Out of Africa: The story of human origin

by Barbora Trubenová, Himani Sachdeva and Kristína Hudáková

November 19, 2018

ave you ever tried to recreate your How did this contradiction arise? family tree, or see if you have any While the doubling rule usually works historical celebrities in your fam- pretty well in the beginning (3 to 4 genera- Hily? Or just tried to make sense of com- tions), your ancestral lines soon start to merge. plicated relationships in the House Tar- Some of your great-great-grandparents may garyens? If so, you are probably familiar have been first or second cousins sharing a with ancestral lines—but in this article we grandparent, or related to each other in some will go deeper in history than you’ve ever other way. Not too long ago, the pool of avail- gone before. able partners was very limited: people did not The question of human origin has fasci- travel very far, and tended to marry within nated us for millennia. Where did we come their village, or someone living nearby. Thus, from? Who were our ancestors? How did when we want to find our ancestors, we of- they spread over the Earth and when? While ten employ a completely different approach. some people are only curious about recent Think about it this way: you can pick any per- generations, some are interested in ancient son on this planet and know that both of you history, going back hundreds of thousands of share a common ancestor! How deep into years. In this issue, we will learn how modern the past you have to go to find this ancestor science enables deeper insights into human often depends on how far apart you live. If evolution than ever before, provides powerful you pick someone from your hometown or tools to search for our ancestors, and answers the hometown of your parents, you probably fundamental questions about human origin. don’t have to go too many generations back to find a common ancestor. If you pick a per- Recreating your own family tree can be son from a long-isolated population, such as fun. You have two biological parents, who Australian aborigines, you may need to go a also have two parents each—your grandpar- few thousand years back and use a different ents, who, again, have two parents each. With approach. every generation further back in your history, the number of great-great-grandparents dou- bles, and in the center of all of that is you. If you continued this line of reasoning, however, Our common ancestors at some point you would have more ancestors in a single generation than the number peo- Our Most Recent Common Ancestor (MRCA) ple who ever lived on Earth! What happened? is the scientific name for the most recent indi- Out of Africa: The story of human origin Page 2 vidual from whom all currently living humans dividual who appears in the genealogical tree are directly descended. If we had perfect fam- of every person. Unfortunately, as you might ily records for everyone in the world, then we have guessed, there are no family records that could find the MRCA by tracing our ancestry go back thousands of years. backwards in time and stopping at the first in-

You don’t just have one family tree, you have two!

Your family tree, also called a genealogical tree, includes all individuals that were involved in your origin. However, it does not mean that you share genes with all of them! You inherited your genes from your biological parents. They came packed in 46 chromosomes, 23 from each parent, who each have their own 46 chromosomes. This means that you inherited only half of the genetic material from each parent, and the other part was lost (or possibly inherited by your siblings). Your parents also inherited their genetic material from their parents, so you share approximately one quarter of your chromosomal DNA with each of your grandparents. However, due to the chromosomal shuffling and recombination explained below, it is quite likely that you inherited slightly more from one of your grandparents than from the other. In fact, if you go back several generations, you encounter many ancestors who were simply not lucky enough to pass any of their genetic material on to you. This doesn’t mean they weren’t necessary for you to be born, it only means that you don’t share any of their DNA. Looking only at those of your ancestors who contributed to your DNA, you can construct another type of tree—a genetic tree—which is a subset of your genealogical tree.

Formation of male reproductive cells. Chromosome shuffling and recombination occur during the formation of reproductive cells (such as sperm or ova). The two chromosomes belonging to each pair exchange pieces of DNA to create two new, mixed chromosomes (see figure). This rearrangement of genetic material is called recombination. The reproductive cell then receives—at random—one of these new chromosomes from each pair. However, there is one chromosome that is more or less exempt from the recombina- tion process: the Y chromosome, which is found only in males. It has a very different appearance than its counterpart, the X chromosome, so these two recombine very rarely.

Another way to get information about an- plained earlier, you inherit half of your ge- cestry and relationships between different netic material from each of your parents. The people is by looking at their DNA. As ex- DNA pieces you inherit are almost identical to Out of Africa: The story of human origin Page 3 those they carry—very few mutations occur errors (mutations). during one generation. The same is true for Consider all humans alive today on Earth. your siblings. Statistically speaking, you share Every one of these humans has a mother, and about half of your genetic material with your all these mothers have their own mothers. If full brother or sister, and a quarter of your we try to find the mothers of all living hu- DNA with your first cousins, with very few mans, and then their mothers, and then their errors caused by mutations. Thus, the greater mothers’ mothers, and so on, the number of the similarity between the DNA of two peo- women keeps decreasing—some women have ple, the more recently they shared a common no daughters, and several women can have ancestor. the same mother. Thus, eventually, you will There is, however, a complication that arrive at a single female, who is matrilineally makes it difficult to trace our general or ge- connected to all of us. This woman is known nealogical MRCA using DNA. As mentioned as Mitochondrial Eve (called mt-Eve in short), earlier, genes and chromosomes inherited our matrilineal Most Recent Common Ances- from the mother and the father are reshuf- tor. Her mitochondrial DNA exists in all hu- fled during sperm (or ovum) production. This mans now living on Earth. means that your father may pass on to you the gene for eye color from your grandmother and Why do mitochondria posses DNA? the gene for hair color from your grandfather. Thus, if you trace the ancestry of different Mitochondria have a fascinating his- genes or stretches of DNA backwards in time, tory themselves: they used to be inde- you might find that different genes originate pendent unicellular organisms—a type from different ancestors in your family tree. of bacterium. Approximately 1.5 bil- That’s why, when trying to find the com- lion years ago, before most multicellular mon ancestors of all humans, it is particu- organisms evolved, some mitochondria larly useful to look at bits of DNA that do not started living symbiotically with eukary- undergo recombination or shuffling. Luckily, otic cells (cells with a nucleus enclosed there are two particular pieces of DNA that are within a cell wall). Over time, they lost not shuffled, and two ancestors that we can their ability to exist as independent or- find relatively easily: Mitochondrial Eve (mt- ganisms. Now, even though they still Eve) and Y-chromosomal Adam (Y-Adam). contain parts of their own DNA, they have lost many of the important genes that are required to survive and repro- mt-Eve and Y-Adam duce independently. However, they are vital to the cell respiratory processes of Both parents contribute equal parts to the all multicellular organisms! nuclear genome—the genes located in the cell nucleus—through their ovum (egg) and The idea of mt-Eve is illustrated in Fig. 2. sperm. However, the role of the maternal ge- Note how mt-Eve (in the circle) is connected netic material is slightly larger. Male sperm to all women in the bottom row via an unbro- are donors of chromosomes only, but mothers ken line of daughters. A line consisting only of also provide the egg with tiny organelles— your female ancestors is called a matrilineal mitochondria—that contain their own DNA. line, or lineage. All the other matrilineal lines Thus, while our nuclear DNA is a mixture of either died out or had at least one generation the DNA of our four grandparents, our mi- in which no daughters, just sons, were born. tochondrial DNA (mt-DNA) is inherited only Of course all of us have many ancestors who from the mother’s side and is an almost ex- do not belong to our matrilineal line—your act copy of the mitochondrial DNA of our ma- father’s mother is an example of an ancestor ternal grandmother, with just a few copying who is not matrilineal to you. Out of Africa: The story of human origin Page 4

the line of fathers—the patrilineal line—back in time all the way to a single man. Again, his existence does not imply that he was the first man, or alone on Earth. None of Y-Adam’s contemporaries, however, have a direct male line that continues through to the present day. Either the line died out, or the line had at least one generation in which no sons, just daughters, were born. Our MRCA changes with time

The MRCA of all humans alive today is not the same as the MRCA of humans alive at some point in the remote past or Fig 2. Finding mt-Eve. Some women leave future. As people die, certain lineages more daughters, some leave none. In this may die out, and a more recent indi- example, all women in the last generation vidual may become the new MRCA of belong to a single matrilineal lineage (in red) all humans living. Moreover, the extinc- and descend from one woman—their mt-Eve tion or re-discovery of small, isolated (in the circle). All other matrilineal lineages groups hidden deep in a jungle can dras- (blue, green, etc.) died out. tically change the estimates of when our MRCA lived! Therefore, you might find Mt-Eve was named after Eve from the Gen- different estimates of when our MRCA, esis story in the Bible, but she has no connec- Y-Adam or mt-Eve, lived, depending on tion with the biblical notion of Eve. Mt-Eve when the source you are reading was was certainly not the first woman on Earth, written. nor was she the only female alive during her lifetime (see Fig 2.). She had ancestors, who are also our common ancestors. The name Mitochondrial Eve just refers to the most re- Tracing our ancestors cent of these ancestors—the woman who is the common grandmother of all of us via ma- Because of the lack of recombination and shuf- ternal inheritance. She also had many female fling in mitochondrial DNA and Y chromo- contemporaries—researchers believe as many somes, we know much more about mt-Eve as 20,000 individuals of mt-Eve’s species may and Y-Adam than about our general MRCA. have lived at the same time as her, but mt-Eve Scientists have even been able to estimate was the only "lucky mother" who produced when these ancestors lived using the molecu- an unbroken line of daughters that still exists lar clock technique. Based on the molecular today. As a result, only mt-Eve’s mitochon- clock, they estimate that Y-Adam lived more dria have descendants in the cells of all living than 300,000 years ago, while mt-Eve lived humans. about 200,000 years ago. This means that Is there a male counterpart of Mitochon- Y-Adam and mt-Eve never met, even though drial Eve? Yes, he is called Y-chromosomal their descendants certainly became closely in- Adam, and he is the patrilineal human MRCA. timate. We also know that both of them lived The “Y-chromosomal” in his name comes from in Africa, and that their descendants started the male Y chromosome, which is passed ex- to wander out of Africa around 60,000 years clusively from father to son. It mostly does not ago, replacing other human populations such recombine with other chromosomes and thus as Homo erectus. allows us to trace back its origin by following How do we know all this? Once again, the Out of Africa: The story of human origin Page 5 clues are in out DNA. Using the genetic analy- fossils, we can sketch a picture of how our an- sis of mitochondrial DNA and Y-chromosomes cestors left Africa and populated different con- of numerous individuals of different ethnic tinents. We can even investigate how humans groups and tribes, including—and especially— adapted to different natural environments!

Molecular clocks

If a mutation (a DNA copying error) occurs in the mitochondrial DNA of a female, all of her offspring will share this mutation, and potentially add further mutations. Therefore, when you compare your mitochondrial DNA and the mitochondrial DNA of your sibling(s), they will be almost identical, with no, or very few, mutations. There will probably be a few more differences between your mitochondrial DNA and that of your first cousins, as the mitochondrial DNA of your grandmother had to be copied over two generations, leading to approximately twice as many errors before it became a part of your cousins and you. We can extend this logic to your second or third cousins and conclude that the higher the number of genetic differences between two individuals, the longer ago they had a common ancestor. The key point is that pieces of DNA that are not under selection accumulate mutations or genetic changes from one generation to the next at a roughly constant rate. By comparing the DNA of fossils and modern humans, we can estimate this mutation rate. Then, by counting the number of genetic differences between two individuals, we can estimate how long ago their common ancestor lived.

Different mutations occurred in different females (Ella and Ferdinanda) who shared a common ancestor. Each of these females passed her respective mutation on to her daughters and granddaughters, some of whom also eventually acquired and passed on their own mutations, creating distinct lineages (Anna, Bea, Cora, and Diana).

We can divide the human population into and establishing how similar or different they several groups based on the similarity of their are to the DNA sequences in other regions of mitochondrial DNA sequences. These groups the world, we can trace the migration routes are called haplogroups; each haplogroup has of our ancestors as they spread across the certain typical mutations that distinguish it Earth (see Fig 3). As an example, the muta- from other haplogroups. Each of these mu- tions in DNA sequences found in modern-day tations can be traced to a single female, in Native Americans are most similar to the ones whom this mutation occurred. found in Asia—this allowed scientists to infer that the most likely way ancient humans mi- By identifying which mitochondrial DNA grated to the Americas was via Siberia. How- sequences are common in particular regions Out of Africa: The story of human origin Page 6 ever, we have to be very careful when inferring Genetic diversity in different human migrating patterns, as people move around populations much more now than in the past. Therefore, it is better to look at the DNA found in fossils, Sequencing the DNA of millions of or native populations that have been living in humans in the past decade has revealed a given area for centuries. some interesting facts about human ge- netic variation. More genetic diversity is found in Africa than in the rest of the world put together. In fact, the genetic diversity of a population of humans is lower the farther away that population is from Africa. This pattern is a key piece of evidence for the “Out of Africa” hy- pothesis. Generally, larger populations tend to be more diverse. Any small subgroup of a large population carries only a small fraction or subset of the mutations present in the entire population. There- Fig 3. By connecting locations with similar fore, each small subgroup that migrated mitochondrial DNA sequences (haplogroups) away is less diverse than the source pop- and using information from the molecular ulation, giving rise to the patterns in hu- clock technique about the order of the man genetic diversity that we see today. mutations (see the “Molecular clock” box), we can construct the map of human migration Of course, in the last hundred years or (below). so, more and more humans are migrat- ing longer distances. It will be interest- ing to see how this alters the geographic patterns of diversity in the future!

Fig 4. Estimated migration routes of humans from Africa. The number on each arrow gives an estimate of how many years ago each migration took place. Out of Africa: The story of human origin Page 7

You might be wondering what happens more closely related to each other, sharing when we go even further back in time. At more features and possessing greater similar- these time scales, different subspecies, then ities in DNA, while others are more distant, species, start to merge. You can find the most showing fewer similarities. Going further and recent common ancestor of humans and Ne- further back in time, we can construct the anderthals, of humans and chimpanzees, of biggest, fullest family tree of all—the Tree of the entire ape family and any other species. Life. But let’s leave this important topic for a The principle is the same: some species are later article.

Useful resources

• A few slides explaining how we can trace human migration routes: www.hhmi.org/biointeractive/using-dna-trace-human-migration • Genographic project—everything about human migration: https://genographic.nationalgeographic.com/ • A good explanation of molecular clocks: http://evolution.berkeley.edu/evolibrary/article/molecclocks_01 • A similar, easy-to-read article: https://io9.gizmodo.com/5791530/why-humans-all-much-more-related-than-you-think

Instructions for the competition

Questions:

Answer the questions from the Questions section. A question may have multiple correct answers, unless otherwise stated. You can get up to 2.5 points per question if you identify all of the (and only the) correct answers. Send your answers in a format stating the question number and correct answers, e.g. “Q1: A, B, C; Q2: B, C, D;...”

The project:

Read the instructions in the Project section. This time, you won’t need any special equipment, but you will need to put on your thinking caps! You can get up to 20 points for this part. After completing the project, send us:

• Answers to the questions mentioned in both parts of the Project. • Family relationship image (see the project) with marked individuals, or a clear identifica- tion of which ones you mean. • Migration pattern across the island.

Also send us explanations of your answers in the project section, so we can understand your thinking and (in some cases) award partial credit. This is a challenging project, so good luck, have fun, and get in touch if anything is unclear! Send the write-up of the project together with the answers to the Question section, preferably as a single PDF, by midnight on December 10, 2018 to [email protected]. Questions Out of Africa: The story of human origin Page 8

Questions:

1. Which of the following statements about mitochondrial DNA are true? (A) A brother and a sister do not have the same mitochondrial DNA but two sisters do. (B) Mitochondrial DNA is only inherited from the mother, and nuclear DNA is inherited from both parents. (C) Mitochondrial DNA recombines with nuclear DNA during reproductive cell formation. (D) Mitochondrial DNA is only found in humans. (E) Mitochondrial DNA contains all genes necessary for survival of an organism. 2. Identify all correct statements about Y-Adam. (A) All human males alive today inherited their entire genome from a single common ancestor (Y-Adam). (B) Y-Adam is the most recent common ancestor of all human beings living today. (C) An individual living in Africa 200,000 years ago had three sons. This individual could have been Y-Adam only if all of his sons also had male descendants. (D) As we sequence the genomes of more and more human males, our estimates of when Y-Adam lived can change. (E) The Y chromosomes of all living male chimpanzees descended from a single male chimpanzee who lived long ago. This chimp Y-Adam is different from the Y-Adam of human males. 3. To estimate how far back (in years) the most recent common ancestor of two species lived, we use the following information: (A) the age of the earth. (B) how similar the species are in appearance. (C) the number of genome sites at which the two species differ. (D) the rate of mutation. (E) all of the above. 4. These graphs show the number of changes that have accumulated in a genetic se- quence over time. Which of these would make a good candidate for a molecular clock? Choose only one answer.

(A) Graph A, because the curve becomes flat after some time. (B) Graph B, because it is a straight line. (C) Graph C, because the change in sequence is the most rapid. (D) Any of the three genetic sequences would make a good molecular clock because genetic changes occur in all of them. (E) None of the three as there should be no genetic change. 5. The “family tree” of Mitochondrial Eve’s descendants was constructed by... (A) calculating the time at which humans and apes shared a common ancestor. Questions Out of Africa: The story of human origin Page 9

(B) comparing the DNA of fossilized humans with that of living humans. (C) analyzing the genealogical trees of humans alive today, then extrapolating back to an initial ancestor. (D) analyzing the similarities in mitochondrial DNA of a large and diverse sample of living humans to identify related groups. (E) reconstructing Eve’s complete genome. 6. Which of the following statements is/are true? (A) Any two humans living on Earth share more DNA with each other than with any other species. (B) Asians and Europeans have several genetic mutations not commonly found in Africans. This disproves the “Out of Africa” hypothesis. (C) There were several human-like (hominin) species, of which only one (Homo Sapiens) survives today. (D) The maximum amount of genetic diversity in human mitochondrial DNA is found in European females. (E) Modern-day Tibetans have several genetic mutations that help them survive at high altitudes. This is an example of a recent human adaptation to an environmental challenge. Project Out of Africa: The story of human origin Page 1

Project: How can we find our ancestors?

In this activity, you will try to trace back your virtual ancestors using the methods explained in the main article.

Finding Y-Adam and mt-Eve

Look at the scheme below. Each horizontal row of couples represents one generation. Matrilineal descent (traced by mitochondrial DNA) is marked by solid lines, while patrilineal descent (traced by Y chromo- somes) is marked by dotted lines. We assume that each couple has children only with each other. This means that even though we only draw a line between a man and his father, we can see from the picture who the mother is: the father’s partner. In the example picture to the right, the first pair in the first generation had two daughters, who got married to two brothers—the sons of the second couple.

Your task

Using what you learned in the article, look at the following diagram and answer the questions on the next page.

You can either mark the individuals in the picture and send it to us, or identify them using their sex (male/female), pair (the column label), and generation number (the row number), e.g. “female, pair A, 1st generation”. Project Out of Africa: The story of human origin Page 2

1. Who is the matrilineal MRCA of the blue woman and the red woman? 2. Who is the matrilineal MRCA of all women in the 9th generation? 3. Is there also a mt-Eve—matrilineal MRCA—of all humans in the 9th generation? If yes, who is it? If not, why not? 4. If the couple marked in the square dies childless and all the other couples have chil- dren, who will be the matrilineal MRCA of all humans in the 10th generation (not pictured)? 5. Who is the Y-Adam of all the men in the 9th generation? 6. Bonus question: Which couple represents the first meeting between the Y-Adam (from question 5) and mt-Eve (from question 2) lineages? 7. Bonus question: Can you find the MRCA (any MRCA via any lineage) of the blue, green and red individuals? Hint: use the genealogical trees of all three individuals. If you can’t find the MRCA of all three, can you find the MRCA of any two of them?

Tracing back migration patterns

Imagine that, even though you live in Eu- rope, your grandmother came from a group of small, remote islands in the Pacific...but you don’t know which one! These small is- lands are isolated from each other and it took your ancestors several thousands of years to colonize them all. Every island was colonized by a small number of closely re- lated individuals, who had the same mito- chondrial DNA sequence. Luckily, you know your own mitochon- drial DNA sequence, as well as the mitochon- drial DNA sequences of the fossils of females who lived on the islands thousands of years ago (representing different haplogroups). Figure 1: Map of the islands.

Table 1: Your mitochondrial DNA and that of the fossils from the islands.

Individual Place Genome You Austria AACTGGCTGACGTCATAATC Petra Uruk ATCTGACTCACGTCTCAAAG Sarah Maku ATCTGACTCACGTCATAATC Rachel Baku ATCTGACTGACGTCATAATC Karen Apon ATCTGACTCACGTCTCAATC Xantipa Mabon ATCTGACTCACGTCTCAATG Ema Uhru ATCTGGCTGACGTCATAATC Jane Paku ATCTGACTCACGTCTTAATC Project Out of Africa: The story of human origin Page 3

Your task

At the end of this activity, you will have drawn a map of your ancestors’ migration across the islands by drawing arrows between the islands. The instructions and questions below will help you to do this. Send us the answers to all the questions in the Instructions section below, as well as the migration pattern, preferably as a drawing of a map, or as a description of the migration pattern (i.e. First, Island ???? was colonized. From there, my ancestors went to Islands ?!?? and ??!!, from ??!! they went to !?!?... where you fill in the appropriate names for the ? and ! marks.).

Instructions

1. Look at the sequences in Table 1 carefully. Highlight the locations (columns) where different mutations occurred in the mitochondrial DNA of your ancestors. 2. Which sequence is most similar to yours? Give the name of the woman it belongs to; she was your closest ancestor—your great-great-grandmother. 3. Which island did your great-great-grandmother come from? 4. Look at the table again. Who is the closest relative of the woman you identified in question 2? Draw a line between these two women, linking them. 5. Keep linking women with the most similar haplogroups (DNA sequences). Repeat this process until you have linked all women. Remember, two haplogroups could be equally similar to the one you are considering! 6. Without knowing anything about the age of the fossils, can you decide which haplogroup is the oldest one? Explain. 7. If two islands have very similar haplogroups (i.e. differing by just one letter), then it is very likely that people from one of the islands colonized the other. Use this information to connect islands that were directly colonized by each other. 8. Can you draw a direction of migration between the islands at this stage? If yes, do so; if not, explain why not. 9. The recent discovery of fossil records on the islands shows that the island of Apon was the first one to be colonized, approximately 3000 years ago. Do your answers to questions 6 and 8 change? If so, write new answers. 10. From the information you have, can you find out the rate of the molecular clock? How many mutations occurred in the mitochondrial DNA from the time the islands were first colonized to the present day? 11. Can you now draw a scheme similar to the one in the “Molecular Clock” box in the article? If so, draw the scheme. 12. Can you now draw the complete map of how the islands were colonized? If so, draw the map, including arrows indicating in which direction islands were colonized.