Costimulatory Molecules CD28 and CD2 to Signals Through TCR And

Regulation of Transcriptional Activity of the Murine CD40 Ligand Promoter in Response to Signals Through TCR and the Costimulatory Molecules CD28 and CD2 This information is current as of September 30, 2021. Hanna Lindgren, Karol Axcrona and Tomas Leanderson J Immunol 2001; 166:4578-4585; ; doi: 10.4049/jimmunol.166.7.4578 http://www.jimmunol.org/content/166/7/4578 Downloaded from

References This article cites 56 articles, 32 of which you can access for free at: http://www.jimmunol.org/content/166/7/4578.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 30, 2021 *average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2001 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Regulation of Transcriptional Activity of the Murine CD40 Ligand Promoter in Response to Signals Through TCR and the Costimulatory Molecules CD28 and CD21

Hanna Lindgren,2 Karol Axcrona, and Tomas Leanderson

We have analyzed the murine CD40 ligand promoter with regard to stimulation of transcriptional activity in Jurkat T cells after signaling via the TCR and the costimulatory molecules CD28 and CD2. TCR engagement was necessary for the induction of transcriptional activity from the CD40 ligand promoter, and costimulation through either CD28 or CD2 further increased the activity. Analysis of promoter deletants showed that the DNA elements needed for transcriptional activity induced by costimulatory molecules were located within two regions containing previously identiﬁed transcription factor NFAT sites. Further studies of the proximal NFAT site showed that it was not dependent on AP-1 binding for transcriptional activity induced by costimulation Downloaded from through CD28. Instead, a region between the TATA box and the proximal NFAT site was shown to bind proteins of the early growth response family and to contribute to NFAT-mediated transcriptional activation. The Journal of Immunology, 2001, 166: 4578–4585.

uring T lymphocyte activation by APCs, cross-talk be- including IL-2 (27), IL-4 (28), and CD40L (29, 30). NFAT was tween surface bound receptor-ligand pairs as well as sol- initially described as a cyclosporin A-sensitive factor (31, 32), and D uble mediators is required. The primary signal is medi- four different forms of NFAT have been identiﬁed that share con- http://www.jimmunol.org/ ated through MHC binding to the TCR, and examples of served DNA binding domains and require similar activation sig- costimulatory signals are those delivered through the surface mole- nals (for review, see Ref. 33). Recently, a ﬁfth member of the cules CD28 and CD2 by ligation to B7 and LFA-3 present on the NFAT family (NFAT5) was cloned that is constitutively localized APC surface (1, 2). Another costimulatory molecule, needed for ac- in the nucleus and differs in structure, DNA binding, and regula- tivation of APCs, is the CD40 ligand (CD40L)3 that is transiently tion from the other NFAT family members (34). Transcription expressed on the surface of activated Th cells (for review, see Refs. 3 factors of the Jun and Fos families, together forming the transcrip- and 4). The CD40L interacts with CD40 that is expressed on B cells tion factor AP-1, have been demonstrated to interact with both

(5), macrophages (6), and dendritic cells (7, 8). A CD40 signal is NFAT and octamer-binding protein (Oct)-1 in the IL-2 promoter by guest on September 30, 2021 required for germinal center development (9, 10) and will rescue ger- (35–38) and with NFAT in the CD40L promoter (30). minal center B cells from apoptosis and promote B cell differentiation In this paper we show that induction of the CD40L and IL-2 (9, 11, 12). On dendritic cells, ligation of CD40L to CD40 results in promoters differs in response to costimulatory signals despite the up-regulation of costimulatory molecules and enhancement of cyto- similarities in transcription factor binding sites between the two kine production (13–16). CD40L expression on the T cell surface has promoters. We show that the CD40L promoter is induced both by been shown to be induced by TCR interactions with MHC class II on TCR ligation alone and by additional signaling through CD28 and the APC surface and further stabilized by costimulation through B7/ CD2, while the IL-2 promoter is only induced by the combination CD28 interactions (12, 17–19). Signaling through CD40L also has of signals through TCR and costimulatory molecules. Further- distinct effects on T cell activation and may regulate the T cell re- more, the induction of CD40L promoter activity is dependent on sponse qualitatively (20–24). two NFAT sites in the promoter, where the proximal site is not Both costimulation through CD28 and CD2 induce nuclear dependent upon interactions with AP-1 to be transcriptionally ac- translocation of the transcription factor NFAT (25, 26). NFAT has tive. Instead, a region located 3Ј of the TATA-proximal NFAT site been shown to interact with sites in promoters controlling expres- is important for transcriptional activity induced by signals through sion of several genes that are important during T cell activation, TCR and CD28, and we identify proteins of the early growth response (Egr) family of transcription factors to bind to this region.

Section for Immunology, Department of Cell and Molecular Biology, Lund Univer- Materials and Methods sity, Lund, Sweden Reagents Received for publication August 9, 2000. Accepted for publication January 30, 2001. Staphylococcal enterotoxin E (SEE) was purchased from Toxin Technol- The costs of publication of this article were defrayed in part by the payment of page ogy (Sarasota, FL). PMA and ionomycin were purchased from Sigma (Sig- charges. This article must therefore be hereby marked advertisement in accordance ma-Aldrich, St. Louis, MO). mAbs directed to mouse NFATp and NFATc with 18 U.S.C. Section 1734 solely to indicate this fact. were purchased from BD PharMingen (San Diego, CA). The polyclonal 1 This work was supported by grants from the Swedish Medical Research Council, the Abs against p50, p65, Egr-1, Egr-2, and Egr-3 were purchased from Santa Swedish Cancer Society, and the Swedish Foundation for Strategic Research. Cruz Biotechnology (Santa Cruz, CA). 2 Address correspondence and reprint requests to Hanna Lindgren, Section for Im- Cell lines and cell culture munology, Department of Cell and Molecular Biology, Lund University, So¨lvegatan 21, S-223 62 Lund, Sweden. E-mail address: [email protected] Chinese hamster ovary (CHO) cells transfected with cDNA for HLA-DR4, 3 Abbreviations used in this paper: CD40L, CD40 ligand; SEE, staphylococcal en- B7-1, and LFA-3 were used as previously described (39, 40). The different terotoxin E; CHO, Chinese hamster ovary; TRD, transcription-regulatory region D; CHO cells used in this study were CHO-DR (single transfected to express Egr, early growth response; Oct, octamer-binding protein. the HLA-DR molecule on the surface), CHO-DR/B7-1, or CHO-DR/

LFA-3 (double transfected to express both HLA-DR and human B7-1 or puriﬁed on 5% polyacrylamide Tris-borate-EDTA gel. Nuclear extracts LFA-3) and CHO-DR/B7-1/LFA-3 (triple transfected to express HLA-DR, were incubated with 2 ␮g of poly(dI-dC) for 15 min at room temperature human B7-1, and human LFA-3). Single, double, and triple transfectants in binding buffer (for the NFAT, CD40L 3Ј deletant, and NFAT/Egr oli- expressing similar levels of the transfected molecules were obtained by gonucleotides: 20 mM HEPES (pH 7.9), 40 mM KCl, 2.5 mM MgCl2,1 repeated cell sorting. The CHO cells were maintained in culture in RPMI mM DTT, and 4% Ficoll; for the Oct oligonucleotide: 10 mM HEPES (pH

1640 medium without glutamine supplemented with 10% FCS, 20 mM 7.9), 70 mM KCl, 1 mM DTT, 1 mM EDTA, and 2.5 mM MgCl2). Probe HEPES, 2 mM sodium pyruvate, 50 ␮M 2-ME, and 50 ␮g gentamicin/ml (20,000 cpm) was added to each sample, and the incubation was continued (all from Life Technologies, Taby, Sweden). The human Jurkat leukemia for 30 min at room temperature. For cross-competition experiments unla- T cell line was maintained in culture in RPMI 1640 medium supplemented beled oligonucleotides were added 10 min before addition of radiolabeled with 2 mM glutamine, 10% FCS, 20 mM HEPES, 2 mM sodium pyruvate, oligonucleotide. For supershifts the mixture of nuclear extracts and radio- 50 ␮M 2-ME, and 50 ␮g gentamicin/ml (all from Life Technologies). All labeled oligonucleotide was incubated with 0.5 ␮g of NFATp or NFATc tests on the Jurkat T cells were performed at a concentration of 106 cells/ Abs; 4 ␮g of Egr-1, Egr-2, or Egr-3 Abs; or 2 ␮g of the control Abs (p50 ml. The CHO transfectants were added to the Jurkat cells at a concentration or p65) for 1 h on ice. The samples were separated on a 5% polyacrylamide of 105 cells/ml. All cells were cultured at 37°C in a humidified atmosphere Tris-borate-EDTA gel, which was subsequently dried and analyzed by au- containing 5% CO2. toradiography. Oligonucleotides used for EMSAs were as follows: CD40L NFAT (proximal site of the murine promoter), 5Ј-AAGCACATTTTC Reporter gene constructs CAGGAA-3Ј; CD40L NFAT extended, 5Ј-GAAGACTACGAAGCA Ј An ϳ1600-bp fragment of the murine CD40L promoter was excised from a CATTTTCCAGGAAGTGTGGGTTGCGACGATTGTGCGC-3 ; CD40L Ј mouse genomic clone of the CD40L gene with XbaI/BglII and subcloned into NFAT extended mutated, 5 -GAAGACTACGAAGCACATTTTTTAG Ј pGem3Z (Promega, Madison, WI). The full-length promoter was generated by GAAGTGTGGGTTGCGACGATTGTGCGC-3 ; IL-2 NFAT (distal site Ј PCR amplification from the pGem3Z plasmid containing the CD40L promoter of the murine IL-2 promoter, ARRE-2), 5 -GATCGCCCAAAGAG Ј Ј using the SP6 primer. The amplified product was cloned into a BglII/HindIII- GAAAATTTGTTTCATACAG-3 ; CD40L 3 deletant wild-type, 5-GT

Ј Ј Downloaded from opened pGL-2 Basic promoter and enhancerless luciferase reporter plasmid GTGGGTTGCGACGATTGTGCG-3 ; CD40L NFAT/Egr, 5 -AAGCA Ј Ј (Promega). The resulting construct was named pGL-X. CD40L promoter CATTTTCCAGGAAGTGTGGGTTGCG-3 ; Oct, 5 -GATCTCAAGTGA Ј deletants were PCR amplified from pGL-X with a 3Ј reverse primer containing TTTGCATCGCATGAGACG-3 ; and transcription-regulatory region D Ј Ј a HindIII site located just 5Ј of the start codon ATG-5Ј-GAGAAGCTTGCT (TRD), 5 -CATGATTTATAAACCAGGTCTTTGCAGTGAGATCTGCA-3 . GACTGAAAGCTGAAA-3Ј. Corresponding 5Ј primers containing a BglII site linked to the 5Ј end were used. The amplified products were cloned into Results a BglII/HindIII-opened pGL-2 Basic vector. The 5Ј primers used for generat- Activity of the CD40L promoter is induced by TCR ligation and ing the deletants were: 5Ј-GAGAGATCTCAGAGCAGTGTTTATATTTC-3Ј http://www.jimmunol.org/ (pGL-I), 5Ј-GAGAGATCTCTTTATACCAGGTTCCAG-3Ј (pGL-II), 5Ј- enhanced by costimulation through CD28 or CD2, while GAGAGATCTGAAGAAACCCGTTTCTTC-3Ј (pGL-III), 5Ј-GAGAGAT induction of IL-2 promoter activity requires costimulation CTTGATATGGGTGTGATTT-3Ј (pGL-IV), 5Ј-GAGAGATCTAAGCACA through TCR and CD28 TTTTCCAGGAAGT-3Ј (pGL-NFAT), 5Ј-GAGAGATCTGAAGACTACG AAGCACAT-3Ј (pGL-NFAT/AP-1) and 5Ј-GAGAGATCTACTAATCCT The objective of this study was to define the sequence elements GAGTAAGGCGGCCA-3Ј (pGL-TATA). The mutated NFAT construct and signal requirements for efficient transcriptional activation of (pGL-NFATmut) was generated by PCR using the HindIII-linked 3Ј primer CD40L expression using a transient transfection approach. We anda5Ј primer in which the consensus sequence 5Ј-TTTTCC-3Ј was replaced by 5Ј-TTTTTT-3Ј,5Ј-TTACGAAGACTACGAAGCACATTTTTTAGGA used the Jurkat T cell line as a target for our transfections and AGTGTGGGTTGCG-3Ј. The amplified product was cloned into a MluI- stimulated the transfectants with various combinations of MHC II opened and blunt-ended pGL-2 Basic vector. The 3Ј promoter deletant and costimulatory molecules using CHO cells transfected with by guest on September 30, 2021 (pGL-3Ј deletant) was generated by PCR using the HindIII-linked 3Ј primer HLA-DR, HLA-DR/B7-1, HLA-DR/LFA-3, or HLA-DR/B7-1/ Ј Ј anda5 primer located just upstream of the TATA box. The 5 primer con- LFA-3. To facilitate TCR engagement, the superantigen SEE was tained a flanking BglII site and the NFAT site followed by 23 bp mutated by replacing the wild-type sequence with a sequence obtained from Liberg et al. added to the cultures during stimulation. To establish the function- (41). The sequence of the 5Ј primer was 5Ј-GAGAGATCTAAGCACATTT ality of our CD40L promoter constructs, the pGL-X construct con- TCCAGGAACATGCGACGCTAACATCGTACGTCTCTTAACTAATC taining 1.6 kb of the CD40L promoter cloned in front of a lucif- CTGAGTA-3Ј where the mutated sequence is in bold, and the annealing se- erase reporter gene was transfected into Jurkat T cells, and the cells quence is underlined. All promoter deletants and mutants were verified by sequencing. The human IL-2 promoter construct contained the fragment were stimulated with the different CHO transfectants described from Ϫ500 to ϩ60, which had been subcloned into pGL-2 Basic vector as above. As a comparison, the same Jurkat cell line was transfected previously described (42). with an IL-2 promoter reporter construct and stimulated in parallel. Transient transfections and luciferase activity analysis The IL-2 promoter has been shown to contain DNA binding elements for the transcription factors NFAT, NF-␬B, AP-1, and Oct-1 Transfection of Jurkat T cells was conducted using the lipofectin method as (44) and to respond to costimulatory signals in the present assay described by the manufacturer (Life Technologies). Briefly, 2 ␮g of plasmid DNA was mixed with 10 ␮l of lipofectin in 400 ␮l of OptiMEM system (42). As shown in Fig. 1, transcriptional activities of both medium and added to 3 ϫ 106 Jurkat cells. The transfected cells were the pGL-X construct and the IL-2 promoter were induced by stim- incubated for 22 h, and the cells transfected with the same promoter delet- ulation using CHO-DR/B7-1 transfectants in the presence of SEE. ant were pooled. The Jurkat cells (1 ϫ 106 cells/ml) were stimulated in Interestingly, stimulation with CHO-DR/LFA-3 transfectants in ϫ 5 triplicate with the different CHO transfectants (1 10 cells/ml) in the the presence of SEE induced 50% of CD40L promoter activity presence or the absence of 100 ng of SEE/ml, or they were left unstimulated. After8hofincubation the cells were harvested, washed twice in compared with stimulation with DR/B7-1, whereas IL-2 promoter PBS, and treated with 100 ␮l of reporter lysis buffer according to the activity was only marginally induced by DR/LFA-3 as previously manufacturer’s recommendations (Promega). Twenty microliters of each described (42). Stimulation with the triple transfectant CHO-DR/ lysate was assayed for luminescence with luciferase assay substrate (Pro- B7-1/LFA-3 in the presence of SEE resulted in transcriptional in- mega) in a MicroLumat LB 96 P luminometer (EG&G Berthold, Wallac Sverige, Upplands Vasby, Sweden). duction of the CD40L promoter to a similar level as that seen after stimulation with the CHO-DR/B7-1 transfectant. In contrast, tran- EMSA and nuclear extracts scriptional activation of the IL-2 promoter was superinduced using Jurkat cells (1 ϫ 106 cells/ml) were stimulated with the different CHO the triple CHO transfectant. Stimulation with the CHO-DR trans- transfectants (1 ϫ 105 cells/ml) in the presence of 100 ng of SEE/ml or fectant resulted in marginal induction of the IL-2 promoter, while with PMA (50 ng/ml) and ionomycin (1 ␮M) for 6 h, or they were left CD40L transcription was induced about 4-fold. These data suggest unstimulated. Nuclear extracts were prepared according to the method reported by Schreiber et al. (43). Oligonucleotides were labeled with that the IL-2 and CD40L promoters are differently regulated by [␥-32P]ATP by incubation with T4 polynucleotide kinase (Roche Diagnos- costimulatory signals, although they share several similar tran- tics Scandinavia, Bromma, Sweden), annealed to the antisense strand, and scription factor binding sites. 4580 TRANSCRIPTIONAL REGULATION OF CD40L BY COSTIMULATORY MOLECULES

FIGURE 1. CD40L and IL-2 promoter activity in Jurkat T cells induced by costimulatory molecules. Jurkat cells were transiently transfected with the CD40L promoter construct pGL-X (1.6 kb) or with the IL-2 promoter construct. After 22 h the transfected cells were stimulated in triplicate with CHO transfectants with or without 100 ng/ml SEE, or they were left unstimulated. The cells were harvested 8 h after stimulation, and the luciferase activity was measured. Promoter activity is expressed as fold activation compared with transfected, but unstimulated, cells. One representative experiment of at least three performed is shown.

Induction of CD40L promoter activity in response to two NFAT binding sites in the CD40L promoter pertinent for func- costimulatory signals is regulated by two distinct regions tional activity (29, 30). containing NFAT sites Downloaded from To further define the DNA elements involved in CD40L transcrip- The proximal NFAT site is not dependent on binding of AP-1 tion induced by costimulatory molecules we generated promoter for transcriptional activity induced by costimulatory signals deletants by PCR. The different CD40L promoter reporter con- Tsytsykova et al. (30) previously showed that a pentamer of the structs (pGL-X through pGL-TATA) are shown in Fig. 2. The 5Ј proximal NFAT site of the murine CD40L promoter was not suf- deletants of the CD40L promoter were transfected into Jurkat T ficient to drive a luciferase reporter gene when the cells were stim- http://www.jimmunol.org/ cells, and the transfected cells were stimulated with CHO-DR/ ulated with PMA and ionomycin. Rather, this NFAT site required B7-1 cells in the presence of SEE. As a control for each promoter a flanking AP-1 sequence to be transcriptionally active. We con- deletant served transfected, but not stimulated, cells. As shown in structed promoter deletants that contained the proximal NFAT site Fig. 2, CHO-DR/B7-1 transfectants stimulated luciferase activity with and without the AP-1 site attached to it. In addition, we made 12-fold above the control level of the constructs pGL-X, pGL-I, a promoter deletant containing a mutated NFAT site with the AP-1 and pGL-II. The activity dropped to a 6-fold induction of the con- site still intact. As shown in Fig. 3, the transcriptional activity of structs pGL-III, pGL-IV, and pGL-NFAT, with pGL-IV showing the pGL-NFAT/AP-1 deletant was induced 7-fold compared with a slightly higher activity than the other two constructs. This drop the control when stimulated with CHO-DR/B7-1 transfectants in in induced activity corresponded to the deletion of the distal NFAT the presence of SEE. Due to high background activities of the by guest on September 30, 2021 site at position Ϫ283 to Ϫ266 upstream of transcription start. The promoter constructs, we failed to obtain significant induction of next drop in activity was seen using the pGL-TATA construct promoter activities when the cells were stimulated with PMA and containing the TATA box only. This corresponded to deletion ionomycin (data not shown). Deletion of the AP-1 site did not of the proximal NFAT site at positions Ϫ74 to Ϫ57 upstream of affect the transcriptional activity of the construct when the cells transcription start. These data support previous identifications of were stimulated with CHO-DR/B7-1 transfectants in the presence

FIGURE 2. Schematic overview of the murine CD40L promoter region and deletion mapping of the CD40L promoter. The different promoter constructs were generated as described in Materials and Methods. Lengths of promoter deletants correspond to the position relative to the start codon. Jurkat T cells were transiently transfected with the CD40L promoter deletion constructs pGL-X through pGL-TATA or with pGL-2 Basic. After 22 h the transfected cells were stimulated in triplicate with CHO cells expressing DR/B7-1 in the presence of 100 ng/ml SEE, or they were left unstimulated. The cells were harvested 8 h after stimulation, and the luciferase activity was measured. Promoter activity for each deletant is given as fold activation compared with transfected, but unstimulated, cells. One representative experiment of at least three performed is shown. The Journal of Immunology 4581

FIGURE 3. Transcriptional activity of the proximal NFAT site of the CD40L promoter. The different NFAT constructs were generated as described in Materials and Methods. Jurkat T cells were transiently transfected with the different NFAT constructs or with pGL-TATA. After 22 h the transfected cells were stimulated in triplicate with CHO cells expressing DR/B7-1 in the presence of 100 ng/ml SEE, or they were left unstimulated. The cells were harvested 8 h after stimulation, and the luciferase activity was measured. Promoter activity for each construct is expressed as fold activation compared with transfected, but unstimulated, cells. One representative experiment of at least three performed is shown. Downloaded from

of SEE, while mutation of the proximal NFAT site reduced the binding, whereas addition of an oligonucleotide containing the dis- induced promoter activity to background levels, although the AP-1 tal NFAT site (ARRE-2) from the murine IL-2 promoter resulted site was kept intact (Fig. 3). We conclude from these data that in complete competition of protein binding. A control oligonucle-

induction of transcriptional activity of the proximal NFAT site in otide, TRD, did not compete for binding. To further verify NFAT http://www.jimmunol.org/ response to signals through TCR and CD28 is not dependent upon binding we performed supershift assays using Abs toward NFATp AP-1 binding to the suggested AP-1 site. and NFATc. Both NFATp and NFATc have previously been shown to bind to the proximal NFAT site in the CD40L promoter Costimulation through CD2 and CD28 results in quantitative following stimulation with PMA and ionomycin (30). As shown in rather than qualitative differences in nuclear expression of Fig. 4C, addition of either Ab shifted the protein complex binding NFAT proteins to the probe containing the proximal NFAT site in the CD40L The difference in magnitude of CD40L promoter activity in re- promoter after stimulation of the cells with CHO-DR/LFA-3 trans- sponse to various costimulatory signals might be due to either fectants as well as with CHO-DR/B7-1 transfectants in the pres- quantitative or qualitative differences in NFAT induction and bind- ence of SEE. A control Ab (anti-NF-␬B p50) did not shift the by guest on September 30, 2021 ing to the promoter. To investigate NFAT binding to the proximal protein complex. This indicates that the higher CD40L promoter site of the CD40L promoter in detail, we performed a series of activity induced by stimulation through TCR/CD28 compared with EMSAs. As shown in Fig. 4A, when the proximal NFAT site was stimulation through TCR/CD2 is due to increased amounts of used as probe we could detect some background protein binding to NFAT binding to the promoter rather than induction of different the site in unstimulated cells. The binding was increased using NFAT components or the presence in the complex of additional nuclear extracts from cells stimulated with CHO-DR or CHO-DR/ transcription factors. LFA-3 transfectants in the presence of SEE. Maximum binding to Ј the site was found using extracts from cells stimulated with CHO- Induction of transcriptional activity is dependent on a region 3 DR/B7-1 transfectants, while extracts from cells simulated with of the TATA-proximal NFAT site that contains Egr protein PMA and ionomycin showed weaker DNA binding activity. It binding sites should be pointed out that the low m.w. NFAT complex is also As the proximal NFAT site was shown not to be dependent on the present in extracts from CHO-DR-stimulated Jurkat cells in a sim- flanking AP-1 site to be transcriptionally active, we wanted to ilar ratio as in extracts from CHO-DR/B7-1-stimulated Jurkat investigate whether the region downstream of the NFAT site was cells, which can be revealed by longer exposure of the gels (data important for binding factors that interact with NFAT. To this end not shown). An EMSA with an Oct probe was used as a loading we generated a CD40L promoter deletant where the 23 bp between control (Fig. 4A). The data are in line with the results from the the NFAT site and the TATA box were substituted with a sequence transfection assays where we detected a high background promoter that contains no detectable transcription factor binding sites (41). activity with maximum activity using stimulation with CHO-DR/ The promoter deletant was transfected into Jurkat T cells, and the B7-1 transfectants (Fig. 1), but no significant increase in activity cells were stimulated with CHO cells expressing DR/B7-1 in the when the cells were stimulated with PMA and ionomycin (data not presence of SEE. As shown in Fig. 5A, replacement of the 23 bp shown). resulted in reduction of the induced transcriptional activity of the To verify the identity of the formed complex we also performed promoter construct to almost background levels. Also, when the cross-competition experiments using various oligonucleotides as wild-type sequence between the NFAT site and the TATA box was competitors. As shown in Fig. 4B, protein binding to the proximal used as a probe in EMSA, two DNA binding protein complexes NFAT site of the CD40L promoter was competed by addition of appeared in cells stimulated with CHO-DR/B7-1 transfectants unlabeled probe in excess. Addition of an oligonucleotide contain- (Fig. 5B). This suggests the presence of proteins binding 3Ј of the ing the NFAT site and the region 23 bp downstream of the NFAT TATA-proximal NFAT site that may positively influence NFAT- site (CD40L NFAT extended) resulted in enhanced competition of induced transcription. DNA binding. An oligonucleotide containing the mutated NFAT To investigate the identity of the proteins we initially attempted site (CD40L NFAT extended mutated) did not compete for protein to compete protein binding to the probe containing the wild-type 4582 TRANSCRIPTIONAL REGULATION OF CD40L BY COSTIMULATORY MOLECULES

23-bp sequence 3Ј of the NFAT site in EMSA. The complexes were competed for binding when an excess of unlabeled self oligonucleotide was used, but we did not manage to reproducibly compete binding with either oligonucleotides derived from the IL-2 NFAT site or the consensus binding sequences of Egr, NF- ␬B, AP-1, and Oct (data not shown). However, based on sequence similarities we suspected that proteins of the Egr family might bind to the 5Ј region of the sequence and that binding conditions thus may be suboptimal. Therefore, we synthesized an oligonucleotide containing both the proximal NFAT site and the potential Egr binding site. When this oligonucleotide was used as a probe in EMSA together with nuclear extracts from Jurkat cells stimulated with CHO-DR/B7-1 transfectants, three bands appeared (Fig. 5C). To identify the proteins binding in the different complexes we performed supershifts using Abs toward NFATp, NFATc, Egr-1, Egr-2, and Egr-3 as well as a control Ab (anti-NF-␬B p65). As shown in Fig. 5C, the upper complex was supershifted using Abs toward NFATp and NFATc, but also using Abs toward Egr-1 and

possibly Egr-3. Abs toward Egr-2 or p65 did not shift the complex. Downloaded from In conclusion, our data suggest that in response to signals through TCR and CD28, Egr proteins bind to a newly identiﬁed site in the CD40L promoter located just downstream of the proximal NFAT site.

Discussion http://www.jimmunol.org/ Costimulation represents a diligent control system where an immune response is not initiated and amplified if several levels of control have not been passed. However, as in all cascade phenom- ena a given event must be limiting and by exceeding a threshold level of activation trigger downstream events that amplify the bi- ological signal. It is well established that the CD40L is transiently expressed on predominantly CD4ϩ T cells following stimulation through the TCR. It has also been reported that costimulation through CD28 can further induce and stabilize CD40L expression by guest on September 30, 2021 (12, 17–19). We wanted to investigate the regulation of CD40L promoter activity following stimulation through TCR and costimulatory molecules, and we used a system where both signals are present on the same cell, i.e., the CHO transfectants. We first show that the IL-2 promoter and the CD40L promoter are distinctly regulated in response to costimulatory signals. Although transcription of the CD40L gene is induced by TCR ligation alone and further up-regulated by signaling through costimulatory molecules, transcription of the IL-2 gene is not induced until the T cells are fully activated by the presence of both B7 and LFA-3 interactions. This reflects the fact that while CD40L functions as a costimulatory molecule acting early during immune triggering, IL-2 is a cytokine that acts downstream, and once secreted it will trigger several cell FIGURE 4. EMSA showing nuclear expression of NFAT after stimulation types independently of their clonal specificity. Hence, we envision with different CHO transfectants. A, Nuclear extracts from unstimulated Jurkat a scenario where low levels of transcription and expression of cells and cells stimulated with the different CHO cells or with PMA/ionomycin CD40L is triggered by TCR stimulus alone or together with the as described in Materials and Methods were incubated with radiolabeled oli- constitutive costimulatory molecule CD2. This CD40L expression gonucleotide containing the proximal NFAT site of the CD40L promoter. The will induce expression of other costimulatory molecules if the radiolabeled Oct oligonucleotide was used as a control for protein content in proper cell type is taking part in the interaction. The expression of the nuclear extracts. B, Cross-competition experiments using nuclear extracts other costimulatory molecules, such as B7, will induce even higher from cells stimulated with CHO-DR/B7-1 in the presence of SEE. Protein binding was competed for by unlabeled oligonucleotides containing the prox- levels of CD40L expression and trigger an amplification cascade imal CD40L NFAT site (self), CD40L NFAT extended, CD40L NFAT ex- of positive signals. It is implicit in our scenario that CD40L in- tended mutated, IL-2 NFAT (ARRE-2), or TRD. The sequences of the dif- duction and expression is one of the early, key events during T cell ferent competitors are described in Materials and Methods. C, Supershift activation and that this expression is regulated at the level of analysis of NFAT binding complexes using nuclear extracts from cells stim- transcription. ulated with CHO-DR/LFA-3 or CHO-DR/B7-1 transfectants in the presence We also investigated the CD40L promoter in detail by generat- of SEE or PMA/ionomycin. Nuclear extracts were incubated with the radio- ing 5Ј promoter deletants. By transfecting these deletants into Ju- labeled CD40L NFAT oligonucleotide in the presence or the absence of Abs rkat T cells we could identify two areas, both containing NFAT to NFATp or NFATc or a control Ab. One representative experiment of at least binding sites, that are required for promoter activity in response to three performed is shown. costimulatory signals (Fig. 2). Analysis of the TATA-proximal The Journal of Immunology 4583

FIGURE 5. A, Transcriptional regulation of the CD40L 3Ј promoter deletant. The construct with the region 23 bp downstream of the proximal NFAT site substituted was generated by PCR as described in Materials and Methods. Jurkat T cells were transiently transfected with the different constructs as in- dicated. After 22 h the transfected cells were stimulated in triplicate with CHO cells expressing DR/B7-1 in the presence of 100 ng/ml SEE, or they were left unstimulated. The cells were harvested 8 h after stimulation, and the luciferase activity was measured. Promoter activity for each construct is expressed as fold activation compared with transfected, but unstimulated, cells. One representative experiment of three performed is shown. B, EMSA showing protein binding to the CD40L 3Ј promoter deletant wild-type sequence. Nuclear extracts from unstimu- Downloaded from lated Jurkat cells and cells stimulated with CHO-DR/B7-1 transfectants in the presence of SEE as described in Materials and Meth- ods were incubated with the CD40L 3Ј deletant probe. The Oct probe in Fig. 4A serves as a loading control. One representative experi-

ment of at least three performed is shown. C, http://www.jimmunol.org/ Supershift analysis of protein complexes binding to the CD40L NFAT/Egr sequence using nuclear extracts from Jurkat cells stimulated with CHO-DR/B7-1 transfectants in the presence of SEE. Nuclear extracts were incubated with the radiolabeled CD40L NFAT/Egr oligonucleotide in the presence or the absence of Abs to NFATp, NFATc, Egr-1, Egr-2, or Egr-3 or of a control Ab. One representative experiment of three performed is shown. by guest on September 30, 2021

NFAT site showed that it is not dependent on the ﬂanking AP-1 require protein tyrosine kinases (46), which subsequently lead to site, as proposed by Tsytsykova et al. (30) (Fig. 3). However, there activation of AP-1 and NF-␬B (47, 48) as well as NFAT (25). are several differences between our study and the previous one. In Costimulation through CD2 has been shown to induce activation the study performed by Tsytsykova et al., a construct containing of NFAT (26, 49) as well as the mitogen-activated protein kinases pentamers of the proximal NFAT site cloned in front of the SV40 extracellular-regulated kinase and c-Jun N-terminal kinase (49). minimal promoter was shown to be transcriptionally inactive with- As shown in Fig. 1, stimulation through TCR and CD28 results in out the AP-1 site attached to it. In the present study we use the a higher induction of CD40L promoter activity than stimulation original promoter sequence with the NFAT site in the exact posi- through TCR and CD2, which might be due to either qualitative or tion upstream of the endogenous TATA box. In addition, quantitative differences in the composition or activation of induced Tsytsykova et al. used a murine T cell hybridoma, while we trans- transcription factors. As shown in Fig. 4A, stimulation through fected the murine promoter into a human Jurkat T cell line (it TCR/CD28 results in a more dramatic increase in nuclear NFAT should be noted that the murine and the human CD40L promoter expression than stimulation through TCR/CD2, suggesting that the are fully conserved in the sequences containing the NFAT and the higher CD40L promoter activity in response to signals through AP-1 site investigated). Lastly, in the previous study the cells were TCR/CD28 is due to increased nuclear expression of NFAT rather stimulated with PMA and ionomycin. We failed to obtain signif- than to induction of additional transcription factors. Supershift icant induction of transcriptional activity of the CD40L promoter analysis of nuclear extracts from cells stimulated through TCR/ when Jurkat cells were stimulated with PMA and ionomycin due to CD28 or TCR/CD2 also showed similar composition of NFAT high background activities of the constructs. Instead, we used subunit binding to the proximal NFAT site of the promoter regard- CHO transfectants that expressed HLA-DR and the costimulatory less of stimulation (Fig. 4C). molecules B7-1 and LFA-3 on the same cell. Stimulation using NFAT most often requires interactions with additional transcrip- these transfectants will result in ligation to TCR as well as to CD28 tion factors to be active, one of them being AP-1. In the murine or CD2, and the cells will receive the endogenous intracellular IL-2 promoter NFAT interacts with AP-1 in four of ﬁve binding signals from these receptors, which we believe represents a more sites (27). However, the human Fas (CD95) ligand promoter has balanced stimulation procedure. been shown to contain two NFAT binding sites that function in- Signals through TCR induce the activation of protein tyrosine dependently of AP-1 binding (50, 51). The Fas ligand and CD40L kinases that phosphorylate numerous downstream substrates (45), belong to the same family of proteins, the TNF family, and both having as an end point the activation of several transcription fac- molecules are induced early after TCR ligation. Studies of the tors, such as NFAT and NF-␬B. Costimulation through CD28 also NFATp knockout mouse, show defects in early Fas ligand and 4584 TRANSCRIPTIONAL REGULATION OF CD40L BY COSTIMULATORY MOLECULES

CD40L expression (52), suggesting that expression of these mol- vestigating the role of the Egr proteins in regulation of transcrip- ecules may be regulated in similar ways. Our data support this tional activities of the CD40L promoter. theory, because we show that the proximal NFAT site of the CD40L promoter is transcriptionally active without adjacent AP-1 Acknowledgments binding. However, the Fas ligand promoter contains binding sites We thank Dr. Mikael Sigvardsson for critical reading of the manuscript, for AP-1 as well as for additional transcription factors, including and Dr. A. Rahemtullah for the genomic CD40L clone. NF-␬B, but their respective binding sites are not located close to the deﬁned NFAT sites (53, 54). Ј References To investigate putative transcription factors binding 3 of the 1. Lenschow, D. J., T. L. Walunas, and J. A. Bluestone. 1996. CD28/B7 system of NFAT site in the CD40L promoter we focused on the 23-bp region T cell costimulation. Annu. Rev. Immunol. 14:233. between the proximal NFAT site and the TATA box. We substi- 2. Bachmann, M. F., M. Barner, and M. Kopf. 1999. CD2 sets quantitative thresh- olds in T cell activation. J. Exp. Med. 190:1383. tuted the wild-type sequence with a sequence that contains no tran- 3. Foy, T. M., A. Aruffo, J. Bajorath, J. E. Buhlmann, and R. J. Noelle. 1996. scription factor binding sites. The transcriptional activity of the 3Ј Immune regulation by CD40 and its ligand GP39. Annu. Rev. Immunol. 14:591. deletant construct was markedly reduced compared with the NFAT 4. Grewal, I. S., and R. A. Flavell. 1998. CD40 and CD154 in cell-mediated immunity. Annu. Rev. Immunol. 16:111. construct when the cells were stimulated through TCR/CD28 (Fig. 5. Clark, E. A., and J. A. Ledbetter. 1986. Activation of human B cells mediated 5A). When the wild-type sequence was used as a probe in EMSA, through two distinct cell surface differentiation antigens, Bp35 and Bp50. Proc. two weak bands appeared upon stimulation of the Jurkat cells with Natl. Acad. Sci. USA 83:4494. 6. Alderson, M. R., R. J. Armitage, T. W. Tough, L. Strockbine, W. C. Fanslow, and the CHO-DR/B7-1 transfectant (Fig. 5B). We tried to compete for M. K. Spriggs. 1993. CD40 expression by human monocytes: regulation by cy- binding of these two complexes by using various binding se- tokines and activation of monocytes by the ligand for CD40. J. Exp. Med. 178: Downloaded from quences for different transcription factors, but none of these com- 669. 7. Romani, N., A. Lenz, H. Glassel, H. Stossel, U. Stanzl, O. Majdic, P. Fritsch, and peted consistently, except for an excess of the cold probe. How- G. Schuler. 1989. Cultured human Langerhans cells resemble lymphoid dendritic ever, the Egr consensus sequence, 5Ј-GCG(G/T)GGGCG-3Ј, cells in phenotype and function. J. Invest. Dermatol. 93:600. competed for binding occasionally. This sequence shows striking 8. Freudenthal, P. S., and R. M. Steinman. 1990. The distinct surface of human blood dendritic cells, as observed after an improved isolation method. Proc. Natl. similarities to the sequence located in the 5Ј end of the 23-bp Acad. Sci. USA 87:7698.

region of the CD40L promoter, just downstream of the proximal 9. Gray, D., P. Dullforce, and S. Jainandunsing. 1994. Memory B cell development http://www.jimmunol.org/ Ϫ Ϫ but not germinal center formation is impaired by in vivo blockade of CD40-CD40 NFAT site (positions 56 to 48). The sequence in the murine ligand interaction. J. Exp. Med. 180:141. CD40L promoter is 5Ј-GTGTGGGTT-3Ј, and that in the human 10. Kawabe, T., T. Naka, K. Yoshida, T. Tanaka, H. Fujiwara, S. Suematsu, promoter 5Ј-GTGTGGGCT-3Ј. The sequence similarities and the N. Yoshida, T. Kishimoto, and H. Kikutani. 1994. The immune responses in CD40-deficient mice: impaired immunoglobulin class switching and germinal competition experiments together suggest that Egr proteins may center formation. Immunity 1:167. bind to this region. However, because the sequence is located at 11. MacLennan, I. C. 1994. Germinal centers. Annu. Rev. Immunol. 12:117. the very end of the 23-bp region, it may result in inadequate bind- 12. Yin, D., L. Zhang, R. Wang, L. Radvanyi, C. Haudenschild, Q. Fang, M. R. Kehry, and Y. Shi. 1999. Ligation of CD28 in vivo induces CD40 ligand ing conditions for the proteins. Therefore, we generated an oligo- expression and promotes B cell survival. J. Immunol. 163:4328. nucleotide containing the proximal NFAT site as well as the sus- 13. Caux, C., C. Massacrier, B. Vanbervliet, B. Dubois, C. Van Kooten, I. Durand, pected Egr binding site (positions Ϫ74 to Ϫ45). When this and J. Banchereau. 1994. Activation of human dendritic cells through CD40 by guest on September 30, 2021 cross-linking. J. Exp. Med. 180:1263. oligonucleotide was used in EMSA together with nuclear extracts 14. Peguet-Navarro, J., C. Dalbiez-Gauthier, F. M. Rattis, C. Van Kooten, from CHO-DR/B7-1 stimulated Jurkat cells, three bands appeared J. Banchereau, and D. Schmitt. 1995. Functional expression of CD40 antigen on (Fig. 5C). Supershift assays revealed that the upper complex con- human epidermal Langerhans cells. J. Immunol. 155:4241. 15. Cella, M., D. Scheidegger, K. Palmer-Lehmann, P. Lane, A. Lanzavecchia, and tained NFATc and NFATp as well as Egr-1 and possibly Egr-3 G. Alber. 1996. Ligation of CD40 on dendritic cells triggers production of high (Fig. 5C). It has recently been shown that both the Egr-1 and Egr-3 levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via proteins bind to the same region (FLRE) in the human Fas ligand APC activation. J. Exp. Med. 184:747. 16. Koch, F., U. Stanzl, P. Jennewein, K. Janke, C. Heufler, E. Kampgen, N. Romani, promoter, but only Egr-3 was shown to induce transcriptional ac- and G. Schuler. 1996. High level IL-12 production by murine dendritic cells: tivity (55). However, another study of the human Fas ligand pro- upregulation via MHC class II and CD40 molecules and downregulation by IL-4 and IL-10. J. Exp. Med. 184:741. moter showed that Egr-1 and Egr-3 bind together with NFAT on 17. Yang, Y., and J. M. Wilson. 1996. CD40 ligand-dependent T cell activation: two sites and cooperate with NFAT to induce transcription on requirement of B7-CD28 signaling through CD40. Science 273:1862. three sites in the promoter (56). 18. Ding, L., J. M. Green, C. B. Thompson, and E. M. Shevach. 1995. B7/CD28- dependent and -independent induction of CD40 ligand expression. J. Immunol. We do not currently know whether both Egr-1 and Egr-3 are 155:5124. involved in transcriptional regulation of the CD40L promoter or 19. Johnson-Leger, C., J. Christensen, and G. G. Klaus. 1998. CD28 co-stimulation whether cooperation with NFAT is required. However, mutation of stabilizes the expression of the CD40 ligand on T cells. Int. Immunol. 10:1083. 20. Peng, X., A. Kasran, P. A. Warmerdam, M. de Boer, and J. L. Ceuppens. 1996. the proximal NFAT site as well as deletion of the Egr site reduced Accessory signaling by CD40 for T cell activation: induction of Th1 and Th2 the induced transcriptional activity to background levels, suggest- cytokines and synergy with interleukin-12 for interferon-␥ production. Eur. J. Im- ing a cooperation between the two transcription factors. Supershift munol. 26:1621. 21. Cayabyab, M., J. H. Phillips, and L. L. Lanier. 1994. CD40 preferentially co- assays also revealed that the NFAT proteins and the Egr proteins stimulates activation of CD4ϩ T lymphocytes. J. Immunol. 152:1523. bind together in a complex, as previously shown in the Fas ligand 22. Blotta, M. H., J. D. Marshall, R. H. DeKruyff, and D. T. Umetsu. 1996. Cross- ϩ promoter (56). This supports the idea that the CD40L promoter is linking of the CD40 ligand on human CD4 T lymphocytes generates a costimulatory signal that up-regulates IL-4 synthesis. J. Immunol. 156:3133. regulated similarly to the Fas ligand promoter where binding of 23. van Essen, D., H. Kikutani, and D. Gray. 1995. CD40 ligand-transduced co- NFAT and Egr-3 (and perhaps Egr-1), but not AP-1, has been stimulation of T cells in the development of helper function. Nature 378:620. shown to be important for transcriptional activity induced by sig- 24. Blair, P. J., J. L. Riley, D. M. Harlan, R. Abe, D. K. Tadaki, S. C. Hoffmann, L. White, T. Francomano, S. J. Perfetto, A. D. Kirk, et al. 2000. CD40 ligand nals through TCR. (CD154) triggers a short-term CD4ϩ T cell activation response that results in In conclusion, we have described the induction of CD40L pro- secretion of immunomodulatory cytokines and apoptosis. J. Exp. Med. 191:651. 25. Ghosh, P., A. Sica, M. Cippitelli, J. Subleski, R. Lahesmaa, H. A. Young, and moter activity in response to signals through TCR and CD28 to be N. R. Rice. 1996. Activation of nuclear factor of activated T cells in a cyclosporin dependent on binding of NFAT to two sites in the promoter, where A-resistant pathway. J. Biol. Chem. 271:7700. the proximal NFAT site is not dependent on AP-1 binding. We 26. Tanaka, N., H. Abe, H. Yagita, K. Okumura, M. Nakamura, and K. Sugamura. 1997. Itk, a T cell-specific tyrosine kinase, is required for CD2-mediated inter- have also identified a previously unknown Egr binding site located leukin-2 promoter activation in the human T cell line Jurkat. Eur. J. Immunol. just downstream of the proximal NFAT site. We are currently in- 27:834. The Journal of Immunology 4585

27. Rooney, J. W., Y. L. Sun, L. H. Glimcher, and T. Hoey. 1995. Novel NFAT sites 42. Parra, E., M. Varga, G. Hedlund, T. Kalland, and M. Dohlsten. 1997. Costimu- that mediate activation of the interleukin-2 promoter in response to T-cell recep- lation by B7-1 and LFA-3 targets distinct nuclear factors that bind to the inter- tor stimulation. Mol. Cell Biol. 15:6299. leukin-2 promoter: B7-1 negatively regulates LFA-3- induced NF-AT DNA bind- 28. Rao, A. 1995. NFATp, a cyclosporin-sensitive transcription factor implicated in ing. Mol. Cell. Biol. 17:1314. cytokine gene induction. J. Leukocyte Biol. 57:536. 43. Schreiber, E., P. Matthias, M. M. Muller, and W. Schaffner. 1989. Rapid detec- 29. Schubert, L. A., G. King, R. Q. Cron, D. B. Lewis, A. Aruffo, and tion of octamer binding proteins with ‘mini-extracts,’ prepared from a small D. Hollenbaugh. 1995. The human gp39 promoter: two distinct nuclear factors of number of cells. Nucleic Acids Res. 17:6419. activated T cell protein-binding elements contribute independently to transcrip- 44. Rothenberg, E. V., and S. B. Ward. 1996. A dynamic assembly of diverse tran- tional activation. J. Biol. Chem. 270:29624. scription factors integrates activation and cell-type information for interleukin 2 30. Tsytsykova, A. V., E. N. Tsitsikov, and R. S. Geha. 1996. The CD40L promoter gene regulation. Proc. Natl. Acad. Sci. USA 93:9358. contains nuclear factor of activated T cells-binding motifs which require AP-1 45. Wange, R. L., and L. E. Samelson. 1996. Complex complexes: signaling at the binding for activation of transcription. J. Biol. Chem. 271:3763. TCR. Immunity 5:197. 31. Brabletz, T., I. Pietrowski, and E. Serﬂing. 1991. The immunosuppressives FK 46. Vandenberghe, P., G. J. Freeman, L. M. Nadler, M. C. Fletcher, M. Kamoun, 506 and cyclosporin A inhibit the generation of protein factors binding to the two L. A. Turka, J. A. Ledbetter, C. B. Thompson, and C. H. June. 1992. Antibody purine boxes of the interleukin 2 enhancer. Nucleic Acids Res. 19:61. and B7/BB1-mediated ligation of the CD28 receptor induces tyrosine phosphor- 32. Mattila, P. S., K. S. Ullman, S. Fiering, E. A. Emmel, M. McCutcheon, ylation in human T cells. J. Exp. Med. 175:951. G. R. Crabtree, and L. A. Herzenberg. 1990. The actions of cyclosporin A and 47. Jung, S., A. Yaron, I. Alkalay, A. Hatzubai, A. Avraham, and Y. Ben-Neriah. FK506 suggest a novel step in the activation of T lymphocytes. EMBO J. 9:4425. 1995. Costimulation requirement for AP-1 and NF-␬B transcription factor acti- 33. Rao, A., C. Luo, and P. G. Hogan. 1997. Transcription factors of the NFAT vation in T cells. Ann. NY Acad. Sci. 766:245. family: regulation and function. Annu. Rev. Immunol. 15:707. 48. Rincon, M., and R. A. Flavell. 1994. AP-1 transcriptional activity requires both 34. Lopez-Rodriguez, C., J. Aramburu, A. S. Rakeman, and A. Rao. 1999. NFAT5, T-cell receptor-mediated and co-stimulatory signals in primary T lymphocytes. a constitutively nuclear NFAT protein that does not cooperate with Fos and Jun. EMBO J. 13:4370. Proc. Natl. Acad. Sci. USA 96:7214. 49. Ueno, H., S. Matsuda, K. Katamura, M. Mayumi, and S. Koyasu. 2000. ZAP-70 35. Jain, J., P. G. McCaffrey, Z. Miner, T. K. Kerppola, J. N. Lambert, G. L. Verdine, is required for calcium mobilization but is dispensable for mitogen-activated T. Curran, and A. Rao. 1993. The T-cell transcription factor NFATp is a substrate protein kinase (MAPK) superfamily activation induced via CD2 in human T for calcineurin and interacts with Fos and Jun. Nature 365:352. cells. Eur. J. Immunol. 30:78. Downloaded from 36. de Grazia, U., M. P. Felli, A. Vacca, A. R. Farina, M. Maroder, L. Cappabianca, 50. Latinis, K. M., L. A. Norian, S. L. Eliason, and G. A. Koretzky. 1997. Two NFAT D. Meco, M. Farina, I. Screpanti, L. Frati, et al. 1994. Positive and negative transcription factor binding sites participate in the regulation of CD95 (Fas) li- regulation of the composite octamer motif of the interleukin 2 enhancer by AP-1, gand expression in activated human T cells. J. Biol. Chem. 272:31427. Oct-2, and retinoic acid receptor. J. Exp. Med. 180:1485. 51. Holtz-Heppelmann, C. J., A. Algeciras, A. D. Badley, and C. V. Paya. 1998. 37. Castigli, E., T. A. Chatila, and R. S. Geha. 1993. A protein of the AP-1 family Transcriptional regulation of the human FasL promoter-enhancer region. J. Biol. is a component of nuclear factor of activated T cells. J. Immunol. 150:3284. Chem. 273:4416. 38. Jain, J., P. G. McCaffrey, V. E. Valge-Archer, and A. Rao. 1992. Nuclear factor 52. Hodge, M. R., A. M. Ranger, F. Charles de la Brousse, T. Hoey, M. J. Grusby,

of activated T cells contains Fos and Jun. Nature 356:801. and L. H. Glimcher. 1996. Hyperproliferation and dysregulation of IL-4 expres- http://www.jimmunol.org/ 39. Gjorloff, A., G. Hedlund, T. Kalland, D. Sansom, H. Fischer, J. Trowsdale, sion in NF-ATp-deficient mice. Immunity 4:397. H. O. Sjogren, and M. Dohlsten. 1992. The LFA-3 adhesion pathway is differ- 53. Matsui, K., S. Xiao, A. Fine, and S. T. Ju. 2000. Role of activator protein-1 in ently utilized by superantigen- activated human CD4ϩ T-cell subsets. Scand TCR-mediated regulation of the murine fasl promoter. J. Immunol. 164:3002. J. Immunol. 36:243. 54. Kasibhatla, S., L. Genestier, and D. R. Green. 1999. Regulation of fas-ligand 40. Parra, E., A. G. Wingren, G. Hedlund, M. Bjorklund, H. O. Sjogren, T. Kalland, expression during activation-induced cell death in T lymphocytes via nuclear D. Sansom, and M. Dohlsten. 1994. Costimulation of human CD4ϩ T lympho- factor ␬B. J. Biol. Chem. 274:987. cytes with B7 and lymphocyte function-associated antigen-3 results in distinct 55. Mittelstadt, P. R., and J. D. Ashwell. 1998. Cyclosporin A-sensitive transcription cell activation profiles. J. Immunol. 153:2479. factor Egr-3 regulates Fas ligand expression. Mol. Cell Biol. 18:3744. 41. Liberg, D., M. Sigvardsson, M. Bemark, and T. Leanderson. 1998. Differentia- 56. Li-Weber, M., O. Laur, and P. H. Krammer. 1999. Novel Egr/NF-AT composite tion-specific, octamer-dependent costimulation of ␬ transcription. J. Immunol. sites mediate activation of the CD95 (APO- 1/Fas) ligand promoter in response 160:3899. to T cell stimulation. Eur. J. Immunol. 29:3017. by guest on September 30, 2021