Viewed with a Fluoroview

LOCALIZATION OF HEMOGLOBIN IN MS CORTEX AND ITS RELEVANCE TO MS NEUROPATHOLOGY

A thesis submitted to the Kent State University Honors College in partial fulfillment of the requirements for University Honors

Nolan Brown

May, 2014

Thesis written by

Nolan Brown

Approved by

______, Advisor

______, Chair, Department of Biology

Accepted by

______, Dean, Honors College

TABLE OF CONTENTS

LIST OF FIGURES………………………………………………………………………iv

LIST OF TABLES………………………………………………………………………...v

ACKNOWLEDGEMENT………………………………………………………………..vi

CHAPTER

I. INTRODUCTION………………………………………………………………...1

II. METHODOLOGY………………………………………………………10

Immunofluorescence……………………………………………………..10

PLP DAB Staining……………………………………………………….11

In situ hybridization probe generation…………………………………...11

In situ hybridization……………………………………………………...12

Hypoxia…………………………………………………………………..14

Bioinformatic Microarray Analysis……………………………………...14

III. RESULTS………………………………………………………………...16

Immunofluorescence……………………………………………………..16

PLP DAB Staining……………………………………………………….21

In situ hybridization……………………………………………………...22

Hypoxia…………………………………………………………………..26

Bioinformatics Microarray Analysis……………………………………..27

iii

IV. DISCUSSION AND CONCLUSIONS………………………………….30

REFERENCES…………………………………………………………………………..40

APPENDIX………………………………………………………………………………45

1. IN SITU HYBRIDIZATION OLIGONUCLEOTIDE SEQUENCES…..45

2. IN SITU HYBRIDIZATION SOLUTIONS……………………………..45

LIST OF FIGURES

Figure 1. Demyelination of neurons…………………………………………………4

Figure 2. Representative confocal images showing colocalization of Hbb and neurofilament (SMI32)…………………………………………………..18

Figure 3. Projections from TH positive neurons appear to contact Hbb positive cells………………………………………………………………………19

Figure 4. Representative confocal images showing staining for activated microglia (red) and Hbb (green) in an MS brain……………………………………20

Figure 5. PLP DAB staining of brain section adjacent to a section containing activated microglia……………………………………………………….21

Figure 6. Probe template before promoter ligation………………………………...23

Figure 7. Probe template after promoter ligation…………………………………..24

Figure 8. RNA probe precipitation assay…………………………………………..25

Figure 9. In situ hybridization of Hbb on human cortical section………………….26

Figure 10. Scanned images of X-ray film developed from Western blot analysis of cultured neurons exposed to hypoxic conditions………………………...27

LIST OF TABLES

Table 1. Brain Donor Demographics…………………………………………………….17

Table 2. Allen Brain Atlas Genes………………………………………………………...28

ACKNOWLEDGEMENTS

I would like to thank Dr. McDonough for her guidance, assistance, and instruction throughout the entire thesis. I would also like to thank Dr. Clements for his help capturing the confocal imagery. Additionally, I would like to thank my colleagues for sharing their knowledge and expertise with me. Finally, I would like to thank Dr. Basu, Dr. Kline, and

Dr. Sampson for graciously volunteering to participate on my thesis board.

vii 1

Chapter 1: Introduction

Multiple sclerosis (MS) is a neurodegenerative disease characterized by the demyelination and deterioration of neurons within the central nervous system (CNS)

(Noseworthy et al., 2000). In MS, inflammatory demyelination and axonal and neuronal degeneration accumulate over time and result in progressive neurological disability

(Bjartmar et al., 2000; DeStefano et al., 2001). MS affects over 2.5 million individuals world-wide and is the leading cause of non-traumatic neurological disability in young adults. Symptoms of MS generally begin in early adulthood and include limb weakness, sensory abnormalities, optic neuritis, and cognitive impairment. Generally, the severity of

MS symptoms increases with age. The brains of MS patients demonstrate the formation of hardened, inflammatory plaques where evidence of demyelinated axons and neuronal destruction can be found. Three major forms of MS progression have been identified: relapsing-remitting, secondary progressive, and primary progressive. The majority of cases are diagnosed as relapsing-remitting, characterized by alternating periods of neurological abnormalities and partial recovery. In early relapsing-remitting MS

(RRMS), inflammatory demyelination results in less efficient conduction of nerve impulses and neurological impairment. These impairments generally resolve over a period of weeks due to redistribution of sodium channels and remyelination (England et al., 1990). RRMS typically evolves into secondary progressive MS (SPMS), where symptomology is more consistent, progresses in severity, and periods of remission are

scarce or absent completely (Confavreux et al., 2000). In SPMS, inflammatory episodes are diminished; however, even in the absence of inflammatory demyelination, neurodegeneration continues (Confavreux et al., 2000), suggesting that an underlying neurodegenerative process may be a primary factor of this disease. Primary progressive

MS (PPMS) is akin to SPMS, but cases of PPMS never exhibit a relapsing-remitting phase and progress directly into the SPMS archetype. It is believed that both genetic and environmental factors contribute to the development of MS. Genes most strongly associated with MS susceptibility are those of the major histocompatibility complex class

II. The environmental factors shown to be related to MS susceptibility include: smoking, vitamin D levels, and viral infection (Witte et al, 2013).

MS is understood to be autoimmune in nature. Various innate and adaptive immune cell types have been associated with the progression of MS lesions, including

CD4+ and CD8+ T-cells and macrophages. Previous studies have shown that macrophages in MS brains are immunoreactive for myelin proteins and could be responsible for the destruction of the myelin sheath of MS neurons. The destruction of the myelin sheath greatly inhibits the ability of neurons to transmit information by interrupting axonal propagation of action potentials. More specifically, the disruption of the action potential propagation is due to the loss of the nodes of Ranvier and the disbursement of the voltage gated sodium channels, both consequences of the demyelination of the axon. The disruption of action potential propagation makes information transmission slow and inefficient, leading to neurological disability and greatly increased energy demand in neurons. The higher energy demand in neurons leads to greatly increased cellular stress

and may contribute to the destruction of neurons. Additionally, investigations of demyelination in MS have revealed that demyelinated neurons are able to partially re- myelinate and regain some ability to propagate action potentials (Kornek and Lassmann,

2003). The destruction of the myelin sheath, disbursement of sodium channels, and partial re-myelination are illustrated in Figure 1 with neuron B, neuron C, and neuron D, respectively. Neuron A in Figure 1 represents a healthy neuron. In addition to demyelination of axons via direct attack from macrophages, studies have shown that phagocytic cells release reactive oxygen species (ROS) when participating in an immune response. While the function of ROS release in immune response is believed to be antimicrobial, the oxidative stress placed on the neurons could be damaging (Fang, 1997).

Figure 1: Demyelination of neurons. Light blue represents myelin, yellow circles represent voltage gated sodium channels, and red circles represent macrophages. Neuron A represents a healthy neuron. Neuron B shows part of the myelin sheath being destroyed by macrophages. Neuron C illustrates the disbursement of voltage gated sodium channels along the axon. Neuron D shows partial re-myelination of a neuron after being demyelinated by macrophages. [Figure provided by Dr. Jennifer McDonough.]

MS has been traditionally considered a white matter disease and much of the research has been focused on understanding autoimmune demyelination. This is reflected in the fact that current therapies for MS consist primarily of immunomodulatory drugs, targeted at inhibiting the immune response. It has now been established that cortical pathology, including extensive gray matter lesions and cortical atrophy, contribute to disease and disability (Bo et al., 2006; Fisher et al., 2008). The mechanisms involved in cortical pathology aren’t clear, but hypotheses concerning the mechanism of MS neurodegeneration involve dysfunction of the mitochondria and the formation of ROS within neuronal cells. In studies analyzing postmortem tissue, altered expression of genes and proteins involved in mitochondrial respiration in normal appearing gray matter

(NAGM) in MS has been reported (Dutta et al., 2006; Pandit et al., 2009; Broadwater et al., 2011; Witte et al., 2013).

Mitochondria are organelles present within all eukaryotic cells and are responsible for various cellular functions, most notably the synthesis of ATP from ADP and inorganic phosphate by oxidative phosphorylation (Wallace, 1992). The production of ATP via oxidative phosphorylation continually produces ROS within the mitochondria. These

ROS can serve as important signaling molecules, but may become harmful if the amount of ROS exceeds the cell’s antioxidant capacity (Lin and Beal, 2006). The cells of the

CNS are particularly energy demanding and must generate a higher than average amount of ATP. This requirement for more ATP places the cells of the CNS at a higher risk of exposure to excess amounts of ROS (DiMauro et al., 2013). Many CNS disorders have been associated with mitochondrial dysfunction, such as MS, Alzheimer’s disease, and

Leber’s hereditary optic neuropathy (Beal, 1995; Wallace et al., 1988). Mitochondrial damage has also been found in the experimental autoimmune encephalomyelitis (EAE) mouse model of MS. Studies have shown that detoxification of ROS in the EAE model lead to the reversal of mitochondrial pathology and rescued neurons from degeneration.

Additionally, literature has demonstrated that energy demand in neurons greatly increases due to demyelination, which leads to a greatly increased amount of ROS production in demyelinated neurons (Witte et al, 2013).

Recent investigations of MS pathology have been focusing on the presence of hemoglobin within neuronal cells. Proteomic analysis of mitochondrial fractions isolated from postmortem cortex of MS and control donors reported increased hemoglobin in MS cortex (Broadwater et al., 2011). Hemoglobin is a tetrameric protein consisting of two alpha subunits (Hba) and two beta subunits (Hbb). Each subunit of hemoglobin contains a heme group, which is capable of reversibly binding oxygen, nitric oxide, and carbon dioxide. Until recently, hemoglobin was believed to be strictly unique to red blood cells.

However, studies have now shown hemoglobin to be present within various cells other than erythrocytes, such as the lens of the eye, macrophages, epithelial cells, and neurons

(Rahaman and Straub, 2013). The roles and effects of hemoglobin in neuronal cells are largely unknown, though some literature shows that hemoglobin may act to mitigate the effects of ROS. If hemoglobin were to act as a scavenger of ROS, then hemoglobin could play an important role in offsetting the high levels of ROS produced in neurons due to large energy demands, as well as serve to attenuate the damage caused by ROS generated by mitochondrial dysfunction and immune response (Richter et al, 2009). Additionally,

hemoglobin is hypothesized to play a role in ischemic conditions, where hemoglobin can bind oxygen when oxygen is abundant, and release oxygen in hypoxic conditions

(Schelshorn et al., 2009). In essence, the hemoglobin would serve as an oxygen reservoir to maintain neuronal activity when oxygen in scarce (Biagioli et al, 2009). Levels of hemoglobin within the neurons of MS brains have been shown to be significantly higher than those levels seen in non-MS brains (Broadwater et al, 2011). The role of hemoglobin in MS pathology is very poorly understood. Current hypotheses suggest that increased hemoglobin expression in MS could be acting to scavenge the larger amount of ROS originating from mitochondrial dysfunction or inflammation (Witte et al, 2013).

An additional hypothesis under investigation is that hemoglobin may modulate neuronal nitric oxide synthase (nNOS). This is due to the fact that hemoglobin has been found to modulate nitric oxide (NO) release in smooth muscle cells (Straub et al., 2012). NO signals smooth muscle cells surrounding arteries to relax and allow for vasodilation.

Endothelial nitric oxide synthase (eNOS) generates NO in arterial endothelial cells and aids in modulating vasodilation and vasoconstriction (Straub et al., 2012). Straub et al.

(2012) showed that Hba is present within cultured endothelial cells via immunoblot, immunofluorescence, and in situ hybridization. The effect of Hba on vasodilation and vasoconstriction was explored by siRNA knockdown. Samples with decreased Hba showed little vasoconstriction in response to phenylephrine and increased vasodilation in response to acetylcholine. Spatial proximity of eNOS and Hba was confirmed by immunofluorescence, a proximity ligation assay, and co-immunoprecipitation. Straub et al. (2012) concluded that Hba modulates vasoconstriction and vasodilation through

scavenging NO produced by eNOS. Unpublished data from our laboratory has shown that nNOS and Hba are colocalized within cultured rat primary neurons. As evidenced by

Straub et al., Hba has the ability to modulate NO signaling. We hypothesize that Hba located within neurons may be performing a role very similar to that of Hba found by

Straub et al. (2012) in endothelial cells.

While the presence of hemoglobin mRNA and protein in neuronal cells has been confirmed, literature does not contain a survey of the location of increased hemoglobin expression relative to specific neuron types in MS, and thus it is unknown if specific neuron types have uniquely increased hemoglobin expression in MS compared to non-

MS neurons. Understanding whether hemoglobin is preferentially expressed in MS neurons or if all neurons within MS brains have increased expression of hemoglobin will provide additional insight into the pathology of MS. Additionally, understanding which neuron types increase hemoglobin expression in MS will aid in the design of future experiments, such as a potential mouse MS model with conditional and inducible knockout of hemoglobin in relevant neurons. GABAergic interneurons are of particular interest due to previous studies showing changes in expression of genes expressed in these neuron types in MS brains (Dutta et al., 2006). Interneurons have been shown to have large decreases in parvalbumin expression in human MS brains (Clements et al.,

2008), and dopaminergic neurons have been shown to have increased expression of hemoglobin in rodent MS models (Richter et al, 2009). In order to ascertain whether hemoglobin is preferentially expressed in specific neuron types in MS brain, I attempted to co-localize hemoglobin mRNA and protein with specific neuronal markers in

postmortem MS brain samples. Hemoglobin mRNA localization was attempted via in situ hybridization targeting Hbb. Both fluorescent labelling and anti-DIG alkaline phosphatase induced precipitation were used as visualization techniques for the in situ hybridization. Localization of the proteins of neuronal markers and Hba and Hbb was performed using immunofluorescence imaged with confocal microscopy. As an additional investigation into the expression of hemoglobin, I analyzed the presence of Hba and Hbb in cultured neurons exposed to hypoxic conditions using Western blot, and used Allen

Brain Atlas (Hawrylycz et al., 2012) and UniProtKB (Apweiler et al., 2014) to determine the functions of the genes most similarly expressed to Hbb.

Chapter 2: Methodology

Immunofluorescence

Post-mortem MS and control brain samples were fixed in 4% paraformaldehyde for 24 hours and cut 30 micrometers thick using a vibratome. Blocking buffer was prepared as 1X phosphate buffered saline (PBS) with 0.5% Triton X-100 and 3% normal donkey serum. Samples were blocked in blocking buffer for one hour at four degrees

Celsius. Primary antibodies were diluted in blocking buffer and applied to samples overnight at four degrees Celsius. Primary antibodies were applied in the following concentrations: hemoglobin subunit alpha [Thermo Scientific, PA1-29342] 1:500, hemoglobin subunit beta [Aviva Systems Biology, OAAB07804] 1:250, parvalbumin

[Sigma Aldrich, P3088] 1:500, SMI32 [Calbiochem, NE1023] 1:500, tyrosine hydroxylase [Santa Cruz, sc-25269] 1:250, and CD68 [Santa Cruz, sc-7084] 1:500. The

Hba and Hbb primary antibodies used have been shown to exhibit cross reactivity between the Hba and Hbb subunits; therefore, results and discussion presented herein will specifically reference the Hb subunits, but may not apply exclusively to the mentioned subunit. Secondary antibodies were also applied in blocking buffer at four degrees

Celsius for two hours. All secondary antibodies were applied at a concentration of 1:500.

Secondary antibodies used are as follows: donkey anti-rabbit Alexafluor 488 [Invitrogen,

A21206], donkey anti-goat Alexafluor 488 [Invitrogen, A11055], donkey anti-mouse

Alexafluor 555 [A31570], and donkey anti-goat Alexafluor 555 [A21432]. After

incubation of secondary antibodies, samples were soaked in 10 mM cupric sulfate, 10 mM ammonium acetate buffer for 90 minutes to quench autofluorescence. Samples were mounted on microscope slides using Vectashield mounting medium for fluorescence with

DAPI [Vector Laboratories, H-1200]. Mounted samples were viewed with a Fluoroview

1000 confocal microscope and imaged using the bundled software.

PLP DAB Staining

Brain sections fixed in 4% PFA and 30 micrometers thick were blocked in 5% horse serum for 30 minutes at four degrees Celsius, then incubated in primary antibody diluted in 5% horse serum for 30 minutes at four degrees Celsius. Primary antibodies used were anti-Hbb and anti-SMI32 as used in immunofluorescence, and anti-PLP

[Chemicon, MAB388] used at 1:1000. After primary incubation, biotinylated secondary antibodies were applied in 5% horse serum for 30 minutes at 4 degrees Celsius.

Secondary antibodies used were horse anti-mouse [Vector Laboratories, BA-2000] and goat anti-rabbit [Vector Laboratories, BA-1000], and both secondary antibodies were applied at a concentration of 1:500. Following secondary incubation, sections were treated with reagents from the Vectastain Elite ABC kit [Vector Laboratories, PK-6200], followed by treatment with DAB peroxidase substrate [Vector Laboratories, SK-4100].

In situ hybridization probe generation

Probe DNA template was generated via PCR from a sequence verified Hbb gene residing within a vector. PCR primers were ordered from Integrated DNA Technologies

and the primer sequences are provided in the Appendix. The PCR mixture was prepared using ZymoTaq Premix [Zymo Research, E2003-1]. The template size was verified using gel electrophoresis. After PCR amplification of the DNA probe template, a SP6 RNA polymerase promoter was ligated to the PCR product using the Lig’nScribe kit [Ambion,

1730]. The SP6 promoter oligonucleotide was provided with the kit, and the adapter primer sequence is provided in the Appendix. The template was again verified with gel electrophoresis after ligation of the RNA polymerase promoter. The produced RNA probe was labeled in two ways: with DIG molecules using the DIG RNA Labeling Kit [Roche,

11175025910] and fluorescently using the 5’ EndTag System [Vector Laboratories, MB-

9001]. The DIG labeling of the RNA was verified by blotting a nitrocellulose membrane with synthesized RNA probe along with the positive control RNA included with the DIG

RNA Labeling Kit. Blotting was performed at 100 nanograms per microliter, 10 nanograms per microliter, and 1 nanogram per microliter. An alkaline phosphatase linked anti-DIG antibody [Roche, 11093274910] was applied to the membrane in 5% Similac non-fat dry milk in 1x PBS. The blotted nitrocellulose was then soaked in BM Purple

[Roche, 11442074001] until precipitant formed, indicating the location of the probe and target complex.

In situ hybridization

Components of solutions used are presented in the Appendix. All washes were performed in RNAse free 1x PBS unless otherwise stated. Frozen human postmortem MS and control brains were sliced via cryostat to 30 micrometers thickness and dried at 50

degrees Celsius for 15 minutes. Sections were then fixed in 4% ice cold PFA for 10 minutes. After fixation, sections were treated with Proteinase K Buffer for 10 minutes.

Following treatment with Proteinase K Buffer, sections were acetylated using 0.1M triethanolamine with 0.25% acetic anhydride for 15 minutes. Next, sections were incubated with Prehybridization Buffer in a humid chamber at 50 degrees Celsius for two hours. After prehybridization, sections were incubated in hybridization buffer with RNA probe (two nanograms per microliter) in a humid chamber for 16 hours at 52 degrees

Celsius. Sections were then washed in saline sodium citrate (SSC) at serial dilutions from

2x to 0.1x. After SSC washes, sections were incubated with RNAse A in 2x SSC at a concentration of 20 micrograms per milliliter for 30 minutes at 37 degrees Celsius, then washed in SSC. At this point, fluorescently labeled probe reactions were mounted and visualized with confocal microscopy on a FV1000 microscope. DIG labeled probes were treated with tween tris buffered saline (TTBS) for 15 minutes. Following TTBS treatment, sections were blocked in 2% normal donkey serum in TTBS for one hour.

After blocking, sections were incubated with an alkaline phosphatase linked anti-DIG antibody in 2% normal donkey serum in TTBS for two nights at a 1:5000 dilution.

Sections were then washed in TTBS and incubated in BM Purple in the dark until sufficient precipitation had occurred (between 12 and 24 hours). Sections were washed with TTBS and mounted. BM Purple staining was visualized with standard light microscopy.

Hypoxia

Neuronal cells were cultured in EMEM (Eagle’s Minimum Essential Medium) and placed in a sealed hypoxic incubator for three days. Cells were incubated at oxygen concentrations of 15%, 2%, and atmospheric concentration. The neuronal cells were lysed with lysis buffer and total protein was collected. Protein concentrations were measured with an optical density plate reader using a bovine serum albumin serial dilution as a standard. The collected protein was then analyzed by Western blot for the presence of Hba and Hbb using the same primary antibodies as the immunofluorescence assay at a concentration of 1:1000, along with an antibody reactive to GAPDH

[Millipore, MAB374] at a concentration of 1:1000. Primary antibodies were incubated overnight at four degrees Celsius. Secondary antibodies were linked with horse radish peroxidase and applied at a concentration of 1:10000 for two hours at room temperature.

Secondary antibodies used were donkey anti-goat [Santa Cruz, sc-2020], goat anti-rabbit

[Santa Cruz, sc-2004], and goat anti-mouse [Santa Cruz, sc-2005]. Visualization of antibodies was performed using Western Blotting Luminol Reagent (Santa Cruz

Biotechnology, sc-2048) and imaged on X-ray film.

Bioinformatic Microarray Analysis

Allen Brain Atlas (Hawrylycz et al., 2012) (human.brain-map.org) contains data from expression microarray analyses of different brain regions from six human brains.

Allen Brain Atlas (Hawrylycz et al., 2012) was queried for hemoglobin beta and results

were sorted by expression similarity. The functions of the 26 most similarly expressed genes were determined via UniProtKB (Apweiler et al., 2014).

Chapter 3: Results

Immunofluorescence

I focused on colocalization of Hbb with neuronal markers because Hbb was the subunit found to be increased in MS cortex (Broadwater et al., 2011). In order to localize

Hbb and neuronal markers, postmortem MS and control brains were incubated with primary antibodies reactive for Hba, Hbb, neurofilament (SMI32), parvalbumin, tyrosine hydroxylase, and CDC68. SMI32 was used to label all neurons, anti-parvalbumin was used to label a subset of interneurons, anti-tyrosine hydroxylase was used to label catecholaminergic neurons, and CDC68 was used to label activated microglia. Primary antibodies were then visualized using fluorescent secondary antibodies and confocal microscopy. Hbb was found to be colocated with SMI32 in both control and MS brains samples. Information on donor tissue used in the study is shown in Table 1. Frozen postmortem cortical tissue was obtained from the Rocky Mountain MS Center and the

Human Brain and Spinal Fluid Resource Center at UCLA under IRB protocol.

Brain Donor Demographics

Donor Age (Years) Sex PMI (hours) Diagnosis Lesion Cortical Status Region MS1 74 Male 4 MS GML Parietal

MS2 53 Female 10 MS NAGM Motor

MS3 63 Female 23 MS NAGM Frontal

MS4 62 Female 6.5 MS NAGM Motor

MS5 55 Female 19 MS NAGM Parietal

Control1 72 Female 30 N/A NAGM Parietal

Control2 90 Female 12 N/A NAGM Motor

Control3 76 Female 9 N/A NAGM Parietal

Table 1: MS and control tissue donor demographics. PMI – Post-Mortem Interval; MS – Multiple Sclerosis; N/A – Not Applicable; NAGM – Normal Appearing Grey Matter; GML- Grey Matter Lesion

A The laminar distribution of SMI32 positive

neurons and colocalization of Hbb with SMI32 is shown in Figure 2. SMI32 is shown in red and Hbb is shown in I green. The red SMI32 signal traces the outline of the soma and axon of a neuron. The green signal of Hbb

II resided predominantly within the soma of labeled

neurons, with little to no signal visible in the axon.

III B

Figure 2: Representative confocal images WM showing colocalization of Hbb and neurofilament (SMI32). A. Image through parietal cortex of an MS brain showing the six layers of the cortex (I –VI) and white matter (WM). Image was taken at 20x. B. Representative confocal image showing colocalization of Hbb and SMI32 in a pyramidal neuron (shown by white arrow head). White arrow denotes Hbb staining of a blood vessel. Counting well defined pyramidal neurons across four MS brains, we identified 16 of 44 pyramidal neurons which coexpressed Hbb.

Neurons labeled with tyrosine hydroxylase (TH) exhibited long, fine neurites interrupted with occasional ovoids. TH labeling did not appear to be colocalized with hemoglobin staining; however, in some cases, the neurites of TH labeled neurons appeared to form synapses to other cells which were positively stained for hemoglobin.

An example of a potential synapse formed between a TH labeled neuron and a Hbb labeled cell is shown in Figure 3, with red labeling representing TH and green labeling representing Hbb.

Figure 3:Projections from TH positive neurons appear to B contact Hbb positive cells. A. Representative confocal image showing TH immunopositive neurons and projections in red, and Hbb staining in green. B. White outline in A shown in greater detail. Arrows denote points of contact.

Activated microglia labeled with CD68 were observed in one MS sample.

Interestingly, these activated microglia appeared to have a concentration of Hbb staining

located on the cell surface, but no staining located within the cells. An image of the

activated microglia and Hbb staining is shown in Figure 4, with red labeling representing

CD68 and green labeling representing Hbb.

A B

Figure 4: Representative confocal images showing staining for activated C microglia (red) and Hbb (green) in an MS brain. A. Several CD68 immunoreactive microglia can be seen noted by white arrows. B. Punctate Hbb staining was seen surrounding microglia. C. Overlay of images shown in A and B.

PLP DAB Staining

A section of brain tissue adjacent to the section stained for activated microglia shown above in Figure 4 was stained for PLP and visualized with DAB in order to determine if the sectioned region of the brain contained a lesion. The DAB stained section is shown in Figure 5. A light DAB staining is indicative of the presence of a lesion, and thus, the section was determined to contain a lesion.

Figure 5: PLP DAB staining of brain section adjacent to a section containing activated microglia. The light area of staining is indicative of a lesion.

In situ hybridization

In situ hybridization was used to verify the presence of hemoglobin mRNA in neurons that contained hemoglobin protein. A RNA probe reverse-complementary to the

Hbb mRNA sequence was synthesized by RNA polymerase from an Hbb gene template and labeled with DIG molecules. Gel electrophoresis results verifying template size before and after ligation of the SP6 RNA polymerase promoter are shown in Figures 6 and 7. The bands present in Figure 6 represent a DNA template size of approximately 150 base pairs, consistent with the intended template size. The bands in Figure 7 show growth of the template by approximately 60 base pairs as would be expected from the addition of the 60 base pair RNA polymerase promoter. After the RNA polymerase reaction was performed to generate the RNA probe, a precipitation assay was performed to verify the presence and labeling of the RNA probe. The precipitation assay is shown in Figure 8, where the presence of precipitant from the product of the RNA polymerase reaction is indicative of successful probe generation. The RNA probe was then incubated with postmortem MS and control brain samples and visualized with an alkaline phosphatase linked anti-DIG antibody and BM Purple. Another RNA probe was generated with an identical sequence to the DIG labeled probe, but was labeled instead with a maleimide fluorophore at the 5' position. Postmortem MS and control brain sections were also incubated with the fluorescent probe and then visualized with confocal microscopy.

Samples visualized with BM Purple showed little precipitation and demonstrated only spurious staining. Groups of consistently sized thin, short lines were visible from BM

Purple precipitation, shown in Figure 9; however, the cause of these lines, and whether

these lines represent actual cellular material or simply spurious precipitation, is unknown.

The staining may have been hemoglobin in immature hematopoietic cells in microvessels, however, these experiments are inconclusive at this time. The fluorescently labeled probe also demonstrated no identifiable staining. Signal was present in the samples tested with the fluorescent probe, but this signal is believed to be lipofuscin or some other form of autofluorescence. These in situ experiments are ongoing.

Figure 6: Probe template before promoter ligation. Size ladders are shown on the right. The three white lines in the left ladder lane highlight the 100 base pair, 200 base pair, and 300 base pair markers, from bottom to top. The probe template was verified to be approximately 150 base pairs long as shown in the first three lanes.

R R F F

Figure 7: Probe template after promoter ligation. The white lines located in the ladder lane highlight the 100 base pair, 200 base pair, and 300 base pair markers, from bottom to top. The white arrow points to a sample of the probe template before ligation. The lanes marked as ‘F’ are templates which code for RNA identical to the Hbb mRNA, which served as a control RNA. The lanes marked as ‘R’ contain templates which code for RNA reverse-complimentary to the Hbb mRNA, which served as the probe. The weaker bands visible between lanes are spill-over.

C F R

1 ng

10 ng

100 ng

Figure 8: RNA probe precipitation assay. One microliter of control RNA from DIG Labeling Kit (C), DIG labeled control RNA probe (F), and DIG labeled RNA probe (R) were blotted on nitrocellulose membrane at 100 nanograms per microliter, 10 nanograms per microliter, and 1 nanogram per microliter, and soaked in BM Purple until precipitate formed. The intensity of the coloration is proportional to the amount of labeled RNA present. The presence of both control RNA probe and RNA probe was confirmed, but at low yield.

Figure 9: In situ hybridization of Hbb on human cortical section. Sample shows only DIG labeled probe in what appears to be microvessels.

Hypoxia

Ischemia, low oxygen concentration in the brain, may contribute to the expression of hemoglobin (Schelshorn et al., 2009). To test this hypothesis, cultured neurons were incubated for three days in a hypoxic chamber. The oxygen concentration inside the chamber was 2%. Neurons incubated at atmospheric oxygen concentration served as a control. After three days, total protein was extracted from the neurons and analyzed by

Western blot visualized via X-ray film. The Western blot was used to screen for Hba and

Hbb, along with GAPDH as a control due to the consistent abundance of GAPDH in

cultured neurons. The bands produced from the Western blot analysis are shown in Figure

10. Hba was present in neurons incubated at atmospheric and 2% oxygen concentrations, although the amount of hemoglobin present in neurons incubated at 2% oxygen was significantly less than in neurons incubated at atmospheric oxygen concentration. Hbb was only observed in neurons incubated at atmospheric oxygen concentration.

GAPDH

Hemoglobin A A 2 2 2 2 A A

Alpha Beta

Figure 10: Scanned images of X-ray film developed from Western blot analysis of cultured neurons exposed to hypoxic conditions. The left four lanes were analyzed for Hba and the right four lanes were analyzed for Hbb. Lanes denoted with ‘A’ contained protein from neurons cultured in atmospheric oxygen concentration, and lanes denoted with ‘2’ contained protein from neurons cultured in 2% oxygen concentration.

Bioinformatics Microarray Analysis

Using Allen Brain Atlas (Hawrylycz et al., 2012) and UniProtKB (Apweiler et al.,

2014), the functions of the 26 genes which had the most similar expression to Hbb were determined. A list of the 26 genes and the functions of those genes is provided in Table 2.

Six of the most related genes encoded for uncharacterized proteins, while another two related genes encoded for pseudogenes. Many of the globin genes, such as Hba1, Hba2, hemoglobin subunit delta, and hemoglobin subunits gamma 1 and 2, were similarly

expressed. Some immune related genes were similarly expressed to Hbb, including

IFITM1, 2, and 3, and S100A13. A transcription promoter for Hbb, KLF2, and the first

enzyme in the heme synthesis pathway, ALAS2, were also similarly expressed to Hbb.

Additionally, the MT2A gene, which encodes a protein that binds various heavy metals,

showed expression similar to Hbb.

Allen Brain Atlas Genes

Gene Relation Description

HBD 0.966 Oxygen transport from the lungs to various peripheral tissues

HBA1 0.898 Oxygen transport from the lungs to various peripheral tissues

HBA2 0.897 Oxygen transport from the lungs to various peripheral tissues

RPS26P11 0.678 Ribosomal pseudogene, associated with lncRNA class

HBG1 0.624 Constituent of fetal hemoglobin

A_32_P168431 0.620 Uncharacterized

IFITM1 0.615 Prevents viral fusion and release of viral contents, implicated in cell growth and migration A_24_P263443 0.610 Uncharacterized

HBG2 0.603 Constituent of fetal hemoglobin

IFITM3 0.597 Prevents viral fusion and release of viral contents, stabilizes vacuolar ATPase, helps lower pH in endosomes C1orf54 0.594 Chromosome 1 open reading frame 54

ALAS2 0.591 First enzyme in heme synthesis

IFITM2 0.591 Prevents viral fusion and release of viral contents, induces cell cycle arrest and mediates apoptosis by caspase activation TRIP6 0.585 Relays signal from cell surface to nucleus to promote actin cytoskeleton reorganization and cell invasiveness

GCSH 0.578 Methylamine shuttle for glycine cleavage system

IFITM4P 0.572 Pseudogene of IFITM4, associated with lncRNA class

A_24_P638294 0.571 Uncharacterized

A_24_P7040 0.564 Uncharacterized

A_23_P319970 0.564 Uncharacterized

ZFP36L1 0.561 Regulates response to growth factors

SAT1 0.560 Catalyzes the acetylation of polyamines

S100A13 0.558 Involved in the export of proteins without signal peptides, required for copper-dependent stress-induced release of IL1A and FGF1 KLF2 0.553 Binds to the CACCC box of beta-globin gene promoter and activates transcription A_24_P161494 0.551 Uncharacterized

ALDH6A1 0.551 Member of aldehyde dehydrogenase family, mitochondrial methylmalonate semialdehyde dehydrogenase MT2A 0.549 Binds various heavy metals

Table 2: Genes with similar expression to Hbb. Many of the genes most similarly expressed to Hbb are directly linked to immune response or may be involved in immune response indirectly.

Chapter 4: Discussion and Conclusions

In the present study, MS and control brain sections were labeled for SMI32

(neurofilament) and Hbb in order to determine a general association between neurons and

Hbb expression and the laminar distribution of Hbb expressing neurons in the cortex.

Both MS and control sections demonstrated localization of Hbb inside of neurons labeled with SMI32. Generally, the Hbb staining of the MS samples appeared stronger than the control samples, but the staining intensity was not quantified. Of particular note was the fact that the majority of neurons labeled with SMI32 that contained Hbb appeared to be pyramidal neurons. Specifically, we counted a total of 44 pyramidal neurons across four

MS brains, and found 16 pyramidal neurons (~36%) which expressed Hbb (Figure 2).

In addition to SMI32 and Hbb labeling, sections of MS and control brains were stained for TH and Hbb in order to determine if Hbb has increased expression within interneurons of MS brains. Tyrosine hydroxylase catalyzes the rate limiting step of the formation of catecholamines, which include the neurotransmitters dopamine, adrenaline, and noradrenaline. TH has also been localized within interneurons, and thus can be used as a histochemical marker for interneurons (Benavides-Piccione and DeFelipe, 2003).

These TH positive interneurons do not synthesize catecholamines, but appear to be

GABAergic. GABA is synthesized by GAD1, which was among the most decreased genes in a microarray analysis of postmortem MS brain (Dutta et al., 2006). GABA is an inhibitory neurotransmitter expressed by many types of interneurons.

An abundance of TH labeled neurons was found in the MS samples, each with morphologies consistent with interneurons. TH labeled neurons did not appear to contain

Hbb; however, some TH labeled neurons were observed to form what appeared to be synapses to cells which did contain Hbb. Benavides-Piccione and DeFelipe (2003) state that the most common cell type targeted by interneurons are pyramidal cells. The facts that the majority of cells labeled with SMI32 which contained Hbb appeared to be pyramidal cells and that interneurons preferentially target pyramidal cells together imply a correlation between hemoglobin expression and signaling from interneurons. While a correlation between interneuron synapses and Hbb expression potentially exists, a synapse with an interneuron does not seem to be a requirement for neurons to express hemoglobin, as some neurons which contained Hbb did not appear to be synapsed with an interneuron. The fact that interneurons did not express Hbb indicates that either interneurons are not subject to the stress which other neuron types are, or that interneurons have adapted a response other than Hbb expression to cope with the stress.

There exists the possibility that interneurons captured in this study did not express neuronal nitric oxide synthase (nNOS), and thus no conclusions can be drawn about potential modulation of NO in interneurons via hemoglobin. A future study of TH and

SMI32 fluorescent confocal colocalization with Hba and nNOS should be performed in order to address the possibility that Hba could modulate nNOS activity in interneurons and pyramidal cells.

In support of the role of hemoglobin in modulating NO, Benavides-Piccione and

DeFelipe (2003) characterized TH immunoreactive neurons in human brains in regards to

position within the cortex and colocalization with nNOS. TH immunoreactive neurons were found to be located almost exclusively in layers V and VI of the cortex, with axons projecting upwards through all layers of the cortex. Neurons labeled with nNOS were found evenly distributed through all layers of the cortex. Both TH and nNOS immunoreactive neurons demonstrated non-pyramidal morphologies. TH and nNOS were colocalized in approximately 25% of TH labeled neurons. In addition to TH and nNOS colocalization, Benavides-Piccione and DeFelipe (2003) stained brain sections for TH and neuron-specific nuclear protein (NeuN) in order to determine how TH labeled neurons form synapses to other neurons. TH labeled neurons were found to preferentially form connections with the dendrites of target neurons as opposed to synapsing onto the soma of target neurons. My data shows what appears to be TH expressing axons synapsing onto the cell bodies of Hbb expressing neurons as opposed to dendrites, suggesting these TH expressing neurons are GABAergic inhibitory interneurons as inhibitory synapses often target cell bodies instead of dendrites.

In addition to delineating neuronal cell types expressing Hbb and their distribution in the cortex, I was also interested in understanding the function of hemoglobin in neurons and its significance in MS pathology. Our original hypothesis on the role of the increased hemoglobin reported in MS brain (Broadwater et al., 2011) was that hemoglobin may be involved in neuronal respiration as mitochondrial defects had been reported in several studies studying cortical grey matter (Pandit et al., 2009; Witte et al., 2013, review). My interrogation of the Allen Brain Atlas, however, has demonstrated the possibility that Hbb may also be involved in the immune response. The Allen Brain

Atlas (2012) was used to determine genes which shared similar expression patterns with

Hbb in brain tissues. The functions of the 26 most related genes were determined with

UniProtKB (Apweiler et al., 2014). Overall, the genes which had the strongest relationship with Hbb expression were other globin genes, including hemoglobin delta, hemoglobin alpha 1 and 2, and hemoglobin gamma 1 and 2. While one may argue that the similar expression of these globin genes would be expected as these globins share a similar function, the expression of globin gamma 1 and 2 is noteworthy due to the fact that the globin gamma 1 and 2 proteins are constituents of fetal hemoglobin and are typically not expressed in humans after birth. Another set of genes of interest are the

IFITM (interferon-induced transmembrane protein) 1, 2, and 3 genes. Each of the IFITM genes encode a protein which aids in preventing viral fusion and release of viral contents, and each have a secondary function which could be related to immune response such as the role of IFITM3 in reducing endosome pH. The increased expression of the IFITM genes alongside Hbb expression implies that cells within the brain are exposed to viral infection and/or mounting an immune response. The increase of TRIP6 gene expression may also be indicative of an immune response due to the fact that the TRIP6 protein product is involved in relaying a signal from the cell surface to direct actin cytoskeleton rearrangement and may be involved in chemotaxis. Other genes of note are ALAS2, due to its role in the synthesis of heme, and KLF2, a transcription factor promoting the transcription of the Hbb gene. Additionally, the MT2A gene encodes a protein capable of binding various heavy metals and may be involved in heme synthesis or sequestering free iron. One gene, ALDH6A1, is a mitochondrial protein and may implicate mitochondrial

function with Hbb expression. Overall, the expression of Hbb, along with other hemoglobin subunit genes, appeared to be most strongly correlated to the expression of genes involved in immune response which suggests that hemoglobin subunit proteins may also regulate immune response.

The notion of hemoglobin functioning as an immune regulator has been supported by multiple studies. One such study by Qu et al. (2006) demonstrated that non-symbiotic hemoglobin plays an integral role in the immune response of Arabidopsis. Transgenic

Arabidopsis which overexpressed non-symbiotic hemoglobin were compared to wild- type Arabidopsis in various circumstances. Qu et al. (2006) found that transgenic

Arabidopsis formed apoptotic lesions (while wild-type Arabidopsis did not), and that transgenic Arabidopsis showed higher expression of immune response marker genes than wild-type. Transgenic Arabidopsis also demonstrated higher tolerance to NO exposure and infection from Pseudomonas syringae and Verticillium dahliae than wild-type

Arabidopsis. These observations strongly implicate hemoglobin having a pivotal role in the immune response of Arabidopsis.

A second study which illustrates the involvement of hemoglobin in immune response was conducted by Ouellet et al. (2002), who showed that a truncated hemoglobin (trHb) protein found in Mycobacterium bovis can metabolize and detoxify

NO. Genetically modified M. bovis lacking a functional trHb gene were unable to metabolize NO and suffered a much greater inhibition of respiration from NO exposure compared to wild-type M. bovis. Ouellet et al. (2012) determined that the trHb metabolized NO via oxidation with molecular oxygen to yield nitrate, and claimed that

this metabolism of toxic NO to benign nitrate could be a response of M. bovis to the production of NO of host macrophages. Doyle and Hoekstra (1981) demonstrated that

Hba is capable of catalyzing the oxidation of NO with molecular oxygen to nitrate much like the trHb in M. bovis. Furthermore, NO has been shown to undergo oxidation by oxyhemoglobin in human erythrocytes (Gladwin et al., 2000). Hba was localized within neurons of MS brain samples in the current study, presenting the possibility that MS neurons are producing increased quantities of Hba in order to detoxify NO produced from the surrounding immune response.

The potential roles played by hemoglobin in the pathology of MS are highly diverse and complex, and understanding these roles is made more difficult by the variability of the disease itself. Lucchinetti et al. (2000) describe four patterns of demyelination in MS brain samples. All four patterns were associated with inflammation consisting predominantly of T-lymphocytes and macrophages. Patterns I and II are extremely similar, both being characterized by localization of demyelination around small veins and venules, sharply demarcated plaque edges, and large amounts of remyelinated neurons in inactive lesions. Pattern II is unique due to marked deposition of immunoglobins and C9neo (marks activated compliment) in areas of active demyelination. Pattern III is characterized by localization around inflamed vessels within demyelinated plaques, poorly defined lesion borders, lack of immunoglobin and C9neo deposition, and preferential loss of myelin protein MAG. Of particular note, oligodendrocytes did not appear to recover in pattern III, and little to no remyelination was observed. Pattern IV demonstrates lack of immunoglobin and C9neo deposition,

demyelinating plaques with sharply defined edges, and oligodendrocyte destruction in periplaque white matter near areas of active demyelination. The destroyed oligodendrocytes in pattern IV did not demonstrate any indication of undergoing apoptosis, and could only be identified by DNA fragmentation. As in pattern III, pattern

IV showed no oligodendrocyte recovery. Lucchinetti et al. (2000) claim that the four patterns indicate a heterogeneity about the pathogenesis of MS. Patterns I and II are hypothesized to indicate an autoimmune pathogenesis, whereas patterns III and IV are believed to be derived from external factors, such as toxins or viruses.

The possibility for MS to be triggered by an infection or toxin is supported by the work of Rumah et al. (2013), who investigated the toxin of Clostridium perfringens type

B as a potential initiator of MS. C. perfringens type A typically out-competes type B in healthy human gastrointestinal tracts and does not produce any harmful substances. By extrapolation, the lack of C. perfringens type A in a GI tract greatly increases the probability of type B to populate said GI tract. Detection of C. perfringens type B is much more difficult than the detection of type A, as type B exists predominantly as endospores in the upper GI tract, rarely entering growth phases. In order to determine the susceptibility of MS individuals to C. perfringens type B in comparison to healthy individuals, Rumah et al. (2013) compared the prevalence of C. perfringens type A in stool samples of MS patients with samples of non-MS individuals. The C. perfringens toxinotypes were determined by PCR. Approximately 52% of the healthy individuals were found to harbor C. perfringens type A, whereas approximately 23% of MS individuals harbored type A, implying that MS individuals have a higher susceptibility of

harboring type B C. perfringens. Rumah et al. (2013) also compared the immunoreactivity of sera and cerebral spinal fluid for C. perfringens epsilon toxin between healthy and MS individuals. The sera and cerebral spinal fluid of 10% of MS individuals were found to be immunoreactive, while only 1% of controls had sera and cerebral spinal fluid immunoreactive for the epsilon toxin. Rumah et al. (2013) claim that the higher incidence of immunoreactivity in MS individuals shows a higher exposure of

MS individuals to C. perfringens epsilon toxin, and that the values found in this study are below representative due to the fact that immunity to epsilon toxin is lost extremely rapidly in mammals. Additionally, Rumah et al. (2013) demonstrated that the epsilon toxin of C. perfringens localizes to the myelin of the CNS along with CNS endothelium.

In the present study, activated microglia were visualized using confocal microscopy in both MS and control brain samples. A large number of activated microglia was found in an MS sample and little to no activated microglia were found in the corresponding control sample. As microglia are a constituent of the immune system, the presence of activated microglia in the MS sample and relative lack of activated microglia in the control sample support the notion of MS having an immune component, although this immune component could be either autoimmune or mounted against a foreign agent as discussed by Lucchinetti et al. (2000). Of particular note is the location of Hbb staining in relation to the CD68 staining of activated microglia. Hbb appeared to be located immediately surrounding activated microglia like a shell, but did not appear to be located within the microglia. The pattern of Hbb appearing as a shell around activated microglia was very consistent. The lack of Hbb staining within the microglia indicates

that microglia do not produce Hbb themselves. A possible explanation of this observation is microglia scavenging Hbb containing cells or cell fragments from the environment. If a neuron or other cell containing Hbb were to be destroyed, microglia would act as scavengers of the debris, and the pattern of microglia surrounded by concentrated Hbb may arise. Additionally, some microorganisms are capable of expressing hemoglobin

(Richter et al., 2009), and these microorganisms could be labeled for Hbb if present within the sample. The presence of Hbb expressing microorganism in the sample could also produce the Hbb-shell pattern observed. A third possibility exists where a leak of hemoglobin through the blood brain barrier may cause the activation of microglia to scavenge the leaked hemoglobin. This third explanation seems unlikely, however, due to the fact that many of the Hbb stained areas are also stained with DAPI, indicating the presence of DNA and a cellular origin. The possibility of a toxin causing an immune response, like discussed by Rumah et al. (2013) also does not seem likely in this case, as the vast majority of observed microglia appeared to be targeting pieces of cellular material labeled with Hbb antibody.

Three major observations were made from the current study. First, my data confirms the colocalization of Hbb in pyramidal neurons in the human cortex.

Furthermore, TH labeled neurons appeared to contact on hemoglobin containing cells.

This observation was consistent with the fact that TH labeled neurons have been shown to preferentially synapse with pyramidal cells. Second, in MS brain tissue shown to contain a grey matter lesion by PLP staining, activated microglia were found associated with Hbb. Interestingly, the Hbb appeared to be localized to the surface of the microglia

and not found inside. This observation may reflect degradation of other Hbb containing neurons. Lastly, the Hbb gene was shown to be related via expression profile to a number of immune response related genes. This relation suggests a novel mechanism for potential involvement of Hbb in the immune response.

References

Beal. (1995). Aging, energy, and oxidative stress in neurodegenerative diseases. Ann

Neurol, 38(3), 357-366.

Benavides-Piccione and DeFelipe. (2003). Different populations of tyrosine-

hydroxylase-immunoreactive neurons defined by differential expression of

nitric oxide synthase in the human temporal cortex. Cereb Cortex, March 2003,

297-307.

Biagioli, Pinto, Cesselli, Zaninello, Lazarevic, Roncaglia, Simone, Vlachouli, Plessy,

Bertin, Beltrami, Kobayashi, Gallo, Santoro, Ferrer, Rivella, Beltrami, Carninci,

Raviola, Gustincich. (2009). Unexpected expression of alpha- and beta-globin in

mesencephalic dopaminergic neurons and glial cells. Proc Natl Acad Sci USA,

106(36), 15454-15459.

Bjartmar, Kidd, Mörk, Rudick, Trapp. (2000). Neurological disability correlates with

spinal cord axonal loss and reduced N-acetyl aspartate in chronic multiple

sclerosis patients. Ann Neurol, 48(6), 893-901.

Bo, Geurts, Mork, van der Valk. (2006). Grey matter pathology in multiple sclerosis. Acta

Neurol Scand, 113(Suppl. 183), 48-50.

Broadwater, Pandit, Clements, Azzam, Vadnal, Sulak, Yong, Freeman, Gregory,

McDonough. (2011). Analysis of the mitochondrial proteome in multiple sclerosis

cortex. Acta Biochim Biophys, 1812(5), 630-641.

Confavreux C, Vukusic S, Moreau T, Adeleine P. (2000). Relapses and progression of

disability in multiple sclerosis. N Engl J Med, 343, 1430-1438.

Clements, McDonough, Freeman. (2008). Distribution of parvalbumin and calretinin

immunoreactive interneurons in motor cortex from multiple sclerosis post-mortem

tissue. Exp Brain Res, 187(3), 459-465.

De Stefano, Narayanan, Francis, Arnaoutelis, Tartaglia, Antel, Matthews, Arnold. (2001).

Evidence of axonal damage in the early stages of multiple sclerosis and its

relevance to disability. Arch Neurol, 58(1), 56-70.

DiMauro, Schon, Carelli, Hirano. (2013). The clinical maze of mitochondrial neurology.

Nat Rev Neurol, 9(8), 429-444.

Doyle and Hoekstra. (1981). Oxidation of nitrogen oxides by bound dioxygen in

hemoproteins. J Inorg Biochem, 14, 351-358.

Dutta, McDonough, Yin, Peterson, Chang, Torres, Gudz, Macklin, Lewis, Fox, Rudick,

Mirnics, Trapp. (2006). Mitochondrial dysfunction as a cause of axonal

degeneration in multiple sclerosis patients. Ann Neurol, 59(3), 478-489.

England, Gamboni, Levinson, Finger. (1990). Changed distribution of sodium channels

along demyelinated axons. Proc Natl Acad Sci USA, 87, 6777-6780.

Fang. (1997). Mechanisms of nitric oxide-related antimicrobial activity. J Clin Invest,

99(12), 2818-2825.

Fisher, Lee, Nakamura, Rudick. (2008). Gray matter atrophy in multiple sclerosis: a

longitudinal study. Ann Neurol, 64(3), 255-265.

Gladwin, Ognibene, Pannell, Nichols, Pease-Fye, Shelhamer, and Schechter. (2000).

Relative role of heme nitrosylation and β-cysteine 93 nitrosation in the transport

and metabolism of nitric oxide by hemoglobin in the human circulation. Proc Natl

Acad Sci USA, 97(18), 9943-9948.

Hawrylycz, M.J. et al. (2012). An anatomically comprehensive atlas of the adult human

brain transcriptome, Nature 489, 391-399. doi: 10.1038/nature11405.

[Internet]. Available from: http://human.brain-map.org/

Kornek and Lassmann. (2003). Neuropathology of multiple sclerosis-new concepts.

Brain Res Bull, 61(3), 321-326.

Lin and Beal. (2006). Mitochondrial dysfunction and oxidative stress in

neurodegenerative diseases. Nature, 443(7113), 787-795.

Lucchinetti, Bruck, Parisi, Scheithauer, Rodriguez, Lassmann. (2000). Heterogeneity of

multiple sclerosis lesions: Implications for the pathogenesis of demyelination.

Ann Neurol, 47, 707-717.

Noseworthy, Lucchinetti, Rodriguez, Weinshenker. (2000). Multiple sclerosis. N Engl J

Med, 343, 938-952.

Ouellet, Ouellet, Richard, Labarre, Wittenberg, Wittenberg, Guertin. (2002). Truncated

hemoglobin HbN protects Mycobacterium bovis from nitric oxide. Proc Natl Acad

Sci USA, 99(9), 5902-5907.

Pandit, Vadnal, Houston, Freeman, McDonough. (2009). Impaired regulation of electron

transport chain subunit genes by nuclear respiratory factor 2 in multiple sclerosis.

J Neurol Sci, 279(1-2), 14-20.

Qu, Zhong, Wang, Chen, Jian, Xia. (2006). Ectopic expression of the cotton non-

symbiotic hemoglobin gene GhHbd1 triggers defense responses and increases

disease tolerance in Arabidopsis. Plant Cell Physiol, 47(8), 1058-1068.

Rahaman and Straub. (2013). The emerging roles of somatic globins in cardiovascular

redox biology and beyond. Redox Biol, 1(1), 405-410.

Richter, Meurers, Zhu, Medvedeva, Chesselet. (2009). Neurons express hemoglobin

alpha- and beta-chains in rat and human brains. J Comp Neurol, 515(5), 538-547.

Rumah, Linden, Fischetti, Vartanian. (2013). Isolation of Clostridium perfringens type B

in an individual at first clinical presentation of multiple sclerosis provides clues

for environmental triggers of the disease. PLoS ONE, 8(10), e76359.

Schelshorn, Schneider, Kuschinsky, Weber, Krüger, Dittgen, Bürgers, Sabouri, Gassler,

Bach, Maurer. (2009). Expression of hemoglobin in rodent neurons. J Cereb

Blood Flow Metab, 29(3), 585-595.

Straub, Lohman, Billaud, Johnstone, Dwyer, Lee, Bortz, Best, Columbus, Gaston,

Isakson. (2012). Endothelial cell expression of haemoglobin α regulates nitric

oxide signalling. Nature, 491(7424), 473-477.

Apweiler et al. UniProt Consortium, The. Activities at the Universal Protein Resource

(UniProt). Nucleic Acids Res. 42: D191-D198 (2014).

Wallace. (1992). Diseases of the mitochondrial DNA. Annu Rev Biochem, 61, 1175-1212.

Wallace, Singh, Lott, Hodge, Schurr, Lezza, Elsas, Nikoskelainen. (1988). Mitochondrial

DNA mutation associated with Leber's hereditary optic neuropathy. Science,

242(4884), 1427-1430.

Witte, Mahad, Lassmann, van Horssen. (2013). Mitochondrial dysfunction contributes to

neurodegeneration in multiple sclerosis. Trends Mol Med, 20(3), 179-187.

Appendix

In situ hybridization oligonucleotide sequences

Forward primer:

ATTTAGGTGACACTATAGAAGAGAACCTCAAGGGCACCTTTGCCAC

Reverse primer:

ATTTAGGTGACACTATAGAAGAGAGCCTGCACTGGTGGGGTGAATTCT

SP6 Adapter primer: TATGTTGTGTGGAAGCGGAAGA

In situ hybridization solutions

Proteinase K Buffer:

235 milliliters of DEPC water

12.5 milliliters of 1M Tris, pH 7.6

2.5 milliliters of 0.5M EDTA, pH 8.0

10 micrograms per milliliter Proteinase K

Prehybridization Buffer:

16.5 milliliters DEPC water

25 milliliters 50% deionized formamide

6 milliliters 5M sodium chloride

1 milliliter 50x Denhardt’s solution

0.5 milliliter 1M Tris, pH 7.6

625 microliters 20% SDS

100 microliters 0.5M EDTA

15 milligrams of yeast tRNA

Hybridization Buffer:

500 microliters 50% deionized formamide

339.5 microliters 25% dextran sulfate

120 microliters of 5M sodium chloride

20 microliters of 50x Denhardt’s solution

10 microliters of 1M Tris, pH 7.6

12.5 microliters of 20% SDS

300 micrograms of yeast tRNA

2 microliters of 0.5M EDTA

2x SSC:

0.3M sodium chloride

30 millimolar sodium citrate

pH adjusted to 7.0 using HCl