The Role of Cysteine String Protein Alpha (Cspα) Phosphorylation at Serine 10, and 34, by Protein Kinase Cγ for Presynaptic Maintenance

This Accepted Manuscript has not been copyedited and formatted. The final version may differ from this version.

Research Articles: Neurobiology of Disease

The role of cysteine string protein alpha (CSPα) phosphorylation at Serine 10, and 34, by protein kinase Cγ for presynaptic maintenance

Toshihiko Shirafuji1, Takehiko Ueyama2, Naoko Adachi2, Ken-ichi Yoshino2, Yusuke Sotomaru3, Junsuke Uwada4, Azumi Kaneoka1, Taro Ueda1, Shigeru Tanaka1, Izumi Hide1, Naoaki Saito2 and Norio Sakai1

1Department of Molecular and Pharmacological Neuroscience, Graduate School of Biomedical Sciences, Hiroshima University, Hiroshima 734-8551, Japan 2Laboratory of Molecular Pharmacology, Biosignal Research Center, Kobe University, Kobe 657-8501, Japan 3Natural Science Center for Basic Research and Development, Hiroshima University, Hiroshima 734-8551, Japan 4Division of Cellular Signal Transduction, Department of Biochemistry, Asahikawa Medical University, Asahikawa 078-8510, Japan.

DOI: 10.1523/JNEUROSCI.1649-17.2017

Received: 14 June 2017

Revised: 23 October 2017

Accepted: 12 November 2017

Published: 22 November 2017

Author contributions: T.S., T. Ueyama, and N. Saito designed research; T.S., K.-i.Y., J.U., A.K., and T. Ueda performed research; T.S., T. Ueyama, N.A., K.-i.Y., J.U., S.T., I.H., N. Saito, and N. Sakai analyzed data; T.S. and T. Ueyama wrote the paper; Y.S. contributed unpublished reagents/analytic tools.

Conflict of Interest: The authors declare no competing financial interests.

We would like to express our deep appreciation to Prof. Sumio Sugano, The University of Tokyo, Dr. Yoshihide Hayashizaki, RIKEN Omics Science Center, and Research Association for Biotechnology for kindly providing the CSP#, SNAP25, SGT1 cDNA. We also thank Dr. Hiroshi Kiyonari and Dr. Kazuki Nakao (RIKEN. CDB) for mice preservation.

Corresponding author: Toshihiko Shirafuji, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8551, Japan. Tel: +81-82-257-5142, Fax: +81-82-257-5144, E-mails: [email protected]

Cite as: J. Neurosci ; 10.1523/JNEUROSCI.1649-17.2017

Alerts: Sign up at www.jneurosci.org/cgi/alerts to receive customized email alerts when the fully formatted version of this article is published.

Accepted manuscripts are peer-reviewed but have not been through the copyediting, formatting, or proofreading process.

1 The role of cysteine string protein alpha (CSPD) phosphorylation at Serine

2 10, and 34, by protein kinase CJ for presynaptic maintenance

4 Abbreviated title: CSPDphosphorylation by PKCJ for presynaptic

5 maintenance

7 *Toshihiko Shirafuji1, Takehiko Ueyama2, Naoko Adachi2, Ken-ichi Yoshino2,

8 Yusuke Sotomaru3㻘㻌Junsuke Uwada4, Azumi Kaneoka1, Taro Ueda1, Shigeru

9 Tanaka1, Izumi Hide1, Naoaki Saito2, Norio Sakai1

11 1. Department of Molecular and Pharmacological Neuroscience, Graduate

12 School of Biomedical Sciences, Hiroshima University, Hiroshima 734-8551,

13 Japan.

14 2. Laboratory of Molecular Pharmacology, Biosignal Research Center, Kobe

15 University, Kobe 657-8501, Japan

16 3. Natural Science Center for Basic Research and Development, Hiroshima

17 University, Hiroshima 734-8551, Japan.㻌

18 4. Division of Cellular Signal Transduction, Department of Biochemistry,

19 Asahikawa Medical University, Asahikawa 078-8510, Japan.

21 *Corresponding author: Toshihiko Shirafuji

22 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8551, Japan

23 Tel: +81-82-257-5142, Fax: +81-82-257-5144

24 E-mails: [email protected]

25 Number of pages: 49

27 Number of figures: 7, tables: 0

28 Number of words for abstract 235, introduction 550, discussion 1591

30 Conflict of interest

31 The authors declare no conflict of interest.

33 Acknowledgements

34 We would like to express our deep appreciation to Prof. Sumio Sugano, The

35 University of Tokyo, Dr. Yoshihide Hayashizaki, RIKEN Omics Science

36 Center, and Research Association for Biotechnology for kindly providing the

37 CSPD, SNAP25, SGT1 cDNA. We also thank Dr. Hiroshi Kiyonari and Dr.

38 Kazuki Nakao (RIKEN.. CDB) for mice preservation.

49 Abstract

50 Protein Kinase CJ (PKCJ) knockout (KO) animals exhibit symptoms of

51 Parkinson’s disease (PD), including dopaminergic neuronal loss in the

52 substantia nigra. However, the PKCJ substrates responsible for the survival

53 of dopaminergic neurons, in vivo, have not yet been elucidated. Previously,

54 we found 10 potent substrates in the striatum of PKCJ-KO mice. Here, we

55 focused on cysteine string protein alpha (CSPD , one of the proteins from the

56 heat shock protein (HSP) 40 co-chaperone families localized on synaptic

57 vesicles. We found that in cultured cells, PKCJ phosphorylates CSPD at

58 Serine (Ser) 10 and Ser34. Additionally, apoptosis was found to have been

59 enhanced by the overexpression of a phosphorylation null mutant of CSPD,

60 “CSPD(S10A/S34A).” The CSPD S10A/S34A) mutant had a weaker

61 interaction with HSP70 than wild-type (WT) CSPD, but in sharp contrast, a

62 phosphomimetic CSPD S10D/S34D) mutant had a stronger interaction with

63 HSP70 than WT CSPD. In addition, total levels of synaptosomal-associated

64 protein (SNAP) 25 protein, a main downstream target of the HSC70/HSP70

65 chaperone complex, was found to have decreased by the CSPD S10A/S34A)

66 mutant, through increased ubiquitination of SNAP25 in PC12 cells. In the

67 striatum of 2-year-old male PKCJ KO mice, decreased phosphorylation levels

68 of CSPD and decreased SNAP25 protein levels were observed. These findings

69 indicate the phosphorylation of CSPD by PKCJ may protect the presynaptic

70 terminal from neurodegeneration. The PKCJ-CSPD-HSC70/HSP70-SNAP25

71 axis may provide a new therapeutic target for the treatment of PD, through

72 the protection of the presynaptic terminal.

74 Significance statement

75 Cysteine string protein alpha (CSPD) is one of the heat shock protein (HSP)

76 40 co-chaperone families localized on synaptic vesicles, which maintain the

77 presynaptic terminal. However, the function of CSPD phosphorylation by

78 PKC for neuronal cell survival remains unclear. The experiments presented

79 here demonstrate that PKCJ phosphorylates CSPD at Serine (Ser)10 and

80 Ser34. CSPD phosphorylation at Ser10 and Ser34 by PKCJ protects the

81 presynaptic terminal through promoting the HSP70 chaperone activity. This

82 report suggests that CSPD phosphorylation may be one of the targets of the

83 treatment of neurodegeneration through modulating the HSP70 chaperone

84 activity.

86 Introduction

87 Protein kinase C (PKC) is an important Serine/Threonine (Ser/Thr) kinase

88 implicated in various cellular functions, including the regulation of cell

89 survival (Ruvolo et al, 1998; Whelan & Parker, 1998), and Ca2+ triggered

90 exocytosis (Barclay et al, 2003; Iwasaki et al, 2000; Shirafuji et al, 2014). The

91 PKC family consists of at least 10 subtypes, and is divided into the following

92 three subfamilies: conventional PKC (cPKC), novel PKC, and atypical PKC

93 (Nishizuka, 1992). Amongst PKCs, only cPKCs (including PKCJ, which is a

94 neuron-specific PKC isoform; (Saito & Shirai, 2002)) are activated by Ca2+

95 because they contain a C2 domain that specifically binds to Ca2+ and

96 phosphatidylserine (PS; (Murray & Honig, 2002)). PKCJ knockout (KO)

97 animal models exhibit Parkinsonian symptoms, including dopaminergic

98 neuronal cell loss in the substantia nigra (SN), in an age-dependent manner

99 (Payne et al, 2000). Further, increased ubiquitination levels in dopaminergic

100 and serotonergic neurons have also been reported in PKCJKO rats at 18

101 months of age (Al-Kushi, 2007). Although anti-apoptotic/pro-survival

102 functions of cPKC have been demonstrated (Ruvolo et al, 1998; Whelan &

103 Parker, 1998), little is known about its function of chaperone regulation in

104 the presynaptic terminal of neurons.

105 We had previously identified 10 candidates for PKCJ substrates in the

106 nigro-striatum system, by using the shotgun phospho-proteome (Shirafuji et

107 al, 2014). Amongst them, in the present study we have focused on cysteine

108 string protein alpha (CSPD which is a member of the HSP40/DNAJ family

109 of co-chaperones, characterized by the presence of the J-domain (Ohtsuka,

110 1993) named after the Escherichia coli (E. coli) protein, DNAJ (Yochem et al,

111 1978). J domain is responsible for interactions with HSC70/HSP70 through

112 the histidine, proline, and aspartic (HPD) motif and helix II (Hill et al, 1995;

113 Szyperski et al, 1994). HSP40/DNAJ binding regulates the ATPase activity

114 of HSC70/HSP70, which leads to the prevention of aggregation of denatured

115 proteins (Braun et al, 1996).

116 The HSP40/DNAJ family consists of at least 50 members (Qiu et al, 2006),

117 which have been classified into three subtypes (HSP40 type 1, 2, and 3; also

118 referred to as DNAJ A, B, and C (Cheetham & Caplan, 1998)). The members

119 of this family differ from each other by subcellular location, and tissue

120 distribution. CSPD belongs to the HSP40 type 3 (DNAJC) subtype, and is

121 highly expressed in all neurons, where it is localized on synaptic vesicle

122 membranes in the presynaptic terminal (Chamberlain & Burgoyne, 2000). In

123 neurodegenerative diseases, it has been reported that there is an early

124 detection of degenerated presynaptic terminals prior to the loss of neuronal

125 somata (Wishart et al, 2006). As deletion of CSPD also causes presynaptic

126 degeneration in flies (Zinsmaier et al, 1994), worms (Kashyap et al, 2014),

127 and mice (Fernandez-Chacon et al, 2004), it is clear that CSPD performs a

128 universal neuroprotective function (Burgoyne & Morgan, 2015), especially at

129 the presynaptic terminal. To date, although there have been several studies

130 on CSPD phosphorylation associated with exocytosis (Evans et al, 2006;

131 Evans et al, 2001), the involvement of CSPD phosphorylation in the

132 regulation of HSC70/HSP70 chaperone activity and the protection of the

133 presynaptic terminal have not been reported.

134 In the present study, we have found that CSPD is phosphorylated by PKCJ at

135 Ser10 and Ser34. CSPα phosphorylation by PKCJ may promote its

136 interaction with HSC70/HSP70 and chaperone activity for SNAP25 in the

137 presynaptic terminal of dopaminergic neurons.

138

139 Materials and Methods

140 Antibodies

141 The anti-green fluorescent protein (GFP) antibody (Ab) was generated in

142 house (Shirafuji et al, 2014). The following Abs were purchased: anti-FLAG

143 (#P2983), anti-E-tubulin (T-4026), and anti-Tyrosine Hydroxylase (TH)

144 (T-1299) from Sigma-Aldrich (St. Louis, MO); anti-glutathione S-transferase

145 (GST) (#sc-33613), anti-PKCJ (#sc-211) and anti-ubiquitin (sc-8017) from

146 Santa Cruz Biotechnology (Dallas, TX) ; anti-pSer PKC motif (#2261),

147 anti-pThr (#9381), anti-cleaved caspase3 (#9661), and anti-Myc (#2276) from

148 Cell Signaling Technology (Danvers, MA); anti-CSPD (ab90499), and

149 anti-SNAP25 (ab41455) from Abcam (Cambridge, UK); anti-CSPD (AB1576),

150 and anti-SNAP25 (MAB331) from Millipore (Billerica, MA); HRP-conjugated

151 anti-rabbit, and anti-mouse secondary Abs from Jackson ImmunoResearch

152 Inc (West Grove, PA). The anti-TH (T-1299), anti-ubiquitin (sc-8017),

153 anti-pSer PKC motif (#2261), anti-SNAP25 (ab41455), anti-SNAP25

154 (MAB331), anti-CSPD (ab90499), and anti-cleaved caspase3 (#9661)

155 antibodies were verified by our laboratory (Shirafuji et al, 2017). The vendor

156 provided a datasheet for anti-PKCJ (#sc-211), which showed that this

157 antibody has no cross reactivity to other PKCs. Anti-CSPD (AB1576) has

158 been verified previously (Kohan et al, 1995).

159

160 Animals

161 PKCJ-Cre knock-in (KI) mouse was provided by Z.F. Chen (Ding et al, 2005).

162 After the sixth backcross, male homozygous littermates obtained by crossing

163 heterozygous PKCJ-Cre KI mice were used as PKCJ KOs, and wild-type (WT)

164 mice in the present study. All animal studies were approved by the

165 Institutional Animal Care and Use Committee, and conducted according to

166 the Hiroshima University Animal Experimentation Regulations.

167

168 Cell culture

169 COS7 cells were cultured in Dulbecco's modiﬁed Eagle's medium (DMEM;

170 Nacalai Tesque, Kyoto, Japan), supplemented with 10% fetal bovine serum,

171 penicillin (100 units/mL), and streptomycin (100 Pg/mL). PC12 cells were

172 cultured in DMEM containing 5% fetal bovine serum, and 10% horse serum.

173 All cells were cultured at 37°C in a humidified atmosphere containing 5%

174 carbon dioxide (CO2).

175

176 Construction of plasmids

177 WT human PKCJwas cloned into pcDNA3.1 (Life Technologies, Carlsbad,

178 CA), and the subdomains of PKCJ were cloned into pcDNA3.1 with GFP, as

179 described previously (Shirafuji et al, 2014). Human influenza hemagglutinin

180 (HA) tagged ubiquitin cDNA was a gift from Dr. Yamashita (Nagano et al,

181 2003). Human CSPD, SNAP25, and small glutamine-rich tetratricopeptide

182 repeat-containing protein 1 (SGT1) were provided by the RIKEN Bio

183 Resource Center through the National Bio Resource Project of MEXT in

184 Ibaraki, Japan (Ota et al, 2004). For construction of the plasmid encoding a

185 full-length CSPD fused to glutathione S-transferase (GST), full-length CSPD

186 with an EcoRI/XhoI site was amplified by PCR, and cloned into the

187 pGEX-6P1 vector (Amersham, Buckinghamshire, UK). For the construction

188 of plasmids encoding CSPD HSP40, HSP70, SGT1, and SNAP25 fused with

189 3xFLAG at the N terminal, each protein with an EcoRI/BamHI site,

190 amplified via PCR, was cloned into a 3xpFLAG-CMV10 vector

191 (Sigma-Aldrich). For the construction of a plasmid encoding HSC70 fused

192 with 3xFLAG at the N terminal, HSC70 with a BglII/BamHI site, amplified

193 via PCR, was cloned into a 3xpFLAG-CMV10 vector. For the construction of

194 a plasmid encoding full-length CSPD fused with enhanced GFP (EGFP) at

195 the N terminal, CSPD with a XhoI/EcoRI site, produced by PCR, was cloned

196 into a pEGFP-C1 vector (Clontech, Mountain View, CA). For the construction

197 of a plasmid encoding HSP70 fused with Myc tag at the C terminal, HSP70

198 with an EcoRI/XhoI site, amplified via PCR, was cloned into a pcDNA3.1 Myc

199 vector (Thermo Fisher Scientific, Waltham, MA). Substitutions of Serine

200 (Ser) to Alanine (Ala), Glutamate (Glu), or Aspartate (Asp) at the identified

201 phosphorylation sites (Ser10Ala, Ser34Ala, Ser81Ala, Ser10Ala/Ser34Ala,

202 Ser10Glu/Ser34Glu, and Ser10Asp/Ser34Asp) were introduced with a

203 QuikChange Multisite-Directed Mutagenesis Kit (Agilent Technologies,

204 Lexington, MA). All cDNAs were veriﬁed by sequencing.

205 㻌

206 RNA interference (RNAi) and short hairpin RNA (shRNA)-resistant CSPD

207 plasmid construction

208 Double-stranded oligonucleotides were cloned into an shRNA expression

209 vector, pSuper (puro; Oligoengine, Seattle, WA). The target sequences for the

210 shRNA rat CSPD were GCTACTGCTGCTGCTGTTTAT (sh356; cording

211 nucleotides 356-376), and GCTGTTTATGCTGTTGCTTTA (sh368; cording

212 nucleotides 368-388). Because the target sequence for the rat CSPD

213 knockdown (KD; sh356 and sh368) was located in the coding region of CSPD,

214 sh356 and sh368-resistant human CSPD in the 3xpFLAG-CMV10 vector was

215 generated by introducing 7- and 8-base silent changes for sh368 and sh356,

216 respectively, within the targeting sequence (5' GtTAtTGtTGCTGtTGc '3

217 356-372), with a QuikChange Multisite-Directed Mutagenesis Kit. All

218 cDNAs were veriﬁed by sequencing.

219

220 Protein expression

221 Protein expression was performed, as described previously (Ueyama et al,

222 2007). In brief, BL21 pLys E. coli and Sf9 cells were transformed using

223 expression plasmids. E. coli and Sf9 cells were harvested and lysed. For the

224 purification of recombinant proteins, GST fusion proteins were purified with

225 glutathione-Sepharose 4B resin (GE Healthcare Biosciences, Chicago, IL).

226

227 In vitro PKC phosphorylation assay

228 An in vitro PKC phosphorylation assay was performed, as described

229 previously (Shirafuji et al, 2014). In brief, purified GST-tagged CSPD were

230 incubated with 200 ng of GST-tagged PKCJor GST, and the following

231 buffers: 20 mM Tris, pH 7.4, 0.5 mM calcium chloride (CaCl2), 10 PM

232 adenosine triphosphate (ATP), 8 Pg/mL PS, and 0.8 Pg/mL

233 (±)-1,2-didecanoylglycerol (DO), in a 50 PL final volume for 30 min.

234 Immunoblotting for anti-pSer PKC Ab and anti-GST Ab was performed.

235

236 PKC phosphorylation assay in cultured cells

237 A PKC phosphorylation assay in cultured cells was performed, as described

238 previously (Shirafuji et al, 2014), albeit with slight modifications. In brief,

239 COS7 cells were transfected with WT CSPD in 3xpFLAG-CMV10 with a

240 NEPA21 electroporator (Nepa Gene, Ichikawa, Japan). After

241 12-O-tetradecanoylphorbol 13-acetate (TPA) stimulation, with or without

242 PKC inhibitors, GF109203X (GFX), pan PKC inhibitor, and Gö6976, classical

243 PKC inhibitor, for 30 min in HEPES buffer at 37°C, cells were collected and

244 resuspended in homogenization buffer, containing 150 mM sodium chloride

245 (NaCl), 10 mM ethylene glycol tetra acetic acid, 2 mM ethylenediamine

246 tetracetic acid, 10 mM HEPES, pH 7.4, 1 mM phenylmethylsulfonyl fluoride,

247 20 Pg/mL leupeptin, and a phosphatase inhibitor cocktail. The precipitated

248 proteins by anti-FLAG Ab were separated via sodium dodecyl sulfate

249 polyacrylamide gel electrophoresis (SDS-PAGE). The phosphorylated

250 proteins were visualized with phospho-Abs. For the calculation of relative

251 phosphorylation levels, the densitometries of the immunoblots of the

252 phospho-Abs were normalized to the total protein levels in each experiment;

253 the averages of the relative levels of phosphorylation in more than three

254 independent experiments have been presented. Phosphorylation levels of the

255 pre-stimulations were defined as 1.00.

256

257 Sample preparation and western blot analysis

258 Mouse brains and cells were homogenized, and the concentrations of proteins

259 were measured using a bicinchoninic acid (BCA) protein assay kit (Thermo

260 Fisher Scientific). SDS-PAGE and immunoblot analyses were performed, as

261 described previously (Shirafuji et al, 2014).

262

263 Co-immunoprecipitation

264 The cells and mouse striatum samples were collected and resuspended in

265 homogenization buffer containing 150 mM NaCl, 10 mM ethylene

266 glycoltetraaceticacid, 2 mM ethylenediamine tetracetic acid, 10 mM HEPES,

267 pH 7.4, 1 mM phenylmethylsulfonyl fluoride, 20 Pg/mL leupeptin, and a

268 phosphatase-inhibitor cocktail. Proteins precipitated by anti-FLAG, Myc,

269 CSPD, and SNAP25 antibodies were separated by SDS-PAGE, and

270 immunoblotted by appropriate antibodies.

271

272 In-gel digestion

273 After destaining, each sliced gel was incubated with 10 mM dithiothreitol in

274 25 mM ammonium bicarbonate for 60 min at 50°C for reduction, and then

275 with 0.1 M iodoacetamide in 50 mM ammonium bicarbonate for 45 min at

276 room temperature for alkylation. For protein digestion, 200 ng porcine

277 trypsin or bovine chymotrypsin (MS grade; ThermoFisher Scientific,

278 Rockford, IL) in 25 mM ammonium bicarbonate was added to each sliced gel

279 in a tube, and the endopeptidase-solution-absorbed gel was then incubated

280 for 2 h at 37°C (trypsin) or 25°C (chymotrypsin). Endopeptidase digestion

281 was halted by addition of 5% formic acid. After incubation for 15 min at room

282 temperature, 5% formic acid/50% acetonitrile was added to each tube and

283 incubated for 15 min at room temperature, for extraction of peptide

284 fragments from the gels. The supernatant was transferred into another tube

285 made of TPX (IEDA Trading Co., Tokyo, Japan). Then, 100% acetonitrile was

286 added to each sliced gel in a tube and incubated for 15 min at room

287 temperature. The supernatant was collected into the same TPX tube. The

288 collected extract was dried down in a vacuum centrifuge.

289

290 Liquid chromatography/Mass Spectrometry/Mass Spectrometry (LC/MS/MS)

291 LC/MS/MS was performed on an LTQ-Orbitrap Discovery linear ion

292 trap-orbitrap tandem mass spectrometer (ThermoFisher Scientific, Bremen,

293 Germany), which was connected to a Dionex UltiMate 3000 pump

294 (Germering, Germany) and a HTC-PAL autosampler (CTC Analytics,

295 Zwingen, Switzerland). The mobile phases consisted of 0.1% formic acid in

296 water (solvent A) and 0.1% formic acid in acetonitrile (solvent B).

297 Dried peptide fragments dissolved in 20 μL of 0.1% trifluoroacetic acid were

298 applied to the LC/MS/MS system. The peptides were fractionated on an

299 L-column Micro C-18 (150 mm length × 100 μm i.d., particle size 3 μm, CERI,

300 Tokyo, Japan) with a linear gradient of 3–43% solvent B for 40 min at a flow

301 rate of 500 nL/min. The column eluent was sprayed directly into the ion

302 source of the mass spectrometer, using a spray tip (Fortis tip, AMR Inc,

303 Tokyo, Japan) with a spray voltage of 1.8 kV. The “lock mass” function was

304 used to obtain high mass accuracy during the fractionation. The mass

305 spectra were measured in a range of m/z 300–2000. In each mass spectrum of

306 eluents, the top seven high-intensity precursor ions were selected

307 automatically for subsequent product ion analysis by a data-dependent scan

308 mode with a dynamic exclusion option.

309 The LC/MS/MS data were interpreted using a MASCOT MS/MS ions search

310 (Matrix Science, London, United Kingdom). Peptides and proteins were

311 identified from the Swiss-Prot database, with a peptide mass tolerance of 4

312 ppm and a fragment mass tolerance of 0.8 Da. Carbamidomethylation at Cys

313 sites and phosphorylation at Ser/Thr sites were allowed as variable

314 modifications.

315

316 Statistical analysis

317 The data are presented as mean ±SEM and were analyzed with two-sided,

318 unpaired t tests and one-way ANOVA with a post hoc Dunnett’s test,

319 Games/Howell’s test, or Tukey's test. Statistical analyses were performed

320 with the Statview 5.0J software package (SAS Institute, Cary, NC). p-values

321 of 5% or less were considered statistically significant.

322

323 Results

324 CSPD is phosphorylated by PKCJ in vitro, and in cultured cells

325 We previously identified the CSPDphosphorylation at Ser10 by PKCJ

326 through phospho-proteome analysis (Shirafuji et al, 2014). To verify whether

327 CSPD is phosphorylated by PKCJ, we performed phosphorylation

328 experiments, in vitro, and in cultured cells. In vitro experiments,

329 GST-tagged CSPD and GST-tagged PKCJ or GST, were incubated with

330 PS/DO/Ca2+, which is the PKC stimulator. Enhanced phosphorylation of

331 GST-tagged CSPD after treatment with PS/DO/Ca2+ was observed with an

332 anti-Ser PKC motif Ab in presence of GST-tagged PKCJ (Fig. 1A). Further,

333 we investigated whether CSPD is phosphorylated by PKC within cells.

334 Enhanced phosphorylation of FLAG-tagged CSPD extracted from COS7 cells,

335 transfected with FLAG-tagged CSPD and GFP-tagged PKCJ was observed

336 with an anti-Ser PKC motif Ab, but not an anti-pThr Ab, after treatment

337 with 1PM TPA, which is a PKC stimulator (Fig. 1B, C). Furthermore, TPA

338 induced phosphorylation of CSPD was found to have reduced by Gö6976,

339 which is a cPKC inhibitor, and GF109203X (GFX), which is a pan PKC

340 inhibitor at a cellular level (Fig. 1D). No significant enhancement of the

341 effect of Gö6976 was observed when the concentration was increased above 1

342 PM, suggesting that PKCs other than cPKC may also phosphorylate CSPD

343 upon TPA stimulation in COS7 cells (Fig.1E).

344 Decreased phosphorylation of FLAG-tagged CSPD extracted from PC12 cells

345 transfected with FLAG-tagged CSPDwas observed with an anti-Ser PKC

346 motif Ab after treatment with 1 PM PKC inhibitors, Gö6976 and GFX

347 (Fig.1F). In summary, although other serine kinases, such as protein kinase

348 A (PKA) (Evans et al, 2001), may phosphorylate CSPD to a lesser extent,

349 CSPD is phosphorylated mainly by PKCJ in vitro and in cultured cells.

350

351 cPKC phosphorylates CSPD at Ser10 and Ser34 in cultured cells

352 Because CSPD contains several predicted PKC phosphorylation sites, such

353 as Ser10, Ser34, and Ser81 (Fig. 2A), we investigated whether CSPD was

354 phosphorylated at Ser10, Ser34, and Ser81 within cells, by using

355 CSPD(S10A), CSPD S34A), and CSPD S81A) mutants, which are

356 phosphorylation null mutants. CSPD S10A) and CSPD S34A), but not

357 CSPD S81A), were less phosphorylated in TPA treated COS7 cells compared

358 to WT CSPD Fig. 2B . Further, CSPD S10A), (S34A), and (S10A/S34A)

359 mutants were less phosphorylated in PC12 cells, compared to WT CSPD (Fig.

360 2C). To demonstrate the phosphorylation of CSPD at Ser10 and Ser34, we

361 performed phosphorylation assays in vitro and in cultured cells, followed by

362 mass-spectrometry. We identified phosphorylation at Ser10 in the trypsin

363 digest of GST-tagged CSPD (Fig. 2D) and at Ser34 in the chymotrypsin

364 digest of FLAG-tagged CSPD(Fig. 2E). These findings indicate that

365 CSPDresidues, Ser10 and Ser34, are phosphorylated by cPKC.

366

367 CSPD is exclusively phosphorylated by cPKC in the

368 CSPD-HSP70/HSC70-SGT complex at a cellular level

369 Because CSPD forms a complex with HSC70/HSP70, and SGT (Tobaben et al,

370 2001), we investigated whether HSC70/HSP70, and SGT were

371 phosphorylated by PKC. It is noted that CSPD can stimulate the ATPase

372 activity of both HSC70 and HSP70 (Chamberlain & Burgoyne, 1997).

373 Moreover, the ATPase domain, which interacts with CSPD J domain, is

374 almost 90 % identical between HSC70 and HSP70. It is assumed that HSP70

375 may be modulated by phosphorylated CSPD in the same manner as HSC70.

376 At a cellular level, HSP70, HSC70, and SGT were not phosphorylated by

377 TPA stimulation, although, SGT was ubiquitously phosphorylated at the Thr

378 residue (Fig. 1B, C). These findings suggested that CSPD were exclusively

379 phosphorylated through PKC activation in this complex. Consistent with a

380 previous study using rat brain (Evans & Morgan, 2005), our previous

381 phospho-proteome analysis revealed extraordinarily high levels of

382 phosphorylation in CSPD (Shirafuji et al, 2014). Almost all protein members

383 of the HSP40/DNAJ family are characteristic of the Ala residue as the 9th

384 amino acid, upstream of the HPD motif; whereas, CSPDis one of the only

385 three HSP40 type 3/DNAJC family members, which consist of the Ser

386 residue at the corresponding position, instead of the Ala residue.

387 CSPDwhich tethers to the synaptic vesicle membrane, could easily be

388 phosphorylated by PKC because PKC phosphorylates substrates bound to

389 membranes (Shirai et al, 1998). Based on these findings, CSPD is supposed

390 to be phosphorylated by PKCJ more strongly than other HSP40/DNAJ

391 families. Therefore, we compared the phosphorylation levels between CSPD

392 (DNAJC5), and HSP40 (DNAJB1). The Ser phosphorylation level of CSPD by

393 PKC was about four times higher than that of HSP40 (DNAJB1) (Fig. 1B). It

394 must be noted that Thr phosphorylation was not observed in CSPD or HSP40

395 (DNAJB1) (Fig. 1C). These findings suggest that CSPD might promote

396 HSC70/HSP70 chaperone activity more strongly than would other members

397 of the HSP40/DNAJ families, through phosphorylation by PKC.

398

399 Involvement of cPKC in apoptosis

400 To study the functional role of PKC and CSPD in the regulation of apoptosis,

401 we examined the levels of cleaved caspase-3 in PC12 cells, a cell line of a

402 dopaminergic neuronal model. PC12 cells express endogenous CSPD and

403 cPKCs, including PKCJ(Shirafuji et al, 2014). The functional role of PKC in

404 the regulation of apoptosis was monitored using Gö6976 and GFX. These

405 PKC inhibitors significantly enhanced apoptosis (Fig. 3A). Furthermore,

406 Gö6976 enhanced apoptosis in a dose-dependent manner (Fig. 3B). These

407 results suggest that PKC, especially cPKC, plays a crucial role in the

408 apoptosis machinery utilized within PC12 cells.

409

410 CSPD knockdown suppresses neuronal cell survival

411 Because CSPD is a co-chaperone of HSC70/HSP70, and is reported to protect

412 neurons from degeneration (Fernandez-Chacon et al, 2004; Kashyap et al,

413 2014; Zinsmaier et al, 1994), we investigated the possible involvement of

414 CSPD against apoptosis. KD of CSPD in PC12 cells by shRNA resulted in a

415 significant enhancement of apoptosis. The enhanced apoptosis by CSPD KD

416 in PC12 cells was rescued by WT CSPDand was incomplete (Fig. 3C). These

417 data suggest that CSPD bears crucial roles for the survival of PC12 cells.

418

419 PKC-mediated phosphorylation of CSPD at both Ser10, and Ser34, promotes

420 cell survival

421 To determine the role of PKC mediated phosphorylation of CSPD in

422 apoptosis, we exogenously introduced WT CSPD and Ser/Ala mutants,

423 including CSPD(S10A), CSPD S34A), CSPD S10A/S34A), into PC12 cells. We

424 found that apoptosis in PC12 cells transfected with FLAG-tagged

425 CSPD S10A/S34A) significantly increased, compared to PC12 cells

426 transfected with FLAG-tagged WT CSPD (Fig. 3D). We also found that

427 apoptosis with CSPD S10A/S34A) significantly increased in SHSY5Y cells

428 (Fig. 3E). Next, we performed this experiment with Ser/Glu or Ser/Asp

429 mutants, including CSPD S10E/S34E) and CSPD(S10D/S34D) mutants,

430 which are phosphomimetic mutants, in PC12 cells. There were no differences

431 between CSPD S10E/S34E) or CSPD(S10D/S34D) mutants and WT CSPD

432 (Fig. 3F). The fact that phosphomimetic mutants had no additional effects on

433 apoptosis compared with WT CSPD may be explained by the presence of an

434 amount of CSPD protein sufficient for cell survival in PC12 cells, as shown in

435 Fig.3D, in which endogenous CSPD is comparable to exogenously expressed

436 CSPD. Alternatively, the fact may be explained by a high prevalence of

437 phosphorylation in exogenously expressed WT CSPD. This possibility is

438 supported by the following facts: 1) exogenously expressed CSPD was

439 phosphorylated without stimulation in PC12 cells (Fig. 1F), and 2) the

440 degree of CSPDphosphorylation was about 100 times higher than that of

441 other phosphorylated proteins (Shirafuji et al, 2014). Together, our results

442 suggest that PKC-mediated CSPD phosphorylation, at both Ser10, and Ser34,

443 positively regulates cell survival.

444

445 CSPD phosphorylation, at Ser10, and Ser34, promotes interaction with

446 HSP70

447 A previous report (Fang et al, 2013) demonstrated that PKC could

448 potentially promote an interaction between CSPD and HSP70. In the present

449 study, we confirmed the enhancing effect of PKC on the interaction between

450 CSPD and HSP70, using a PKC stimulator TPA (Fig. 4A, B). On the contrary,

451 TPA did not promote interaction between HSP40 and HSP70, suggesting

452 that CSPD may be unique among the HSP40 families that are regulated by

453 PKC (Fig.4 C, D). Together with targeted phosphorylation on CSPDby PKC

454 amongst candidates within the CSPD-HSC70/HSP70-SGT complex (Fig. 1B,

455 C), our results suggested that phosphorylation of residues within CSPD may

456 be crucial for the formation of the CSPD-HSC70/HSP70-SGT complex.

457 Further, to investigate whether Ser10 and/or Ser34 phosphorylation

458 modulates CSPD and HSP70 interaction, we performed a

459 co-immunoprecipitation assay using COS7 cells transfected with Myc-tagged

460 HSP70, and FLAG-tagged WT CSPD or Ser/Ala mutants. CSPD (S10A/S34A)

461 mutants interacted to a lesser degree with HSP70, than with WT CSPD (Fig.

462 4E). We also investigated the interactions of the CSPD S10E/S34E) and

463 CSPD(S10D/S34D) mutants with HSP70. The CSPD S10D/S34D) mutant

464 clearly demonstrated higher interaction with HSP70 than WT CSPD or

465 CSPD S10E/S34E) (Fig. 4F). Because, from a chemical formula point of view,

466 Asp and Glu resemble the phosphorylated Ser and Thr, respectively, CSPD

467 Ser10/34 phosphorylation might be crucial for the increased interaction with

468 HSP70. Taken together, CSPD Ser10, and Ser34, two-residue

469 phosphorylation by PKCJmay be important for CSPD-HSC70/HSP70-SGT

470 complex formation, thereby leading to the promotion of HSC70/HSP70

471 chaperone activity.

472

473 CSPD phosphorylation at Ser10 and Ser34 promotes HSC70/HSP70

474 chaperone activity on SNAP25 in PC12 cells

475 Previous reports identified a lot of targets of the CSPD-HSC70/HSP70-SGT

476 complex (Boal et al, 2011; Boal et al, 2004; Chandra et al, 2005; Evans &

477 Morgan, 2002; Leveque et al, 1998; Magga et al, 2000; Sakisaka et al, 2002;

478 Sharma et al, 2011; Shirasaki et al, 2012; Wu et al, 1999; Zhang et al, 2012).

479 Among those targets, SNAP25 is thought to be the main target responsible

480 for presynaptic degeneration (Sharma et al, 2011). When the functions of the

481 CSPD-HSC70/HSP70-SGT complex are disturbed, ubiquitination of

482 substrates may increase, suggesting that ubiquitination level is one of the

483 indicators of the chaperone activity disorder. To examine the function of

484 CSPD phosphorylation on the HSC70/HSP70 chaperone activity on SNAP25,

485 we investigated the degree of ubiquitination on SNAP25.

486 Immunoprecipitation experiments using an anti-FLAG Ab, and lysates of

487 PC12 cells transfected with HA-tagged ubiquitin, FLAG-tagged SNAP25,

488 and EGFP-tagged WT CSPD or Ser/Ala mutants showed that CSPD S34A),

489 and CSPD S10A/S34A) mutants promoted ubiquitination on FLAG-tagged

490 SNAP25 (Fig. 5A). Next, we confirmed the effect of CSPD on expression

491 levels of SNAP25 protein in PC12 cells. There is a significant difference on

492 SNAP25 protein level between WT CSPD and control (Fig.5B), suggesting

493 that CSPD may have a chaperone effect on SNAP25 in PC12 cells. Further,

494 we investigated the effect of CSPD Ser/Ala mutants on the protein level of

495 SNAP25. TheSNAP25 protein level decreased when the experiment was

496 conducted with the CSPD(S34A) or CSPD(S10A/S34A) mutants, compared

497 with WT CSPD (Fig. 5B). We also investigated the effect of

498 CSPD(S10D/S34D) on SNAP25 protein level, finding that it did not differ

499 from the effect of WT CSPD (Fig. 5B). Because a large proportion of CSPD is

500 phosphorylated in PC12 cells, phosphomimetic mutants may not have any

501 additional effect on SNAP25 protein levels compared with WT CSPD. These

502 results suggest that CSPD phosphorylation at Ser10 and Ser34, but

503 predominantly at S34, might play important roles for maintaining the

504 normal conformation of SNAP25, through HSC70/HSP70 chaperone activity.

505

506 CSPDphosphorylation and SNAP25 protein level decrease in PKCJ KO mice,

507 in an age-dependent manner

508 Finally, we investigated whether these changes in cultured cells are true in

509 mice, in vivo. To confirm decreased phosphorylation of CSPD in the striatum

510 of PKCJ KO mice, we performed immunoprecipitation experiments with an

511 anti-CSPD Ab, followed by immunoblotting for an anti-pSer PKC motif Ab.

512 Although phosphorylation levels of CSPD had not significantly decreased in

513 the striata of PKCJ KO mice at 1 year of age (Fig. 6A), we found a reduction

514 in the striata of 2-year-old PKCJ KO mice, compared to those of WT mice (Fig.

515 6B). These findings were consistent with the results of the phospho-proteome

516 of our previous report (Shirafuji et al, 2014). We further evaluated SNAP25

517 protein levels and ubiquitination for SNAP25, in PKCJ KO mice. We found

518 that SNAP25 protein levels were not changed in PKCJ KO mice at 1 year of

519 age (Fig. 6C). However, SNAP25 protein levels declined in the striata of

520 PKCJ-KO mice at the age of 2 years, even though the protein levels of TH,

521 which is an indicator of the damage of dopaminergic neurons of the striatum,

522 remained preserved (Fig. 6D). In support of our results, previous reports

523 have shown that when a loss of dopaminergic neurons occurs in the SN, the

524 remaining dopamine neurons eventually promote compensatory axonal

525 sprouting, and new dopaminergic synapse formation (Arkadir et al, 2014;

526 Finkelstein et al, 2000). These findings suggest that PKCJ protects

527 dopaminergic neurons by modulating the CSPD-HSC70/HSP70-SNAP25 axis,

528 through CSPD phosphorylation, in vivo.

529

530 Discussion

531 In the present study, we discovered a novel phosphorylation site of CSPD,

532 Ser34, in the helix II of the J domain, for phosphorylation by PKCJ, in

533 addition to the previously reported site, Ser10 (Evans et al, 2006; Evans et al,

534 2001). We also demonstrated that double phosphorylation of CSPD at Ser10,

535 and Ser34, by PKCJ promoted the interaction between CSPD and

536 HSC70/HSP70, which further induced HSC70/HSP70 chaperone activity for

537 SNAP25, and eventually neuronal cell survival. In the striata of 2-year-old

538 PKCJ KO mice, decreased phosphorylation levels of CSPD and decreased

539 SNAP25 protein levels were observed. Thus, we proposed the

540 PKCJ-CSPD-HSC70/HSP70-SNAP25 signaling axis, in which the Ca2+

541 dependent PKC isoform, PKCJ, functions in protection for the presynaptic

542 terminal through CSPD phosphorylation, at Ser10, and Ser34.

543

544 Phosphorylation sites of CSPD targeted by PKCJ

545 In our previous study, we identified that Ser10 of CSPD is a potent

546 PKCJ substrate for phosphorylation in the mice striatum (Shirafuji et al,

547 2014). CSPD has been reported to be phosphorylated at Ser10, in rat brains

548 (Evans & Morgan, 2005). Earlier reports (Evans et al, 2006; Evans et al,

549 2001) also demonstrated that PKA, and protein kinase B/Akt phosphorylate

550 CSPD at Ser10, which was previously the only reported phosphorylation site

551 on CSPD. Phosphorylation of CSPD at Ser10 has been reported to modulate

552 the binding affinity of CSPD for key exocytotic proteins, including syntaxin,

553 synaptotagmin, (Evans et al, 2006; Evans & Morgan, 2002) and the 14-3-3

554 protein (Prescott et al, 2008). These findings suggested that phosphorylation

555 of CSPD at Ser10 may be important for interaction with other proteins and

556 associated with various cell functions. In contrast, CSPD Ser10

557 phosphorylation has been reported to have no function for interaction with

558 HSP70 (Boal et al, 2011; Evans et al, 2001). In the present study, we

559 demonstrated for the first time that human CSPD Ser34 in the helix II of the

560 J domain is a cPKC phosphorylation site. As HPD motif and helix II in the J

561 domain are important for interaction with HSC70/HSP70 (Greene et al,

562 1998; Tsai & Douglas, 1996), CSPD Ser34 phosphorylation is assumed to

563 promote interaction with the HSC70/HSP70 complex. We propose here that

564 CSPD phosphorylation at both Ser10 and Ser34 may have important

565 functions for interaction with HSC70/HSP70, owing to 2 reasons: 1) amongst

566 the CSPD-HSC70/HSP70-SGT complex, only CSPD was phosphorylated upon

567 the activation of cPKC (Fig. 1B, C), and 2) CSPD(S10A/S34A) mutant showed

568 impaired binding between HSP70 and CSPD Fig. 4E . The reason why the

569 double mutant exhibits a stronger effect than CSPD S34A), when the other

570 single mutant, CSPD S10A), displays no effect, remains unclear. However,

571 the possible mechanism may be that CSPD Ser10 phosphorylation may help

572 the interaction with HSC70/HSP70 by Ser34 phosphorylation through a

573 conformational change because CSPD Ser10 phosphorylation has been

574 reported to trigger a major conformational change (Patel et al, 2016). In line

575 with this speculation, Ser34 phosphorylation is necessary for Ser10

576 phosphorylation by PKC because CSPD(S34A) mutant was not

577 phosphorylated by TPA, a PKC stimulator (Fig. 2B).

578

579 Comparison of CSPD phosphorylation sites

580 CSPD Ser10 is conserved through the species, from Drosophila melanogaster

581 to Homo sapiens. Ser34 is also relatively conserved within fish (Danio rerio),

582 and humans, although not in D. melanogaster (Thr) and Xenopus laevis

583 (Cys) (Fig. 7). As Cys has a negative charge like the phosphoryl group, CSP of

584 X. laevis may function the same as those of other species with Ser. As the

585 CSPD(S10D/S34D), but not CSPD(S10E/S34E) mutant interacted with

586 HSP70 more strongly than WT CSPD (Fig. 4F), phosphorylated Ser, not Thr,

587 may be crucial for the interaction of CSPD with HSP70. CSPD belongs to the

588 HSP40 type 3 (also called DNAJC5) subtype, and is specifically expressed on

589 the synaptic vesicles in the presynaptic terminal in neurons. CSPD Ser34 in

590 the helix II of J domain is located 9 amino acids upstream from the HPD

591 motif (Hill et al, 1995; Szyperski et al, 1994), which is crucial for interaction

592 with HSC70/HSP70. The amino acid corresponding to Ser34 of CSPD is Ala

593 in almost all members of the human HSP40/DNAJ families (Walsh et al,

594 2004), and it is converted into Ser residue only in human DNAJC5 (CSPD),

595 DNAJC22, and DNAJC28. Moreover, CSPD has been reported to be

596 modulated through palmitoylation, to tether to membranes on the synaptic

597 vesicles (Greaves et al, 2008). Because PKC easily phosphorylates

598 membrane-bound proteins (Shirai et al, 1998), CSPD may become a good

599 substrate of PKC, through palmitoylation. As shown in Fig. 4, TPA promoted

600 the interaction between CSPD and HSP70, but not between HSP40 and

601 HSP70 (Fig. 4A, B, C, D). Collectively, CSPD with Ser34, which is potentially

602 phosphorylated by PKCJ, may be a specifically evolved HSP40/DNAJC

603 family protein for serving HSC70/HSP70 chaperone activity in presynaptic

604 terminals, compared to other HSP40 co-chaperone families.

605

606 Downstream cascade of phosphorylated CSPD

607 How can CSPD regulate neuronal cell survival through phosphorylation?

608 Previous reports identified many targets of CSPD (Boal et al, 2011; Boal et al,

609 2004; Chandra et al, 2005; Evans & Morgan, 2002; Leveque et al, 1998;

610 Magga et al, 2000; Sakisaka et al, 2002; Sharma et al, 2011; Shirasaki et al,

611 2012; Wu et al, 1999; Zhang et al, 2012). Amongst them, SNAP25 is a critical

612 target of the CSPD-HSC70/HSP70-SGT complex (Sharma et al, 2012;

613 Sharma et al, 2011) for the maintenance of the presynaptic terminal. In our

614 2-years-old PKCJ KO mice, levels of CSPD phosphorylation and SNAP25

615 protein decreased significantly (Fig. 6B, D). Indeed, a previous report

616 demonstrated an elevated ubiquitination level in dopaminergic and

617 serotonergic neurons of PKCJ KO rat (Al-Kushi, 2007). In line of our results

618 obtained from PKCJ KO mice, dysfunctional SNAP25 with abnormal

619 conformation is ubiquitinated, and degraded by the proteasome in a synaptic

620 activity-dependent manner in CSPD deficient mice, which exhibits

621 presynaptic degeneration and neurodegeneration (Sharma et al, 2012;

622 Sharma et al, 2011). The number of neurons in the SN was lower at 13-14

623 months than at 10-12 months in PKCJ KO rats (Payne et al, 2000). As shown

624 in Fig. 6, the SNAP25 protein level decreased from 12 months to 24 months.

625 These findings suggest that the decline in SNAP25 may be correlated with

626 the decreased numbers of SN neurons. Collectively, CSPD phosphorylation

627 by PKCJ may maintain the normal conformation of SNAP25, and protect the

628 synaptic terminal by promoting the HSC70/HSP70 chaperone activity.

629

630 PKCJ-CSPD-HSC70/HSP70-SNAP25 axis protects the presynaptic terminal

631 In neurodegenerative diseases, there is an early degeneration of presynaptic

632 terminals prior to the loss of neuronal somata (Wishart et al, 2006). CSPD is

633 one of the synaptic proteins which were thought to be capable of directly

634 modulating the stability and/or degeneration of the presynaptic terminal

635 (Gillingwater & Wishart, 2013). It has also been shown that mice lacking

636 CSPD are susceptible to a synaptic degeneration phenotype

637 (Fernandez-Chacon et al, 2004). Indeed, reduced CSPD expression

638 contributes to the initial stages of synaptic degeneration in patients with

639 Alzheimer's disease (AD) (Tiwari et al, 2015). Thus, CSPD dysfunction, such

640 as decreased phosphorylation, may be related to presynaptic degeneration

641 observed in the early stage of neurodegenerative diseases. In line with this

642 speculation, apoptosis increased, and SNAP25 protein level decreased, in a

643 CSPD phosphorylation null mutant in PC12 cells (Fig. 3D and Fig. 5B).

644 Improving the PKCJ-CSPD-HSC70/HSP70-SNAP25 pathway may prevent

645 neurodegenerative diseases, by facilitating the HSC70/HSP70 chaperone

646 function.

647

648 PKCJ may protect the presynaptic terminal in association with Ca2+

649 triggered exocytosis

650 During neuronal activity, the synaptic vesicle cycle (exocytosis and

651 endocytosis) occurs. Ca2+-dependent PKCs are also activated by neuronal

652 activity in the rat hippocampus (Brager & Thompson, 2003). Many studies

653 have shown that Ca2+-stimulated exocytosis is controlled by PKC through

654 the phosphorylation of components of the exocytotic machinery, such as

655 SNAP25, Munc18, and EPIX (Barclay et al, 2003; Iwasaki et al, 2000;

656 Shirafuji et al, 2014). It has been suggested that neuronal activity and

657 exocytosis/endocytosis is involved in neurodegeneration (Cirrito et al, 2005;

658 Garcia-Junco-Clemente et al, 2010; Koch et al, 2011). Thus, cPKC may be

659 related to neurodegeneration, in association with exocytosis/endocytosis. In

660 CSPD deficient mice, presynaptic degeneration occurs in a neuronal activity

661 dependent manner (Sharma et al, 2011). This CSPD dependent protection for

662 the presynaptic terminal might be modulated by PKCJ downstream of Ca2+

663 influx. Taken together, cPKC, including PKCJ may play important roles for

664 maintaining homeostasis in the presynaptic terminal, which is the damaged

665 site in neurodegenerative diseases, occurring at an early stage through

666 CSPD phosphorylation, in association with Ca2+ stimulated exocytosis, or

667 neuronal activity.

668

669 Dysfunction of PKC activation in aging 670 Dysfunction of PKC activity was reported in aging. During aging, lipid 671 environment alteration and changes in protein-protein interactions may 672 impair the mechanisms of PKC activation (Battaini & Pascale, 2005).㻌 In 673 rodents, despite no changes in PKC isoform protein levels, the

674 activation/translocation processes of the PKCs are impaired in aged brains 675 (Battaini et al, 1995; Friedman & Wang, 1989; Pascale et al, 1996). Human 676 studies have shown that dysfunction of PKC activation is caused by declined 677 expression levels of its adaptor protein, receptor of activated protein C 678 kinase 1 (RACK1), in pathologically aged brain, such as in AD (Battaini et al, 679 1999). From our results obtained in PKCJ KO mice, decreased levels of CSPD 680 phosphorylation and SNAP25 protein in the striatum may also occur in the 681 aging human brain. Thus, in the primary process of neurodegeneration, the 682 dysfunction of the PKCJ-CSPD-HSC70/HSP70-SNAP25 axis caused by aging 683 may promote the development of the neurodegeneration.

684 In conclusion, PKCJ㻌 may promote HSC70/HSP70 chaperone activity

685 through CSPD phosphorylation, at both Ser10, and Ser34, in the presynaptic

686 terminal of dopaminergic neurons. Phosphorylation modulation of CSPD by

687 PKC may be a potential therapeutic target for the treatment of early stages

688 of neurodegenerative diseases, especially PD.

689

690 Fig legends㻌

691 Fig. 1

692 CSPD is phosphorylated by PKCJ in vitro

693 A: In vitro phosphorylation of CSPD. GST-tagged CSPD proteins were

694 incubated with, or without recombinant PKCJ in the presence of PKC

695 activator (PS/DO/Ca2+), and ATP for 30 min. The phosphorylated proteins

696 were detected by immunoblot for anti-pSer PKC motif Ab, and protein

697 expression was determined by immunoblot with an anti-GST Ab. EPIX is a

698 positive control. The arrowheads on the left panel indicate the bands of

699 immunoblot for anti-pSer PKC motif Ab, and those on the right indicate the

700 total proteins immunoblotted by anti-GST Ab. The phosphorylation levels of

701 GST-tagged CSPDwith PKCJ were normalized to those without PKCJ

702 phosphorylation, which were set at 100%, as shown in the bar graph (n = 3, *

703 p<0.05, unpaired t-test).

704 B, C: COS7 cells expressing FLAG-tagged CSPD, HSP40, HSP70, HSC70,

705 and SGT1 were stimulated with 1 PM TPA for 30 min. Phosphorylated

706 proteins were detected by immunoblotting for the anti-pSer PKC motif Ab

707 (B) and anti-pThr Ab (C), and protein expression was determined by

708 immunoblots with an anti-FLAG Ab. Arrowheads on the top panels indicate

709 the bands for the anti-pSer PKC motif and anti-pThr Abs, or the assumed

710 positions for the anti-pSer PKC motif and anti-pThr Abs, if any. The

711 arrowheads on the bottom panels indicate the total proteins immunoblotted

712 by the anti-FLAG Ab. The phosphorylation levels of CSPD with anti-pSer

713 PKC motif Ab and anti-pThr Abs were normalized to the HSP40

714 phosphorylation signal, which was set to 100%, as shown in the graph (n = 3

715 for each; * p < 0.05, unpaired t-test). The results are expressed as mean ±

716 SEM.

717 D: Cellular phosphorylation of CSPD. COS7 cells expressing FLAG-tagged

718 CSPD and GFP-tagged PKCJ were stimulated with 1 PM

719 12-O-tetradecanoylphorbol 13-acetate (TPA) in the presence or absence of 1

720 PM GFX, or Gö6976 for 30 min. FLAG-tagged CSPD proteins were purified

721 with anti-FLAG agarose resin. Phosphorylated proteins were detected by an

722 immunoblot analysis with an anti-pSer PKC motif Ab. Protein expression

723 was determined by immunoblot with an anti-FLAG Ab. The right bar graph

724 represents the quantification of phosphorylation levels of FLAG-tagged

725 CSPD normalized to that of 1 PM TPA stimulation, which was set to 100% (n

726 = 6; * p < 0.05, one-way ANOVA with post hoc Tukey's test). The results are

727 expressed as mean ± SEM.

728 E: COS7 cells expressing FLAG-tagged CSPD and GFP-tagged PKCJ were

729 stimulated with 1 PM 12-O-tetradecanoylphorbol 13-acetate (TPA) in the

730 presence of 1, 5, and 10 PM Gö6976 for 30 min. The phosphorylation levels of

731 FLAG-tagged CSPD were normalized to that of 1 PM TPA stimulation, which

732 was set to 100%, as shown in right bar graph (n = 6; * p < 0.05, one-way

733 ANOVA with post hoc Tukey's test). The results are expressed as mean ±

734 SEM.

735 F: PC12 cells expressing FLAG-tagged CSPD were incubated for 72 hours in

736 the absence, or presence of 1 PM GFX and Gö6976. FLAG-tagged CSPD

737 proteins were purified with anti-FLAG agarose resin. Phosphorylated

738 proteins were detected by immunoblot for the anti-pSer PKC motif Ab, and

739 protein expression was determined by immunoblots with an anti-FLAG Ab.

740 The phosphorylation levels of FLAG-tagged CSPD were normalized to that of

741 the control, which was set to 100%, as shown in the right bar graph (n = 4; *

742 p < 0.05, one-way ANOVA with post hoc Tukey's test). The results are

743 expressed as mean ± SEM.

744

745 Fig. 2

746 cPKC mediates the phosphorylation of CSPD at Ser 10 and Ser34 in cultured

747 cells

748 A: Schematic illustrations of the CSPD. The predicted phosphorylation sites

749 are circled. Note: Cys is the cysteine string domain.

750 B: COS7 cells transfected with FLAG-tagged CSPD (WT and Ser/Ala

751 mutants), and GFP-tagged PKCJ were stimulated with 1 PM TPA for 30 min.

752 FLAG-tagged CSPD was precipitated and separated by SDS-PAGE. The

753 phosphorylation levels of the FLAG-tagged CSPD proteins that were

754 determined with an anti-pSer PKC Ab were normalized to the protein levels

755 of the CSPD (WT and Ser/Ala mutants) determined by immunoblots, with an

756 anti-FLAG Ab. The right bar graph shows the relative phosphorylation levels

757 normalized to the WT CSPD levels, which were set as 100% (n= 6, * p < 0.05

758 versus WT, one-way ANOVA with post hoc Games-Howell test).

759 C: PC12 cells transfected with FLAG-tagged CSPD WT and Ser/Ala

760 mutants) were incubated for 72 hours. The phosphorylation levels of the

761 FLAG-tagged CSPD proteins that were determined with an anti-pSer PKC

762 Ab were normalized to the protein levels of the CSPD (WT and Ser/Ala

763 mutants), determined by immunoblots with an anti-FLAG Ab. The right

764 graph shows the relative phosphorylation levels normalized to the WT CSPD

765 levels, which were set as 100% (n= 6, * p < 0.05 versus WT, one-way ANOVA

766 with post hoc Dunnett's test).

767 D: HPLC/MS/MS spectrum of phosphopeptide representing 8-24 residues of

768 CSPD after PKCJ assay. Product ion spectrum of the doubly charged peptide

769 at m/z 943.4528, acquired on a linear ion trap mass spectrometer. The

770 predominant product ion at m/z 894.7 generated by neutral loss of 98.0 Da

771 (H3PO4) is clearly visible, featuring a product ion spectrum of a

772 phosphoserine/phosphothreonine-containing peptide. Sequence-revealing

773 product ions appeared at relatively weak intensity; however, they were

774 sufficient to distinguish the exact site (S10) of phosphorylation among five

775 potential sites (S8, S10, T11, S12, and S15).

776 E: HPLC/MS/MS spectrum of phosphopeptide representing 21-38 residues of

777 CSPD after PKC assay. Product ion spectrum of the quadruply charged

778 peptide m/z 533.7739 acquired on a linear ion trap mass spectrometer. The

779 predominant product ion at m/z 509.6 generated by neutral loss of 98.0 Da

780 (H3PO4) is clearly visible, featuring a product ion spectrum of a

781 phosphoserine/phosphothreonine-containing peptide. Sequence-revealing

782 product ions appeared at relatively weak intensity; however, they were

783 sufficient to distinguish the exact site (S34) of phosphorylation among three

784 potential sites (T27, S28, and S34).

785

786 Fig. 3

787 Phosphorylation of CSPD at Ser10, and Ser34, promotes cell survival

788 A: Immunoblot for anti-cleaved caspase3 Ab after treatment with 1 PM GFX,

789 or Gö6976, for 72 hours was examined in PC12 cells. The right bar graphs

790 represent the cleaved caspase3 levels with PKC inhibitors, normalized to the

791 control levels, which were set to 100%. The results are expressed as mean ±

792 SEM (n = 4; * p < 0.05, unpaired t-test).

793 B: Immunoblot for anti-cleaved caspase3 was examined with 0, 40, 200, and

794 1000 nM Gö6976 for 72 hours. The cleaved caspase3 levels with Gö6976 were

795 normalized to the levels without Gö6976, which were set to 100%, as shown

796 in the right graph (n = 4; * p < 0.05 versus control, one-way ANOVA with

797 post hoc Dunnett's test). The results are expressed as mean ± SEM.

798 C: Immunoblot for anti-cleaved caspase3 was examined in PC12 cells that

799 were transfected with Control, short hairpin RNA (shRNA) for CSPD, and

800 both shRNA for CSPD and CSPD WT with shRNA-resistant sequences. The

801 bar graph represents the quantification of the cleaved caspase3 levels with

802 shRNA and with shRNA and CSPDWT, normalized to the levels of control,

803 which were set to 100%. The results are expressed as mean ± SEM (n = 9, *

804 p<0.05 one-way ANOVA with post hoc Tukey's test).

805 D: Immunoblot for anti-cleaved caspase3 was evaluated in PC12 cells that

806 were transfected with FLAG-tagged CSPD (WT and Ser/Ala mutants). The

807 levels of endogenous CSPD, and exogenous CSPD were confirmed.

808 Comparable levels of all ectopically expressed CSPD proteins were confirmed

809 by western blot analyses. The cleaved caspase3 levels of CSPD mutants were

810 normalized to the levels of WT, which were set to 100%, as shown in the right

811 bar graph. The results are expressed as mean ± SEM (n = 6, * p < 0.05 versus

812 WT, one-way ANOVA with post hoc Dunnett's test).

813 E: Immunoblot for anti-cleaved caspase3, evaluated in SHSY5Y cells that

814 were transfected with FLAG-tagged CSPD (WT and Ser/Ala mutants). The

815 levels of endogenous CSPD, and exogenous CSPD were confirmed.

816 Comparable levels of all ectopically expressed CSPD proteins were confirmed

817 by western blot analyses. The cleaved caspase3 levels of the CSPD mutants

818 were normalized to the levels of WT, which were set to 100%, as shown in the

819 bar graph. The results are expressed as mean ± SEM (n = 4, * p < 0.05 versus

820 WT, one-way ANOVA with post hoc Dunnett's test).

821 F: Immunoblot for anti-cleaved caspase3 was evaluated in PC12 cells that

822 were transfected with FLAG-tagged CSPD (WT, Ser/Glu, and Ser/Asp

823 mutants). The levels of endogenous CSPD, and exogenous CSPD were

824 confirmed. Comparable levels of all ectopically expressed CSPD proteins

825 were confirmed by western blot analyses. The cleaved caspase3 levels of the

826 CSPD mutants were normalized to the levels of WT, which were set to 100%,

827 as shown in the bar graph. The results are expressed as mean ± SEM (n = 3).

828

829 Fig. 4

830 Phosphorylation of CSPDat Ser10, and Ser34, promotes the interaction with

831 HSP70 in PC12 cells

832 A: Co-immunoprecipitation assay with anti-Myc Ab was performed with

833 COS7 transfected with Myc-tagged HSP70, and FLAG-tagged WT CSPD in

834 the presence or absence of 1 PM TPA. The interaction of Myc-tagged HSP70

835 and FLAG-tagged WT CSPDwas normalized to the level of the control, as

836 shown in the bar graph. The results are expressed as mean ± SEM (n =4, * p

837 < 0.05, unpaired t-test).

838 B: Co-immunoprecipitation assay with anti-FLAG Ab was performed with

839 COS7, transfected with Myc-tagged HSP70, and FLAG-tagged WT CSPD in

840 the presence or absence of 1 PM TPA. The interaction of Myc-tagged HSP70

841 and FLAG-tagged WT CSPDwas normalized to the level of the control, as

842 shown in the bar graph. The results are expressed as mean ± SEM (n = 9, * p

843 < 0.05, unpaired t-test).

844 C: Co-immunoprecipitation assay with anti-FLAG Ab was performed with

845 COS7, transfected with Myc-tagged HSP70, and FLAG-tagged HSP40 in the

846 presence or absence of 1 PM TPA. The interaction of Myc-tagged HSP70 and

847 FLAG-tagged HSP40was normalized to the level of the control, as shown in

848 the bar graph. The results are expressed as mean ± SEM (n=4, p>0.05,

849 unpaired t-test).

850 D: Co-immunoprecipitation assay with anti-FLAG Ab was performed with

851 COS7, transfected with Myc-tagged HSC70, and FLAG-tagged HSP40 in the

852 presence or absence of 1 PM TPA. The interaction of Myc-tagged HSC70 and

853 FLAG-tagged HSP40was normalized to the level of the control, as shown in

854 the bar graph. The results are expressed as mean ± SEM (n=4, p>0.05,

855 unpaired t-test).

856 E: Co-immunoprecipitation assay with anti-FLAG Ab was performed with

857 COS7, transfected with Myc-tagged HSP70, and FLAG-tagged CSPD (WT

858 and Ser/Ala mutants). The interaction of Myc-tagged HSP70 and

859 FLAG-tagged CSPD (WT and Ser/Ala mutants)was normalized to the level

860 of WT. The results are expressed as mean ± SEM (n = 5, * p < 0.05 versus WT,

861 one-way ANOVA with post hoc Dunnett's test).

862 F: Co-immunoprecipitation assay with anti-FLAG Ab was performed with

863 COS7, transfected with Myc-tagged HSP70, and FLAG-tagged CSPD (WT,

864 Ser/Asp, and Ser/Glu mutants). The interaction of Myc-tagged HSP70 and

865 FLAG-tagged CSPD (WT, Ser/Asp, and Ser/Glu mutants)was normalized to

866 the level of WT, as shown in the bar graph. The results are expressed as

867 mean ± SEM (n = 3, * p < 0.05 versus WT, one-way ANOVA with post hoc

868 Dunnett's test).

869

870 Fig. 5

871 Phosphorylation of CSPDat Ser10 and Ser34 increases the

872 ubiquitination/degradation of SNAP25 in PC12 cells

873 A: Isolated FLAG-tagged SNAP25 by anti-FLAG Ab from PC12 cells,

874 transfected with GFP-tagged CSPD (WT and Ser/Ala mutants) and

875 FLAG-tagged SNAP25 and HA-tagged Ubiquitin, was immunoblotted by

876 anti-Ubiquitin Ab. The ubiquitin levels of FLAG-tagged SNAP25 from PC12

877 cells transfected with GFP-tagged CSPD (WT and Ser/Ala mutants) were

878 normalized with respect to WT, as shown in the bar graph. The results are

879 expressed as mean ± SEM (n = 5, * p < 0.05 versus WT, one-way ANOVA

880 with post hoc Dunnett's test). The star indicates the ubiquitinated

881 FLAG-tagged SNAP25.

882 B: Endogenous SNAP25 protein levels were measured in PC12 cells

883 transfected with GFP-tagged CSPD (WT, Ser/Ala mutants, and Ser/Asp

884 mutant) by using immunoblot for anti-SNAP25 Ab. SNAP25 protein levels

885 were normalized with respect to WT, as shown in the bar graph. The results

886 are expressed as mean ± SEM (Control (n=12), WT (n=13), S10A (n=7), S34A

887 (n=7), S10A/S34A (n=13), S10D/S34D (n=8), * p < 0.05 versus WT, one-way

888 ANOVA with post hoc Games/Howell’s test).

889

890 Fig. 6

891 Decreased levels of CSPD phosphorylation and SNAP25 protein levels in the

892 PKCJ KO mice striatum

893 A: Isolated CSPD by anti-CSPD Ab from the striatum of PKCJ KO, and WT

894 mice were immunoblotted with anti-pSer PKC motif Ab at the age of 1 year.

895 The right bar graph represents the quantification of pSer levels normalized

896 to respect to WT. The results are expressed as mean ± SEM (WT (n=4), KO

897 (n=5), not significant, unpaired t-test).

898 B: Isolated CSPD by anti-CSPD Ab from the striatum of PKCJ KO, and WT

899 mice were immunoblotted with anti-pSer PKC motif Ab at the age of 2 years.

900 The right bar graph represents the quantification of pSer levels normalized

901 to respect to WT. The results are expressed as mean ± SEM (WT (n=5), KO

902 (n=6); * p < 0.05, unpaired t-test).

903 C: The protein level of SNAP25 and TH in the striatum was examined by

904 immunoblot with anti-SNAP25 Ab, and anti-TH Ab, at the age of 1 year. The

905 right bar graphs represent the quantification of TH and SNAP25 protein

906 levels normalized with respect to WT, respectively. The results are expressed

907 as mean ± SEM (TH: WT (n=4), KO (n=5), not significant, unpaired t-test,

908 SNAP25: WT (n=4), KO (n=5), not significant, unpaired t-test).

909 D: The protein level of SNAP25 and TH in the striatum was measured by

910 immunoblot with anti-SNAP25 Ab, and anti-TH Ab at the age of 2 years. The

911 right bar graphs represent the quantification of TH and SNAP25 protein

912 levels normalized with respect to WT, respectively. The results are expressed

913 as mean ± SEM (TH: WT (n=3), KO (n=4), not significant, unpaired t-test,

914 SNAP25: WT (n=5), KO (n=6), * p < 0.05, unpaired t-test).

915

916 Fig. 7

917 Schematic comparisons of CSPD Ser10, and Ser34, through evolution

918 CSPD Ser10 is evolutionarily conserved in all species listed. Notably, CSPD

919 Ser34 is relatively conserved between Danio rerio and Homo sapiens,

920 although not in the Drosophila melanogaster and Xenopus laevis species.

921

922

923

924

925

926

927

928

929

930 Reference

931

932 Al-Kushi AG (2007) Pathological change in mesostriatal neurons in a 933 PKC-gamma mutant rat. Thesis of Glasgow University 934 935 Arkadir D, Bergman H, Fahn S (2014) Redundant dopaminergic activity may 936 enable compensatory axonal sprouting in Parkinson disease. Neurology 82: 937 1093-1098 938 939 Barclay JW, Craig TJ, Fisher RJ, Ciufo LF, Evans GJ, Morgan A, Burgoyne 940 RD (2003) Phosphorylation of Munc18 by protein kinase C regulates the 941 kinetics of exocytosis. The Journal of biological chemistry 278: 10538-10545 942 943 Battaini F, Elkabes S, Bergamaschi S, Ladisa V, Lucchi L, De Graan PN, 944 Schuurman T, Wetsel WC, Trabucchi M, Govoni S (1995) Protein kinase C 945 activity, translocation, and conventional isoforms in aging rat brain. 946 Neurobiology of aging 16: 137-148 947 948 Battaini F, Pascale A (2005) Protein kinase C signal transduction regulation 949 in physiological and pathological aging. Annals of the New York Academy of 950 Sciences 1057: 177-192 951 952 Battaini F, Pascale A, Lucchi L, Pasinetti GM, Govoni S (1999) Protein 953 kinase C anchoring deficit in postmortem brains of Alzheimer's disease 954 patients. Experimental neurology 159: 559-564 955 956 Boal F, Laguerre M, Milochau A, Lang J, Scotti PA (2011) A charged 957 prominence in the linker domain of the cysteine-string protein Cspalpha 958 mediates its regulated interaction with the calcium sensor synaptotagmin 9 959 during exocytosis. FASEB journal : official publication of the Federation of 960 American Societies for Experimental Biology 25: 132-143 961 962 Boal F, Zhang H, Tessier C, Scotti P, Lang J (2004) The variable C-terminus 963 of cysteine string proteins modulates exocytosis and protein-protein 964 interactions. Biochemistry 43: 16212-16223

965 966 Brager DH, Thompson SM (2003) Activity-dependent release of adenosine 967 contributes to short-term depression at CA3-CA1 synapses in rat 968 hippocampus. Journal of neurophysiology 89: 22-26 969 970 Braun JE, Wilbanks SM, Scheller RH (1996) The cysteine string secretory 971 vesicle protein activates Hsc70 ATPase. The Journal of biological chemistry 972 271: 25989-25993 973 974 Burgoyne RD, Morgan A (2015) Cysteine string protein (CSP) and its role in 975 preventing neurodegeneration. Seminars in cell & developmental biology 40: 976 153-159 977 978 Chamberlain LH, Burgoyne RD (1997) Activation of the ATPase activity of 979 heat-shock proteins Hsc70/Hsp70 by cysteine-string protein. The 980 Biochemical journal 322 ( Pt 3): 853-858 981 982 Chamberlain LH, Burgoyne RD (2000) Cysteine-string protein: the 983 chaperone at the synapse. Journal of neurochemistry 74: 1781-1789 984 985 Chandra S, Gallardo G, Fernandez-Chacon R, Schluter OM, Sudhof TC 986 (2005) Alpha-synuclein cooperates with CSPalpha in preventing 987 neurodegeneration. Cell 123: 383-396 988 989 Cheetham ME, Caplan AJ (1998) Structure, function and evolution of DnaJ: 990 conservation and adaptation of chaperone function. Cell stress & chaperones 991 3: 28-36 992 993 Cirrito JR, Yamada KA, Finn MB, Sloviter RS, Bales KR, May PC, Schoepp 994 DD, Paul SM, Mennerick S, Holtzman DM (2005) Synaptic activity regulates 995 interstitial fluid amyloid-beta levels in vivo. Neuron 48: 913-922 996 997 Ding YQ, Xiang CX, Chen ZF (2005) Generation and characterization of the 998 PKC gamma-Cre mouse line. Genesis 43: 28-33 999 1000 Evans GJ, Barclay JW, Prescott GR, Jo SR, Burgoyne RD, Birnbaum MJ,

1001 Morgan A (2006) Protein kinase B/Akt is a novel cysteine string protein 1002 kinase that regulates exocytosis release kinetics and quantal size. The 1003 Journal of biological chemistry 281: 1564-1572 1004 1005 Evans GJ, Morgan A (2002) Phosphorylation-dependent interaction of the 1006 synaptic vesicle proteins cysteine string protein and synaptotagmin I. The 1007 Biochemical journal 364: 343-347 1008 1009 Evans GJ, Morgan A (2005) Phosphorylation of cysteine string protein in the 1010 brain: developmental, regional and synaptic specificity. The European 1011 journal of neuroscience 21: 2671-2680 1012 1013 Evans GJ, Wilkinson MC, Graham ME, Turner KM, Chamberlain LH, 1014 Burgoyne RD, Morgan A (2001) Phosphorylation of cysteine string protein by 1015 protein kinase A. Implications for the modulation of exocytosis. The Journal 1016 of biological chemistry 276: 47877-47885 1017 1018 Fang S, Crews AL, Chen W, Park J, Yin Q, Ren XR, Adler KB (2013) 1019 MARCKS and HSP70 interactions regulate mucin secretion by human 1020 airway epithelial cells in vitro. Am J Physiol Lung Cell Mol Physiol 304: 1021 L511-518 1022 1023 Fernandez-Chacon R, Wolfel M, Nishimune H, Tabares L, Schmitz F, 1024 Castellano-Munoz M, Rosenmund C, Montesinos ML, Sanes JR, 1025 Schneggenburger R, Sudhof TC (2004) The synaptic vesicle protein CSP 1026 alpha prevents presynaptic degeneration. Neuron 42: 237-251 1027 1028 Finkelstein DI, Stanic D, Parish CL, Tomas D, Dickson K, Horne MK (2000) 1029 Axonal sprouting following lesions of the rat substantia nigra. Neuroscience 1030 97: 99-112 1031 1032 Friedman E, Wang HY (1989) Effect of age on brain cortical protein kinase C 1033 and its mediation of 5-hydroxytryptamine release. Journal of 1034 neurochemistry 52: 187-192 1035 1036 Garcia-Junco-Clemente P, Cantero G, Gomez-Sanchez L, Linares-Clemente P,

1037 Martinez-Lopez JA, Lujan R, Fernandez-Chacon R (2010) Cysteine string 1038 protein-alpha prevents activity-dependent degeneration in GABAergic 1039 synapses. The Journal of neuroscience : the official journal of the Society for 1040 Neuroscience 30: 7377-7391 1041 1042 Gillingwater TH, Wishart TM (2013) Mechanisms underlying synaptic 1043 vulnerability and degeneration in neurodegenerative disease. 1044 Neuropathology and applied neurobiology 39: 320-334 1045 1046 Greaves J, Salaun C, Fukata Y, Fukata M, Chamberlain LH (2008) 1047 Palmitoylation and membrane interactions of the neuroprotective chaperone 1048 cysteine-string protein. The Journal of biological chemistry 283: 1049 25014-25026 1050 1051 Greene MK, Maskos K, Landry SJ (1998) Role of the J-domain in the 1052 cooperation of Hsp40 with Hsp70. Proceedings of the National Academy of 1053 Sciences of the United States of America 95: 6108-6113 1054 1055 Hill RB, Flanagan JM, Prestegard JH (1995) 1H and 15N magnetic 1056 resonance assignments, secondary structure, and tertiary fold of Escherichia 1057 coli DnaJ(1-78). Biochemistry 34: 5587-5596 1058 1059 Iwasaki S, Kataoka M, Sekiguchi M, Shimazaki Y, Sato K, Takahashi M 1060 (2000) Two distinct mechanisms underlie the stimulation of 1061 neurotransmitter release by phorbol esters in clonal rat pheochromocytoma 1062 PC12 cells. Journal of biochemistry 128: 407-414 1063 1064 Kashyap SS, Johnson JR, McCue HV, Chen X, Edmonds MJ, Ayala M, 1065 Graham ME, Jenn RC, Barclay JW, Burgoyne RD, Morgan A (2014) 1066 Caenorhabditis elegans dnj-14, the orthologue of the DNAJC5 gene mutated 1067 in adult onset neuronal ceroid lipofuscinosis, provides a new platform for 1068 neuroprotective drug screening and identifies a SIR-2.1-independent action 1069 of resveratrol. Human molecular genetics 23: 5916-5927 1070 1071 Koch P, Breuer P, Peitz M, Jungverdorben J, Kesavan J, Poppe D, Doerr J, 1072 Ladewig J, Mertens J, Tuting T, Hoffmann P, Klockgether T, Evert BO,

1073 Wullner U, Brustle O (2011) Excitation-induced ataxin-3 aggregation in 1074 neurons from patients with Machado-Joseph disease. Nature 480: 543-546 1075 1076 Kohan SA, Pescatori M, Brecha NC, Mastrogiacomo A, Umbach JA, 1077 Gundersen CB (1995) Cysteine string protein immunoreactivity in the 1078 nervous system and adrenal gland of rat. The Journal of neuroscience : the 1079 official journal of the Society for Neuroscience 15: 6230-6238 1080 1081 Leveque C, Pupier S, Marqueze B, Geslin L, Kataoka M, Takahashi M, De 1082 Waard M, Seagar M (1998) Interaction of cysteine string proteins with the 1083 alpha1A subunit of the P/Q-type calcium channel. The Journal of biological 1084 chemistry 273: 13488-13492 1085 1086 Magga JM, Jarvis SE, Arnot MI, Zamponi GW, Braun JE (2000) Cysteine 1087 string protein regulates G protein modulation of N-type calcium channels. 1088 Neuron 28: 195-204 1089 1090 Murray D, Honig B (2002) Electrostatic control of the membrane targeting of 1091 C2 domains. Molecular cell 9: 145-154 1092 1093 Nagano Y, Yamashita H, Takahashi T, Kishida S, Nakamura T, Iseki E, 1094 Hattori N, Mizuno Y, Kikuchi A, Matsumoto M (2003) Siah-1 facilitates 1095 ubiquitination and degradation of synphilin-1. The Journal of biological 1096 chemistry 278: 51504-51514 1097 1098 Nishizuka Y (1992) Intracellular signaling by hydrolysis of phospholipids 1099 and activation of protein kinase C. Science 258: 607-614 1100 1101 Ohtsuka K (1993) Cloning of a cDNA for heat-shock protein hsp40, a human 1102 homologue of bacterial DnaJ. Biochemical and biophysical research 1103 communications 197: 235-240 1104 1105 Ota T, Suzuki Y, Nishikawa T, Otsuki T, Sugiyama T, Irie R, Wakamatsu A, 1106 Hayashi K, Sato H, Nagai K, Kimura K, Makita H, Sekine M, Obayashi M, 1107 Nishi T, Shibahara T, Tanaka T, Ishii S, Yamamoto J, Saito K, Kawai Y, Isono 1108 Y, Nakamura Y, Nagahari K, Murakami K, Yasuda T, Iwayanagi T,

1109 Wagatsuma M, Shiratori A, Sudo H, Hosoiri T, Kaku Y, Kodaira H, Kondo H, 1110 Sugawara M, Takahashi M, Kanda K, Yokoi T, Furuya T, Kikkawa E, Omura 1111 Y, Abe K, Kamihara K, Katsuta N, Sato K, Tanikawa M, Yamazaki M, 1112 Ninomiya K, Ishibashi T, Yamashita H, Murakawa K, Fujimori K, Tanai H, 1113 Kimata M, Watanabe M, Hiraoka S, Chiba Y, Ishida S, Ono Y, Takiguchi S, 1114 Watanabe S, Yosida M, Hotuta T, Kusano J, Kanehori K, Takahashi-Fujii A, 1115 Hara H, Tanase TO, Nomura Y, Togiya S, Komai F, Hara R, Takeuchi K, 1116 Arita M, Imose N, Musashino K, Yuuki H, Oshima A, Sasaki N, Aotsuka S, 1117 Yoshikawa Y, Matsunawa H, Ichihara T, Shiohata N, Sano S, Moriya S, 1118 Momiyama H, Satoh N, Takami S, Terashima Y, Suzuki O, Nakagawa S, 1119 Senoh A, Mizoguchi H, Goto Y, Shimizu F, Wakebe H, Hishigaki H, Watanabe 1120 T, Sugiyama A, Takemoto M, Kawakami B, Yamazaki M, Watanabe K, 1121 Kumagai A, Itakura S, Fukuzumi Y, Fujimori Y, Komiyama M, Tashiro H, 1122 Tanigami A, Fujiwara T, Ono T, Yamada K, Fujii Y, Ozaki K, Hirao M, 1123 Ohmori Y, Kawabata A, Hikiji T, Kobatake N, Inagaki H, Ikema Y, Okamoto 1124 S, Okitani R, Kawakami T, Noguchi S, Itoh T, Shigeta K, Senba T, 1125 Matsumura K, Nakajima Y, Mizuno T, Morinaga M, Sasaki M, Togashi T, 1126 Oyama M, Hata H, Watanabe M, Komatsu T, Mizushima-Sugano J, Satoh T, 1127 Shirai Y, Takahashi Y, Nakagawa K, Okumura K, Nagase T, Nomura N, 1128 Kikuchi H, Masuho Y, Yamashita R, Nakai K, Yada T, Nakamura Y, Ohara O, 1129 Isogai T, Sugano S (2004) Complete sequencing and characterization of 1130 21,243 full-length human cDNAs. Nature genetics 36: 40-45 1131 1132 Pascale A, Fortino I, Govoni S, Trabucchi M, Wetsel WC, Battaini F (1996) 1133 Functional impairment in protein kinase C by RACK1 (receptor for activated 1134 C kinase 1) deficiency in aged rat brain cortex. Journal of neurochemistry 67: 1135 2471-2477 1136 1137 Patel P, Prescott GR, Burgoyne RD, Lian LY, Morgan A (2016) 1138 Phosphorylation of Cysteine String Protein Triggers a Major Conformational 1139 Switch. Structure 24: 1380-1386 1140 1141 Payne AP, Campbell JM, Russell D, Favor G, Sutcliffe RG, Bennett NK, 1142 Davies RW, Stone TW (2000) The AS/AGU rat: a spontaneous model of 1143 disruption and degeneration in the nigrostriatal dopaminergic system. 1144 Journal of anatomy 196 ( Pt 4): 629-633

1145 1146 Prescott GR, Jenkins RE, Walsh CM, Morgan A (2008) Phosphorylation of 1147 cysteine string protein on Serine 10 triggers 14-3-3 protein binding. 1148 Biochemical and biophysical research communications 377: 809-814 1149 1150 Qiu XB, Shao YM, Miao S, Wang L (2006) The diversity of the DnaJ/Hsp40 1151 family, the crucial partners for Hsp70 chaperones. Cellular and molecular 1152 life sciences : CMLS 63: 2560-2570 1153 1154 Ruvolo PP, Deng X, Carr BK, May WS (1998) A functional role for 1155 mitochondrial protein kinase Calpha in Bcl2 phosphorylation and 1156 suppression of apoptosis. The Journal of biological chemistry 273: 1157 25436-25442 1158 1159 Saito N, Shirai Y (2002) Protein kinase C gamma (PKC gamma): function of 1160 neuron specific isotype. Journal of biochemistry 132: 683-687 1161 1162 Sakisaka T, Meerlo T, Matteson J, Plutner H, Balch WE (2002) 1163 Rab-alphaGDI activity is regulated by a Hsp90 chaperone complex. The 1164 EMBO journal 21: 6125-6135 1165 1166 Sharma M, Burre J, Bronk P, Zhang Y, Xu W, Sudhof TC (2012) CSPalpha 1167 knockout causes neurodegeneration by impairing SNAP-25 function. The 1168 EMBO journal 31: 829-841 1169 1170 Sharma M, Burre J, Sudhof TC (2011) CSPalpha promotes SNARE-complex 1171 assembly by chaperoning SNAP-25 during synaptic activity. Nat Cell Biol 13: 1172 30-39 1173 1174 Shirafuji T, Ueyama T, Tanaka S, Hide I, Saito N, Sakai N (2017) Validation 1175 of anti-CSPalpha, SNAP25, Tyrosine hydroxylase, Ubiquitin, cleaved 1176 caspase3, adn pSer PKC motif antibodies for utilization in western blotting. 1177 Acta Histochemica et Cytochemica in press 1178 1179 Shirafuji T, Ueyama T, Yoshino K, Takahashi H, Adachi N, Ago Y, Koda K, 1180 Nashida T, Hiramatsu N, Matsuda T, Toda T, Sakai N, Saito N (2014) The

1181 role of Pak-interacting exchange factor-beta phosphorylation at serines 340 1182 and 583 by PKCgamma in dopamine release. The Journal of neuroscience : 1183 the official journal of the Society for Neuroscience 34: 9268-9280 1184 1185 Shirai Y, Sakai N, Saito N (1998) Subspecies-specific targeting mechanism of 1186 protein kinase C. Japanese journal of pharmacology 78: 411-417 1187 1188 Shirasaki DI, Greiner ER, Al-Ramahi I, Gray M, Boontheung P, Geschwind 1189 DH, Botas J, Coppola G, Horvath S, Loo JA, Yang XW (2012) Network 1190 organization of the huntingtin proteomic interactome in mammalian brain. 1191 Neuron 75: 41-57 1192 1193 Szyperski T, Pellecchia M, Wall D, Georgopoulos C, Wuthrich K (1994) NMR 1194 structure determination of the Escherichia coli DnaJ molecular chaperone: 1195 secondary structure and backbone fold of the N-terminal region (residues 1196 2-108) containing the highly conserved J domain. Proceedings of the 1197 National Academy of Sciences of the United States of America 91: 1198 11343-11347 1199 1200 Tiwari SS, d'Orange M, Troakes C, Shurovi BN, Engmann O, Noble W, 1201 Hortobagyi T, Giese KP (2015) Evidence that the presynaptic vesicle protein 1202 CSPalpha is a key player in synaptic degeneration and protection in 1203 Alzheimer's disease. Molecular brain 8: 6 1204 1205 Tobaben S, Thakur P, Fernandez-Chacon R, Sudhof TC, Rettig J, Stahl B 1206 (2001) A trimeric protein complex functions as a synaptic chaperone machine. 1207 Neuron 31: 987-999 1208 1209 Tsai J, Douglas MG (1996) A conserved HPD sequence of the J-domain is 1210 necessary for YDJ1 stimulation of Hsp70 ATPase activity at a site distinct 1211 from substrate binding. The Journal of biological chemistry 271: 9347-9354 1212 1213 Ueyama T, Tatsuno T, Kawasaki T, Tsujibe S, Shirai Y, Sumimoto H, Leto TL, 1214 Saito N (2007) A regulated adaptor function of p40phox: distinct p67phox 1215 membrane targeting by p40phox and by p47phox. Molecular biology of the 1216 cell 18: 441-454

1217 1218 Walsh P, Bursac D, Law YC, Cyr D, Lithgow T (2004) The J-protein family: 1219 modulating protein assembly, disassembly and translocation. EMBO reports 1220 5: 567-571 1221 1222 Whelan RD, Parker PJ (1998) Loss of protein kinase C function induces an 1223 apoptotic response. Oncogene 16: 1939-1944 1224 1225 Wishart TM, Parson SH, Gillingwater TH (2006) Synaptic vulnerability in 1226 neurodegenerative disease. Journal of neuropathology and experimental 1227 neurology 65: 733-739 1228 1229 Wu MN, Fergestad T, Lloyd TE, He Y, Broadie K, Bellen HJ (1999) Syntaxin 1230 1A interacts with multiple exocytic proteins to regulate neurotransmitter 1231 release in vivo. Neuron 23: 593-605 1232 1233 Yochem J, Uchida H, Sunshine M, Saito H, Georgopoulos CP, Feiss M (1978) 1234 Genetic analysis of two genes, dnaJ and dnaK, necessary for Escherichia coli 1235 and bacteriophage lambda DNA replication. Molecular & general genetics : 1236 MGG 164: 9-14 1237 1238 Zhang YQ, Henderson MX, Colangelo CM, Ginsberg SD, Bruce C, Wu T, 1239 Chandra SS (2012) Identification of CSPalpha clients reveals a role in 1240 dynamin 1 regulation. Neuron 74: 136-150 1241 1242 Zinsmaier KE, Eberle KK, Buchner E, Walter N, Benzer S (1994) Paralysis 1243 and early death in cysteine string protein mutants of Drosophila. Science 1244 263: 977-980 1245 1246

1247

1248