Retinoids Enhance the Expression of Cathelicidin Antimicrobial Peptide During Reactive Dermal Adipogenesis

Retinoids Enhance the Expression of Cathelicidin Antimicrobial Peptide during Reactive Dermal Adipogenesis

This information is current as Marc C. Liggins, Fengwu Li, Ling-juan Zhang, Tatsuya of September 25, 2021. Dokoshi and Richard L. Gallo J Immunol 2019; 203:1589-1597; Prepublished online 16 August 2019; doi: 10.4049/jimmunol.1900520

http://www.jimmunol.org/content/203/6/1589 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2019/08/15/jimmunol.190052 Material 0.DCSupplemental http://www.jimmunol.org/ References This article cites 47 articles, 8 of which you can access for free at: http://www.jimmunol.org/content/203/6/1589.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision by guest on September 25, 2021 • No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2019 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Retinoids Enhance the Expression of Cathelicidin Antimicrobial Peptide during Reactive Dermal Adipogenesis

Marc C. Liggins,* Fengwu Li,* Ling-juan Zhang,*,† Tatsuya Dokoshi,* and Richard L. Gallo*

A subset of dermal fibroblasts undergo rapid differentiation into adipocytes in response to infection and acutely produce the cathelicidin antimicrobial peptide gene Camp. Vitamin A and other retinoids inhibit adipogenesis yet can show benefit to skin disorders, such as cystic acne, that are exacerbated by bacteria. We observed that retinoids potently increase and sustain the expression of Camp in preadipocytes undergoing adipogenesis despite inhibition of markers of adipogenesis, such as Adipoq, Fabp4, and Rstn. Retinoids increase cathelicidin in both mouse and human preadipocytes, but this enhancement of antimicrobial peptide expression did not occur in keratinocytes or a sebocyte cell line. Preadipocytes undergoing adipogenesis more effectively inhibited growth of Staphylococcus aureus when exposed to retinoic acid. Whole transcriptome analysis identified hypoxia- Downloaded from inducible factor 1-a (HIF-1a) as a mechanism through which retinoids mediate this response. These observations uncouple the lipid accumulation element of adipogenesis from the innate immune response and uncover a mechanism, to our knowledge previously unsuspected, that may explain therapeutic benefits of retinoids in some skin disorders. The Journal of Immunology, 2019, 203: 1589–1597.

etinoids comprise a large group of chemical compounds peptide that peaks during this process as the local adipocytes http://www.jimmunol.org/ that are vitamin A (retinol [ROL]) analogs and/or deriv- mature (20). Reactive adipogenesis is essential for optimal innate R atives and can influence multiple physiological processes, immune defense because impairment of the adipogenic process including vision, cell proliferation, differentiation, and immunity decreases total skin cathelicidin expression and increases the (1, 2). Within the skin, retinoids have been shown to affect mul- severity of bacterial infections (19–21). tiple cell types, modulating several processes, including wound Retinoids have been shown to inhibit adipogenesis and promote healing, pigmentation, and immune defense (3–9), and have been lipid breakdown (22–27) and therefore would be predicted to used pharmacologically to treat chronological and photoaging, decrease cutaneous antimicrobial defense capacity. In this study, psoriasis, and acne (9–13). There are few cases in which retinoids we sought to understand the effects of retinoids on antimicrobial have exhibited direct antimicrobial activity (14, 15); however, peptide production during adipogenesis to better understand the by guest on September 25, 2021 under most circumstances, immune modulation by retinoids is therapeutic mechanism of action of retinoids. Despite exhibiting thought to only occur indirectly (5–7, 9, 16–18). For example, the the anticipated antiadipogenic effects, we unexpectedly observed mechanism by which retinoids are therapeutically useful in acne, a that retinoids enhanced and sustained cathelicidin levels in de- disorder that is driven in part by the bacterium Cutibacterium veloping preadipocytes, ultimately translating to increased an- acnes, is thought to occur through their effect to decrease sebum timicrobial activity. This process was found to depend in part on production and alter epidermal function rather than through an hypoxia-inducible factor 1-a (HIF1a), a broadly active transcrip- influence on immune defense against bacterial growth (9). tion factor within the CAMP gene promoter. These observations It has been recently observed that dermal fibroblasts of the reveal an uncoupling between adipogenesis and antimicrobial preadipocyte lineage will undergo rapid, local proliferation and expression that could be exploited as a novel means of modulating differentiation in response to bacterial infection of the skin (19, 20). innate immune defense. This process, dubbed reactive adipogenesis, results in an increase in the expression of the cathelicidin gene CAMP, an antimicrobial Materials and Methods Abs, chemicals, and reagents Vitamin A (ROL), all trans-retinal (RAL), all trans-retinoic acid (RA), *Department of Dermatology, University of California, San Diego, La Jolla, CA 92093; 9-cis RA, 13-cis RA, 1a,25-dihydroxyvitamin D , L-mimosine, tazarotene, and †School of Pharmaceutical Sciences, Xiamen University, Xiamen 361102, China 3 3-isobutyl-1-methylxanthine (IBMX), dexamethasone, indomethacin, and ORCIDs: 0000-0003-1402-9245 (M.C.L.); 0000-0001-5092-770X (F.L.); 0000-0003- recombinant human insulin were purchased from Sigma-Aldrich (St. Louis, 3678-6781 (T.D.); 0000-0002-1401-7861 (R.L.G.). MO). Acriflavine hydrochloride was purchased from Thermo-Fisher Scientific Received for publication May 7, 2019. Accepted for publication July 16, 2019. (Pittsburgh, PA). AM580 was purchased from Abcam. MALP-2 was pur- This work was supported by National Institutes of Health Grant R01AR069653. chased from Enzo Life Sciences. Rabbit anti-CRAMP Abs were made in our laboratory, as previously described (28). Mouse anti-FABP4 was Address correspondence and reprint requests to Dr. Richard L. Gallo, Department purchased from Santa Cruz Biotechnology (Santa Cruz, CA). of Dermatology, University of California, San Diego, 9500 Gilman Drive, MC#0869, La Jolla, CA 92093-0869. E-mail address: [email protected] Cell culture The online version of this article contains supplemental material. 3T3-L1 primary mouse preadipocytes were purchased from the American Abbreviations used in this article: HIF1a, hypoxia-inducible factor 1-a;MSFB, mouse neonatal dermal fibroblast; qPCR, quantitative PCR; RA, retinoic acid; RAL, Type Culture Collection (CL-173). Neonatal primary dermal fibroblasts retinal; RAR, retinoid acid receptor; RNA-seq, RNA sequencing; ROL, retinol; were isolated by our laboratory, as previously described (19). Cells were UCSD, University of California, San Diego; WAT, white adipose tissue. grown in DMEM supplemented with 10% FBS, glutamax, and antibiotic- antimycotic (Thermo-Fisher Scientific) in a humidified incubator at 5% Copyright Ó 2019 by The American Association of Immunologists, Inc. 0022-1767/19/$37.50 CO2 and 37˚C under sterile conditions. To induce differentiation, 2-d www.jimmunol.org/cgi/doi/10.4049/jimmunol.1900520 1590 RETINOIDS INDUCE ANTIMICROBIALS IN ADIPOGENESIS postconfluent 3T3-L1 cells were switched to adipocyte differentiation and maintained in the animal facility of UCSD. Animals in all experimental medium containing 2 mM dexamethasone, 250 mMIBMX,200mM models were age and sex matched. Skin infections were conducted as pre- indomethacin, and 10 mg/ml recombinant human insulin. For time course viously described (20), using S. aureus strain USA300 (methicillin-resistant experiments, differentiation media were refreshed at indicated times. Im- S. aureus)(S. aureus strain AH4807 was used for IVIS experiments) or mortalized nondiabetic human preadipocytes (29) were a generous gift PBS control. Mice were distally administered one s.c. injection with RA from Dr. P. M. Schliever (Carver College of Medicine, Iowa City, IA). (10 mg/kg) or vehicle (DMSO) dissolved in olive oil on the day of infection Human preadipocytes were grown and differentiated, as previously described and two additional injections on subsequent days. Mice were sacrificed on (29), and differentiation media were refreshed on indicated days. Human day 3, and a skin biopsy of the infected region was harvested. Skin biopsies epidermal keratinocytes (no. C-001-5C; Life Technologies) were cultured in were homogenized in PureLink Lysis Buffer (or PBS for CFU counting) with EpiLife medium supplemented with 60 mM CaCl2, EpiLife Defined Growth 2 mM zirconia beads in a minibead beater (Biospect, Bartleville, OK) for Supplement (Life Technologies), and antibiotic/antimycotic. SEB-1 sebo- RNA extraction. To quantify CFU, homogenized skin samples were serially cytes were cultured in Sebomed basal medium (Millipore) supplemented diluted and plated onto Baird-Parker agar and grown for 24 h to quantify with recombinant human epidermal growth factor (5 ng/ml) (Sigma-Aldrich). the CFU per gram of tissue. For in vivo live bacterial imaging, mice were To examine the effects of retinoids on cathelicidin expression, retinoids imaged under isoflurane inhalation anesthesia (2%). Photons emitted from (1 mM, unless otherwise noted) or vehicle (ethanol) were added to differ- luminescent bacteria were collected during a 1-min exposure, using the entiation media or cell culture media on day 0 (unless indicated otherwise). Xenogen IVIS Imaging System and living image software (Xenogen, Retinoid-containing media were subsequentially refreshed every 2–3 d Alameda, CA). Bioluminescent image data are presented on a pseudocolor throughout the course of the experiment. Treatment of cells with 1a,25- scale overlaid onto a grayscale photographic image. Using the image anal- dihydroxyvitamin D3 (vitamin D) (10 nM) or vehicle (ethanol) was con- ysis tools in living image software, circular analysis windows (of uniform ducted identical to that of retinoids. To examine the role of HIF-1a, cells area) were overlaid onto regions of interest, and the corresponding were cotreated with L-mimosine (400 mM), acriflavine (5 mM), or vehicle bioluminescence values (total flux) were measured. (water) for 24 h.

RNA sequencing Downloaded from RNA isolation, cDNA synthesis, and real-time quantitative Purified RNA was submitted to the UCSD Institute for Genomic Medicine PCR analysis core facility for library preparation and high-throughput next-generation sequencing. Library preparation and subsequent analysis were conducted, Cultured cells were lysed with TRIzol reagent (Life Technologies) or PureLink Lysis Buffer (Ambion/Life Technologies), and RNA was iso- as previously described (30). Venn diagram was prepared using Venny (31). lated using the PureLink isolation kit. Up to 1 mg of RNA was reverse Statistical analysis transcribed to cDNA using the iScript cDNA synthesis kit (Bio-Rad). Quantitative real-time PCR was performed with the CFX96 Real-Time Experiments conducted were performed in triplicate with at least three http://www.jimmunol.org/ System (Bio-Rad) using SYBR Green Mix (Biomake, Houston, TX). technical replicates. Statistical significance was calculated using a Student The housekeeping gene TAT-binding box protein (Tbp) was used to nor- two-tailed t test in which *p , 0.05, **p , 0.01, ***p , 0.001, and malize gene expression in samples. Specific primer sequences are shown in ****p , 0.0001, as indicated in the figure legends. Supplemental Table I. Results Western blots Retinoids increase cathelicidin expression during adipogenesis Supernatants from treated cells were enriched for protein using Oasis HLB Plus Light Cartridges (Waters, Milford, MA) and lyophilized. To determine the effects of retinoids on Camp expression during Lyophilized protein from 500 ml of supernatant was separated on a Novex reactive adipogenesis, we first examined differentiation of pre- 10–20% Tricine Gel (Invitrogen) and transferred to a PVDF membrane adipocytes in vitro under defined conditions. Differentiation was by guest on September 25, 2021 using Trans-Blot Turbo Transfer Pack (Bio-Rad), according to the man- associated with increased Camp mRNA expression, and treat- ufacturer’s instructions. Membranes were blocked with Odyssey blocking buffer (LI-COR) and incubated overnight at 4˚C with primary Abs. Im- ment with the TLR2/6 ligand, MALP-2, further stimulated Camp munoblots were washed and incubated with fluorescent secondary Abs expression in both undifferentiated and differentiating 3T3-L1 (LI-COR) for 1 h at room temperature and subsequentially imaged using preadipocytes (Fig. 1A). The addition of vitamin A (ROL) greatly the Odyssey Infrared Imager (LI-COR). amplified the Camp response to differentiation, resulting in an Immunofluorescence increase in steady-state Camp mRNA levels compared with un- treated 3T3-L1 cells, with the greatest increase occurring with For immunofluorescence analysis, 3T3-L1 cells were grown, differentiated, Malp-2 and ROL (Fig. 1A). and treated in eight-well chamber slides, as described earlier. Cells were fixed in 4% PFA for 10 min and subsequentially incubated with primary Abs Vitamin A (also known as ROL) is an inactive precursor that overnight at 4˚C. Cells were washed and incubated for 1 h with secondary can be enzymatically converted to RA or RAL to exhibit physi- Abs conjugated to Alexa Fluor 594 (Invitrogen), and nuclei were coun- ological activity. Addition of ROL, RAL or RA had similar effects terstained with DAPI. All images were taken with an Olympus BX41 on Camp induction when added to 3T3-L1 cultures at the start of microscope. an 8-d differentiation experiment. RA appeared most potent when Histology and immunohistochemistry added between day 2 and 8 after differentiation was initiated, and Tissue biopsies were directly embedded in OCT compound. Frozen sections induction was least potent when added later during adipogenesis were fixed in 4% PFA for 10 min prior to H&E staining or immunofluo- at day 5–8 (Fig. 1B). These findings suggest adipocyte precursors rescence staining. For immunohistochemistry, fixed and permeabilized can metabolize vitamin A to active forms. frozen tissue sections were stained with BODIPY solution to visualize RA can isomerize between all-trans RA, 9-cis RA, and 13-cis lipid droplets, and nuclei were counterstained with DAPI. All images RA (32). Similar activity was observed by each of these isoforms were taken with an Olympus BX41 microscope. on Camp expression (Fig. 1C). Using RA analogs specific for the In vitro bacterial killing assay retinoid acid receptors (RAR), agonists for both RARa and Antibiotic-free conditioned media were collected from differentiating dermal RARb/g potently stimulated Camp expression to an extent similar fibroblasts, as previously described (20). Conditioned media (200 ml) were to RA (Supplemental Fig. 1A). RA demonstrated a dose-dependent mixed with 105 CFU of Staphylococcus aureus stain USA300 in deep-well induction of Camp at 24 h (Fig. 1D) but significantly induced Camp 96-well plates and incubated at 37˚ with shaking at 275 rpm for 12 h prior to expression in as little as 6 h and resulted in sustained high levels plating for CFU counting. of expression at day 8, a prolonged increase that contrasted with Mice experiments the normal downregulation of Camp seen during late adipogenesis All animal experiments were approved by the University of California, San in the absence of a retinoid (Fig. 1E). Previous observations have Diego (UCSD), Institutional Animal Care and Use Committee. SKH-1 hairless shown that Camp is the only AMP induced during adipogenesis, mice were originally purchased from Charles River Laboratories and bred whereas expression of a- and b-defensins was not altered (20). The Journal of Immunology 1591 Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 1. Retinoids signiﬁcantly increase cathelicidin expression during adipogenesis. 3T3-L1 preadipocytes were differentiated in the presence of retinoids or control, and relative mRNA expression of Camp (A–E), Adipoq (F), Fabp4 (G), or Rstn (H) was assayed by real-time qPCR. (A) 3T3-L1 cells were treated for 24 h in the presence of 1 mM ROL and/or 100 ng/ml MALP-2 or vehicle control in the absence or presence of differentiation media (DM). (B) Cells were differentiated for 8 d, and cotreatment was initiated on day 0, day 2, or day 5 in the presence of 1 mM ROL, all-trans RAL, RA, or control. (C) Cells were differentiated for 24 h in the presence of all-trans RA (ATRA), 9-cis RA (9-CRA), or 13-cis RA (13-CRA). (D) Cells were differentiated for 24 h in the presence of increasing concentrations of RA. (E–H) Cells were differentiated for 8 d in the presence of RA or vehicle control, and mRNA expression was assayed at given timepoints. All data are mean 6 SD. **p , 0.01, ***p , 0.001, ****p , 0.0001 using a Student paired t test. 1592 RETINOIDS INDUCE ANTIMICROBIALS IN ADIPOGENESIS

Our current studies are consistent with these observations, as sequencing (RNA-seq) of 3T3-L1 cells. The expression of genes that addition of RA was unable to induce expression of other AMPs were changed by more than 2-fold when 3T3-L1 cells were differ- (Supplemental Fig. 1B). Contrary to the increase in antimicrobial entiated in the presence of RA were identified (Fig. 4A, 4B). An peptide gene expression that was promoted by retinoids but con- increase in genes associated with adipogenesis (Zfp423, Fabp4, sistent with prior observations of the effect of RA to inhibit adi- Adipoq, Cebpa) was evident with differentiation, but several genes pogenesis (27, 33), we observed that RA inhibited expression of involved in hypoxic responses were also observed to be upregulated adipocyte maturation markers Adipoq, Fab4, and Rstn during the by RA (Supplemental Fig. 3A), particularly HIF1a (Fig. 4C). Quan- time course of this experiment (Fig. 1F, 1G). These observations titative PCR (qPCR) validated that Hif1a expression was increased suggest that RA promoted an uncoupling between antimicrobial in both mouse and human preadipocytes treated with RA (Fig. 4F, peptide expression and classic markers of adipocyte differenti- Supplemental Fig. 3B). Hif1a mRNA expression was also increased ation that are associated with lipid accumulation. in skin samples from mice treated with RA and infected with In agreement with our transcriptional studies, significantly elevated S. aureus (Fig. 4D). levels of the murine cathelicidin protein (Cramp) precursor protein To ascertain the role of HIF1a in the response of preadipocytes were detected in RA-treated 3T3-L1 cell supernatants (Fig. 2A). toRA,weusedanestablishedHIF1a agonist (L-mimosine) and in- Cramp immunostaining complimented these findings, as more Cramp hibitor (acriflavine). Camp expression was induced in preadipocytes staining was seen in the cytoplasm of 3T3-L1 cells during differen- treated with the HIF1a agonist and further enhanced by RA, and tiation into adipocytes in the presence of RA (Fig. 2B). On day 12, the HIF1a antagonist blocked Camp expression (Fig. 4E, 4F). numerous round areas in the cytosol that were unstained by DAPI Vascular endothelial growth factor A (VEGFA), a regulatory target or for Cramp are maturing lipid droplets. of HIF1a, responded as expected with an increase in expression Downloaded from Human and mouse cathelicidin genes exhibit several regulatory after agonist exposure and a decrease after antagonist treatment, parallels but also have important differences. The human CAMP thus serving as a control for the response to these chemical modi- promoter possesses an active vitamin D response element that is fiers of HIF1a activity (Supplemental Fig. 3C). Given our ob- lacking in mice (34, 35), and vitamin D can upregulate CAMP ex- servations that MALP-2 can stimulate Camp expression both in pression in several human cell types, including human keratinocytes undifferentiated and differentiating 3T3-L1 cells, we validated

(34, 36). To determine if the observations made in murine-derived theroleofHIF1a in Camp regulation by cotreating cells with http://www.jimmunol.org/ 3T3-L1 cells could be found in human preadipocytes, we inves- both acriflavine and MALP-2 under both conditions. Similarly, tigated the effects of RA and vitamin D in a cultured human HIF1a inhibition effectively blocked MALP-2 induction of Camp preadipocyte line (19, 20). Both 9-cis RA and vitamin D increased expression and further evidenced the regulatory role of HIF1a CAMP expression in human preadipocytes and exhibited an ad- (Supplemental Fig. 3D, 3E). ditive effect when cells were treated with both together (Fig. 2C). However, RA was unable to stimulate CAMP expression under similar Discussion culture conditions in a human sebocyte cell line or in primary cul- Retinoids are an effective therapy in the treatment of acne and other tures of normal human keratinocytes (Fig. 2D). Thus, we conclude disorders (9–13). However, the clinical response to retinoids is that retinoids can increase expression of cathelicidin in both human dependent on mode of delivery, and the mechanisms responsible by guest on September 25, 2021 and mouse preadipocytes, but the effects of RA on this response are for the physiological effects of retinoids are incompletely under- specific to cell type. stood. Retinoids indeed have been shown to exhibit both anti- Given the significant cathelicidin upregulation observed with inflammatory and proinflammatory effects on cellular immune retinoid treatment, we next wished to determine whether these responses of the skin (9, 37–39), but the activity of retinoids on results correlate with antimicrobial activity. As our observations innate host antimicrobial defense has not been well characterized. have shown that mouse neonatal dermal fibroblasts (MSFBs) In this study, we present an unexpected observation that ROL express significantly more Cramp protein compared with 3T3-L1 and its metabolites potently enhance cathelicidin AMP expression cells (Supplemental Fig. 2A), we selected to use MSFBs to determine during reactive adipogenesis. These findings suggest an alterna- antimicrobial activity. MSFB cells were stimulated to initiate adipo- tive and previously underappreciated mechanism for the action genesis in culture within the presence of RA, and this culture su- of retinoids in the skin. pernatant was then added to bacterial cultures of S. aureus (USA300). Retinoids inhibit adipogenesis and promote lipid breakdown The growth of S. aureus was maximally inhibited from culture (22–27). Inhibition of adipogenesis by inhibition of the Pparg supernatants of cells treated with RA (Fig. 3A). Despite promoting system will also inhibit the antimicrobial activity of dermal pre- Camp expression and enhancing antimicrobial activity, RA’s ef- adipocytes (19, 20). However, and contrary to expectations, we fects on cytokine and chemokine expression were comparatively show in the current study that retinoids increase Camp expression minor under the conditions we examined (Supplemental Fig. 2B). despite exhibiting antiadipogenic activity. This observation dem- Given our in vitro findings, we next wished to determine how RA onstrates an uncoupling between the processes of adipogenesis might contribute to antimicrobial activity during S. aureus infection. and AMP expression. Systemic treatment of mice with 10 mg/kg RA for 3 d decreased Previous observations have shown that adipocytes produce dermal adipose in uninfected skin as well as in skin after challenge the cathelicidin precursor protein that is upregulated during adipo- with S. aureus (Fig. 3B, 3C). Camp mRNA expression was induced genesis, which is processed into an active AMP (CRAMP); how- by S. aureus and RA (Fig. 3D). However, no consistent change in the ever, the enzyme that catalyzes this reaction in adipocytes has not susceptibility to S. aureus survival was seen in mice treated with RA been identified (19, 20). Our studies have shown that an increase in by manual CFU counting of live bacteria (Fig. 3E) or as detected by Camp gene expression then results in a significant upregulation of IVIS analysis of a reporter strain of S. aureus (Fig. 3F). the CRAMP preprotein, yet the increase in antimicrobial activity was modest in comparison with the change in protein abundance. Transcriptomic response of preadipocytes to RA identifies Whether this was indicative of a saturation of the system or mod- HIF1a as mediator of antimicrobial response ulation of CRAMP processing from inactive precursor protein to To gain further insight into the mechanism through which pre- active peptide is unclear. We hypothesize that the contribution adipocytes increase Camp in response to RA, we performed RNA of other cells in vivo during the complex response of reactive The Journal of Immunology 1593 Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 2. RA enhances adipogenic innate immune response in vitro. (A) Western blot analysis of concentrated 3T3-L1 cell supernatants treated with 1 mM RA or vehicle (ethanol). (B) Immunoﬂuorescence analysis of CRAMP expression (red) in cultured 3T3-L1 cells treated with 1 mM RA or vehicle. Nuclei are counterstained with DAPI. Scale bar, 10 mm. (C) Human preadipocytes were differentiated for 16 d in the presence of 1 mM9-cis RA (9-CRA) and/or 10 nM 1a,25-dihydroxyvitamin D3 (vitamin D) or vehicle control, and CAMP mRNA expression was assayed. (D) Differentiating 3T3-L1 preadipocytes, human keratinocytes, and human sebocytes were treated with 1 or 5 mM RA for 5 d, and CAMP mRNA expression was measured relative to TBP. All data are mean 6 SD. **p , 0.01, ***p , 0.001 using a Student paired t test. adipogenesis may contribute to the maturation of the cathelicidin in an expansion of dermal WAT (20, 27, 40). Interestingly, RA precursor that is enhanced by retinoids in preadipocytes. treatment attenuated the dermal WAT expansion associated with Excess vitamin A results in epidermal hyperplasia and a re- S. aureus infection, yet Camp was still signiﬁcantly upregulated in duction in white adipose tissue (WAT), whereas infection results comparison with the individual stimuli. RA improved the capacity 1594 RETINOIDS INDUCE ANTIMICROBIALS IN ADIPOGENESIS Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 3. RA modulates reactive adipogenesis. (A) Supernatants from differentiated and undifferentiated dermal fibroblasts were grown in the presence of USA300 for 12 h, and CFU counts were determined. (B–D) SKH-1 wild-type mice (∼8 wk old) were distally intradermally infected with S. aureus on day 0 and simultaneously treated s.c. with RA or olive oil (control) for 3 d (n = 4 per group). (B) Representative H&E histology of skin on day 3 of infection. Scale bar, 100 mm. (C) Lipid droplet staining of frozen sections. Scale bar, 100 mm. (D) Skin lesions were collected, and gene expression was analyzed by qPCR for Camp expression. (E and F) SKH-1 wild-type mice were distally intradermally infected with S. aureus or bioluminescent S. aureus as on day 0 and treated s.c. with RA or olive oil (control) for 3 d (day 0, 1, and 2). (E) Measurement of bacterial CFU from skin lesion of the infected area on day 3 (n = 8). (F) Representative day 3 images of vehicle- (top) and RA-treated (bottom) mice and quantification of fluorescence in region of interest (ROI) of skin from images taken by IVIS on days 1, 3, and 6 (n = 3 or 4). All data are mean 6 SD. **p , 0.01, ***p , 0.001 using a Student paired t test. of differentiating preadipocytes to inhibit S. aureus. However, suggests that the immunomodulatory role of RA in the skin is despite these observations that RA was active in vivo and induced complex and may be dependent on dose, timing, or target or- antimicrobial activity in vitro, there was no clear increase in the ganism. Additional work is needed to define the physiological antimicrobial activity in vivo of mouse skin against S. aureus. This significance of retinoid exposure on innate immune defense. The Journal of Immunology 1595 Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 4. RA and HIF1a coordinate to enhance innate immune defense. Transcriptomic comparisons of genes (A) upregulated or (B) downregulated in 3T3-L1 cells differentiated and/or treated with RA for 24 h. (C) Heat map clustering of adipogenic-related genes and hypoxia response genes. (D) SKH-1 wild-type mice (∼8 wk old) were distally intradermally infected with S. aureus on day 0 and simultaneously treated s.c. with RA or olive oil (control) for 3 d (n = 4 per group). Skin lesions were collected, and gene expression was analyzed by qPCR. (E and F) 3T3-L1 cells were differentiated for 24 h in the presence of RA supplemented with an HIF1a agonist (400 mM L-mimosine) or antagonist (5 mM acriﬂavine) along with appropriate controls, and mRNA expression of (E) Camp or (F) Hif1a was determined by qPCR. mRNA expression of (E) Camp or (F) Hif1a was determined by qPCR. **p , 0.01, ***p , 0.001, ****p , 0.0001.

To gain further insight and understand the complexity of analysis identified HIF1a as a potential regulator of Camp ex- RA-mediated regulation, we examined the transcriptomic response pression. The human CAMP promoter possesses an HIF1a re- to RA in the context of differentiating preadipocytes. RNA-seq sponse element and has been implicated in cutaneous immune 1596 RETINOIDS INDUCE ANTIMICROBIALS IN ADIPOGENESIS defense as well as CRAMP expression in the colon (41). The 4. Paterson, E. K., H. Ho, R. Kapadia, and A. K. Ganesan. 2013. 9-cis retinoic acid Hif1a is the ALDH1A1 product that stimulates melanogenesis. Exp. Dermatol. 22: promoter possesses an RA response element (42), and RA 202–209. has been reported to enhance HIF1a expression under normoxic 5. Morizane, S., K. Yamasaki, F. D. Kabigting, and R. L. Gallo. 2010. Kallikrein conditions (42–44). These past observations are in agreement expression and cathelicidin processing are independently controlled in keratinocytes by calcium, vitamin D(3), and retinoic acid. J. Invest. Dermatol. 130: with our RNA-seq and qPCR data in which we found that RA 1297–1306. induced elevated Hif1a. Similarly, activation of HIF1a by the iron 6. Kligman, L. H. 1986. Effects of all-trans-retinoic acid on the dermis of hairless chelator L-mimosine mimicked the effects of RA on Camp expres- mice. J. Am. Acad. Dermatol. 15: 779–785, 884–887. 7. Hunt, T. K. 1986. Vitamin A and wound healing. J. Am. Acad. Dermatol. 15: sion. The combinatorial effect of both activation and increased Hif1a 817–821. expression exhibited a significant additive effect, thus providing 8. Kitano, Y., K. Yoshimura, G. Uchida, K. Sato, and K. Harii. 2001. Pretreatment further evidence that HIF1a and RA work in concert to promote with topical all-trans-retinoic acid is beneficial for wound healing in genetically diabetic mice. Arch. Dermatol. Res. 293: 515–521. Camp expression. Interestingly, HIF1a inhibition abolished Camp 9. Chivot, M. 2005. Retinoid therapy for acne. A comparative review. Am. J. Clin. expression under all conditions. This may suggest Camp transcription Dermatol. 6: 13–19. a a 10. Kafi, R., H. S. Kwak, W. E. Schumacher, S. Cho, V. N. Hanft, T. A. Hamilton, is entirely dependent on HIF1 or that the global effects of HIF1 A. L. King, J. D. Neal, J. Varani, G. J. Fisher, et al. 2007. Improvement of further attenuate other mechanisms involved in the expression of naturally aged skin with vitamin A (retinol). Arch. Dermatol. 143: 606–612. Camp. Support for this comes from observations that HIF1a inhi- 11. Mukherjee, S., A. Date, V. Patravale, H. C. Korting, A. Roeder, and G. Weindl. 2006. Retinoids in the treatment of skin aging: an overview of clinical efficacy bition also downregulates Cebpb transcription and inhibits initiation and safety. Clin. Interv. Aging 1: 327–348. of adipogenesis (45). Inhibition by acriflavine similarly downregu- 12. Roeder, A., M. Schaller, M. Scha¨fer-Korting, and H. C. Korting. 2004. Tazar- lated Cebpb expression, whereas L-mimosine downregulated Cebpa, otene: therapeutic strategies in the treatment of psoriasis, acne and photoaging. Skin Pharmacol. Physiol. 17: 111–118. the latter of which has also been proposed to regulate CAMP 13. Hoegler, K. M., A. M. John, M. Z. Handler, and R. A. Schwartz. 2018. Gen- Downloaded from expression. Taken together, this could suggest that C/EBPb indi- eralized pustular psoriasis: a review and update on treatment. J. Eur. Acad. rectly regulates Camp expression; however, our data do not define Dermatol. Venereol. 32: 1645–1651. 14. Peche`re, M., L. Germanier, G. Siegenthaler, J. C. Peche`re, and J. H. Saurat. if either C/EBPb or C/EBPa directly regulates this process. 2002. The antibacterial activity of topical retinoids: the case of retinaldehyde. Induction of adipogenesis is mediated by C/EBPb, which in turn Dermatology (Basel) 205: 153–158. a 15. Kim, W., W. Zhu, G. L. Hendricks, D. Van Tyne, A. D. Steele, C. E. Keohane, mediates the expression of the preadipogenic factors C/EBP and N. Fricke, A. L. Conery, S. Shen, W. Pan, et al. 2018. A new class of synthetic

PPARg (46, 47). Although RA does not inhibit the expression of retinoid antibiotics effective against bacterial persisters. Nature 556: 103–107. http://www.jimmunol.org/ C/EBPb, it has been shown to inhibit its function (22). Our ob- 16. Wheelwright, M., E. W. Kim, M. S. Inkeles, A. De Leon, M. Pellegrini, S. R. Krutzik, and P. T. Liu. 2014. All-trans retinoic acid-triggered antimicrobial servations have shown that initiation of differentiation, yet not final activity against Mycobacterium tuberculosis is dependent on NPC2. J. Immunol. maturation of adipocytes, is sufficient and necessary to enhance Camp 192: 2280–2290. expression by retinoids. However, there appears to be a limited time- 17. le Maire, A., S. Alvarez, P. Shankaranarayanan, A. R. Lera, W. Bourguet, and H. Gronemeyer. 2012. Retinoid receptors and therapeutic applications of RAR/ frame during which this effect can be observed, as the potency of RXR modulators. Curr. Top. Med. Chem. 12: 505–527. retinoid stimulation was markedly reduced when treatment was initi- 18. Hammerschmidt, S. I., M. Friedrichsen, J. Boelter, M. Lyszkiewicz, E. Kremmer, ated at later timepoints during differentiation. This suggests that access O. Pabst, and R. Fo¨rster. 2011. Retinoic acid induces homing of protective T and B cells to the gut after subcutaneous immunization in mice. J. Clin. Invest. 121: to the Camp promoter is limited during adipogenesis; such a limited 3051–3061. access period may partially explain why acute, high-dose RA admin- 19. Zhang, L. J., S. X. Chen, C. F. Guerrero-Juarez, F. Li, Y. Tong, Y. Liang, by guest on September 25, 2021 istration to mice did not improve resistance to S. aureus infection. M. Liggins, X. Chen, H. Chen, M. Li, et al. 2019. Age-related loss of innate immune antimicrobial function of dermal fat is mediated by transforming growth Under these conditions, initiation of adipogenesis is also inhibited and factor beta. Immunity 50: 121–136.e5. may counteract the beneficial host defense function of RA that we have 20. Zhang, L. J., C. F. Guerrero-Juarez, T. Hata, S. P. Bapat, R. Ramos, M. V. Plikus, and R. L. Gallo. 2015. Innate immunity. Dermal adipocytes protect against in- observed in vitro. Analysis of low-dose vitamin A exposure, as well as vasive Staphylococcus aureus skin infection. Science 347: 67–71. correlation of responses in human subjects on RA therapy, is needed. 21. Dokoshi, T., L. J. Zhang, T. Nakatsuji, C. A. Adase, J. A. Sanford, R. D. Paladini, In summary, these observations have revealed a novel disassociation H. Tanaka, M. Fujiya, and R. L. Gallo. 2018. Hyaluronidase inhibits reactive adipogenesis and inflammation of colon and skin. JCI Insight 3: e123072. between adipogenesis and the process through which fibroblasts in 22. Schwarz, E. J., M. J. Reginato, D. Shao, S. L. Krakow, and M. A. Lazar. 1997. the dermis that become adipocytes can produce cathelicidin. Reactive Retinoic acid blocks adipogenesis by inhibiting C/EBPbeta-mediated transcrip- adipogenesis is a recently discovered and important physiological tion. Mol. Cell. Biol. 17: 1552–1561. 23. Berry, D. C., D. DeSantis, H. Soltanian, C. M. Croniger, and N. Noy. 2012. response to infection of skin and gut (19–21, 48). These findings Retinoic acid upregulates preadipocyte genes to block adipogenesis and suppress provide further insight into how Camp is regulated in adipocytes, diet-induced obesity. Diabetes 61: 1112–1121. a mechanism with important therapeutic implications. 24. Ziouzenkova, O., G. Orasanu, M. Sharlach, T. E. Akiyama, J. P. Berger, J. Viereck, J. A. Hamilton, G. Tang, G. G. Dolnikowski, S. Vogel, et al. 2007. Retinaldehyde represses adipogenesis and diet-induced obesity. Nat. Med. 13: 695–702. Acknowledgments 25. Garcia, E., D. Lacasa, B. Agli, Y. Giudicelli, and D. Castelli. 2000. Antiadipogenic properties of retinol in primary cultured differentiating human adipocyte precursor We thank members of the Gallo Laboratory for helpful advice pertaining to cells. Int. J. Cosmet. Sci. 22: 95–103. experimental procedures and design. We also thank Dr. Patrick M. Schliever 26. Sagara, C., K. Takahashi, H. Kagechika, and N. Takahashi. 2013. Molecular (Carver College of Medicine, Iowa City, IA) for the immortalized human mechanism of 9-cis-retinoic acid inhibition of adipogenesis in 3T3-L1 cells. Biochem. Biophys. Res. Commun. 433: 102–107. adipocyte cell line. 27. Bonet, M. L., J. A. Canas, J. Ribot, and A. Palou. 2015. Carotenoids and their conversion products in the control of adipocyte function, adiposity and obesity. Disclosures Arch. Biochem. Biophys. 572: 112–125. 28. Dorschner, R. A., V. K. Pestonjamasp, S. Tamakuwala, T. Ohtake, J. Rudisill, R.L.G. is a co-founder, scientific advisor, consultant and has equity in MatriSys V. Nizet, B. Agerberth, G. H. Gudmundsson, and R. L. Gallo. 2001. Cutaneous Biosciences and is a consultant, receives income, and has equity in Sente. The injury induces the release of cathelicidin anti-microbial peptides active against other authors have no financial conflicts of interest. group A Streptococcus. J. Invest. Dermatol. 117: 91–97. 29. Vu, B. G., F. A. Gourronc, D. A. Bernlohr, P. M. Schlievert, and A. J. Klingelhutz. 2013. Staphylococcal superantigens stimulate immortalized human adipocytes to produce chemokines. PLoS One 8: e77988. References 30. Sanford, J. A., L. J. Zhang, M. R. Williams, J. A. Gangoiti, C. M. Huang, and 1. Morriss-Kay, G. M. 1999. Treatment of mice with retinoids in vivo and in vitro. R. L. Gallo. 2016. Inhibition of HDAC8 and HDAC9 by microbial short-chain Skeletal staining. Methods Mol. Biol. 97: 33–39. fatty acids breaks immune tolerance of the epidermis to TLR ligands. Sci. Immunol. 2. Kane, M. A., and J. L. Napoli. 2010. Quantification of endogenous retinoids. 1: eaah4609. Methods Mol. Biol. 652: 1–54. 31. Oliveros, J. C. 2007.Venny. An interactive tool for comparing lists with 3. Gendimenico, G. J., and J. A. Mezick. 1993. Pharmacological effects of retinoids Venn’s diagrams. Available at: http://bioinfogp.cnb.csic.es/tools/venny/. Accessed: on skin cells. Skin Pharmacol. 6(Suppl. 1): 24–34. June 25, 2018. The Journal of Immunology 1597

32. O’Byrne, S. M., and W. S. Blaner. 2013. Retinol and retinyl esters: biochemistry activation via specific induction of its ligands heparin-binding EGF and and physiology. J. Lipid Res. 54: 1731–1743. amphiregulin in human skin in vivo. J. Invest. Dermatol. 126: 732–739. 33. Bonet, M. L., J. A. Canas, J. Ribot, and A. Palou. 2016. Carotenoids in adipose 41. Elloumi, H. Z., and S. M. Holland. 2008. Complex regulation of human cath- tissue biology and obesity. Subcell. Biochem. 79: 377–414. elicidin gene expression: novel splice variants and 5’UTR negative regulatory 34. Wang,T.T.,F.P.Nestel,V.Bourdeau,Y. Nagai, Q. Wang, J. Liao, L. Tavera-Mendoza, element. Mol. Immunol. 45: 204–217. R. Lin, J. W. Hanrahan, S. Mader, and J. H. White. 2004. Cutting edge: 1,25- 42. Fernańdez-Martıńez, A. B., M. I. Jimeńez, I. S. Hernańdez, M. L. Garcıá-Bermejo, dihydroxyvitamin D3 is a direct inducer of antimicrobial peptide gene ex- V. M. Manzano, E. A. Fraile, and F. J. de Lucio-Cazanã. 2011. Mutual regulation pression. [Published erratum appears in 2004 J. Immunol. 173: following 6489.] of hypoxic and retinoic acid related signalling in tubular proximal cells. Int. J. J. Immunol. 173: 2909–2912. Biochem. Cell Biol. 43: 1198–1207. 35. Gombart, A. F. 2009. The vitamin D-antimicrobial peptide pathway and its role 43. Liang, C., S. Guo, and L. Yang. 2014. Effects of all-trans retinoic acid on VEGF in protection against infection. Future Microbiol. 4: 1151–1165. and HIF-1a expression in glioma cells under normoxia and hypoxia and its 36. Schauber, J., R. A. Dorschner, K. Yamasaki, B. Brouha, and R. L. Gallo. 2006. anti-angiogenic effect in an intracerebral glioma model. Mol. Med. Rep. 10: 2713–2719. Control of the innate epithelial antimicrobial response is cell-type specific and 44. Fernańdez-Martıńez, A. B., M. I. Arenas Jimeńez, and F. J. Lucio Cazanã. 2012. dependent on relevant microenvironmental stimuli. Immunology 118: 509–519. Retinoic acid increases hypoxia-inducible factor-1a through intracrine prosta- 37. Babina, M., S. Guhl, E. Motakis, M. Artuc, T. Hazzan, M. Worm, A. R. Forrest, glandin E(2) signaling in human renal proximal tubular cells HK-2. Biochim. and T. Zuberbier. 2015. Retinoic acid potentiates inflammatory cytokines in Biophys. Acta 1821: 672–683. human mast cells: identification of mast cells as prominent constituents of the 45. Yamaguchi,J.,T.Tanaka,H.Saito,S.Nomura,H.Aburatani,H.Waki,T.Kadowaki, skin retinoid network. Mol. Cell. Endocrinol. 406: 49–59. and M. Nangaku. 2017. Echinomycin inhibits adipogenesis in 3T3-L1 cells in a 38. Tsukada, M., M. Schro¨der, T. C. Roos, R. A. Chandraratna, U. Reichert, HIF-independent manner. Sci. Rep. 7: 6516. H. F. Merk, C. E. Orfanos, and C. C. Zouboulis. 2000. 13-cis retinoic acid 46. Lefterova, M. I., A. K. Haakonsson, M. A. Lazar, and S. Mandrup. 2014. PPARg exerts its specific activity on human sebocytes through selective intracellular and the global map of adipogenesis and beyond. Trends Endocrinol. Metab. 25: isomerization to all-trans retinoic acid and binding to retinoid acid receptors. 293–302. J. Invest. Dermatol. 115: 321–327. 47. Darlington, G. J., S. E. Ross, and O. A. MacDougald. 1998. The role of C/EBP 39. Oliveira, L. M., F. M. E. Teixeira, and M. N. Sato. 2018. Impact of retinoic acid genes in adipocyte differentiation. J. Biol. Chem. 273: 30057–30060. on immune cells and inflammatory diseases. Mediators Inflamm. 2018: 3067126. 48. Chen, S. X., L. J. Zhang, and R. L. Gallo. 2019. Dermal white adipose Downloaded from 40. Rittie´, L., J. Varani, S. Kang, J. J. Voorhees, and G. J. Fisher. 2006. Retinoid- tissue: a newly recognized layer of skin innate defense. J. Invest. Dermatol. induced epidermal hyperplasia is mediated by epidermal growth factor receptor 139: 1002–1009. http://www.jimmunol.org/ by guest on September 25, 2021 Supplemental Table 1

Gene Strand Sequence 5’ to 3’ Animal Forward CAC ACC AGG CCG TGA TGG CA Mouse Adipoq Reverse GAA GCC CCG TGG CCC TTC AG Mouse Forward CAA GGA ACA GGG GGT GG Mouse Camp Reverse TCC GGC TGA GGT ACA AGT TT Mouse Forward AGG TCC TCA GCT ACA AGG AAG Human CAMP Reverse TCT TGA AGT CAC AAT CCT CTG GT Human Forward CAAGAACAGCAACGAGTACCG Mouse Cebpa Reverse GTCACTGGTCAACTCCAGCAC Mouse Forward CAAGAGCCGCGACAAGGCCA Mouse Cebpb Reverse CTCGCGACAGCTGCTCCACC Mouse Forward CACAGTTGCCGGCTGGAGCA Mouse Ccl2 Reverse CAGCAGGTGAGTGGGGCGTT Mouse Forward GCTGCTTTGCCTACCTCTCC Mouse Ccl5 Reverse TCGAGTGACAAACACGACTGC Mouse Forward AGAAGTCATAGCCACTCTCAAGGGC Mouse Cxcl2 Reverse AGCAGCCCAGGCTCCTCCTTT Mouse Forward TGGAGACCCAGAAGGCTCTTCTCTT Mouse Defa3 Reverse TCTGCAGGTCCCATTCATGCGT Mouse Forward TGGAGGCCAAGAAGGGTCTGCT Mouse Defa5 Reverse ACGCGTTCTCTTCTTTTGCAGCC Mouse Forward TGGAGACCCAGAAGGCTCTTCTCTT Mouse Defa17 Reverse TCTGCAGGTCCCATTCATGCGT Mouse Forward CCAGATGGAGCCAGGTGTTGGC Mouse Defb1 Reverse ATGGGCAGCTGGAGCGGAGA Mouse Forward TGCTGCTGATATGCTGCCTCCT Mouse Defb2 Reverse TCCCAGGACGCCTGGCAGAA Mouse Forward GGTGCTGCTGTCTCCACCTGC Mouse Defb3 Reverse TGCACCGATTCCAGCATCTGCC Mouse Forward TGGTGCTGCTGTCTCCACTTGC Mouse Defb4 Reverse AGGGCACGGACCCCAGCATA Mouse Forward TGGTGCCTGCTCCAGGGGAC Mouse Defb14 Reverse CAGCACACCGGCCACCTCTT Mouse Forward GTG GGA GTG GGC TTT GCC ACA Mouse Fabp4 Reverse CAC CAG GGC CCC GCC ATC TA Mouse Forward CGCCTCTGGACTTGTCTCTT Mouse Hif1a Reverse TCGACGTTCAGAACTCATCCT Mouse Forward AAATGAGCTCCCAATGTCGG Human HIF1A Reverse TGGCTGCATCTCGAGACTTTT Human Forward CGAAGACTACAGTTCTGCCATT Mouse Il1a Reverse GACGTTTCAGAGGTTCTCAGAG Mouse Forward GAAATGCCACCTTTTGACAGTG Mouse Il1b Reverse TGGATGCTCTCATCAGGACAG Mouse Forward ACAAAGCCAGAGTCCTTCAGAGAGA Mouse Il6 Reverse AGCCACTCCTTCTGTGACTCCAG Mouse Forward TCT CCT CCA GAG GGA AGT TGG Mouse Rstn Reverse TTT CTT CAC GAA TGT CCC ACG Mouse Forward CCT TGT ACC CTT CAC CAA TGA C Mouse Tbp Reverse ACA GCC AAG ATT CAC GGT AGA Mouse Forward CCCGAAACGCCGAATATAATCC Human TBP Reverse AATCAGTGCCGTGGTTCGTG Human Forward ACTTCGGGGTGATCGGTCCCC Mouse Tnfa Reverse TGGTTTGCTACGACGTGGGCTAC Mouse Forward TGAAGCCCTGGAGTGCGT Mouse Vegfa Reverse AGGTTTGATCCGCATGATCTG Mouse

Supplemental Figure 1. (A) 3T3-L1 preadipocytes were differentiated for 24 hours in the presence of 1 µM RA, 100 nM AM580 (RARα agonist), 1 µM tazarotene (RARβ/γ agonist) or vehicle (ethanol) control and relative mRNA expression of Camp. (B) 3T3-L1 mRNA expression of α-defensins, β-defensins, and Camp in cells treated with RA. All data are mean ± S.D.

Supplemental Figure 2. (A) Western blot analysis of 3T3-L1 or MSFB cell supernatants treated with 1 µM retinoic acid (RA) or vehicle (ethanol). (B) 3T3-L1 cells were differentiated for 24 hours in the presence of RA and mRNA expression was assayed for indicated genes. All data are mean ± S.D.

Supplemental Figure 3. (A) Gene ontology analysis of gene sets upregulated in 3T3-L1 cells differentiated for 24 hrs. in the presence of RA. (B) Human preadipocytes were differentiated for 16 days in presence of 1 µM 9- cis retinoic acid (9-CRA) and/or 10 nM 1α,25-Dihydroxyvitamin D3 (Vitamin D) or vehicle control and HIF1A mRNA expression was assayed. (C) 3T3-L1 cells were differentiated for 24 hours in the presence of RA supplemented with a HIF1α agonist (400 µM L-mimosine) or antagonist (5 µM acryflavine) along with appropriate controls and mRNA expression of Vegfa. (D-E) 3T3-L1 cells differentiated and/or treated with 100 ng/ml MALP-2 for 24 hrs in the presence of the HIF1α antagonist (5 µM acryflavine) along with appropriate controls and mRNA expression of (D) Camp or (E) Hif1a was determined by qPCR. and mRNA expression of (E) Camp or (F) Hif1a was determined by qPCR.