Axenfeld-Rieger Anomaly a Novel Mutation in the Forkhead Box C1 (FOXC1) Gene in a 4-Generation Family

OPHTHALMIC MOLECULAR GENETICS

SECTION EDITOR: THADDEUS P. DRYJA, MD; LESLIE HYMAN, PhD Axenfeld-Rieger Anomaly A Novel Mutation in the Forkhead Box C1 (FOXC1) Gene in a 4-Generation Family

Bruno Mortemousque, MD, PhD; Patrizia Amati-Bonneau, MD; Franc¸ois Couture, MSc; Rodolphe Graffan, MD; Ste´phane Dubois, BSc; Joseph Colin, MD; Dominique Bonneau, MD; Jean Morissette, MSc; Didier Lacombe, MD; Vincent Raymond, MD, PhD

Objective: To characterize DNA mutations in a pedi- mapped at this locus, FOXC1, was screened for muta- gree of Axenfeld-Rieger anomaly (ARA) (Online Men- tions in cases and controls. delian Inheritance of Man 601631), a clinically and genetically heterogeneous, autosomal dominantly inherited Main Outcome Measure: Linkage of the ARA phe- disorder associated with anterior chamber abnormali- notype at the 6p25 locus and mutation detected in FOXC1. ties and glaucoma. Results: Direct sequencing of FOXC1 detected a new mu- Design: Observational case-control and DNA linkage and tation, T272C, that segregated with the ARA phenotype screening studies. in this family and was not detected in DNA from family members without ARA. This mutation, a T→C transi- Participants: Affected (10 cases) and unaffected (5 con- tion, is predicted to result in a change of isoleucine to trols) members of a family with ARA. threonine (Ile9lThr) in a highly conserved location within the first helix of the forkhead domain. Methods: Clinical characteristics of ARA were docu- mented by history or physicial examination of symptom- Conclusion: Characterization of the FOXC1 mutation atic individuals. With their informed consent, a blood in family members with ARA furthers our understand- sample was collected from each of 10 affected and 5 un- ing of the molecular origin of developmental glaucoma affected family members. DNA was tested for linkage to and other anterior segment disorders. the IRID1 locus at chromosome 6p25, a known locus for ARA/Rieger syndrome. A candidate gene previously Arch Ophthalmol. 2004;122:1527-1533

From the Service XENFELD-RIEGER ANOMALY Axenfeld-Rieger anomaly is geneti- d’Ophtalmologie (Drs Mortemousque, Graffan, (ARA); (Online Mende- cally as well as clinically heterogeneous. and Colin), and Service de lian Inheritance of Man Many chromosomal aberrations involv- Geńe´tique (Dr Lacombe), 601631) is a clinically and ing chromosomes 4, 6, 9, 13, 18, and 21 Centre Hospitalier genetically heterog- have been identified in patients affected et Universitaire Bordeaux, eneousA disorder with an autosomal domi- with ARA,8 and linkage studies have iden- Bordeaux, France; Laboratoire nant mode of transmission. Clinically, ARA tified at least 3 loci for the abnormalities de Biochimie et Biologie is characterized by iris stromal hypopla- in ARA. The first locus, at chromosome Molećulaire sia, prominent Schwalbe line, adhesion be- 4q25, which displayed the ARA pheno- (Dr Amati-Bonneau) and tween the iris and Schwalbe line, micro- type, was mapped in 1992 by Murray et Service de Geńe´tique Me´dicale 9 (Dr Bonneau), Centre cornea, corneal opacity, and increased al and named RIEG1. Subsequently, the Hospitalier et Universitaire intraocular pressure (IOP) that leads to RIEG1 abnormality was identified as a mu- 1-4 d’Angers, Angers, France; glaucoma in about half of the cases. tation in the PITX2 gene in a patient with Endocrinologie Molećulaire When nonocular clinical features are pre- RS.10 PITX2 is a bicoid homeobox gene that et Oncologique, Centre de sent, the disorder is named Rieger syn- is expressed in the anterior structures of Recherche du Centre drome (RS). In addition to the anterior seg- the eye and regulates the expression of Hospitalier de l’Universite´ ment anomalies just described, patients other genes during embryonic develop- Laval, Que´bec, Que´bec with RS often have maxillary hypoplasia, ment. To date, 9 mutations of the PITX2 (Mssrs Couture and Morissette, dental anomalies,5,6 umbilical hernia,7 gene have been reported,11 all resulting in Ms Dubois, and Dr Raymond). and/or hypospadias. More rarely, they may various anterior segment disorders such Drs Mortemouseque and 10 12 Raymond contributed equally to have hydrocephalus, hearing loss, car- as RS, iris hypoplasia, iridogoniodys- 13 the work. The authors have no diac and kidney abnormalities, and con- genesis syndrome type 2, and Peters relevant financial interest in genital hip dislocation in addition to ocu- anomaly (or anterior chamber cleavage this article. lar abnormalities. syndrome).14

(REPRINTED) ARCH OPHTHALMOL / VOL 122, OCT 2004 WWW.ARCHOPHTHALMOL.COM 1527

Mutations Change Disorders Localization Source 22-bp INS INS 26-47 Axenfeld anomaly 5Ј of the forkhead domain Nishimura et al19 Glu23Ter C67T ARA, variable degree of iris hypoplasia, displaced pupils 5Ј of the forkhead domain Mirzayans et al20 (corectopia), and posterior embryotoxon 10-bp DEL DEL 93-102 ARA and glaucoma 5Ј of the forkhead domain Mears et al16 10-bp DEL DEL 99-108 Axenfeld anomaly 5Ј of the forkhead domain Nishimura et al19 8-bp DEL DEL 116-123 Rieger anomaly 5Ј of the forkhead domain Nishimura et al19 11-bp DEL DEL 153-163 Rieger anomaly, iris hypoplasia, and glaucoma 5Ј of the forkhead domain Nishimura et al17 Pro79Leu C236T Rieger anomaly Into the forkhead domain, 5Ј of helix 1 Nishimura et al19 Ser82Thr G245C Anterior segment dysgenesis and glaucoma Into the forkhead domain, 5Ј of helix 1 Mears et al16 Ile87Met C261G ARA and glaucoma Helix 1 of the forkhead domain Mears et al16 1-bp INS INS 262 ARA Helix 1 of the forkhead domain Nishimura et al19 Ile91Thr T272C ARA Helix 1 of the forkhead domain Present study Phe112Ser T335C Spectrum of anterior segments defects Into the forkhead domain, 5Ј of helix 3 Nishimura et al17 Ile126Met C378G Axenfeld anomaly and glaucoma Helix 3 of the forkhead domain Nishimura et al17 SER131Leu C392T Rieger anomaly and glaucoma Helix 3 of the forkhead domain Nishimura et al7,19 1-bp DEL DEL 1512 Axenfeld anomaly 3Ј of the forkhead domain Nishimura et al19

Abbreviations: ARA, Axenfeld-Rieger anomaly; bp, base pair; DEL, deletion; Glu, glutamic acid; Ile, isoleucine; INS, insertion; Leu, leucine; Met, methionine; Phe, phenylalanine; Pro, proline; Ser, serine; Ter, terpin; Thr, threonine.

A second locus, for the RS phenotype labeled RIEG2 analysis, a 20-mL sample of blood was collected in an EDTA- (Online Mendelian Inheritance of Man 601499), was coated tube from each family member who was available for test- linked at chromosome 13q14 by Phillips et al15 in 1996 ing and who gave informed consent. DNA was isolated and ana- using a large 4-generation family.The gene responsible lyzed using standard techniques, as follows. Oligonucleotide for RS at this locus has not yet been identified. primers were obtained from the Centre de Recherches du Cen- tre Hospitalier et Universitaire Laval (CHUL), Quebec, Quebec. A third locus for ARA has been mapped to chromo- 16 some 6p25 at the IRID1 locus. Subsequently, muta- DNA SEGMENT ISOLATION, AMPLIFICATION, tions in the forkhead box C1 (FOXC1) gene were iden- AND GENOTYPING tified in some patients with ARA by Mears et al16 and 17 Nishimura et al. FOXC1 (previously called FKHL7 or Six (CA)n microsatellite markers, including 4 markers (Ge´ne´- FREAC3) is a member of the forkhead winged/helix tran- thon, Paris, France), identified by Dib et al22—AFMa350zc9 scription-factor family and is a monomeric DNA- at D6S1600, AFM092xb7 at D6S344, AFM205xh4m at D6S1617, binding protein consisting of 553 amino acids that is en- and AFM088yh3 at D6S1685, and 2 new markers, AM01 and CA43, developed by searching the Human Genome Working Draft coded by a single exon of 1659 base pair. More than 100 sequence for (CA)n and (TG)n repeats—were tested for linkage proteins encoding this evolutionarily conserved do- at 6p25. main have been identified so far in species ranging from 18 yeast to man. Including the present study, 15 muta- Ge´ne´thon Markers tions of the FOXC1 gene have been reported to date, all resulting in a variety of anterior segment disorders Polymerase chain reaction (PCR) amplification was per- (Table 1).16,17,19,20 One article published in 2001 de- formed with 100-ng DNA to which was added 200nM each of primer; 200µM each of [␣-33P]-deoxyadenosine triphosphate scribed a chromosomal duplication involving 6p25 in 2 ␣ 33 Ј Ј 19 ([ - P] (dATP), 2 -deoxycytidine-5 -triphosphate (dCTP), de- families. In both families, the duplicated region con- oxyguanosine triphosphate (dGTP), and deoxythymidine tri- tained FOXC1, FOXF2, and FOXQ1, previously known phosphates (dTTP); 1ϫPCR buffer: 10mM Tris (hydroxy- 19 as HFH1, all of which are genes of the forkhead family. methyl) aminomethane (pH 9.0 at room temperature); 50mM Moreover, a chromosomal duplication involving the 6p25 potassium chloride; 1.5mM magnesium chloride; 0.1% Triton region, including FOXC1, has been reported in a large X-100; and 0.001% gelatin in water to achieve a total sample pedigree with iris hypoplasia and glaucoma.21 We stud- volume of 40 µL. Each reaction was overlaid with 25 µL of light ied the clinical characteristics of ARA, tested linkage at mineral oil to prevent evaporation. 6p25, and screened for mutations the FOXC1 gene in an Polymerase chain reaction specificity was increased by in- 18-month-old girl with ARA we have followed up since cluding a “hot-start” step in which samples were denatured for birth and in members of 4 generations of the proband’s 5 minutes at 95°C. After the hot-start step, l U of Thermus aquaticus DNA polymerase in 1ϫPCR buffer was added to achieve a family. final PCR sample volume of 50 µL. Each sample was put through 35 cycles of denaturing at 95°C for 30 seconds, annealing at METHODS 55°C for 30 seconds, and extending at 72°C for 30 seconds. Polymerase chain reaction products were separated on 6% PATIENT MATERIAL denaturing polyacrylamide gels. After electrophoresis, the gel was transferred to a positively charged nylon membrane (Boeh- Clinical evaluations included history, examination of the ante- ringer-Mannheim, Quebec, Canada) and hybridized with a di- rior and posterior chambers (funduscopy), testing of visual acu- goxigenin–11-2Ј,3Ј–dideoxy-uridine-5Ј-triphosphate (DIG-11- ity and the visual fields, and measurement of IOP. For genotype ddUTP) 3Ј end-labeling CA probe, according to the instructions

(REPRINTED) ARCH OPHTHALMOL / VOL 122, OCT 2004 WWW.ARCHOPHTHALMOL.COM 1528

Set Forward Primer Reverse Primer Gene Region PCR Products, bp 1 AGGAGCCAGCCCCAGCGA CGGGTACTGCTCGGCGTG N-terminal 346 2 ATGAGCGTGTACTCGCAC GGAAGCTGCCGTTCTCGAAC Forkhead box 372 3 TGGACCCGGACTCCTACAAC CGCAGCGACGTCATGATGTT 3Ј Region of the forkhead domain 492 4 ACCATAGCCAGGGCTTCAG CAGGTACCACGAGGTGAGG 3Ј Region of the forkhead domain 517 5 CAAGCCATGAGCCTGTACG AGAAGAAACTACGTGTTATCTGG C-terminal 798

Abbreviations: bp, base pair; PCR, polymerase chain reaction. *Temperature was 57° C for all 5 sets.

in the DIG System User’s Guide for filter hybridization (Roche salts–radiolabeled Terminator Thermosequenase Cycle Diagnostic, Basel, Switzerland). The probe was made chemo- Sequencing Kit (Amersham-Pharmacia, Mississauga). Family luminescent with Lumigen PPD (Roche, Montreal, Quebec), members were subsequently analyzed by automated which is the 4-methoxy-4-(3-phosphatephenyl)spiro-(1,2- sequencing using an ABI PRISM 3700 DNA Analyzer dioxetane-3,2Ј-admantane) substrate for alkaline phospha- (Perkin-Elmer Applied Biosystems, Foster City, Calif). Auto- tase, before being exposed to the single emulsion film, Bio- mated sequencing was performed on both strands. Max MR-1 (Eastman Kodak Co, Rochester, NY) that provides maximum resolution and sensitivity for 12 to 24 hours. LINKAGE ANALYSIS

AMO1 and CA43 Markers The PedCheck software program was used to identify genotype incompatibilities in linkage analysis.23 Two-point analy- For the AMO1 (forward, SЈ-CTGGTAAGGAGGGTTGAGG- sis was then performed using the MLINK option of the link- 3Ј; reverse, 5Ј-AGTTCCAATAGTCAACTTGCC-3Ј) and CA43 age package.24 The ARA/RS phenotype was modeled as an (forward, 5Ј-AGGTGGAAACAACTCACG-3Ј; reverse, 5Ј- autosomal dominant trait with penetrance of 90% in persons AGTGTCCACAAGGTGCAT-3Ј) markers, PCR amplification from birth to 110 years old. Phenocopy rate was estimated at was performed with 50 ng of DNA to which was added 200nM 0.001%. Recombination rates were assumed to be equal in male of each primer; 200µM each of dCTP, dGTP, and dTTP; 10µM and female subjects. Because the frequencies of marker alleles of dATP; 1.5 µCi of deoxyadenosine 5Ј[␣-35S]-thiotriphos- in this population are unknown, the frequencies for each marker phate, triethylammonium salt–dATP; and 1ϫPCR buffer to were set at 1/N where N was the number of alleles observed in achieve a total sample volume of 15 mL. Each reaction was over- the pedigree. laid with 25 µL of light mineral oil to prevent evaporation. Polymerase chain reaction specificity was increased through a hot-start step (denaturing for 5 minutes at 95°C) before 1 U RESULTS of T aquaticus DNA polymerase, in 5 mL of 1ϫPCR buffer was added to reach a final volume of 20 µL. As a control for the Based on clinical information, 13 members of this pedi- determination of allele size, the Centre d’Etude du Polymor- gree were considered to have ARA (Table 3). None of phisme Humain, Paris, France, control DNA 134702 se- them displayed nonocular symptoms associated with RS. quence was amplified and loaded on the gel together with the patient’s DNA sequences. DNA analysis was completed for 15 members (10 with and 5 without ARA) (Figure). As depicted on the Fig- SEQUENCING STUDIES ure, segregation of the disorder was clearly autosomal dominant with 5 affected males and 8 symptomatic fe- Betaine (Sigma-Aldrich Co, St Louis, Mo) was used for ampli- males as well as presence of male-to-male transmission. fication of DNA sequences. Oligonucleotide primers used for DNA sequencing were obtained from the Centre de Re- PHENOTYPES cherches du CHUL and from Synovis Life Technologies Inc, St Paul, Minn, and are given in Table 2. In the proband (IV:1), a posterior embryotoxon (PE) was For each analysis, 100-ng DNA was added to a solution visible in the clear zone of each cornea (Table 3) and both containing 200nM each of primer; 200µM each of dATP, dCTP, dGTP, and dTTP; 1ϫPCR buffer (10mM Tris; pH 9.0 at room irises were abnormal (IA in Table 3). On echography, the temperature); 50mM potassium chloride; 1.5mM magnesium axial length measured 20 mm and the corneal diameter chloride; 0.1% Triton X-100; and 0.01% gelatin), and 1.2M be- measured 12 mm in both eyes. The IOP averaged 13 mm taine. The reaction was overlaid with 25 µL of light mineral oil Hg in both eyes and reached maximal values of 26 and and denatured for 5 minutes at 95°C (the hot-start step). Then 27 mm Hg (Table 3). 1UofT aquaticus DNA polymerase, 1ϫPCR buffer, was added The proband’s 27-year-old father (III:4) was seen for a final PCR reaction sample volume of 50 µL. The sample with Rieger-type anomalies. Although his visual acuity was put through 35 cycles of denaturing at 95°C for 40 sec- was 20/20 in both eyes, both eyes had severe PE and cor- onds, annealing at 57°C for 50 seconds, and extending at 72°C ectopia and the iris of the right eye consisted only of a for 50 seconds. temporal atrophic zone. However, there was no polyco- All PCR products were purified using QIAGEN columns (Mississauga, Ontario) (ie, convenient spin-columns ria and the IOP and fundus were normal in both eyes. that provide selective binding for small DNA molecules) The proband’s 24-year-old aunt (III:3) had a mod- prior to sequencing. The mutation described here was first erate PE in each eye but normal IOP. identified by manual sequencing using the dideoxyribo- The proband’s 50-year-old grandfather (II:3) had nucleotide 5Ј-[␣-33P]-triphosphates, triethylammonium first been examined by an ophthalmologist at the age

(REPRINTED) ARCH OPHTHALMOL / VOL 122, OCT 2004 WWW.ARCHOPHTHALMOL.COM 1529

BCVA IOP Max

Individual/Sex RLRLPE ICS IA Exc CO I:1/F 0 0 40 45 DM DM DM + − I:3/F 0 0 DM DM DM DM DM + − II:2/M LP 20/20 24 22 ++++− II:3/M 20/20 20/25 15 15 +++−− II:5/M 20/20 20/20 24 24 −−−−− II:6/F 20/25 LP 30 26 ++−+− II:8/F 20/100 20/50 DM DM + DM DM + − II:9/F LP 20/30 40 25 ++−+− III:1/M 20/20 20/20 17 17 −−−−− III:2/M 20/20 20/20 DM DM −−−−− III:3/F 20/20 20/25 15 15 +++−− III:4/M 20/20 20/20 18 18 +++−− III:7/M 20/20 20/30 21 21 +++−− III:8/M 20/20 20/20 13 12 −−−−− III:9/M 20/20 20/20 12 12 −−−−− III:10/M 20/20 0 20 20 +++−− III:11/F 20/20 20/20 14 13 +++−− IV:1/F 20/400 20/400 26 27 +++−+

Abbreviations: ADA, Axenfeld-Rieger anomaly; BCVA, best-corrected visual acuity; CO, corneal opacities; DM, data missing; Exc, optic disc cupping; IA, iridal abnormalities; ICS, iridocorneal synechiae; IOP max, maximum intraocular pressure (in millimeters of mercury); LP, light perception; PE, posterior embryotoxon; −, absent; +, present.

of 25 years because of progressively decreasing visual Individual III:7 has congenital bilateral glaucoma for acuity over several months. Slitlamp examination at which he underwent surgery at the age of 18 months. His that time revealed severe bilateral temporal PE, ante- visual acuity is 20/20 OD and 20/30 OS. He has bilateral rior synechiae extending over a 200° area, and iris irido-corneal dysgenesis with PE, goniodysgenesis, and atrophy. Funduscopy showed glaucomatous atrophy corectopia aggravated by filtering procedures per- of the optic nerve in the right eye and glaucomatous formed during his childhood. His IOP is being main- papillar excavation in the left eye. Visual field testing tained in the normal range by topical ␤-adrenergic block- showed a Bjerrum scotoma in the left eye and a small ing medication and funduscopy shows no excavation of nasal islet scotoma in the right eye. This individual the papillae. underwent bilateral trabeculectomy in 1973. At the Individuals II:8, II:9, III:10, and III:11 all have clear time of the current study, his visual acuity was 20/20 corneas with PE and goniodysgenesis without glau- OD and 20/25 OS. The right eye had tubular retraction coma. Individuals I:1 and I:3 were dead at the time of and a temporal islet scotoma as well as the nasal islet the study. They both were reported to be blind owing to scotoma present before surgery. Intraocular pressure glaucoma. was 15 mm Hg bilaterally. Individual II:2, a 58-year-old man, has congenital LINKAGE ANALYSIS ARA. He underwent surgery twice (at ages 30 and 42 years) for bilateral glaucoma. His visual acuity is light Examination of 6 microsatellite markers (D6S1600, AMO1, perception OD and 20/20 OS with alteration in the D6S344, CA43, D6S1617, and D6S1685) flanking the visual field. Both eyes have transparent cornea, PE, FOXC1 gene at locus 6p25 showed linkage of this locus corectopia (more pronounced in the right eye), and with ARA in this family. Nine of the 10 affected indi- corneo-iridal adhesions that may be responsible for viduals shared a complete haplotype for markers span- the corectopia. Intraocular pressure remains difficult ning the region when a recombination event occurred be- to control medically, even after 2 operations on each tween markers D6S344 and CA43 in affected individual eye for glaucoma. FR021. A maximum lod score (Zmax) of 2.82 at a re- Individual II:6 is a 45-year-old woman who has combination fraction (␪) of 0.00 was observed with marker been followed up since her childhood for trabeculo- D6S344. With reference to BAC 118B18 of the working irido-corneal dysgenesis with corectopia. She has poly- draft sequence, D6S344 is located approximately 10 kb coria and a history of retinal detachment in the right from FOXC1. D6S1617 also had a positive lod score of eye. The left eye does not have polycoria but does have 2.39 at a ␪ of 0.00. areas of iris atrophy associated with a PE and posterior The maximum lod score of 3.00 required to indi- synechiae of the Rieger type. Her best–corrected visual cate significant linkage was not reached in this study be- acuity is 20/25 OD and light perception OS. Although cause the family size was small and some of the markers IOP reached maxima of 30 and 26 mm Hg, respec- were not very polymorphic. Nevertheless, we judged the tively, it has been normal in both eyes since surgery lod scores to be high enough to look for an ARA- for glaucoma. associated mutation in FOXC1.

(REPRINTED) ARCH OPHTHALMOL / VOL 122, OCT 2004 WWW.ARCHOPHTHALMOL.COM 1530

1 2 3 4 FR003 FR005 FR004 FR010

6 6 6 6 6 - 2 7 1 2 2 1 1 - 2 2 1 2 2 2 1 - 5 5 C T T T C T T T 3 1 3 3 3 - 1 1 2 4 4 4 2 - 2 2 1 1 1 1 1 - - 4

1 2 3 4 5 6 7 8 9 10 FR015 FR006 FR007 FR017 FR008 FR009 FR022 FR011 FR012 FR013

6 - 6 6 6 6 6 3 6 6 6 6 6 6 6 2 6 7 - 6 2 - 1 2 1 1 2 - 2 2 1 2 1 2 1 2 1 2 - 2 7 - 1 2 1 2 3 9 2 2 1 2 9 6 1 5 1 5 - 6 T T C T C T T T T T C T T T C T C T T T 1 - 3 3 3 3 2 - 1 3 3 3 2 1 3 1 3 1 - 1 4 - 2 4 2 4 2 2 4 4 2 4 7 7 2 2 2 2 - 10 1 - 1 1 1 1 3 3 1 1 1 1 1 1 1 - 1 4 - 4

III

1 2 3 4 5 67 89 10 11 FR016 FR018 FR019 FR020 FR023 FR014

6 6 6 6 6 6 1 3 6 6 6 6 2 1 2 1 2 1 2 2 1 2 1 2 7 2 3 1 3 1 5 6 1 6 1 6 T T T C T C T T C T C T 1 3 2 3 2 3 1 2 3 1 3 1 4 4 2 2 2 2 1 8 2 7 2 10 1 1 3 1 3 1 3 1 1 1 1 4

1 FR021 D6S1600 Female 3 6 AM01 Male 2 1 D6S344 Dead 6 1 FOXC1 T C CA43 2 2 D6S1617 8 2 D6S1685 1 3

C T C A T C A C C A T G G C C A C/T C C A G A A C G C C C C G G A

Affected (II:6/FR009)

C T C A T C A C C A T G G C C A T C C A G A A C G C C C C G G A

Wild-Type (II:5/FR008)

Pedigree of the family described in this study. Small black dots represent individuals whose DNA was analyzed.

MUTATION OF THE FOXC1 GENE quencing of FOXC1 showed a T272C alteration in 1 al- ASSOCIATED WITH ARA lele of FOXC1 in both of the affected patients. The association between this mutation and the ARA phenotype The FOXC1 genes of 2 affected and 2 unaffected family was confirmed by the results of automatic sequencing of members were sequenced manually. This direct DNA se- the FOXC1 gene for all 15 family members from whom

(REPRINTED) ARCH OPHTHALMOL / VOL 122, OCT 2004 WWW.ARCHOPHTHALMOL.COM 1531

©2004 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/25/2021 forced by the fact that the DNA sequence near the end of Table 4. Amino Acid Alignments the FOXC1 gene is conserved in man, mouse, rat, Xeno- of Forkhead Domain Proteins* pus species, and chicken, and by in vitro studies showing that the C-terminus of the FOXC1 protein contained an Amino Acid Position in the Forehead Domain Protein activation domain. In addition to missense and frame- Gene Name * shift mutations affecting FOXC1, it seems that underex- h FOXC1 82-SYIALITMA I QNAPDKKIT-100 pression or overexpression (as with duplication of the gene) h FOXD1 129-SYIALITMA I LQSPKKRLT-147 of FOXC1 can cause defects in the anterior chamber of the h FOXF1 27-SYIALIVMA I QSSPTKRLT-45 eye. For example, Smith et al26 demonstrated that haplo- h FOXF2 104-SYIALIVMA I QSSPSKRLT-122 insufficiency of the transcription factors FOXC1 in the h FOXG1c 15-SYNALIMMA I RQSPEKRLT-33 mouse (Foxc1+/−) resulted in histologically evident ante- h FOXI1 10-SYNALIMMA I HGAPDKRLT-28 rior segment abnormalities in every affected mouse. More- h FOXK1a 189-SYAQLIVQA I TMAPDKQLT-207 h FOXL1 53-SYIALITMA I QDAPEQRVT-71 over, Foxc1 homozygous mutants (Foxc1−/−) died dur- h FOXO1a 65-SYADLITKA I ESSAEKRLT-83 ing the perinatal period, indicating that this gene plays a r hnf-3b 163-SYISLITMA I QQSPNKMLT-181 key role in embryonic development. r hfh-1 104-SYIALIAMA I RDSAGGRLT-116 In the 10 patients with ARA we sequenced, we found Consensus SYIALITMA I QQ/SSPD/EKRLT a missense mutation (T272C) in the first helix of the forkhead domain of FOXC1. The alignment of amino acids Abbreviations: h, human; r, rat. Table 4 *Residue corresponding to isoleucine at codon 91 in FOXCI (boxed) is in forkhead domain proteins ( ) indicates that conserved. the isoleucine at codon 91 in the forkhead domain is highly conserved.25 The mutation we report herein occurs in this conserved motif. This suggests that the blood samples had been obtained. Indeed, the T272C al- Ile9lThr mutation we describe occurs in a nuclear local- teration was present in all 10 family members with ARA ization sequence of FOXC1 and contributes to anterior and absent in the 5 unaffected members. No sequence chamber abnormalities by hindering nuclear localiza- variation was observed at this position in FOXC1 in 54 tion. Saleem et al,27 recently studied the effect of 5 mis- healthy French-Canadian individuals representing a total sense mutations of the winged/helix domain found in pa- of 108 chromosomes sequenced. The FOXC1T272C mu- tients with AR malformations. Although these authors tation is predicted to result in a change of an isoleucine did not investigate the Ile91Thr variation, they demon- to threonine at codon 91 of the polypeptide, a highly con- strated that mutations in the FOXC1 forkhead domain served amino acid of the first helix of the FOXC1 fork- reduced stability, DNA binding, or transactivation, all head domain. causing a decrease in the ability of the polypeptide to trans- activate genes. Further experimentation should reveal the COMMENT exact mechanism(s) by which the Ile91Thr mutation al- ter FOXC1 transactivation. The forkhead/winged helix transcription factors are char- The most important feature of ARA is the high risk acterized by a 100–amino acid, monomeric DNA- of developing glaucoma, which causes progressive nar- binding domain and play critical roles during early rowing of the visual field and, when uncontrolled, blind- embryonic development, cell differentiation and special- ness.27 It was estimated, for 2000, that almost 6 million ization, tumorigenesis, and tissue-specific gene expres- people worldwide have developed glaucoma.28 Glau- sion in both vertebrates and invertebrates.25 To date, more coma is often insidious and rarely hurts, and it is be- than 100 forkhead family genes have been cloned and cause its severe consequences may be minimized if it is characterized in species ranging from yeast to man. diagnosed early, it becomes important to understand the Fourteen of the 15 mutations of FOXC1 reported to genetic bases of disorders of the anterior chamber of the date affect the forkhead box. Missense mutations occur eye. Our results serve to improve the understanding of directly in the forkhead domain, whereas frameshift mu- the role FOXC1 plays in developmental glaucoma and ex- tations caused by insertion or deletion take place 5Ј of pands the knowledge of the genetic causes of anterior seg- the forkhead box and result in truncated proteins with ment disorders. missing or abnormal forkhead domains. To date only 1 mutation causing anomalies of the Submitted for publication September 5, 2002; final revi- anterior chamber has been found outside the forkhead sion received March 25, 2004; accepted May 10, 2004. box. This mutation, a 1–base pair deletion of the nucleo- This study was supported by grants MOP-13428 from tide 1512, is located in the C-terminal region. In addi- the Canadian Institutes for Health Research Ottawa, On- tion to these mutations, distinct duplications encom- tario, and 548 from the Canada Foundation for Innova- passing FOXC1 has recently been reported in 3 different tion, Ottawa. families with iris hypoplasia and glaucoma.19,21 Dr Raymond is a Fonds de la Recherche en Sante´du Most of the FOXC1 mutations described so far em- Que´bec National Investigator. phasized the critical role of the forkhead domain for DNA We thank all the families and patients who partici- binding and nuclear localization. Nishimura et al19 also re- pated in this study. ported a mutation 3Ј of the forkhead box, which sug- Correspondence: Bruno Mortemousque, MD, Centre Hos- gested the presence of functionally important elements at pitalier et Universitaire Bordeaux, Service d’Ophtalmologie, the end of the FOXC1 protein. This assumption was en- Place Ame´lie Raba-Le´on, 33076 Bordeaux, France.

(REPRINTED) ARCH OPHTHALMOL / VOL 122, OCT 2004 WWW.ARCHOPHTHALMOL.COM 1532

©2004 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/25/2021 15. Phillips JC, del Bono EA, Haines JL, et al. A second locus for Rieger syndrome REFERENCES maps to chromosome 13q14. Am J Hum Genet. 1996;59:613-619. 16. Mears AJ, Jordan T, Mirzayans F, et al. Mutations of the forkhead/winged-helix 1. Axenfeld Th. Embryotoxon cornea posterius. Klin Monatsbl Augenheilkd. 1920; gene, FKHL7, in patients with Axenfeld-Rieger anomaly. Am J Hum Genet. 1998; 65:381-382. 63:1316-28. 2. Rieger H. Verlagerung und Schlitzform der Pupille mit Hypoplasie des Irisvorder- 17. Nishimura DY, Swiderski RE, Alward WL, et al. The forkhead transcription fac- blattes. Z Augenheilkd. 1934;84:98-103. tor gene FKHL7 is responsible for glaucoma phenotypes which map to 6p25. 3. Rieger H. Beitra¨ge zur Kenntnis seltener Missblildungen der Iris, II: Über Hypo- Nat Genet. 1998;19:140-147. plasie des Irisvorderblattes mit Verlagerung und Entrundung der Pupille. Al- 18. Kaestner KH, Knochel W, Martinez DE. Unified nomenclature for the winged helix/ brecht von Graefes Arch Klin Exp Ophthalmol. 1935;133:602-635. forkhead transcription factors. Genes Dev. 2000;14:142-146. 4. Rieger H. Dysgenesis mesodermalis corneae et iridis. Z Augenheilkd. 1935;86: 19. Nishimura DY, Searby CC, Alward WL, et al. A spectrum of FOXC1 mutations 333. suggests gene dosage as a mechanism for developmental defects of the ante- 5. Mathis H. Zahnunterzahl und Missbildungen der Iris. Z Stomatol. 1936;34:895- rior chamber of the eye. Am J Hum Genet. 2001;68:364-372. 909. 20. Mirzayans F, Gould DB, Heon E, et al. Axenfeld-Rieger syndrome resulting from 6. Drum MA, Kaiser-Kupfer MI, Guckes AD, Roberts MW. Oral manifestations of mutation of the FKHL7 gene on chromosome 6p25. Eur J Hum Genet. 2000;8: the Rieger syndrome: report of a case. J Am Dent Assoc. 1985;110:343-346. 71-4. 7. Friedman JM. Umbilical dysmorphology: the importance of contemplating the 21. Lehmann OJ, Ebenezer ND, Jordan T, et al. Chromosomal duplication involving belly button. Clin Genet. 1985;28:343-347. the forkhead transcription factor gene FOXC1 causes iris hypoplasia and glau- 8. Nielsen F, Tranebjaerg L. A case of partial monosomy 21q22.2 associated with coma. Am J Hum Genet. 2000;67:1129-1135. Rieger’s syndrome. J Med Genet. 1984;21:218-221. 22. Dib C, Faure S, Fizames C, et al. A comprehensive genetic map of the human 9. Murray JC, Bennett SR, Kwitek AE, et al. Linkage of Rieger syndrome to the re- genome based on 5,264 microsatellites. Nature. 1996;380:152-154. gion of the epidermal growth factor gene on chromosome 4. Nat Genet. 1992; 23. O’Connell JR, Weeks DE. PedCheck: a program for identification of genotype in- 2:46-49. compatibilities in linkage analysis. Am J Hum Genet. 1998;63:259-266. 10. Semina EV, Reiter R, Leysens NJ, et al. Cloning and characterization of a novel 24. Lathrop GM, Lalouel GM. Easy calculation of lod scores and genetic risk on small bicoid-related homeobox transcription factor gene, RIEG, involved in Rieger syn- computers. Am J Hum Genet. 1984;36:460-465. drome. Nat Genet. 1996;14:392-399. 25. Kaufmann E, Knochel W. Five years on the wings of fork head. Mech Dev. 1996; 11. Amendt BA, Semina EV, Alward LM. Rieger syndrome: a clinical, molecular, and 57:3-20. biochemical analysis. Cell Mol Life Sci. 2000;57:1652-1666. 26. Smith RS, Zabaleta A, Kume T, et al. Haploinsufficiency of the transcription fac- 12. Alward WL, Semina EV, Kalenak JW, Heon E, Sheth BP, Stone EM. Autosomal tors FOXC1 and FOXC2 results in aberrant ocular development. Hum Mol Genet. dominant iris hypoplasia is caused by a mutation in the Rieger syndrome (RIEG/ 2000;9:1021-1032. PITX2) gene. Am J Ophthalmol. 1998;125:98-100. 27. Salem RA, Banerjee-Basu S, Berry FB, Baxevanis AD, Walter MA. Analyses of the 13. Kulak SC, Kozlowski K, Semina EV, Pearce WG, Walter MA. Mutation in the RIEG1 effects that disease-causing missense mutations have on the structure and func- gene in patients with iridogoniodysgenesis syndrome. Hum Mol Genet. 1998;7: tion of the winged-helix protein FOXC1. Am J Hum Genet. 2001;68:627-641. 1113-1117. 28. Raymond V. Molecular genetics of the glaucomas: mapping of the first five “GLC” 14. Doward W, Perveen R, Lloyd IC, Ridgway AE, Wilson L, Black GC. A mutation in loci. Am J Hum Genet. 1997;60:272-277. the RIEG1 gene associated with Peters’ anomaly. J Med Genet. 1999;36:152- 29. Quigley HA. Number of people with glaucoma worldwide. Br J Ophthalmol. 1996; 155. 80:389-393.

(REPRINTED) ARCH OPHTHALMOL / VOL 122, OCT 2004 WWW.ARCHOPHTHALMOL.COM 1533