DOCSLIB.ORG

Supplementary Material Supplemental Methods Characterization Of

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Material Supplemental Methods Characterization Of Supplementary material Supplemental methods Characterization of tenocytes like cells Surface markers of TLC were determined at passage 2 by flow cytometry (FACS). The cells were incubated with antibodies against CD44, CD45, CD73, CD90, CD105, CD133 and CD146 for 20 minutes at room temperature. Unstained cells were used as controls (CT). After fixation, cells were analyzed with the BD- Accuri C6 Cytometer (BD Biosciences, Germany) and with BD-Accuri C6 Plus Software. 1 Table S1. Primers used for quantitative PCR. GENE Forward Reverse RUNT-RELATED TRANSCRIPTION FACTOR gcctaggcgcatttcaga gctcttcttactgagagtggaagg 2 (RUNX2) SOX9 gtacccgcacttgcacaac tcgctctcgttcagaagtctc TYPE I COLLAGEN (COL1A1) ctggacctaaaggtgctgct gctccagcctctccatcttt TYPE II COLLAGEN (COL2A1) tggtgctaatggcgagaag cccagtctctccacgttcac TYPE III COLLAGEN (COL 3A1) agggaaagatggcccaag gcaccaccttcacccttatc TYPE X COLLAGEN (COL10A1) caccttctgcactgctcatc ggcagcatattctcagatgga SECRETED PHOSPHOPROTEIN 1 (SPP1) gagggcttggttgtcagc caattctcatggtagtgagttttcc BONE GAMMA-CARBOXYGLUTAMATE ggcgctacctgtatcaatgg tcagccaactcgtcacagtc PROTEIN (BGLAP) BONE SIALOPROTEIN (BSP) cgaatacacgggcgtcaatg gtagctgtactcatcttcataggc TISSUE NON-SPECIFIC ALKALINE aacaccacccaggggaac ggtcacaatgcccacagatt PHOPHATASE (TNAP) ECTONUCLEOTIDE gaaagaccacacttttacactctg ggctttgatgacttcactgct PYROPHOSPHATE/PHOPHODIESTERASE 1 (ENPP1) MOHAWK HOMEOBOX (MKX) gctcgcagatgacgctagt tctggctgtcgaacggtatt SCLERAXIS (SCX) accttctgcctcagcaacca ggccacctcctaactgcgaat TENOMODULIN (TNMD) gccagacaagcaagtgagga ttgcctcgacggcagtaaat CARTILAGE OLIGOMERIC MATRIX PROTEIN gacatcaggactctcgggacaac tcgtcgtcgcaggcatcac (COMP) AGGRECAN (ACAN) cccctgctatttcatcgaccc gacacacggctccacttgat MATRIX METALLOPEPTIDASE 13 (MMP13) cctggacaagtagttccaaagg gccggtgtaggtgtagatagga GLYCERALDEHYDE-3-PHOSPHATE tgggtgtgaaccatgagaagtatg ggtgcaggaggcattgct dehydrogenase (GAPDH) 2 Supplemental figure S1. Histology and immunohistochemistry of a normal tendon (representative images). HE: haematoxylin and eosin; SO/FG: Safranin O Fast Green; COL2: type II collagen; ENPP1: Ectonucleotidepyrophosphatase/phosphodiesterase 1; TNAP: Tissue non-specific alkaline phosphatase; COL10: type X collagen. Scale bar = 200µM. 3 Supplemental figure S2. Characterization of tenocyte-like cells. A: Gene expression of tenocyte markers at different passages assessed by quantitative PCR (N=1). B: Surface markers of tenocyte-like cells assessed by Flow Cytometry (N=1). COL: collagen; MKX: Mohawk homeobox; SCX: scleraxis; TNMD: Tenomodulin; P: passage; ND: not detected; CT: control with unstained cells. 4 Supplementary Table S2. Proteomic analysis of calcium deposits from 5 patients. P: peptides; SC: Spectral Count; BSC : Basic Spectral Count; SSC: Specific Spectral Count. Tot Patient 1 Patient 2 Patient 3 Patient 4 Patient 5 al Gene Accession Description SSC name BS SS BS SS BS SS BS SS BS SS P P P P P C C C C C C C C C C A0A024R 7 13 13 6 11 11 7 13 13 8 22 22 7 16 16 Fibronectin 1, isoform CRA_n FN1 768 462 2 6 6 3 0 0 4 2 2 7 1 1 5 9 9 7 13 13 4 5 8 18 18 4 CO3 Complement C3 C3 73 73 80 80 80 80 554 6 8 8 4 2 6 3 3 9 2 2 11 10 2 10 10 2 3 13 12 APOA1 Apolipoprotein A-I APOA1 84 78 88 82 486 5 8 0 1 9 7 0 8 1 6 5 SERPIN 2 2 2 2 2 ANT3 Antithrombin-III 60 60 38 38 53 53 68 68 49 49 268 C1 7 1 6 6 4 3 2 2 3 3 PLMN Plasminogen PLG 40 40 29 29 38 38 64 64 63 63 234 2 4 9 9 8 3 1 2 5 3 CO6A3 Collagen alpha-3(VI) chain COL6A3 36 36 22 22 39 39 64 64 39 39 200 0 9 7 0 2 1 2 2 2 2 APOA4 Apolipoprotein A-IV APOA4 24 24 46 46 29 29 25 25 33 33 157 5 4 2 1 0 1 1 1 2 1 CLUS Clusterin CLU 21 21 27 27 28 28 42 42 36 36 154 2 2 3 1 9 2 1 2 1 2 GELS Gelsolin GSN 38 38 26 26 29 29 18 18 39 39 150 0 5 0 3 4 2 1 1 3 2 COMP Cartilage oligomeric matrix protein COMP 35 33 19 16 19 16 60 57 27 25 147 2 1 4 0 0 1 1 1 2 1 PRG4 Proteoglycan 4 PRG4 30 30 13 12 13 12 75 71 21 21 146 4 0 1 6 2 SERPINF 1 1 1 PEDF Pigment epithelium-derived factor 36 36 8 16 16 38 38 8 23 23 30 30 143 1 3 3 1 6 77 6 67 6 82 5 39 6 65 ALBU Serum albumin ALB 40 15 40 8 27 130 9 5 0 2 6 3 6 5 6 9 1 1 6 APOB Apolipoprotein B-100 APOB 14 14 26 26 5 5 5 73 73 3 3 3 121 4 9 2 A0A024R 1 1 3 2 Tenascin C (Hexabrachion), isoform CRA_a TNC 20 20 8 10 10 14 14 47 47 25 25 116 884 7 3 9 1 SERPIN 1 1 1 1 1 AACT Alpha-1-antichymotrypsin 23 23 22 22 27 27 17 17 22 22 111 A3 3 3 5 1 2 1 1 1 1 1 PCOC1 Procollagen C-endopeptidase enhancer 1 PCOLCE 20 20 18 18 21 21 25 25 25 25 109 2 2 4 3 3 1 1 1 1 B4DPP8 cDNA FLJ53075, highly similar to Kininogen-1 15 15 9 13 13 21 21 29 29 27 27 105 2 3 9 6 A0A384M 3 3 11 3 10 2 3 Epididymis secretory sperm binding protein 87 22 28 14 59 11 97 16 91 DQ7 2 7 1 2 7 4 3 cDNA FLJ55673, highly similar to Complement factor 1 1 1 1 1 B4E1Z4 19 19 13 13 16 16 19 19 18 18 85 B 5 2 4 5 3 2 1 1 CERU Ceruloplasmin CP 29 29 5 6 6 11 11 24 24 8 12 12 82 1 0 9 1 1 1 FGFP2 Fibroblast growth factor-binding protein 2 FGFBP2 16 16 9 16 16 9 16 16 17 17 16 16 81 1 1 2 1 VTNC Vitronectin VTN 5 10 10 7 9 9 5 8 8 41 41 6 11 11 79 4 1 1 2 1 CILP1 Cartilage intermediate layer protein 1 CILP 11 11 12 12 8 10 10 29 29 16 16 78 0 0 4 5 1 1 CO9 Complement component C9 C9 13 13 5 5 5 8 10 10 38 38 7 11 11 77 0 9 1 1 VTDB Vitamin D-binding protein GC 9 13 13 9 13 13 9 16 16 17 17 18 18 77 3 4 1 1 1 APOE Apolipoprotein E APOE 6 7 7 11 11 8 9 9 32 32 17 17 76 0 8 4 1 1 2 FIBB Fibrinogen beta chain FGB 13 13 8 11 11 13 13 35 35 3 3 3 75 1 1 8 1 2 THRB Prothrombin F2 15 15 3 5 5 5 8 8 37 37 6 9 9 74 2 1 1 1 1 F5GY80 Complement component C8 beta chain C8B 17 17 6 10 10 6 8 8 19 19 12 12 66 1 6 1 1 FETUA Alpha-2-HS-glycoprotein AHSG 7 14 14 6 9 9 5 7 7 24 24 8 12 12 66 0 1 1 1 1 TENX Tenascin-X TNXB 8 8 8 15 15 13 13 14 14 12 12 62 4 2 4 2 A0A024R SERPIN 2 3 3 11 2 3 10 Alpha-1-antitrypsin 69 4 87 4 19 59 11 20 58 6I7 A1 9 3 1 2 5 5 1 CRAC1 Cartilage acidic protein 1 CRTAC1 1 12 12 7 7 7 5 5 5 1 21 21 8 10 10 55 5 0 4 Q6PIL8 IGK@ protein IGK@ 5 19 11 6 24 13 6 23 11 6 22 12 5 17 7 54 Insulin-like growth factor-binding protein complex 1 ALS IGFALS 9 12 12 5 5 5 7 7 7 17 17 7 12 12 53 acid labile subunit 2 LBP Lipopolysaccharide-binding protein LBP 9 12 12 2 3 3 5 6 6 8 17 17 7 13 13 51 1 1 HTRA1 Serine protease HTRA1 HTRA1 14 14 4 6 6 6 8 8 16 16 4 5 5 49 2 0 ANGT Angiotensinogen AGT 7 8 8 7 11 11 6 7 7 7 11 11 8 11 11 48 1 1 B4E1B2 cDNA FLJ53691, highly similar to Serotransferrin 4 5 5 8 8 8 12 12 13 13 9 10 10 48 0 0 TTHY Transthyretin TTR 8 12 12 4 5 5 8 14 14 9 9 9 8 8 8 48 1 CO8A Complement component C8 alpha chain C8A 8 10 10 4 5 5 5 5 5 18 18 8 9 9 47 6 CO8G Complement component C8 gamma chain C8G 4 10 10 2 5 5 3 6 6 8 15 15 6 11 11 47 1 FIBG Fibrinogen gamma chain FGG 8 8 8 5 6 6 7 7 7 20 20 3 3 3 44 7 CO1A2 Collagen alpha-2(I) chain COL1A2 9 10 10 5 5 5 9 9 9 7 7 7 9 11 11 42 1 FIBA Fibrinogen alpha chain FGA 4 4 4 3 4 4 6 8 8 21 21 5 5 5 42 6 SERPIN IPSP Plasma serine protease inhibitor 7 8 8 8 11 11 7 9 9 6 7 7 7 7 7 42 A5 SERPIN KAIN Kallistatin 8 11 11 5 6 6 6 7 7 7 9 9 7 9 9 42 A4 1 SPRC SPARC SPARC 7 10 10 6 7 7 7 8 8 1 1 1 14 14 40 0 1 CO5 Complement C5 C5 5 5 5 6 7 7 1 1 1 22 22 4 4 4 39 9 1 ITIH4 Inter-alpha-trypsin inhibitor heavy chain H4 ITIH4 4 4 4 5 7 7 2 2 2 18 18 6 6 6 37 4 1 CO3A1 Collagen alpha-1(III) chain COL3A1 4 4 4 5 6 6 6 9 9 5 6 6 11 11 36 0 SERPIN 1 HEP2 Heparin cofactor 2 7 7 7 3 4 4 4 6 6 13 13 5 6 6 36 D1 1 1 INHBA Inhibin beta A chain INHBA 3 3 3 3 4 4 6 6 6 8 9 9 14 14 36 1 DKFZp6 1 1 1 1 Q6N093 Uncharacterized protein DKFZp686I04196 (Fragment) 86I0419 18 10 7 10 2 25 9 25 10 18 5 36 0 3 2 0 6 APOA2 Apolipoprotein A-II APOA2 3 7 7 5 7 7 5 7 7 4 8 8 3 6 6 35 DKFZp6 1 1 1 1 1 Q6MZQ6 Uncharacterized protein DKFZp686G11190 86G111 25 5 22 7 31 7 32 8 31 7 34 2 1 3 2 3 90 APOC1 Apolipoprotein C-I APOC1 3 3 3 4 9 9 4 6 6 5 8 8 3 6 6 32 Transforming growth factor-beta-induced protein ig- BGH3 TGFBI 7 8 8 4 4 4 3 3 3 8 10 10 7 7 7 32 h3 1 CCD80 Coiled-coil domain-containing protein 80 CCDC80 5 6 6 1 1 1 2 2 2 16 16 4 6 6 31 0 CD14 Monocyte differentiation antigen CD14 CD14 5 9 9 2 2 2 4 5 5 4 6 6 7 9 9 31 Q8NEJ1 Uncharacterized protein 3 7 4 4 9 4 5 16 9 5 9 6 4 11 8 31 CHAD Chondroadherin CHAD 6 10 10 4 5 5 1 1 1 6 10 10 3 4 4 30 HABP2 Hyaluronan-binding protein 2 HABP2 1 1 1 2 3 3 5 8 8 9 13 13 5 5 5 30 TSP1 Thrombospondin-1 THBS1 6 7 7 3 3 3 5 5 5 6 7 7 8 8 8 30 PRELP Prolargin PRELP 5 6 6 2 2 2 4 5 5 9 12 12 4 4 4 29 APOL1 Apolipoprotein L1 APOL1 2 2 2 3 4 4 4 4 4 8 10 10 7 8 8 28 1 CO7 Complement component C7 C7 3 3 3 3 3 3 18 18 4 4 4 28 4 LUM Lumican LUM 4 6 6 1 1 1 6 9 9 5 6 6 4 5 5 27 SAMP Serum amyloid P-component APCS 5 6 6 3 4 4 4 5 5 6 8 8 4 4 4 27 SERPINF A2AP Alpha-2-antiplasmin 7 7 7 3 3 3 5 5 5 4 5 5 6 6 6 26 2 AMBP Protein AMBP AMBP 4 5 5 1 1 1 4 5 5 5 8 8 5 7 7 26 CO6A1 Collagen alpha-1(VI) chain COL6A1 3 4 4 2 2 2 4 5 5 6 9 9 6 6 6 26 ENOA Alpha-enolase ENO1 5 6 6 3 3 3 4 4 4 9 10 10 2 3 3 26 1 MXRA5 Matrix-remodeling-associated protein 5 MXRA5 2 2 2 22 22 2 2 2 26 7 SODE Extracellular superoxide dismutase [Cu-Zn] SOD3 5 6 6 3 3 3 3 3 3 4 7 7 5 7 7 26 PGS2 Decorin DCN 5 6 6 4 5 5 2 2 2 8 11 11 1 1 1 25 PON1 Serum paraoxonase/arylesterase 1 PON1 1 1 1 1 4 4 2 3 3 5 12 12 2 5 5 25 1 VIME Vimentin VIM 1 1 1 1 1 1 15 15 7 8 8 25 2 6 1 HBB Hemoglobin subunit beta HBB 7 12 4 3 4 2 7 11 4 5 6 2 22 12 24 1 G3P Glyceraldehyde-3-phosphate dehydrogenase GAPDH 3 4 4 3 3 3 8 9 9 5 7 7 23 1 FBLN1 Fibulin-1 FBLN1 2 2 2 1 1 1 16 16 3 3 3 22 2 ANXA1 Annexin A1 ANXA1 1 1 1 2 2 2 4 5 5 7 8 8 5 5 5 21 HIST1H H14 Histone H1.4 4 5 5 2 3 3 2 3 3 3 4 4 4 6 6 21 1E HBA Hemoglobin subunit alpha HBA1 4 6 6 2 3 3 2 2 2 3 3 3
Load more

Recommended publications
  • The Extracellular Matrix: an Accomplice in Gastric Cancer Development and Progression
    cells Review The Extracellular Matrix: An Accomplice in Gastric Cancer Development and Progression Ana Margarida Moreira 1,2,3, Joana Pereira 1,2,4, Soraia Melo 1,2,4 , Maria Sofia Fernandes 1,2, Patrícia Carneiro 1,2 , Raquel Seruca 1,2,4 and Joana Figueiredo 1,2,* 1 Epithelial Interactions in Cancer Group, i3S-Instituto de Investigação e Inovação em Saúde, Universidade do Porto, 4200-135 Porto, Portugal; [email protected] (A.M.M.); [email protected] (J.P.); [email protected] (S.M.); [email protected] (M.S.F.); [email protected] (P.C.); [email protected] (R.S.) 2 Institute of Molecular Pathology and Immunology of the University of Porto (IPATIMUP), 4200-135 Porto, Portugal 3 Institute of Biomedical Sciences Abel Salazar (ICBAS), University of Porto, 4050-313 Porto, Portugal 4 Medical Faculty, University of Porto, 4200-319 Porto, Portugal * Correspondence: jfi[email protected]; Tel.: +351-220408800; Fax: +351-225570799 Received: 15 January 2020; Accepted: 6 February 2020; Published: 8 February 2020 Abstract: The extracellular matrix (ECM) is a dynamic and highly organized tissue structure, providing support and maintaining normal epithelial architecture. In the last decade, increasing evidence has emerged demonstrating that alterations in ECM composition and assembly strongly affect cellular function and behavior. Even though the detailed mechanisms underlying cell-ECM crosstalk are yet to unravel, it is well established that ECM deregulation accompanies the development of many pathological conditions, such as gastric cancer. Notably, gastric cancer remains a worldwide concern, representing the third most frequent cause of cancer-associated deaths. Despite increased surveillance protocols, patients are usually diagnosed at advanced disease stages, urging the identification of novel diagnostic biomarkers and efficient therapeutic strategies.
    [Show full text]
  • Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)
    BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron.
    [Show full text]
  • Bruch's Membrane Abnormalities in PRDM5-Related Brittle Cornea
    Porter et al. Orphanet Journal of Rare Diseases (2015) 10:145 DOI 10.1186/s13023-015-0360-4 RESEARCH Open Access Bruch’s membrane abnormalities in PRDM5-related brittle cornea syndrome Louise F. Porter1,2,3, Roberto Gallego-Pinazo4, Catherine L. Keeling5, Martyna Kamieniorz5, Nicoletta Zoppi6, Marina Colombi6, Cecilia Giunta7, Richard Bonshek2,8, Forbes D. Manson1 and Graeme C. Black1,9* Abstract Background: Brittle cornea syndrome (BCS) is a rare, generalized connective tissue disorder associated with extreme corneal thinning and a high risk of corneal rupture. Recessive mutations in transcription factors ZNF469 and PRDM5 cause BCS. Both transcription factors are suggested to act on a common pathway regulating extracellular matrix genes, particularly fibrillar collagens. We identified bilateral myopic choroidal neovascularization as the presenting feature of BCS in a 26-year-old-woman carrying a novel PRDM5 mutation (p.Glu134*). We performed immunohistochemistry of anterior and posterior segment ocular tissues, as expression of PRDM5 in the eye has not been described, or the effects of PRDM5-associated disease on the retina, particularly the extracellular matrix composition of Bruch’smembrane. Methods: Immunohistochemistry using antibodies against PRDM5, collagens type I, III, and IV was performed on the eyes of two unaffected controls and two patients (both with Δ9-14 PRDM5). Expression of collagens, integrins, tenascin and fibronectin in skin fibroblasts of a BCS patient with a novel p.Glu134* PRDM5 mutation was assessed using immunofluorescence. Results: PRDM5 is expressed in the corneal epithelium and retina. We observe reduced expression of major components of Bruch’s membrane in the eyes of two BCS patients with a PRDM5 Δ9-14 mutation.
    [Show full text]
  • Calmodulin and Calmodulin-Dependent Protein Kinase II Inhibit Hormone Secretion in Human Parathyroid Adenoma
    31 Calmodulin and calmodulin-dependent protein kinase II inhibit hormone secretion in human parathyroid adenoma Ming Lu1,2,3, Erik Berglund1, Catharina Larsson1,3, Anders Ho¨o¨g4, Lars-Ove Farnebo1 and Robert Bra¨nstro¨m1 1Department of Molecular Medicine and Surgery, Karolinska Institutet, Karolinska University Hospital L1:03, SE-171 76 Stockholm, Sweden 2Department of Geriatric Endocrinology, First Affiliated Hospital of Guangxi Medical University, NanNing, People’s Republic of China 3Center for Molecular Medicine (CMM), Karolinska University Hospital, SE-171 76 Stockholm, Sweden 4Department of Oncology–Pathology, Karolinska Institutet, Karolinska University Hospital, SE-171 76 Stockholm, Sweden (Correspondence should be addressed to M Lu at Department of Molecular Medicine and Surgery, Karolinska Institutet, Karolinska University Hospital; Email: [email protected]) Abstract 2C 2C Intracellular calcium ([Ca ]i) is the most relevant modulator adenoma cells in spite of increased [Ca ]i. The inhibitory C of parathyroid hormone (PTH) secretion. Uniquely, an effect of Ca2 calmodulin on PTH secretion may be due to 2C increase in [Ca ]i results in an inhibition of PTH secretion, the absence of synaptotagmin 1 protein in parathyroid and it probably exerts its function via calcium-binding protein adenomas, as demonstrated by western blot analysis. An pathways. The ubiquitous calcium-binding proteins, calmo- increased extracellular calcium level acutely lowered the dulin and calmodulin-dependent protein kinase II (CaMKII), amount of active phosphorylated CaMKII (pCaMKII) in have well-established roles in regulated exocytosis in neurons adenoma cells in vitro, indicating the physiological importance and neuroendocrine cells. However, their roles in parathyroid of this pathway. Moreover, a negative correlation between the cells and PTH secretion are still unclear.
    [Show full text]
  • Bioinformatic Analyses in Early Host Response To
    Schroyen et al. BMC Genomics (2016) 17:196 DOI 10.1186/s12864-016-2547-z RESEARCH ARTICLE Open Access Bioinformatic analyses in early host response to Porcine Reproductive and Respiratory Syndrome virus (PRRSV) reveals pathway differences between pigs with alternate genotypes for a major host response QTL Martine Schroyen1†, Christopher Eisley2†, James E. Koltes3, Eric Fritz-Waters1, Igseo Choi4, Graham S. Plastow5, Leluo Guan5, Paul Stothard5, Hua Bao5, Arun Kommadath5, James M. Reecy1, Joan K. Lunney4, Robert R. R. Rowland6, Jack C. M. Dekkers1 and Christopher K. Tuggle1* Abstract Background: AregiononSus scrofa chromosome 4 (SSC4) surrounding single nucleotide polymorphism (SNP) marker WUR10000125 (WUR) has been reported to be strongly associated with both weight gain and serum viremia in pigs after infection with PRRS virus (PRRSV). A proposed causal mutation in the guanylate binding protein 5 gene (GBP5)is predicted to truncate the encoded protein. To investigate transcriptional differences between WUR genotypes in early host response to PRRSV infection, an RNA-seq experiment was performed on globin depleted whole blood RNA collectedon0,4,7,10and14dayspost-infection(dpi)from eight littermate pairs with one AB (favorable) and one AA (unfavorable) WUR genotype animal per litter. Results: Gene Ontology (GO) enrichment analysis of transcripts that were differentially expressed (DE) between dpi across both genotypes revealed an inflammatory response for all dpi when compared to day 0. However, at the early time points of 4 and 7dpi, several GO terms had higher enrichment scores compared to later dpi, including inflammatory response (p <10-7), specifically regulation of NFkappaB (p < 0.01), cytokine, and chemokine activity (p <0.01).At10and 14dpi, GO term enrichment indicated a switch to DNA damage response, cell cycle checkpoints, and DNA replication.
    [Show full text]
  • Differential Proteomic Analysis of Hepatocellular Carcinomas From
    CANCER GENOMICS & PROTEOMICS 17 : 669-685 (2020) doi:10.21873/cgp.20222 Differential Proteomic Analysis of Hepatocellular Carcinomas from Ppp2r5d Knockout Mice and Normal (Knockout) Livers CAROLINE LAMBRECHT 1, GABRIELA BOMFIM FERREIRA 2, JUDIT DOMÈNECH OMELLA 1, LOUIS LIBBRECHT 3, RITA DE VOS 4, RITA DERUA 1, CHANTAL MATHIEU 2, LUT OVERBERGH 2, ETIENNE WAELKENS 1 and VEERLE JANSSENS 1,5 1Laboratory of Protein Phosphorylation and Proteomics, Department Cellular and Molecular Medicine, University of Leuven (KU Leuven), Leuven, Belgium; 2Clinical and Experimental Endocrinology, Department Clinical and Experimental Medicine, University of Leuven (KU Leuven), Leuven, Belgium; 3Department of Pathology, Université Catholique de Louvain (UCL), Brussels, Belgium; 4Translational Cell and Tissue Research, Department Imaging and Pathology, University of Leuven (KU Leuven), Leuven, Belgium; 5LKI, KU Leuven Cancer Institute, Leuven, Belgium Abstract. Background: Hepatocellular carcinoma (HCC) ‘gastrointestinal disease’ as top hits. Conclusion: We is the major type of primary liver cancer. Mice lacking the identified several proteins for further exploration as novel tumor-suppressive protein phosphatase 2A subunit B56 δ potential HCC biomarkers, and independently underscored (Ppp2r5d ) spontaneously develop HCC, correlating with the relevance of Ppp2r5d knockout mice as a valuable increased c-MYC oncogenicity. Materials and Methods: We hepatocarcinogenesis model. used two-dimensional difference gel electrophoresis-coupled matrix-assisted laser desorption/ionization time-of-flight Hepatocellular carcinoma (HCC) is the most common primary mass spectrometry to identify differential proteomes of livers liver cancer, and the second leading cause of cancer-related death from wild-type, non-cancerous and HCC-affected B56 δ worldwide (1). Most patients with HCC are diagnosed at an knockout mice.
    [Show full text]
  • Characterization of Glomerular Extracellular Matrix in Iga Nephropathy by Proteomic Analysis of Laser-Captured Microdissected Gl
    Paunas et al. BMC Nephrology (2019) 20:410 https://doi.org/10.1186/s12882-019-1598-1 RESEARCH ARTICLE Open Access Characterization of glomerular extracellular matrix in IgA nephropathy by proteomic analysis of laser-captured microdissected glomeruli Flavia Teodora Ioana Paunas1,2* , Kenneth Finne2, Sabine Leh2,3, Tarig Al-Hadi Osman2, Hans-Peter Marti2,4, Frode Berven5 and Bjørn Egil Vikse1,2 Abstract Background: IgA nephropathy (IgAN) involves mesangial matrix expansion, but the proteomic composition of this matrix is unknown. The present study aimed to characterize changes in extracellular matrix in IgAN. Methods: In the present study we used mass spectrometry-based proteomics in order to quantitatively compare protein abundance between glomeruli of patients with IgAN (n = 25) and controls with normal biopsy findings (n = 15). Results: Using a previously published paper by Lennon et al. and cross-referencing with the Matrisome database we identified 179 extracellular matrix proteins. In the comparison between IgAN and controls, IgAN glomeruli showed significantly higher abundance of extracellular matrix structural proteins (e.g periostin, vitronectin, and extracellular matrix protein 1) and extracellular matrix associated proteins (e.g. azurocidin, myeloperoxidase, neutrophil elastase, matrix metalloproteinase-9 and matrix metalloproteinase 2). Periostin (fold change 3.3) and azurocidin (3.0) had the strongest fold change between IgAN and controls; periostin was also higher in IgAN patients who progressed to ESRD as compared to patients who did not. Conclusion: IgAN is associated with widespread changes of the glomerular extracellular matrix proteome. Proteins important in glomerular sclerosis or inflammation seem to be most strongly increased and periostin might be an important marker of glomerular damage in IgAN.
    [Show full text]
  • 2812 Matrix Vesicles: Structure, Composition, Formation and Function in Ca
    [Frontiers in Bioscience 16, 2812-2902, June 1, 2011] Matrix vesicles: structure, composition, formation and function in calcification Roy E. Wuthier Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC 29208 TABLE OF CONTENTS 1. Abstract 2. Introduction 3. Morphology of matrix vesicles (MVs) 3.1. Conventional transmission electron microscopy 3.2. Cryofixation, freeze-substitution electron microscopy 3.3. Freeze-fracture studies 4. Isolation of MVs 4.1. Crude collagenase digestion methods 4.2. Non-collagenase dependent methods 4.3. Cell culture methods 4.4. Modified collagenase digestion methods 4.5. Other isolation methods 5. MV proteins 5.1. Early SDS-PAGE studies 5.2. Isolation and identification of major MV proteins 5.3. Sequential extraction, separation and characterization of major MV proteins 5.4. Proteomic characterization of MV proteins 6. MV-associated extracellular matrix proteins 6.1. Type VI collagen 6.2. Type X collagen 6.3. Proteoglycan link protein and aggrecan core protein 6.4. Fibrillin-1 and fibrillin-2 7. MV annexins – acidic phospholipid-dependent ca2+-binding proteins 7.1. Annexin A5 7.2. Annexin A6 7.3. Annexin A2 7.4. Annexin A1 7.5. Annexin A11 and Annexin A4 8. MV enzymes 8.1. Tissue-nonspecific alkaline phosphatase(TNAP) 8.1.1. Molecular structure 8.1.2. Amino acid sequence 8.1.3. 3-D structure 8.1.4. Disposition in the MV membrane 8.1.5. Catalytic properties 8.1.6. Collagen-binding properties 8.2. Nucleotide pyrophosphate phosphodiesterase (NPP1, PC1) 8.3. PHOSPHO-1 (Phosphoethanolamine/Phosphocholine phosphatase 8.4. Acid phosphatase 8.5.
    [Show full text]
  • WES Gene Package Multiple Congenital Anomalie.Xlsx
    Whole Exome Sequencing Gene package Multiple congenital anomalie, version 5, 1‐2‐2018 Technical information DNA was enriched using Agilent SureSelect Clinical Research Exome V2 capture and paired‐end sequenced on the Illumina platform (outsourced). The aim is to obtain 8.1 Giga base pairs per exome with a mapped fraction of 0.99. The average coverage of the exome is ~50x. Duplicate reads are excluded. Data are demultiplexed with bcl2fastq Conversion Software from Illumina. Reads are mapped to the genome using the BWA‐MEM algorithm (reference: http://bio‐bwa.sourceforge.net/). Variant detection is performed by the Genome Analysis Toolkit HaplotypeCaller (reference: http://www.broadinstitute.org/gatk/). The detected variants are filtered and annotated with Cartagenia software and classified with Alamut Visual. It is not excluded that pathogenic mutations are being missed using this technology. At this moment, there is not enough information about the sensitivity of this technique with respect to the detection of deletions and duplications of more than 5 nucleotides and of somatic mosaic mutations (all types of sequence changes). HGNC approved Phenotype description including OMIM phenotype ID(s) OMIM median depth % covered % covered % covered gene symbol gene ID >10x >20x >30x A4GALT [Blood group, P1Pk system, P(2) phenotype], 111400 607922 101 100 100 99 [Blood group, P1Pk system, p phenotype], 111400 NOR polyagglutination syndrome, 111400 AAAS Achalasia‐addisonianism‐alacrimia syndrome, 231550 605378 73 100 100 100 AAGAB Keratoderma, palmoplantar,
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • A Genome-Wide Association Study Identifies Four Novel Susceptibility Loci Underlying Inguinal Hernia
    UCSF UC San Francisco Previously Published Works Title A genome-wide association study identifies four novel susceptibility loci underlying inguinal hernia. Permalink https://escholarship.org/uc/item/7g06z1k5 Journal Nature communications, 6(1) ISSN 2041-1723 Authors Jorgenson, Eric Makki, Nadja Shen, Ling et al. Publication Date 2015-12-21 DOI 10.1038/ncomms10130 Peer reviewed eScholarship.org Powered by the California Digital Library University of California ARTICLE Received 24 Aug 2015 | Accepted 6 Nov 2015 | Published 21 Dec 2015 DOI: 10.1038/ncomms10130 OPEN A genome-wide association study identifies four novel susceptibility loci underlying inguinal hernia Eric Jorgenson1,*, Nadja Makki2,3,*, Ling Shen1, David C. Chen4, Chao Tian5, Walter L. Eckalbar2,3, David Hinds5, Nadav Ahituv2,3 & Andrew Avins1 Inguinal hernia repair is one of the most commonly performed operations in the world, yet little is known about the genetic mechanisms that predispose individuals to develop inguinal hernias. We perform a genome-wide association analysis of surgically confirmed inguinal hernias in 72,805 subjects (5,295 cases and 67,510 controls) and confirm top associations in an independent cohort of 92,444 subjects with self-reported hernia repair surgeries (9,701 cases and 82,743 controls). We identify four novel inguinal hernia susceptibility loci in the regions of EFEMP1, WT1, EBF2 and ADAMTS6. Moreover, we observe expression of all four genes in mouse connective tissue and network analyses show an important role for two of these genes (EFEMP1 and WT1) in connective tissue maintenance/homoeostasis. Our findings provide insight into the aetiology of hernia development and highlight genetic pathways for studies of hernia development and its treatment.
    [Show full text]
  • Proteomics of Serum Extracellular Vesicles Identifies a Novel COPD Biomarker, Fibulin-3 from Elastic Fibres
    ORIGINAL ARTICLE COPD Proteomics of serum extracellular vesicles identifies a novel COPD biomarker, fibulin-3 from elastic fibres Taro Koba 1, Yoshito Takeda1, Ryohei Narumi2, Takashi Shiromizu2, Yosui Nojima 3, Mari Ito3, Muneyoshi Kuroyama1, Yu Futami1, Takayuki Takimoto4, Takanori Matsuki1, Ryuya Edahiro1, Satoshi Nojima5, Yoshitomo Hayama1, Kiyoharu Fukushima1, Haruhiko Hirata1, Shohei Koyama1, Kota Iwahori1, Izumi Nagatomo1, Mayumi Suzuki1, Yuya Shirai1, Teruaki Murakami1, Kaori Nakanishi 1, Takeshi Nakatani1, Yasuhiko Suga1, Kotaro Miyake1, Takayuki Shiroyama1, Hiroshi Kida 1, Takako Sasaki6, Koji Ueda7, Kenji Mizuguchi3, Jun Adachi2, Takeshi Tomonaga2 and Atsushi Kumanogoh1 ABSTRACT There is an unmet need for novel biomarkers in the diagnosis of multifactorial COPD. We applied next-generation proteomics to serum extracellular vesicles (EVs) to discover novel COPD biomarkers. EVs from 10 patients with COPD and six healthy controls were analysed by tandem mass tag-based non-targeted proteomics, and those from elastase-treated mouse models of emphysema were also analysed by non-targeted proteomics. For validation, EVs from 23 patients with COPD and 20 healthy controls were validated by targeted proteomics. Using non-targeted proteomics, we identified 406 proteins, 34 of which were significantly upregulated in patients with COPD. Of note, the EV protein signature from patients with COPD reflected inflammation and remodelling. We also identified 63 upregulated candidates from 1956 proteins by analysing EVs isolated from mouse models. Combining human and mouse biomarker candidates, we validated 45 proteins by targeted proteomics, selected reaction monitoring. Notably, levels of fibulin-3, tripeptidyl- peptidase 2, fibulin-1, and soluble scavenger receptor cysteine-rich domain-containing protein were significantly higher in patients with COPD.
    [Show full text]