Glucocorticoids and Metabolic Disorders by Tzu-Chieh Chen A
Total Page:16
File Type:pdf, Size:1020Kb

Load more
Recommended publications
-
Combination of Photodynamic Therapy with Fenretinide and C6
Wayne State University Wayne State University Theses 1-1-2015 Combination Of Photodynamic Therapy With Fenretinide And C6-Pyridinium Ceramide Enhances Killing Of Scc17b Human Head And Neck Squamous Cell Carcinoma Cells Via The eD Novo Sphingolipid Biosynthesis And Mitochondrial Apoptosis Nithin Bhargava Boppana Wayne State University, Follow this and additional works at: https://digitalcommons.wayne.edu/oa_theses Part of the Medicinal Chemistry and Pharmaceutics Commons Recommended Citation Boppana, Nithin Bhargava, "Combination Of Photodynamic Therapy With Fenretinide And C6-Pyridinium Ceramide Enhances Killing Of Scc17b Human Head And Neck Squamous Cell Carcinoma Cells Via The eD Novo Sphingolipid Biosynthesis And Mitochondrial Apoptosis" (2015). Wayne State University Theses. 431. https://digitalcommons.wayne.edu/oa_theses/431 This Open Access Thesis is brought to you for free and open access by DigitalCommons@WayneState. It has been accepted for inclusion in Wayne State University Theses by an authorized administrator of DigitalCommons@WayneState. COMBINATION OF PHOTODYNAMIC THERAPY WITH FENRETINIDE AND C6-PYRIDINIUM CERAMIDE ENHANCES KILLING OF SCC17B HUMAN HEAD AND NECK SQUAMOUS CELL CARCINOMA CELLS VIA THE DE NOVO SPHINGOLIPID BIOSYNTHESIS AND MITOCHONDRIAL APOPTOSIS by NITHIN BHARGAVA BOPPANA THESIS Submitted to the Graduate School of Wayne State University, Detroit, Michigan in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE 2015 MAJOR: PHARMACEUTICAL SCIENCES Approved By: ________________________________ Advisor Date © COPYRIGHT BY NITHIN BHARGAVA BOPPANA 2015 All Rights Reserved DEDICATION Dedicated to my mom Rekha Vasireddy for always believing in me and helping me in becoming the person who I am today. ii ACKNOWLEDGEMENTS I am grateful to my advisor, Dr. Duska Separovic for her invaluable mentorship throughout the project. -
Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase -
Adipose Tissue NAPE-PLD Controls Fat Mass Development by Altering the Browning Process and Gut Microbiota
ARTICLE Received 11 Jul 2014 | Accepted 4 Feb 2015 | Published 11 Mar 2015 DOI: 10.1038/ncomms7495 OPEN Adipose tissue NAPE-PLD controls fat mass development by altering the browning process and gut microbiota Lucie Geurts1, Amandine Everard1,*, Matthias Van Hul1,*, Ahmed Essaghir2, Thibaut Duparc1, Se´bastien Matamoros1, Hubert Plovier1, Julien Castel3, Raphael G.P. Denis3, Marie Bergiers1, Ce´line Druart1, Mireille Alhouayek4, Nathalie M. Delzenne1, Giulio G. Muccioli4, Jean-Baptiste Demoulin2, Serge Luquet3 & Patrice D. Cani1 Obesity is a pandemic disease associated with many metabolic alterations and involves several organs and systems. The endocannabinoid system (ECS) appears to be a key regulator of energy homeostasis and metabolism. Here we show that specific deletion of the ECS synthesizing enzyme, NAPE-PLD, in adipocytes induces obesity, glucose intolerance, adipose tissue inflammation and altered lipid metabolism. We report that Napepld-deleted mice present an altered browning programme and are less responsive to cold-induced browning, highlighting the essential role of NAPE-PLD in regulating energy homeostasis and metabolism in the physiological state. Our results indicate that these alterations are mediated by a shift in gut microbiota composition that can partially transfer the phenotype to germ-free mice. Together, our findings uncover a role of adipose tissue NAPE-PLD on whole-body metabolism and provide support for targeting NAPE-PLD-derived bioactive lipids to treat obesity and related metabolic disorders. 1 Metabolism and Nutrition Research Group, WELBIO-Walloon Excellence in Life Sciences and BIOtechnology, Louvain Drug Research Institute, Universite´ catholique de Louvain, Avenue E. Mounier, 73 B1.73.11, 1200 Brussels, Belgium. 2 de Duve Institute, Universite´ catholique de Louvain, Avenue Hippocrate, 74 B1.74.05, 1200 Brussels, Belgium. -
HCC and Cancer Mutated Genes Summarized in the Literature Gene Symbol Gene Name References*
HCC and cancer mutated genes summarized in the literature Gene symbol Gene name References* A2M Alpha-2-macroglobulin (4) ABL1 c-abl oncogene 1, receptor tyrosine kinase (4,5,22) ACBD7 Acyl-Coenzyme A binding domain containing 7 (23) ACTL6A Actin-like 6A (4,5) ACTL6B Actin-like 6B (4) ACVR1B Activin A receptor, type IB (21,22) ACVR2A Activin A receptor, type IIA (4,21) ADAM10 ADAM metallopeptidase domain 10 (5) ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif, 9 (4) ADCY2 Adenylate cyclase 2 (brain) (26) AJUBA Ajuba LIM protein (21) AKAP9 A kinase (PRKA) anchor protein (yotiao) 9 (4) Akt AKT serine/threonine kinase (28) AKT1 v-akt murine thymoma viral oncogene homolog 1 (5,21,22) AKT2 v-akt murine thymoma viral oncogene homolog 2 (4) ALB Albumin (4) ALK Anaplastic lymphoma receptor tyrosine kinase (22) AMPH Amphiphysin (24) ANK3 Ankyrin 3, node of Ranvier (ankyrin G) (4) ANKRD12 Ankyrin repeat domain 12 (4) ANO1 Anoctamin 1, calcium activated chloride channel (4) APC Adenomatous polyposis coli (4,5,21,22,25,28) APOB Apolipoprotein B [including Ag(x) antigen] (4) AR Androgen receptor (5,21-23) ARAP1 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 (4) ARHGAP35 Rho GTPase activating protein 35 (21) ARID1A AT rich interactive domain 1A (SWI-like) (4,5,21,22,24,25,27,28) ARID1B AT rich interactive domain 1B (SWI1-like) (4,5,22) ARID2 AT rich interactive domain 2 (ARID, RFX-like) (4,5,22,24,25,27,28) ARID4A AT rich interactive domain 4A (RBP1-like) (28) ARID5B AT rich interactive domain 5B (MRF1-like) (21) ASPM Asp (abnormal -
Supplementary File 2A Revised
Supplementary file 2A. Differentially expressed genes in aldosteronomas compared to all other samples, ranked according to statistical significance. Missing values were not allowed in aldosteronomas, but to a maximum of five in the other samples. Acc UGCluster Name Symbol log Fold Change P - Value Adj. P-Value B R99527 Hs.8162 Hypothetical protein MGC39372 MGC39372 2,17 6,3E-09 5,1E-05 10,2 AA398335 Hs.10414 Kelch domain containing 8A KLHDC8A 2,26 1,2E-08 5,1E-05 9,56 AA441933 Hs.519075 Leiomodin 1 (smooth muscle) LMOD1 2,33 1,3E-08 5,1E-05 9,54 AA630120 Hs.78781 Vascular endothelial growth factor B VEGFB 1,24 1,1E-07 2,9E-04 7,59 R07846 Data not found 3,71 1,2E-07 2,9E-04 7,49 W92795 Hs.434386 Hypothetical protein LOC201229 LOC201229 1,55 2,0E-07 4,0E-04 7,03 AA454564 Hs.323396 Family with sequence similarity 54, member B FAM54B 1,25 3,0E-07 5,2E-04 6,65 AA775249 Hs.513633 G protein-coupled receptor 56 GPR56 -1,63 4,3E-07 6,4E-04 6,33 AA012822 Hs.713814 Oxysterol bining protein OSBP 1,35 5,3E-07 7,1E-04 6,14 R45592 Hs.655271 Regulating synaptic membrane exocytosis 2 RIMS2 2,51 5,9E-07 7,1E-04 6,04 AA282936 Hs.240 M-phase phosphoprotein 1 MPHOSPH -1,40 8,1E-07 8,9E-04 5,74 N34945 Hs.234898 Acetyl-Coenzyme A carboxylase beta ACACB 0,87 9,7E-07 9,8E-04 5,58 R07322 Hs.464137 Acyl-Coenzyme A oxidase 1, palmitoyl ACOX1 0,82 1,3E-06 1,2E-03 5,35 R77144 Hs.488835 Transmembrane protein 120A TMEM120A 1,55 1,7E-06 1,4E-03 5,07 H68542 Hs.420009 Transcribed locus 1,07 1,7E-06 1,4E-03 5,06 AA410184 Hs.696454 PBX/knotted 1 homeobox 2 PKNOX2 1,78 2,0E-06 -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Downloaded As a Text File, Is Completely Dynamic
BMC Bioinformatics BioMed Central Database Open Access ORENZA: a web resource for studying ORphan ENZyme activities Olivier Lespinet and Bernard Labedan* Address: Institut de Génétique et Microbiologie, CNRS UMR 8621, Université Paris-Sud, Bâtiment 400, 91405 Orsay Cedex, France Email: Olivier Lespinet - [email protected]; Bernard Labedan* - [email protected] * Corresponding author Published: 06 October 2006 Received: 25 July 2006 Accepted: 06 October 2006 BMC Bioinformatics 2006, 7:436 doi:10.1186/1471-2105-7-436 This article is available from: http://www.biomedcentral.com/1471-2105/7/436 © 2006 Lespinet and Labedan; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Despite the current availability of several hundreds of thousands of amino acid sequences, more than 36% of the enzyme activities (EC numbers) defined by the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (NC-IUBMB) are not associated with any amino acid sequence in major public databases. This wide gap separating knowledge of biochemical function and sequence information is found for nearly all classes of enzymes. Thus, there is an urgent need to explore these sequence-less EC numbers, in order to progressively close this gap. Description: We designed ORENZA, a PostgreSQL database of ORphan ENZyme Activities, to collate information about the EC numbers defined by the NC-IUBMB with specific emphasis on orphan enzyme activities. -
A Selective Inhibitor of Ceramide Synthase 1 Reveals a Novel Role in Fat Metabolism
ARTICLE DOI: 10.1038/s41467-018-05613-7 OPEN A selective inhibitor of ceramide synthase 1 reveals a novel role in fat metabolism Nigel Turner1, Xin Ying Lim2,3, Hamish D. Toop 4, Brenna Osborne 1, Amanda E. Brandon5, Elysha N. Taylor4, Corrine E. Fiveash1, Hemna Govindaraju1, Jonathan D. Teo3, Holly P. McEwen3, Timothy A. Couttas3, Stephen M. Butler4, Abhirup Das1, Greg M. Kowalski 6, Clinton R. Bruce6, Kyle L. Hoehn 7, Thomas Fath1,10, Carsten Schmitz-Peiffer8, Gregory J. Cooney5, Magdalene K. Montgomery1, Jonathan C. Morris 4 & Anthony S. Don3,9 1234567890():,; Specific forms of the lipid ceramide, synthesized by the ceramide synthase enzyme family, are believed to regulate metabolic physiology. Genetic mouse models have established C16 ceramide as a driver of insulin resistance in liver and adipose tissue. C18 ceramide, syn- thesized by ceramide synthase 1 (CerS1), is abundant in skeletal muscle and suggested to promote insulin resistance in humans. We herein describe the first isoform-specific ceramide synthase inhibitor, P053, which inhibits CerS1 with nanomolar potency. Lipidomic profiling shows that P053 is highly selective for CerS1. Daily P053 administration to mice fed a high- fat diet (HFD) increases fatty acid oxidation in skeletal muscle and impedes increases in muscle triglycerides and adiposity, but does not protect against HFD-induced insulin resis- tance. Our inhibitor therefore allowed us to define a role for CerS1 as an endogenous inhibitor of mitochondrial fatty acid oxidation in muscle and regulator of whole-body adiposity. 1 School of Medical Sciences, UNSW Sydney, Sydney 2052 NSW, Australia. 2 Prince of Wales Clinical School, Faculty of Medicine, UNSW Sydney, Sydney 2052 NSW, Australia. -
Lipid Signalling Dynamics of Palmitate- Induced Endoplasmic Reticulum Stress in Skeletal Muscle
Lipid signalling dynamics of palmitate- induced endoplasmic reticulum stress in skeletal muscle A dissertation submitted for the degree of Doctor of Philosophy at the University of Cambridge. Submitted September 2018. Ben Daniel McNally King’s College “Obviously my method of thought and reasoning is influenced by a scientific training – if that were not so my scientific training will have been a waste and a failure.” Rosalind Franklin – taken from a letter to her father, Ellis Franklin, undated (approximately 1940). “I was taught that the way of progress is neither swift nor easy.” Marie Curie - Taken from Pierre Curie (1936). “Machines will do the heavy work, Men will supervise the machines, You owe much to these machines, Horsepower, not manpower, Brains, not brawn.” Progress by Public Service Broadcasting, released in 2017. Declaration This dissertation is the result of my own work and includes nothing which is the outcome of work done in collaboration except as declared in the Preface and specified in the text. It is not substantially the same as any that I have submitted, or, is being concurrently submitted for a degree or diploma or other qualification at the University of Cambridge or any other University or similar institution except as declared in the Preface and specified in the text. I further state that no substantial part of my dissertation has already been submitted, or, is being concurrently submitted for any such degree, diploma or other qualification at the University of Cambridge or any other University or similar institution except as declared in the Preface and specified in the text. -
Supplementary Table 1A. Genes Significantly Altered in A4573 ESFT
Supplementary Table 1A. Genes significantly altered in A4573 ESFT cells following BMI-1knockdown genesymbol genedescription siControl siBMI1 FC Direction P-value AASS aminoadipate-semialdehyde synthase | tetra-peptide repeat homeobox-like6.68 7.24 1.5 Up 0.007 ABCA2 ATP-binding cassette, sub-family A (ABC1), member 2 | neural5.44 proliferation,6.3 differentiation1.8 and Upcontrol, 1 0.006 ABHD4 abhydrolase domain containing 4 7.51 6.69 1.8 Down 0.002 ACACA acetyl-Coenzyme A carboxylase alpha | peroxiredoxin 5 | similar6.2 to High mobility7.26 group2.1 protein UpB1 (High mobility0.009 group protein 1) (HMG-1) (Amphoterin) (Heparin-binding protein p30) | Coenzyme A synthase ACAD9 acyl-Coenzyme A dehydrogenase family, member 9 9.25 8.59 1.6 Down 0.008 ACBD3 acyl-Coenzyme A binding domain containing 3 7.89 8.53 1.6 Up 0.008 ACCN2 amiloride-sensitive cation channel 2, neuronal 5.47 6.28 1.8 Up 0.005 ACIN1 apoptotic chromatin condensation inducer 1 7.15 7.79 1.6 Up 0.008 ACPL2 acid phosphatase-like 2 6.04 7.6 2.9 Up 0.000 ACSL4 acyl-CoA synthetase long-chain family member 4 6.72 5.8 1.9 Down 0.001 ACTA2 actin, alpha 2, smooth muscle, aorta 9.18 8.44 1.7 Down 0.003 ACYP1 acylphosphatase 1, erythrocyte (common) type 7.09 7.66 1.5 Up 0.009 ADA adenosine deaminase 6.34 7.1 1.7 Up 0.009 ADAL adenosine deaminase-like 7.88 6.89 2.0 Down 0.006 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 6.57 7.65 2.1 Up 0.000 ADARB1 adenosine deaminase, RNA-specific, B1 (RED1 homolog rat) 6.49 7.13 1.6 Up 0.008 ADCY9 adenylate cyclase 9 6.5 7.18 -
Sphingolipids
Ectopic expression of ceramide synthase 2 in neurons suppresses neurodegeneration induced by ceramide synthase 1 deficiency Stefka D. Spassievaa,1, Xiaojie Jib,c,1, Ye Liub, Kenneth Gabled, Jacek Bielawskie, Teresa M. Dunnd, Erhard Bieberichf, and Lihong Zhaob,2 aDepartment of Molecular and Cellular Medicine, Texas A&M Health Science Center, College Station, TX 77843; bThe Jackson Laboratory, Bar Harbor, ME 04609; cGraduate School of Biomedical Science and Engineering, University of Maine, Orono, ME 04469; dDepartment of Biochemistry and Molecular Biology, Uniformed Services University of the Health Sciences, Bethesda, MD 20814; eDepartment of Biochemistry and Molecular Biology, Medical University of South Carolina, Charleston, SC 29425; and fDepartment of Neuroscience and Regenerative Medicine, Medical College of Georgia/Augusta University, Augusta, GA 30912 Edited by David W. Russell, University of Texas Southwestern Medical Center, Dallas, TX, and approved April 13, 2016 (received for review December 7, 2015) Sphingolipids exhibit extreme functional and chemical diversity suggested to cause apoptosis in certain cancer cells, whereas that is in part determined by their hydrophobic moiety, ceramide. ceramide with a C16 fatty acyl chain (C16 ceramide) has been In mammals, the fatty acyl chain length variation of ceramides is considered prosurvival (10–12). The ceramide profile changes in determined by six (dihydro)ceramide synthase (CerS) isoforms. aging and neurodegenerative brains, but whether these alterations Previously, we and others -
Manual D'estil Per a Les Ciències De Laboratori Clínic
MANUAL D’ESTIL PER A LES CIÈNCIES DE LABORATORI CLÍNIC Segona edició Preparada per: XAVIER FUENTES I ARDERIU JAUME MIRÓ I BALAGUÉ JOAN NICOLAU I COSTA Barcelona, 14 d’octubre de 2011 1 Índex Pròleg Introducció 1 Criteris generals de redacció 1.1 Llenguatge no discriminatori per raó de sexe 1.2 Llenguatge no discriminatori per raó de titulació o d’àmbit professional 1.3 Llenguatge no discriminatori per raó d'ètnia 2 Criteris gramaticals 2.1 Criteris sintàctics 2.1.1 Les conjuncions 2.2 Criteris morfològics 2.2.1 Els articles 2.2.2 Els pronoms 2.2.3 Els noms comuns 2.2.4 Els noms propis 2.2.4.1 Els antropònims 2.2.4.2 Els noms de les espècies biològiques 2.2.4.3 Els topònims 2.2.4.4 Les marques registrades i els noms comercials 2.2.5 Els adjectius 2.2.6 El nombre 2.2.7 El gènere 2.2.8 Els verbs 2.2.8.1 Les formes perifràstiques 2.2.8.2 L’ús dels infinitius ser i ésser 2.2.8.3 Els verbs fer, realitzar i efectuar 2.2.8.4 Les formes i l’ús del gerundi 2.2.8.5 L'ús del verb haver 2.2.8.6 Els verbs haver i caldre 2.2.8.7 La forma es i se davant dels verbs 2.2.9 Els adverbis 2.2.10 Les locucions 2.2.11 Les preposicions 2.2.12 Els prefixos 2.2.13 Els sufixos 2.2.14 Els signes de puntuació i altres signes ortogràfics auxiliars 2.2.14.1 La coma 2.2.14.2 El punt i coma 2.2.14.3 El punt 2.2.14.4 Els dos punts 2.2.14.5 Els punts suspensius 2.2.14.6 El guionet 2.2.14.7 El guió 2.2.14.8 El punt i guió 2.2.14.9 L’apòstrof 2.2.14.10 L’interrogant 2 2.2.14.11 L’exclamació 2.2.14.12 Les cometes 2.2.14.13 Els parèntesis 2.2.14.14 Els claudàtors 2.2.14.15