fig.13 F) seems to represent the first known male of this species, some doubts must remain concerning its identification. In three described Lichenochrus species, the genicular lobes of the hind femora carry only small spines or they are unarmed (Beier 1962) as in this specimen. So our specimen belongs to one of these three. From the first species, L. marmoratus Sjösted, 1901, our male differs by the structure of the subgenital plate, in which the distal lobes are widely separated by a deep, rounded incision (much wider than in L. marmoratus; see Fig. 14 A, B). The other two species are known only from a single female each. One of them was found in West Africa (L. servus Beier, 1954) and has a shiny black face and dark hind wings, two characters not seen in our specimen. So only L. congicus remains with its type locality in the Kivu region. Most of the characters mentioned by Beier (1962) for the female are also true for the male except that it is not smaller than L. marmoratus. Perhaps the tegmina are shorter, but the difference may be very small. Measurements: length of pronotom 6.5 mm, hind femur 22.5 mm, tegmina 28 mm. Song. The calling song (Fig. 15) consisted of short echemes (duration 0,5–0,8 s, syllable repetition rate 28–31 Hz; T = ca. 22ºC). It was heard only at night (recording time 55 min, 8 echemes). The stridulatory file carries many small teeth, similar to other Pseudophyllinae (e.g., Heller 1995). At its basal end it is running on a free bulge separated from the wing surface as also seen in other Pseudophyllinae (e.g., Morris & Beier 1982, Montealegre-Z. & Morris 1999). The main energy of the song may be in the ultrasonic range.

Mecopodinae Walker, 1871

Mecopodini Walker, 1871

Afromecopoda Uvarov, 1940

Afromecopoda monroviana (Karsch, 1886) stat. rev.

At present, there are four named forms in the genus (see Table 8), three of them considered as valid species since Kirby (1906). All except A. preussiana (Karsch, 1891) have spines on the lower side of the hind femora (see key in Redtenbacher 1892). Among the remaining three, A. austera (Karsch, 1893) differs from the other by its short tegmina. Only in this species and in A. monroviana the hind wings are shorter than the tegmina. So this character and the narrow tegmina separate A. monroviana from the sympatric A. frontalis (Walker. 1871). A. monroviana is therefore removed from synonymy and considered as valid species. The species was considered as a synonym of A. frontalis by Kirby (1891) without any comments, probably because of the close proximity of the type localities (Monrovia and Sierra Leone). In recent papers Naskrecki (2007, 2009) mentioned to have found two Afromecopoda species closely together in Ghana, West Africa, one of them identified as A. frontalis.

Afromecopoda preussiana (Karsch, 1891)

[A] CH4945, CH5001 2 ♂♂, CH5009–10 2 ♀♀ There are only two published records of A. preussiana outside Cameroon, both in Congo: Lukula (5.24’ S, 12.56’E) and Umangi (2.21ºS, 21.4ºE; Griffini 1908a). Irangi is quite far from these localities and much more in the East. One undetermined nymph of the genus, however, had been already collected in the Ituri region (Rehn, 1914), north of the Kivu region. With respect to the possibly large variability (Griffini mentions an unusually small male), we consider our specimens as belonging to this species despite the tegmina being considerably shorter than in the types. At the frontal edge, the tegmina show a very narrow, translucent margin similar as described for A. austera by Karsch 1893.

366 · Zootaxa 3785 (3) © 2014 Magnolia Press HELLER ET AL. TABLE 8. Measurements of Afromecopoda species (from descriptions) and own specimens (in mm). Pronotum length Hind femur length Tegmina length Tegmina ♂ / ♀ ♂ / ♀ ♂ / ♀ ♂ / ♀ frontalis (Walker, 1871) ? monroviana (Karsch, 1886) - / 8 -/ 43 - / 51 - / 10 austera (Karsch, 1893) - / 8 - / 38.5 - / 43 - / 8.5 preussiana (Karsch, 1891) 6.5 / 8 39 / 41 53 / 60 11/13 preussiana CH4945/ 5.7 / - 34 / - - / - 10.5/ - preussiana CH5001 6.3 / - 37 / - 47 / - 11.5/ - preussiana CH5009 - / 6.7 - / 40 - / 53 - / 12 preussiana CH5010 - / 7.0 - / 41 - / 52 - / 12 continued. Spines on fore tibia, Spines on hind Ovipositor Rel. tegmen Alae > above femur, below length (tegmen l / tegmina (except at tip) width) frontalis (Walker, 1871) + 4.4* + monroviana (Karsch, 1886) 1 + ? 5.7* - austera (Karsch, 1893) - + 20 5.2* - preussiana (Karsch, 1891) 3-5 - 23 4.8* + preussiana CH4945/ 2-3/ - - preussiana CH5001 1-2/ - - 4.1 + preussiana CH5009 -/ 1 - 23 4.4 + preussiana CH5010 - / 1 - 23 4.3 +

* measured from type photos in OSF

Anoedopoda cf. erosa Karsch, 1891

[A] CH4996 ♂ nymph

Leproscirtini Gorochov, 1988

Leproscirtus granulosus (Karsch, 1886)

Leproscirtus ebneri Karny, 1919, syn. n. Leproscirtus karschi Karny, 1919, syn. n. Leproscirtus granulosus aptera Karny, 1919, syn. n.

[A] CH4983–4 2 ♂♂, CH4938, CH4989, CH4993 3 ♀♀ While the arrangement of the specimens in this genus is quite clear, the identification to species level is difficult from two reasons, from the variation of the diagnostic characters and from the definition of the species. The genus was considered as monotypic, until Karny (1919) described four new species. One of them, L. brunneri, seems to differ from all others by a double tooth on each tergite. In the same paper Karny described another new species from literature, L. griffinii, but the sole diagnostic character, the unusual length of tegmina, was obviously based on a printing error, and the species was synonymised by Ebner (1943). The remaining three species are relatively similar to each other, and differ according to the descriptions in the colour of some body parts and the shape of the male subgenital plate.

TETTIGONIOIDEA FROM EASTERN CONGO Zootaxa 3785 (3) © 2014 Magnolia Press · 367 Our female specimens (habitus Fig. 13 H) agree exactly with the description of the holotype of L. granulosus Karsch (1886) (single known specimen at that time; holotype probably lost, missing in MfN at least since 1974 according to a note in the collection) having rudimentary tegmina, the tip of the ovipositor not reaching knees of hind legs (except one leg; see below) and face and other parts not bright yellow (no yellow markings mentioned in description in contrast to specimens described later (1891) by Karsch). The tegmina overlap the caudal edge of the mesonotum, longer than described for L. karschi (Karny, 1919: p. 288) in which also the hind femora reach the tip of the ovipositor. Karny (1919), however, defines L. granulosus Karsch as having face, genae, lower edge of pronotum and mesopleura bright yellow, probably influenced by a series of specimens (from Barombi Station, Cameroun) described by Karsch (1891) which all show this character, and own new material (at least two females). According to the material in MfN, the coloration can be variable even in individuals of the same locality (yellow in 2 of 8 specimens (and in female deposited in Geneve; Hollier 2010) from Buea, Cameroun, and in 7 out of 8 specimens from Victoria, Cameroun). Only from Barombi, all specimens in MfN are yellow as noted by Karsch (1891). Karny (1919) splits the former L. granulosus in three species distinguished by the shape of the male subgenital plate and colour (yellow body parts diagnostic for ‘true’ L. granulosus). Unfortunately, however, as mentioned above, the holotype of L. granulosus was very probably not yellow. The females of Karny’s granulosus have also clearly longer hind femora than the type (30.5–30.8 mm, type 26.8 mm, our specimens CH4993 left side 24 (shorter), right 25 (longer than ovipositor), CH4989 both sides 26, CH4938 left side 25, right 24.5 mm (longer than ovipositor)). So our specimens seem to be true granulosus. Possibly Karsch (1891) and Karny (1919) assumed a second species (?) to be granulosus, which is larger (no measurements in Karsch 1891, but according to own measurements 32 mm (one female) and 27-30 mm (4 males; specimens from Barombi)) than the original species and which has bright yellow markings. Karny was aware of this possibility, however, he was erroneously asking, if Karsch’s animal from 1886 (holotype of granulosus) might be in fact his new karschi! The combined data from all specimens in MHB (13 males, 17 females) do not show a clear bimodality, although the yellow individuals tend to belong to the larger ones. In the males from Cameroun, Karny (1919) distinguished three types of subgenital plates. In his ‘ebneri’ (some syntypes in MfN, although not mentioned by Karny as types, but same place, date and collector (Buea, 1-10th April 1891, Preuss; determined by Karsch 1892 as L. granulosus)), the median incision of the narrow subgenital plate is very short, much shorter than the lobes carrying the styli (Fig 14 C). In ‘karschi’ this incision is much larger, longer than the lobes (as in Fig. 14 E, F). In Karny’s ‘granulosus’ the situation is intermediate (Fig. 14 D; male from Barombi Station). In Dibongo, both types (and/or yellow and not yellow specimens) are possibly found together (same locality for both species; Karsch 1919). Our males (Fig. 14 F; both very similar to each other) are clearly nearest to ‘karschi’, although they have special characters. Instead of describing a new species, we propose to consider L. ebneri and L. karschi as synonyms of L. granulosus due to the above mentioned taxonomic problems and missing clear diagnostic characters. The high variability within Cameroun requires detailed studies throughout the range of this widespread species (see long list of references in OSF). If the above mentioned second large and yellow species should turn out to be a good species, it must be called L. aptera Karny, 1919. The name was coined for the missing female tegmina, but the diagnostic characteristics would be colouration and size. Otherwise aptera characterises a variety, but not a geographic subspecies. Song. The calling song (Fig. 15) consisted of isolated syllables, repeated at intervals of 10–15 s, and was heard only at night. One syllable contained ca. 35 clearly separated (im)pulses with a frequency peak at 9 kHz. We recorded two males singing closely together (in captivity). The song of the leader was followed by that of the second male usually within ca. 0.7 s and often not only by one, but by several (up to three) syllables. The stridulatory file on the lower side of the left tegmen carries a dense series of broad teeth and ends distally in an unusual knob (Fig. 16 A). In contrast to the upper, leather-like appearing left tegmen the lower right one presents a large transparent mirror (Fig. 16 B).

Tettigoniidae Krauss, 1902

Hexacentrinae Karny, 1925

Hexacentrus karnyi Griffini, 1909

368 · Zootaxa 3785 (3) © 2014 Magnolia Press HELLER ET AL. [A] CH4982 ♂ The song of this species (two males recorded in the field at night) was in its basic structure (Fig. 15) similar to that of the Asiatic species H. unicolor Serville, 1831 (Heller, 1986) and other Hexacentrus species (e.g., Ichikawa et al. 2006), but it is much slower in echeme and syllable repetition rate. It consisted of a series of echemes, repeated at intervals of 8–12 s (0.5 s in H. unicolor). The syllable repetition rate was around 50 Hz (T=21ºC), again much slower than H. unicolor, which heats up before singing and reaches more than 300 Hz. Each echeme (duration about 0.7 s) started with a distinct impulse, probably indicating the opening of the tegmina. Similar isolated impulses can be seen in the song of the other species, but usually shortly after an echeme and produced during a final wing closure. The peak of the spectrum was situated at 9.7 kHz, close to that of 11 kHz observed in H. unicolor (Heller, 1986).

FIGURE 16. A—Stridulatory file Leproscirtus granulosus (three-quarter view; articulation below); B—Right tegmen of Leproscirtus granulosus; C—Stridulatory file of Plastocorypha ituriana (articulation below). Scales 1 mm.

Meconematinae Burmeister, 1838

[A] CH5003 ♀ The damaged female is unidentifiable with the key of Beier (1967).

Conocephalinae Burmeister, 1838

Conocephalini Burmeister, 1838

Conocephalina Burmeister, 1838

Conocephalus inaequalis Uvarov, 1928

[A] CH5004 ♂ In the structure of the cerci the male is very similar to C. inaequalis, described from South Africa (see Fig. 10 in Uvarov 1928, photos of the type in OSF). Even the upward orientation of the small inner denticle agrees with the type. This type of cercus does not belong to the common ones in the genus (not figured e.g. in the only available multi-species study of the genus by Pitkin (1980) on the species of the Pacific area). There are also no obvious

TETTIGONIOIDEA FROM EASTERN CONGO Zootaxa 3785 (3) © 2014 Magnolia Press · 369 differences to C. inaequalis in the general structure of the tip of the abdomen and the length of the tegmina. However, from many African Conocephalus species (more than 30 besides of subgenus Megalotheca) stable characters for identification are missing, so our classification must remain preliminary. A large female nymph (CH5005) of the genus may belong to another species.

Karniellina Hemp & Heller 2010

Karniella bullata Rehn, 1914

[C] CH4965 ♂, CH4966–7 2 ♀♀ See Hemp et al. (2010a) for differences to K. crassicerca.

Karniella crassicerca Hemp, 2010

[B] CH4968 ♂, D CH4969–70 2 ♂♂ K. crassicerca is in habitus (Fig. 13 I) quite similar to K. bullata. The calling song is described in Hemp et al. (2010a).

Copiphorini Karny, 1912

Lanistoides Sjöstedt, 1913 stat. rev.

The tribe Copiphorini contains six genera in Africa (excluding the genera endemic to Madagascar and St. Helena and the doubtful species Copiphora subulata (Stoll, 1813)): the closely related genera Euconocephalus and Ruspolia and the equally widespread Pseudorhynchus and the endemic Clasma, Lanista and Plastocorypha. Another endemic genus, Lanistoides Sjöstedt, 1913, was placed in synonymy of Plastocorypha by Chopard (1955: 88), who obviously did not notice that both genera have different type species with same specific name (overlooked also by Otte 1997): Plastocorypha is based on Pseudorhynchus nigrifrons Redtenbacher 1891, Lanistoides on Lanistoides nigrifrons Sjöstedt, 1913. Combining both genera would produce a secondary homonym and require a new name for Lanistoides nigrifrons Sjöstedt, 1913. Since the tip of the fastigium verticis seems to be distinctly longer in Lanistoides nigrifrons than in Lanista and Plastocorypha (at least in the species figured in OSF), a character mentioned as typical for the genus by Sjöstedt (1913), and the shape of the head is different, we propose to re-establish Lanistoides as a valid genus.

Plastocorypha ituriana Bolivar, 1922

Plastocorypha cabrai Griffini, 1909 stat. rev.

[A] CH4986, CH4997 2 ♂ For the identification of Plastocorypha species (five species in OSF) not many characters are available. Our males have a dark orange red face (Fig. 13 J). Applying this character, the two Plastocorypha forms with black faces (nigrifrons nigrifrons and vandikana) can be excluded. In these two forms, the tip of the fastigium is tapering, while it is blunt in P. brevipes (see OSF) and our animals. The remaining three forms have all dark orange red (“ferruginous”) faces and are all distributed in Central Africa—brevipes Rehn, 1914, nigrifrons cabrai Griffini 1909 and ituriana Bolivar 1922. P. brevipes has shorter hind femora than the other two and our specimens. Bolivar did not give any diagnosis when describing ituriana, only “voisine de vandikana” (=related to vandikana). Although caprai (we propose to treat it as species due to the difference in colour of the face) and ituriana may be the same taxon, we will call our animals at the moment P. ituriana, since the type locality of cabrai (Mayumbe) is near the Atlantic Ocean.

370 · Zootaxa 3785 (3) © 2014 Magnolia Press HELLER ET AL. Song. The calling song (Fig. 17) consisted of long echemes (ca. 4 s) with a syllable repetition rate of ca. 40 Hz (T= 21 ºC). In our nightly field recording, two males were imperfectly synchronizing, at the beginning or the end of the echeme the softer singing male could be heard (in Fig. 16 at the end). The echemes were separated by intervals of ca. 25 s. The stridulatory file (Fig. 16 C) is similar to that figured in OSF for P. brevipes. In both species there is a small bulge near the proximal end.

FIGURE 17. Oscillogram of calling song of Plastocorypha ituriana (6 s sequence).

Ruspolia Schulthess, 1898

In Africa, the genus Ruspolia contains about 20 species (Bailey 1975), which are sometimes difficult to identify even after Bailey’s revision. All species have homogenous, continuous, trilling songs with a species-specific syllable repetition rate (see Bailey 1976 for data from Uganda) and sometimes differences in syllable structure. Since the main energy of the song is usually above 14 kHz, it was at the edge of the capabilities of our equipment, and we can only give the syllable repetition rate of the song, but no details of syllable structure.

Ruspolia fuscopunctata (Karny, 1907)

[A] CH4985 ♂ The specimen agrees in all measurements (length of pronotum, tegmen, hind femur, syllable repetition rate, number of stridulatory teeth) with the data given by Bailey for R. fuscopunctata. The calling song showed a syllable repetition rate of 19 Hz (T= 22.5ºC) and was produced with a file (“crescentic” type; Bailey 1975) containing 115 teeth. The mixed remainings of another three Ruspolia specimens (CH4971–3) from [C] could not be identified with certainty. Two of them belonged to specimens with files of the “crescentic” type (number of teeth ca. 80, 86) and may also be H. fuscopunctata, but could also be H. ruthae or H. ampla (see Bailey, 1975).

Ruspolia flavovirens (Karny, 1907)

[A] CH5000 ♂, CH4995, CH4999 2 ♀♀ According to the data presented by Bailey (1975) the specimens most probably belong to H. flavovirens, a species widespread in East Africa. With 130 stridulatory teeth (in a bulbous file) the male clearly fits in the range of that species (123–143). The same is true for its syllable repetition rate (95 Hz (laboratory recording) to 75–95 Hz in Bailey 1975). However, the length of the pronotum (7.7 mm in all our specimens) is distinctly larger than the range given by Bailey (6.2–7.1 mm). In this aspect the specimens would agree better with the more western species H. paraplesia (Karny, 1907), which has a separate subspecies in Uganda. In this species the number of file teeth (95– 126) and the syllable repetition rate (65–75 Hz) are only slightly lower than in our animals. Song. See previous paragraph.

Special thanks go to Boni Ndumbo, Irangi, for his help in the field, to Dr. Steinhauer-Burkhard, Bukavu, for his logistic help in Congo (Zaire), to Dr. Yeying Wang for her work in the molecular experiments, to Mr. Bussmann, Kigali, and last, but not least, to A. and C. Liegl for their nightly support in looking for Orthoptera. In addition, our thank goes to John A. Hollier for information about a specimen of Leproscirtes granulosus kept in Geneve. We are also very grateful to OSF and all its contributors of data and pictures, which facilitated the study considerably. Part of this research received support from the Synthesys Project (http://www.sysnthesys.info/) financed by the European Community Research Infrastructure Action under the FP6 "Structuring the European Research Area Programme", enabling CH to visit collections in London, Copenhagen and Paris. Molecular research is supported by the grants from the Natural Science Foundation of China (No. 31071953) for Chunxiang Liu.

References

Ander, K. (1939) Vergleichend-anatomische und phylogenetische Studien über die Ensifera (Saltatoria). Opuscula Entomologica, Supplementum 2, 1–306. Bailey, W.J. (1975) A review of the African species of the genus Ruspolia Schulthess (Orthoptera Tettigonioidea). Bulletin de l' Institut Fondamental d' Afrique Noire, Série A, 37, 171–226. Bailey, W.J. (1976) Species isolation and song types of the genus Ruspolia Schulthess in Uganda. Journal of Natural History, 10, 511–528. http://dx.doi.org/10.1080/00222937600770421 Beier, M. (1954) Revision der Pseudophyllinen 1. Hälfte. Trabajos del Instituto Espanol de Entomologia, 1–479. Beier, M. (1957) Pseudophyllinae aus dem Belgischen Congo (Orthoptera Tettigoniidae). Revue de Zoologie et de Botanique Africaines, 55, 49–68. Beier, M. (1962) Orthoptera Tettigoniidae (Pseudophyllinae I). In: Mertens, R., Hennig, W. & Wermuth, H. (Eds.), Das Tierreich. 73. Walter de Gruyter & Co., Berlin, 468 pp. Beier, M. (1967) Neue Beiträge zur Kenntnis der Gattungsgruppe Amytta Karsch (Orth. Meconematinae). Beiträge zur Entomologie, 15 [1966], 203–242. Bey-Bienko, G.Ya. (1954) Orthoptera Vol. II. No. 2. Tettigonioidea Phaneropterinae, Fauna of the U.S.S.R. Zoological Institute Akademii Nauk SSSR, 381 pp. [English translation 1965 Jerusalem (Israel Program for Scientific Translations)] Bolívar, I. (1906) Fasgonuridos de la Guinea española. Memorias de la Real Sociedad Española de Historia Natura, 1, 327– 377, pl. 10. Bolívar, I. (1922) Orthoptères. In: Voyage de M. Le Baron Maurice de Rothschild en Ethiopie et en Afrique orientale anglaise 1904–l905). Animaux Articulés, Paris. Imprimerie National 1, pp. 169–219, pls (10)1–(10)4. Brunner von Wattenwyl, C. (1878) Monographie der Phaneropteriden. Brockhaus, Wien, 401 pp. Brunner von Wattenwyl, C. (1891) Additamenta zur Monographie der Phaneropteriden. Verhandlungen der k.k. zoologisch- botanischen Gesellschaft Wien, 41, 1–196. Brunner von Wattenwyl, C. (1895) Monographie der Pseudophylliden. Wien (K.K. Zoologisch–Botanische Gesellschaft), 282 pp. Burmeister, H. (1838) Handbuch der Entomologie, Zweiter Band. Besondere Entomologie. Zweite Abtheilung Kaukerfe, Gymnognatha. Erste Hälfte; vulgo Orthoptera. T.C.F. Enslin, Berlin, i–viii + pp. 457–756. Bybee, S.M., Taylor, S.D., Nelson, C.R. & Whiting, M.F. (2004) A phylogeny of robber flies (Diptera: Asilidae) at the subfamilial level: molecular evidence. Molecular Phylogenetic Evolution, 30, 789–797. http://dx.doi.org/10.1016/s1055-7903(03)00253-7 Chopard, L. (1955) La Réserve Naturelle Intégrale du Mont Nimba, fasc. 2. III. Orthoptères Ensifères. Mémoires de l' Institut Français d' Afrique Noire, 40 [1954], 25–98. Colgan, D.J., McLauchlan, A., Wilson, G.D.F., Livingston, S., Macaranas, J., Edgecombe, G.D., Cassis, G. & Gray, M.R. (1998) Molecular phylogenetics of the Arthropoda: relationships based on histone H3 and U2 snRNA DNA sequences. Australian Journal of Zoology, 46, 419–437. Dieterlen, F. (1978) Zur Phänologie des äquatorialen Regenwaldes im Ost-Zaire (Kivu). Dissertationes botanicae, 47, 111 pp. Eades, D.C., Otte, D., Cigliano, M.M., & Braun, H. (2013) Orthoptera species file online. Version 2.0/4.1. Available from: http://Orthoptera.SpeciesFile.org (accessed 11 November 2013) Ebner, R. (1943) Einige Orthoptera Saltatoria von Fernando Po (Spanisch Guinea). Zoologischer Anzeiger, 143, 259–274. Folmer, O., Black, M., Hoeh, W., Lutz, R. & Vrijenhoek, R. (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology & Biotechnology, 3, 294– 299. Glenn, G.S. Jr. (1991) A systematic revision of Enyaliopsis Karsch 1887 (Orthoptera: Tettigoniidae, Hetrodinae). Transactions of the American Entomological Society, 117, 67–102.

372 · Zootaxa 3785 (3) © 2014 Magnolia Press HELLER ET AL. Gorochov, A.V. (1988) Classification and phylogeny of Tettigonioidea. (Gryllida = Orthoptera, Tettigonioidea). In: Ponomarenko, A.G. (Ed.), [Cretaceous biocoenotic crisis and insect evolution]. Moscow (Nauka) [Russian], pp. 145–190. Gorochov, A.V. (1995) System and evolution of the suborder Ensifera (Orthoptera). Part II. Trudy Zoologitscheskogo Instituta Akad. Nauk SSSR [= Proc. Zool. Inst. Acad. Sci. USSR], 260, 1–213. Gorochov, A.V. & Kang Le (2002) Review of the Chinese species of Ducetiini (Orthoptera: Tettigoniidae: Phaneropterinae). Insect Systematics and Evolution, 33, 337–360. http://dx.doi.org/10.1163/187631202x00190 Griffini, A. (1906) Ortotteri raccolti da Leonardo Fea nell'Africa occidentale. 1. Hetrodidi, Conocephalidi, Meconemidi, Pseudophyllidi, Mecopodidi e Fanerotteridi. Annali del Museo Civico di Storia Naturale 'Giacomo Doria‘, Genova, (3), 2, 358–397. Griffini, A. (1908a) Phasgonuridae africane del R. Museo di Storia Naturale di Bruxelles, 3. Hetrodidae, Mecopodidae, Pseudophyllidae. Mémoires de la Societé Entomologique de Belgique, 15, 35–64. Griffini, A. (1908b) Phasgonuridae africane del R. Museo di Storia Naturale di Bruxelles. 5. Phaneropteridae pars 1a. Mémoires de la Societé Entomologique de Belgique, 15, 74–86. Griffini, A. (1908c) Phasgonuridae africane del R. Museo di Storia Naturale di Bruxelles. 6. Phaneropteridae pars 2a (reliquae species omnes). Mémoires de la Societé Entomologique de Belgique, 15, 201–226. Griffini, A. (1909) Note sopra alcune Phasgonuridae del Congo. Annales de la Société entomologique de Belgique, 53 (1908), 9–28. Grzywacz, B., Heller, K.-G., Lehmann, A.W., Warchalowska-Sliwa, E. & Lehmann, G.U.C. (2014) Chromosomal diversification in the flightless Western Mediterranean bushcricket genus Odontura (Orthoptera: Tettigoniidae: Phaneropterinae) inferred from molecular data. Journal of Zoological Systematics and Evolutionary Research, in press. http://dx.doi.org/10.1111/jzs.12046 Hall, T. (2005) Bioedit version 7.0.4. Department of Microbiology, North Carolina State University. Hebert, P.D.N., Cywinska, A., Ball, S.L. & deWaard, J.R. (2003) Biological identifications through DNA barcodes. Proceedings of the Royal Society London, B (270), 313–322. http://dx.doi.org/10.1098/rspb.2002.2218 Heller, K.-G. (1986) Warm-up and stridulation in the bushcricket, Hexacentrus unicolor Serville (Orthoptera, Conocephalidae, Listroscelidinae). Journal of Experimental Biology, 126, 97–109. Heller, K.-G. (1988) Bioakustik der europäischen Laubheuschrecken. Verlag Josef Margraf, Weikersheim, 358 pp. Heller, K.-G. (1995) Acoustic signalling in palaeotropical bushcrickets (Orthoptera: Tettigonioidea: Pseudophyllidae): does predation pressure by eavesdropping enemies differ in the Palaeo- and Neotropics? Journal of Zoology, 237, 469–485. http://dx.doi.org/10.1111/j.1469-7998.1995.tb02775.x Heller, K.-G. (1996) Unusual abdomino-alary, defensive stridulatory mechanism in the bushcricket Pantecphylus cerambycinus (Orthoptera: Tettigonioidea: Pseudophyllidae). Journal of Morphology, 227, 81–86. http://dx.doi.org/10.1002/(sici)1097-4687(199601)227:1<81::aid-jmor6>3.0.co;2-s Heller, K.-G., Ostrowski, T. & Hemp, C. (2010) The function of low frequencies: singing and hearing in Aerotegmina kilimandjarica (Tettigoniidae: Hexacentrinae). Bioacoustics, 19 (3), 195–210. http://dx.doi.org/10.1080/09524622.2010.9753624 Helversen, O. von & Elsner, N. (1977) The stridulatory movements of acridid grasshoppers recorded with an opto-electronic device. Journal of Comparative Physiology, 122, 53–64. http://dx.doi.org/10.1007/bf00611248 Hemp, C. (2013) Annotated list of Ensifera (Orthoptera) and further records on Caelifera (Orthoptera) of Mt Kilimanjaro, Tanzania. Zootaxa, 3613 (4), 301–342. http://dx.doi.org/10.11646/zootaxa.3613.4.1 Hemp, C., Heller, K.- G., Kehl, S., Warchalowska-Sliwa, E. Waegele, J.W. & Hemp, A. (2010a) The Phlesirtes complex (Orthoptera, Tettigoniidae, Conocephalinae, Conocephalini) reviewed: integrating morphological, molecular, chromosomal and bioacoustic data. Systematic Entomology, 35, 554–580. http://dx.doi.org/10.1111/j.1365-3113.2009.00512.x Hemp, C., Voje, K.L., Heller, K.-G. & Hemp, A. (2010b) Lunidia, a new genus of African Phaneropterinae (Orthoptera: Tettigoniidae). Organisms, Diversity & Evolution, 10, 215–226. Hollier, J.A. (2010) An annotated list of type specimens of Orthoptera (Insecta) described by Ferdinand Karsch and deposited in the collections of the Muséum d’histoire naturelle de la Ville de Genève. Revue Suisse de Zoologie, 117, 17–22. Ichikawa, A., Ito, F., Kanô, Y., Kawai, M., Tominaga, O. & Murai, T. (Eds.) (2006) Orthoptera of the Japanese Archipelago in color. Sapporo, 688 pp. + 2 CD. Ingrisch, S. (1994) Drei neue Arten der Gattung Stictophaula aus Thailand (Ensifera, Phaneropteridae). Entomologische Zeitschrift, 104, 245–264. Ingrisch, S. (2011) New taxa of Mirolliini from South East Asia and evidence for an abdominal gland in male Phaneropterinae (Orthoptera: Tettigoniidae). Zootaxa, 2943, 1–44. Ingrisch, S. & Willemse, F. (2004) Bibliographia Systematica Orthopterorum Saltatoriorum. Systematic bibliography of saltatorial Orthoptera from Linnaean times to the end of the 20th century. Pensoft, Sofia, 536 pp. Karny, H.H. (1907) Revisio Conocephalidarum. Abhandlungen der zoologisch-botanischen Gesellschaft Wien, 4, 1–114.

TETTIGONIOIDEA FROM EASTERN CONGO Zootaxa 3785 (3) © 2014 Magnolia Press · 373 Karny, H.H. (1912) Orthoptera Fam. Locustidae Subfam. Copiphorinae. In: Wytsman, P. (Ed.), Genera Insectorum, 139, 1–50. Karny, H.H. (1919) Revision der Gattung Leproscirtus (Orthoptera, Mecopodinae). Zoologischer Anzeiger, 50, 287–289. Karny, H.H. (1925) List of some katydids (Tettigoniidae) in the Sarawak Museum. Sarawak Museum Journal, 8, 35–53. Karsch, F. (1886) Eine neue westafrikanische Mecopode. Entomologische Nachrichten, Berlin, 12, 316–318. Karsch, F. (1889) Orthopterologische Beiträge. III. Berliner Entomologische Zeitschrift, 32 [1888], 415–464. Karsch, F. (1890) Verzeichniss der von Herrn Dr. Paul Preuss auf der Barombi–Station in Deutsch–Westafrika 1890 gesammelten Locustodeen aus den Familien der Phaneropteriden, Mekonemiden und Gryllakriden. Entomologische Nachrichten, Berlin, 16, 353–369. Karsch, F. (1891) Uebersicht der von Herrn Dr. Paul Preuss auf der Barombi-Station in Kamerun gesammelten Locustodeen. Anhang: Ueber die Mecopodiden. Berliner Entomologische Zeitschrift, 36, 317–346. Karsch, F. (1892) Verzeichniss der von Herrn Dr Paul Preuss im Kamerungebirge erbeuteten Orthopteren. Berliner Entomologische Zeitschrift, 37, 65–78. http://dx.doi.org/10.1002/mmnd.18920370112 Karsch, F. (1893) Locustodeen von Victoria in Kamerun, gesammelt durch Herrn Dr. Paul Preuss. Entomologische Nachrichten, Berlin, 19, 195–199. Karsch, F. (1896) Neue Orthopteren aus dem tropischen Afrika. Stettiner Entomologische Zeitung, 57, 242–359. Kimura, M. (1980) A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution, 16, 111–120. http://dx.doi.org/10.1007/bf01731581 Kirby, W.F. (1891) Notes on the Orthopterous family Mecopodidae. Transactions of the Royal Entomological Society of London, 1891, 405–412. http://dx.doi.org/10.1111/j.1365-2311.1891.tb03036.x Kirby, W.F. (1906) A synonymic catalogue of Orthoptera. Vol. II. Orthoptera Saltatoria. Part I. (Achetidae et Phasgonuridae). The Trustees of the British Museum, London, 562 pp. Kirby, W.F. (1909) Ruwenzori Expedition Reports. 8. Orthoptera. Transactions of the Zoological Society of London, 19, 63–66. Krauss, H.A. (1902) Die Namen der ältesten Dermapteren- (Orthopteren-) Gattungen und ihre Verwendung für Familien- und Unterfamilien-Benennungen auf Grund der jetzigen Nomenclaturregeln. Zoologischer Anzeiger, 25, 530–543. Lanfear, R., Calcott, B., Ho, S.Y. & Guindon, S. (2012) Partitionfinder: combined selection of partitioning schemes and substitution models for phylogenetic analyses. Molecular Biology and Evolution, 29, 1695–701. http://dx.doi.org/10.1093/molbev/mss020 Leroy, L. (1970) Diversites d`aspects et la dissymetrie des rapes de stridulation des Insectes Orthopteres Phaneropterinae. Comptes rendus hebdomadaires des séances de l'Académie des sciences. Série D, Sciences naturelles, 270, 96–99. Liu, C.-X. (2011) Brief summary of Holochlorini (Orthoptera: Tettigoniidae: Phaneropterinae), with description of seven new species from China. Zootaxa, 2931, 35–52. Morris, G.K. & Beier, M. (1982) Song structure and description of some Costa Rican katydids (Orthoptera: Tettigoniidae). Transactions of the American Entomological Society, 108, 287–314. Montealegre, Z.F. & Morris, G.K. (1999) Songs and systematics of some Tettigoniidae from Colombia and Ecuador 1. Pseudophyllinae (Orthoptera). Journal of Orthoptera Research, 8, 163–236. http://dx.doi.org/10.2307/3503439 Moulton, M.J., Song, H. & Whiting, M.F. (2010) Assessing the effects of primer specificity on eliminating numt coamplification in DNA barcoding: a case study from Orthoptera (Arthropoda: Insecta). Molecular Ecology Resources, 10, 615–627. http://dx.doi.org/10.1111/j.1755-0998.2009.02823.x Mugleston, J.D., Song, H. & Whiting, M.F. (2013) A century of paraphyly: A molecular phylogeny of katydids (Orthoptera: Tettigoniidae) supports multiple origins of leaf-wings. Molecular Phylogenetics and Evolution, 69, 1120–1134. http://dx.doi.org/10.1016/j.ympev.2013.07.014 Naskrecki, P. (2007) The katydids of the Atewa Range Forest Reserve, Ghana. RAP Bulletin of Biological Assessment, 47, 63– 68. Naskrecki, P. (2009) A survey of katydids (Insecta: Orthoptera: Tettigoniidae) of Ajenjua Bepo and Mamang River Forest Reserves, Eastern region of Ghana. RAP Bulletin of Biological Assessment, 50, 34–39. Naskrecki, P. & Bazelet, C.S. (2012) A revision of the southern African katydid genus Griffiniana Karny (Orthoptera: Tettigoniidae: Mecopodinae). Zootaxa, 3218, 47–58. Nickle, D.A. (2012) Synonymies of wasp-mimicking species within the katydid genus Aganacris (Orthoptera: Tettigoniidae: Phaneropterinae). Journal of Orthoptera Research, 21, 245–250. http://dx.doi.org/10.1665/034.021.0209 OSF (Orthoptera species file) (2013) See Eades et al. 2013 Otte, D. (1997) Orthoptera Species File 7. Tettigonioidea. Orthopterists' Society at the Academy of Natural Sciences of Philadelphia, Philadelphia, 373 pp. Pitkin, L.M. (1980) A revision of the Pacific species of Conocephalus Thunberg (Orthoptera: Tettigoniidae). Bulletin of the British Museum (Natural History), Entomology Series, 41, 315–355. Ragge, D.R. (1955) The wing-venation of the Orthoptera Saltatoria, with notes on Dictyopteran wing-venation. British

374 · Zootaxa 3785 (3) © 2014 Magnolia Press HELLER ET AL. Museum (Natural History), London, 159 pp. Ragge, D.R. (1960) The Acrometopae of the Ethiopian Region: a revision, with notes on the sexual dimorphism shown by the group (Orthoptera: Tettigoniidae). Bulletin of the British Museum (Natural History), Entomology Series, 8, 269–333. Ragge, D.R. (1964) A revision of the genus Tylopsis Fieber (Orthoptera: Tettigoniidae). Bulletin of the British Museum (Natural History), Entomology Series 15, 297–322. Ragge, D.R. (1968) An index–catalogue of African Phaneropterinae (Orthoptera: Tettigoniidae). Bulletin of the British Museum (Natural History), Entomology Series, 22, 75–108. Redtenbacher, J. (1891) Monographie der Conocephaliden. Verhandlungen der zoologisch-botanischen Gesellschaft Wien, 41, 315–562, pls 3–4. Redtenbacher, J. (1892) Monographische Uebersicht der Mecopodiden. Verhandlungen der zoologisch-botanischen Gesellschaft Wien, 42, 183–224, pl. 3. Rehn, J.A.G. (1914) Orthoptera. I. Mantidae, Phasmidae, Acrididae, Tettigoniidae und Gryllidae aus dem Zentral– Afrikanischen Gebiet, Uganda und dem Ituri–Becken des Kongos. Wissenschaftliche Ergebnisse der deutschen Zentral– Afrika Expedition, 1907–1908, Leipzig, 5 (Zool. 3 [1]), 1–223. Rentz, D.C.F. (1979) Comments on the classification of the orthopteran family Tettigoniidae, with a key to subfamilies and description of two new subfamilies. Australian Journal of Zoology, 27, 991–1013. http://dx.doi.org/10.1071/zo9790991 Rentz, D.C.F. (2010) A guide to the katydids of Australia. CSIRO Publishing, Collingwood, 214 pp. Ronquist, F. & Huelsenbeck, J.P. (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19, 1572–1574. http://dx.doi.org/10.1093/bioinformatics/btg180 Saussure, H. de (1899) Wissenschaftliche Ergebnisse der Reise in Madagaskar und Ostafrika in den Jahren 1889–95 von Dr. A. Voeltzkow. Orthoptera. Abhandlungen der Senckenbergischen Naturforschenden Gesellschaft, Frankfurt/M, 21, 569–664, pls. 37–38. Schmidt, G.H. (2006a) A new species of Pantecphylus collected in Low Zaire (Democratic Republic Congo) (Orthoptera, Pseudophyllidae). Fragmenta Entomologica, 38, 1–6. Schmidt, G.H. (2006b) Description of six new Pantecphylus Karsch found in Central Africa near to, and in the north of the equator (Democratic Republic Congo and South of Sudan) (Orthoptera, Ensifera, Tettigonioidea, Pseudophyllidae). Bollettino di Zoologia Agraria e di Bachicoltura, 38, 1–25. Schmidt, G.H. (2007) Two new Pantecphylus males from Kassai province (Democratic Republic Congo), and the problem to select conspecific females (Insecta, Orthopteroidea, Ensifera, Tettigonoidea, Pseudophyllidae). Bollettino di Zoologia Agraria e di Bachicoltura, 39, 35–43. Schmidt, G.H., Stelzer, R. & Marshall, J. (2004) Description of five new Pantecphylus species from Kivu, the east province of Democratic Republic Congo (Ensifera: Tettigonioidea: Pseudophyllidae). Bollettino di Zoologia Agraria e di Bachicoltura, 36, 279–301. Schulthess, A. von (1898) Orthoptères du pays des Somalis, recueillis par L. Robecchi–Brichetti en 1891 et par le Prince E. Ruspoli en 1892–93. Annali del Museo Civico di Storia Naturale 'Giacomo Doria', Genova, (2), 19, 161–216. Serville, J.G.A. (1831) Revue méthodique des insectes de l‘ordre des Orthoptères. Annales des Sciences Naturelles Zoologie et Biologie Animale, 22, 28–65; 134–167; 262–292. Sjöstedt, Y. (1901) Beiträge zur Kenntniss der Insektenfauna von Kamerun. 8. Locustodeen aus Kamerun und Kongo. Bihang till Kongliga Svenska Vetenskaps–akademiens Handlingar, 27, 1–45. Sjöstedt, Y. (1913) Neue Orthopteren aus Ost–und Westafrika, nebst einigen anderen zugehörigen Formen. Arkiv för Zoologi, 8, 1–26, pls 1–3. Sjöstedt, Y. (1929) Orthoptera 2. Phasgonurodea. In: Voyage au Congo de S.A.R. le Prince Léopold de Belgique (1925) Revue de Zoologie et de Botanique Africaines, 17, 38–43. Song, H., Buhay, J.E., Whiting, M.F. & Crandall, K.A. (2008) Many species in one: DNA barcoding overestimates the number of species when nuclear mitochondrial pseudogenes are coamplified. Proceedings of the National Academy of Sciences of the United States of America, 105, 13486–13491. http://dx.doi.org/10.1073/pnas.0803076105 Stål, C. (1856) Orthoptera cursoria och Locustina fran Cafferlandet. Öfversigt Kongliga Vetenskaps–akademiens Förhandlingar, Stockholm, 13, 165–170; Stål, C. (1873) Orthoptera nova descripsit. Öfversigt Kongliga Vetenskaps–akademiens Förhandlingar, Stockholm, 30, 39–53. Stoll, C. (1813) Natuurlijke en naar het leven nauwkeurig gekleurde afbeeldingen en beschrijvingen der spoken, wandelende bladen, zabel-springhanen, krekels, trek-springhanen en kakkerlakken. J.C.Sepp & sohn, Amsterdam, 1–9, 1–79, pls 1+1– 25; 1–28, pls 1a–13a; 1–42, pls 1b–23b; 1–8, pls 1c–4c; 1–14, pls 1d–5d. [Dutch and French] Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. & Kumar, S. (2011). MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution, 28, 2731–2739. http://dx.doi.org/10.1093/molbev/msr121 Thompson, J.D., Higgins, D.G. & Gibson, T.J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids

TETTIGONIOIDEA FROM EASTERN CONGO Zootaxa 3785 (3) © 2014 Magnolia Press · 375 Research, 22, 4673–4680. http://dx.doi.org/10.1093/nar/22.22.4673 Uvarov, B.P. (1928) Notes on the types of Orthoptera described by Dr. L. Péringuey. Annals of the South African Museum, 25, 341–357. Uvarov, B.P. (1940) Eleven new generic names in Orthoptera. Annals and Magazine of Natural History, (11), 6, 377–380. Walker, F. (1869) Catalogue of the specimens of Dermaptera Saltatoria in the collection of the British Museum. Part II. Catalogue of Locustidae. British Museum of Natural History, London, pp. 225–423. Walker, F. (1871) Supplement to the Catalogue of Dermaptera Saltatoria. The Trustees of the British Museum, London, 116 pp. Whiting, M.F. (2002) Mecoptera is paraphyletic: multiple genes and phylogeny of Mecoptera and Siphonaptera. Zoologica Scripta, 31, 93–104. http://dx.doi.org/10.1046/j.0300-3256.2001.00095.x