Critical Elements of the Immunoglobulin Heavy Chain Gene Enhancers for Deregulated Expression of Bcl-21

[CANCER RESEARCH 63, 6666–6673, October 15, 2003] Critical Elements of the Immunoglobulin Heavy Chain Gene Enhancers for Deregulated Expression of Bcl-21

Caroline A. Heckman, Thai Cao, Lina Somsouk, Hong Duan, John W. Mehew, Chun-yi Zhang, and Linda M. Boxer2 Center for Molecular Biology in Medicine, Veterans Affairs Palo Alto Health Care System and the Department of Medicine, Stanford University School of Medicine, Stanford, California 94305

ABSTRACT (20) and as positive regulators in sporadic Wilms’ tumors (21). Although these transcription factors play a role in the deregulated Translocation of the bcl-2 gene to the immunoglobulin heavy chain gene bcl-2 expression in t(14;18) lymphoma cells, it is likely that regulatory is the most common alteration in follicular lymphoma. The result is the regions of the immunoglobulin heavy chain locus influence bcl-2 deregulated expression of bcl-2 and increased resistance to cell death. Regulation of the immunoglobulin heavy chain gene is controlled in part expression as well. by four DNase I-hypersensitive regions located 3؅ of the gene. Here, we Studies on the regulation of the immunoglobulin heavy chain gene show that these four enhancer regions also contribute to bcl-2 up-regula- have identified several enhancers (22). Four B-cell-specific DNase tion in t(14;18) cells. The enhancers are able to individually or in combi- I-hypersensitive sites, HS1 to HS4, are located 10–35 kb 3Ј of the nation activate bcl-2 promoter activity. The HS4 enhancer region was murine C␣ gene (23–26). The activity of the individual enhancer found to impart the largest positive effect on the bcl-2 promoter, activating regions varies during B-cell differentiation (23, 27, 28), and these it by 6-fold, whereas addition of the HS1,2 region with HS4 increased enhancers function as a locus control region in B cells (23). Enhancers promoter activity by approximately 9-fold. Nuclear factor ␬B binding are also located downstream of two human C␣ genes, and these sites were shown to be primarily responsible for the positive activity regions share some homology with the murine enhancers, although contributed by the HS1,2 and HS4 regions, and we observed the in vivo they are not as well characterized (29–31). Several transcription interaction of these factors with the human immunoglobulin heavy chain gene enhancer regions in t(14;18) cells. In addition, two Sp1 binding sites factor-binding sites have been identified in these enhancer regions, ␬ in HS4 were also found to positively influence bcl-2 activity, and Sp1 was including sites for NF- B (32–34), Oct (32–34), Pax5/BSAP [B-cell observed to interact with the human HS4 enhancer in vivo. These results lineage-specific activator protein (35, 36)], Bach2/Maf (37), AP1 suggest that the interactions of the nuclear factor ␬B and Sp1 transcrip- (38), and Ets proteins (38–40). tion factors with the immunoglobulin heavy chain enhancer region are In this study, we describe the activation of the bcl-2 promoter by the important for bcl-2 deregulation in t(14;18) cells. immunoglobulin heavy chain gene 3Ј enhancers. Enhancer region HS4 is the most active with the bcl-2 promoter, and different combinations of the 3Ј enhancers show increased activation of bcl-2 expres- INTRODUCTION sion. NF-␬B proteins play an important role through sites in HS1,2 ␬ The t(14;18) translocation involves the bcl-2 gene on chromosome and HS4. In vivo binding of NF- B to these sites was demonstrated by 18 and the IgH gene on chromosome 14 (1–3). This translocation is ChIP assays in t(14;18) lymphoma cells. In addition, two Sp1 sites are present in the majority of follicular lymphomas and results in the required for the activity of the HS4 enhancer with the bcl-2 promoter. deregulated expression of bcl-2. Increased levels of Bcl-2 protect the These sites have not been previously described as important for the cells from apoptosis (4, 5) and enhance resistance to chemotherapeutic regulation of the immunoglobulin gene promoters. agents (6–9). Two promoters mediate initiation of bcl-2 gene transcription. In B MATERIALS AND METHODS cells, the 5Ј promoter is the most active, whereas there is very little transcription from the 3Ј promoter. Several factors that regulate bcl-2 Plasmid Constructs. The bcl-2 promoter-luciferase reporter construct for transient transfections has been described previously (11, 19). Creation of the transcription have been identified. A CRE3 mediates the positive Ј IgH enhancer-bcl-2 promoter-luciferase reporter constructs was accomplished regulation of the 5 promoter (P1). We have shown that this activity by PCR amplification of the DNase I-hypersensitive regions HS1,2, HS3, and ␬ is due to both CREB and NF- B family members binding to this site HS4 from mouse genomic DNA with primers based on the published sequence, (10–12). The CRE site is required for the increased expression of which incorporated unique restriction sites. Hypersensitive regions 1 and 2 bcl-2 in activated B cells and for the rescue of immature B cells from (HS1,2) were amplified together due to their close proximity to each other, calcium-dependent apoptosis, and the activation of CREB is mediated whereas hypersensitive regions 3 and 4 (HS3 and HS4) were amplified by protein kinase C (11). The CRE site is also required for bcl-2 separately. The following sequences were used as primers: 5Ј HS1,2, TACG- expression in neuronal cells (13), prostate cancer cells (14), and TATGATAGAGAGGAGATGACAGAAGG; 3Ј HS1,2, GTCGACCCAACT- cardiomyocytes (15) and for estrogen receptor activation of the bcl-2 GCAGTTGACAAACTGAGCAG; 5Ј HS3, GTCGACTCTAGAACCACAT- Ј promoter in mammary cells (16). Both insulin-like growth factor I and GCGATCTAAGGG; 3 HS3, TCGCGAGATCATTGAGCTCCGGCTCTA- ACAAC; 5Ј HS4, TCGCGACTGCAGACTCACTGTTCACCATGAACCC; Akt/protein kinase B induce the bcl-2 promoter through the CRE site and 3Ј HS4, ACGCGTAGCTTGGAGTTAGGTGGGTAGGTGAGTGC. PCR (17, 18). The bcl-2 promoter also contains WT1 binding sites, which amplification of the HS1,2 region resulted in a 1564-bp product, whereas HS3 act as negative regulators of bcl-2 in t(14;18) cells (19) and HeLa cells amplification produced a 1182-bp amplicon, and amplification of the HS4 regions resulted in a 1381-bp product. The PCR products were cloned into a Received 2/11/03; revised 6/25/03; accepted 7/30/03. TA cloning vector (Clontech). A linker containing four unique restriction sites The costs of publication of this article were defrayed in part by the payment of page was cloned into the bcl-2 promoter-luciferase reporter construct, and the charges. This article must therefore be hereby marked advertisement in accordance with enhancer sequences were then inserted individually or in different combina- 18 U.S.C. Section 1734 solely to indicate this fact. Ј 1 Supported by NIH Grant CA56764. tions using the unique sites. The 5 deletions of HS1,2 and HS4 were created 2 To whom requests for reprints should be addressed, at Hematology, CCSR 1155, 269 by PCR amplification using 5Ј primers based on different regions of the Campus Drive, Stanford University School of Medicine, Stanford, CA 94305-5156. enhancer, which contained the unique restriction site, and the 3Ј primers Phone: (650) 849-0551; Fax: (650) 858-3982; E-mail: [email protected]. described above. These amplified sequences were cloned into a TA vector 3 The abbreviations used are: CRE, cAMP-responsive element; CREB, CRE-binding protein; NF-␬B, nuclear factor ␬B; EMSA, electrophoretic mobility shift assay; ChIP, (Clontech and Invitrogen) and then substituted for the full-length sequences in chromatin immunoprecipitation assay. the reporter construct. Similarly, the 3Ј deletions were created with the 5Ј 6666

primers described above and with new 3Ј primers representing different antibody were added to the completed binding reaction, and this was incubated regions of the enhancers. All deletions were cloned into a reporter construct for1hat4°C. All antibodies were acquired from Santa Cruz Biotechnology. containing the bcl-2 promoter with the full-length sequences of the other Electrophoresis was performed in a 0.5ϫ Tris borate-EDTA 5% polyacryl- enhancer regions, and all constructs were confirmed by sequence analysis. amide gel at 20 mA and 4°C. The episomal IgH enhancer-bcl-2-luciferase reporter construct was created ChIP Assay. The ChIP assay was performed as outlined previously (12). by digesting pREP4 (Invitrogen) with SalI and then gel-purifying the backbone For PCR amplification, the following oligonucleotide sequences from the fragment containing the EBV oriP and EBNA-1 sequences and ligating it with human IgH locus were used as primers: HS4 NF-␬B and 5Ј Sp1 sense, a linker sequence. The IgH enhancer, bcl-2 promoter, and firefly luciferase CAGGCACAAACACATTCTTGCA; HS4 NF-␬B and 5Ј Sp1 antisense, sequences were then inserted into the modified episomal vector through the GAATAGTCAGGAATCCTGCAAAC; HS4 3Ј Sp1 sense, GCAGGATTC- unique restriction sites contained in the linker. To create an episomal Renilla CTGACTATTCACAC; HS4 3Ј Sp1 antisense, CAGATCTTCTCCTAG- luciferase vector, the Renilla luciferase cDNA was removed from the pRL-TK CAGGGTC; HS1,2 NF-␬B sense, CATGGCAGGACCCACTTTCCTCAC; vector (Promega) and subcloned into the NheI and BamHI sites of pREP4 and HS1,2 NF-␬B antisense, TCGGGCCTCAGGGCTCTGCATC. Amplifica- (Invitrogen). The I␬B␣-SR expression vector was a gift from Dr. Arnold tion of the HS4 NF-␬B and 5Ј Sp1 immunoprecipitated samples required 34 Rabson (University of Medicine and Dentistry of New Jersey). cycles and an annealing temperature of 55°C. For amplification of the HS4 3Ј Site-Directed Mutagenesis. Mutation of the HS4 NF-␬B binding site was Sp1 ChIP samples, 44 cycles and an annealing temperature of 65°C were used. described previously (41). To mutate the two HS4 Sp1 binding sites and the Amplification of the HS1,2 NF-␬B site required 32 cycles and a 60°C anneal- HS1,2 NF-␬B binding site, Stratagene’s Chameleon Double-Stranded Site- ing temperature. PCR products were resolved on 2% agarose gels and visual- Directed Mutagenesis kit was used with the following primers: HS4, 5Ј Sp1, ized by ethidium bromide staining. GCATGGTGCTGGGACGGGTTGGCCCTGG; HS4 3Ј Sp1, CCAGTCT- GGGTACCTGTCCTATACACCCCAAAGAAGC; and HS1,2 NF-␬B, GGC- RESULTS CTATGCTGGGAGTCGAGCATCCCCAAGGCTGG. Although neither HS4 region contained an exact Sp1 binding site, both contained a GGA Increased bcl-2 Promoter Activity with the Immunoglobulin -sequence that was changed to the underlined bases. The NF-␬B binding site in Heavy Chain Gene 3؅ Enhancers. The activity of the IgH 3Ј en HS1,2 is indicated by bold type, and the mutated bases are underlined. hancers is believed to contribute to bcl-2 deregulation in t(14;18) Incorporation of the mutations was confirmed by sequence analysis. lymphomas. To determine which enhancer regions activate the bcl-2 Transfections. The DHL-4 cell line is a human B-cell line containing the promoter, we created a series of reporter constructs containing the t(14;18) translocation and has been described previously (10). These cells were bcl-2 promoter with the luciferase reporter gene and different combi- maintained in RPMI 1640 with 10% FCS, L-glutamine, penicillin, and strep- nations of the IgH 3Ј enhancers. A schematic diagram of the IgH tomycin. For each transient reporter gene assay, 2 ϫ 107 cells at mid-log phase enhancer regions that were cloned is shown in Fig. 1A, and the were pelleted and washed twice with unsupplemented RPMI 1640. The cells were resuspended in 0.75 ml of RPMI 1640 and mixed with 20 ␮gof different reporter constructs are illustrated in Fig. 1B. DNase I-hyper- DEAE-dextran. The cells were then placed in a 0.4-cm electroporation cuvette sensitive regions 1 and 2 were amplified and cloned together due to with 10 ␮g of the reporter plasmid and 0.1 ␮g of the pRL-TK vector (Promega) their close proximity to each other. As shown in Fig. 1C, each containing the Renilla luciferase cDNA. Electroporation was carried out at 975 enhancer region alone showed some positive regulatory activity with ␮F and 320 V using the Bio-Rad Gene Pulser. The electroporated cells were the bcl-2 promoter. HS4 demonstrated the strongest contribution with allowed to recover at 37°C in 25 ml of supplemented RPMI 1640 for approx- a 6-fold increase in promoter activity, whereas the HS1,2 region imately 48 h. These cells were then pelleted, washed twice with PBS solution, increased promoter activity by 2.6-fold, and HS3 alone displayed only and resuspended in 100 ␮l of passive lysis buffer (Promega). The firefly and a 1.8-fold increase. Additionally, combinations of the enhancer re- Renilla luciferase activities in the cell lysates were quantitated using Pro- gions exhibited additive effects. The combination of HS1,2 and 4 mega’s Dual Luciferase Assay System on a Femtomaster FB12 luminometer (HS124) increased bcl-2 promoter activity by 8.8-fold, and all four (Zylux). Results were normalized to the Renilla luciferase activity. All trans- enhancer regions (HS1234) resulted in a 10-fold increase in bcl-2 fections were performed at least six times using two different plasmid prepa- rations. In the cotransfection assays, either 5 ␮g of the I␬B␣-SR expression promoter activity. vector or an empty expression vector was included with 10 ␮g of the reporter Identification of the Active Regions of HS4. Enhancer HS4 was construct and 0.1 ␮g of pRL-TK. Transfected cells were incubated for 48 h the most active one with the bcl-2 promoter. To locate the elements before analysis. For transfection of the episomal vectors, the same conditions that contributed to this activity, we first constructed a series of 5Ј were used except that 10 ␮g of the reporter construct and 5 ␮g of the episomal deletions of the HS4 region as shown in Fig. 2A. Results from Renilla vector were used for each transfection. Hygromycin was added to a transfections of DHL-4 cells with reporter constructs containing these final concentration of 400 ␮g/ml 24 h after transfection. The cells were deletions showed a sharp drop in activity between HS4 bases 652 and allowed to recover for 3–6 days and then assayed for luciferase activity as 663 (Fig. 2B). Analysis of this region revealed a NF-␬B binding site described previously. that was described in other studies examining IgH gene expression EMSA. The double-stranded oligonucleotides of the HS4 NF-␬B binding (33) and c-myc deregulation in t(8;14) lymphomas (41). site and the consensus NF-␬B binding site have been described previously (41). The oligonucleotides of the HS4 Sp1 binding sites and the HS1,2 NF-␬B To further identify elements that could not be distinguished through Ј binding site are listed below with mutated bases in bold type (the noncoding the 5 deletions, we also constructed a number of HS4 deletions sequences are shown 3Ј to 5Ј): HS4 5Ј Sp1, CTGGGGGAGGTTGGCCCTG- starting from the 3Ј end (Fig. 2C). Transfection of these reporter GATCAG and GACCCCCTCCAACCGGGACCTAGTC; HS4 mut 5Ј Sp1, constructs into DHL-4 cells resulted in the identification of two new CTGGGACGGGTTGGCCCTGGATCAG and GACCCTGCCCAACCGG- positive regulatory regions (Fig. 2D). The first region was just 3Ј of GACCTAGTC; HS4 3Ј Sp1, GTGGAATACACCCCAAAG and CACCTT- the NF-␬B binding site between bases 729 and 770 and contained a ATGTGGGGTTTC; HS4 mut 3Ј Sp1, GTCCTATACACCCCAAAG and weak Sp1 consensus sequence. The second region was at the very 3Ј ␬ CAGGATATGTGGGGTTTC; HS1,2 NF- B, ATGCTGGGAGTCCCCC- end of the HS4 sequence between bases 1067 and 1083. This site had ATCCCCAAG and TACGACCCTCAGGGGGTAGGGGTTC; and HS1,2 little resemblance to known transcription factor binding sites, al- mut NF-␬B, ATGCTGGGAGTCGAGCATCCCCAAGGGAC and TACGA- though there was some homology to a Rel consensus sequence. CCCTCAGCTCGTAGGGGTTCCCTG. The oligonucleotides were synthe- sized with 5Ј overhangs, annealed, and labeled with [␣-32P]dCTP using Kle- Neither region had been described in previous studies of IgH gene now polymerase. The binding conditions have been described previously (42, regulation, yet both appeared to contribute to bcl-2 activation in 43). For DNA competition experiments, a 100-fold molar excess of unlabeled t(14;18) lymphoma cells. oligonucleotide was added before the 20-min room temperature incubation NF-␬B and Sp1 Interact with Sequences in HS4 in Vitro. To with nuclear extract and labeled probe. For the supershift experiments, 4 ␮gof determine whether NF-␬B family members interacted with HS4 in 6667

Fig. 1. Increased bcl-2 promoter activity in the presence of immunoglobulin heavy chain enhancers. A, schematic diagram of the immunoglobulin heavy chain region and the DNase I-hypersensitive regions. There are four tissue- and cell-specific DNase I-hypersensitive sites, HS1–HS4. HS1 and HS2 are located close together and were amplified as one sequence. B, illustration of the bcl-2 promoter-luciferase reporter constructs with cloned IgH 3Ј DNase I-hypersensitive regions. C, results from transient transfections of DHL-4 cells with the bcl-2 promoter-luciferase-enhancer reporter constructs. Luciferase activity was normalized to the activity of the construct containing the bcl-2 promoter without any enhancers. The activity of that construct was given a value of 100, and the activity of all other transfections was plotted relative to that value.

DHL-4 cells, we used DHL-4 nuclear extract with a sequence representing the NF-␬B binding site for EMSA. As shown in Fig. 3A, Lane 1, a specific complex was observed with the HS4 NF-␬B binding site in vitro. This complex could be competed with a 100-fold molar excess of the wild-type competitor or a NF-␬B consensus sequence (Fig. 3A, Lanes 2 and 4), but little competition was observed with the addition of a 100-fold molar excess of a sequence containing a mutation to the NF-␬B site or a nonspecific sequence (Fig. 3A, Lanes ␬ 3 and 5). The addition of antibodies specific for NF- B family Fig. 2. Identification of the active regions in HS4 with the bcl-2 promoter. A, diagram members p50, p52, RelA, c-Rel, and RelB all resulted in a supershifts of the HS4 5Ј deletion constructs with the location of the NF-␬B site indicated. B, results or diminishment of the specific complex, therefore indicating the of transient transfection analysis with the bcl-2 promoter and the 5Ј deletions of HS4 in ␬ DHL-4 cells. The activity of the bcl-2 promoter with all four enhancer regions (HS1–HS4) presence of these proteins in the complex with the HS4 NF- B was assigned a value of 100, and the activity from the other transfections was plotted binding site (Fig. 3A, Lanes 6–10). relative to that value. C, diagram of the HS4 3Ј deletion constructs with the location of the From the 3Ј deletion analysis of HS4, two positive regulatory Sp1 and NF-␬B sites indicated. D, results of transient transfection analysis of the 3Ј deletions of HS4 and the bcl-2 promoter. regions were identified. The 5Ј region contained a weak consensus 6668

3C, Lane 2). Closer examination of the sequence revealed a slight similarity to the Sp1 site described above, and when a similar mutation was made in this region, the mutated sequence failed to compete for the specific complexes, as did a nonspecific sequence (Fig. 3C, Lanes 3 and 4). In addition, incubation with a Sp1 antibody resulted in a supershift, which was not observed upon incubation with a nonspecific antibody (Fig. 3C, Lanes 5 and 6). We therefore concluded that Sp1 interacted with this region of HS4 as well. In Vivo Analysis of NF-␬B and Sp1 Interaction with HS4 in t(14;18) Cells. Although we observed NF-␬B family members inter- acting with the HS4 sequence in vitro, we wished to determine whether a similar observation could be made in vivo. Using the ChIP assay as described by Boyd and Farnham (44), chromatin isolated from formaldehyde-treated DHL-4 cells was subjected to immunoprecipitation reactions using antibodies specific for the NF-␬B family members p50, p52, c-Rel, RelA, and RelB. An anti-IgG antibody was used as a nonspecific control. The precipitated DNA was subjected to PCR amplification using primers specific for the human IgH HS4 region containing the NF-␬B binding site. As shown in Fig. 4A, these primers produced a 174-bp amplicon that could be observed with the positive control (total chromatin) and when the chromatin was precipitated with antibodies specific for p50, c-Rel, RelA, and RelB. Use of the p52 antibody resulted in a very weak positive signal, whereas no amplification was observed with three negative controls (no chromatin, no antibody, and ␣IgG; Fig. 4A). Due to the close proximity of the NF-␬B site to the 5Ј Sp1 site, the same primers were used to analyze Sp1 binding to this region of HS4. Use of a Sp1 antibody in the immunoprecipitation reaction resulted in the isolation of the same region of HS4, indicating the in vivo interaction with Sp1. A different

Fig. 3. In vitro protein binding analysis of regulatory elements in the HS4 region. A, EMSA of the HS4 NF-␬B site with DHL-4 nuclear extract. Lane 1 contains no competitor; Lanes 2–5 contain a 100-fold excess of cold HS4 NF-␬B site (WT), mutated HS4 NF-␬B site (Mut), a NF-␬B consensus site, and a nonspecific sequence (NS), respectively; Lanes 6–11 contain antibodies for p50, p52, RelA, c-Rel, RelB, or a non-transcription factor protein (␣NS), respectively. B, EMSA of the HS4 5Ј Sp1 site. Lane 1 contains no competitor; Lanes 2–4 contain a 100-fold molar excess of cold HS4 5Ј Sp1 site (WT), mutated Sp1 site (Mut), and a nonspecific sequence (NS), respectively; Lanes 5 and 6 contain antibodies against Sp1 or a non-transcription factor protein, respectively. C, EMSA of the HS4 3Ј Sp1 site. Lane 1 contains no competitor; Lanes 2–4 contain a 100-fold molar excess of cold HS4 3Ј Sp1 site (WT), mutated Sp1 site (Mut), and a nonspecific sequence (NS), respectively; Lanes 5 and 6 contain antibodies against Sp1 or a non-transcription factor protein, respectively. sequence for a Sp1 binding site. To assess specific protein interaction with this sequence, a labeled double-stranded oligonucleotide was incubated with DHL-4 nuclear extract. As shown in Fig. 3B, complex formation with the labeled probe was observed, and the complexes could be competed with a 100-fold molar excess of unlabeled wild- type competitor, but not with a 100-fold molar excess of a sequence containing a mutation to the Sp1 binding site or with a nonspecific sequence (Fig. 3B, Lanes 1–4). The addition of an antibody specific for Sp1 resulted in a supershift, indicating the presence of Sp1 in these complexes, whereas no change in complex formation was observed with the addition of an antibody specific for a non-transcription factor protein (Fig. 3B, Lanes 5 and 6). Although the second positive regulatory region identified through Fig. 4. NF-␬B and Sp1 interact with the human IgH HS4 enhancer in vivo. A, ChIP 3Ј deletion analysis of HS4 most closely resembled a Rel binding site, analysis of the HS4 NF-␬B site in DHL-4 cells. The cross-linked chromatin was precip- EMSA results indicated that the Rel and NF-␬B family members did itated with specific antibodies as indicated. The positive control is represented by the total input fraction. Negative controls included a no chromatin sample, no antibody sample, and not interact with this site (data not shown). However, we found that nonspecific antibody (␣IgG). Precipitated DNA was analyzed by PCR using primers that specific complexes formed with this region with DHL-4 nuclear amplified a 174-bp region that included the NF-␬B site. B, ChIP analysis of the HS4 5Ј Sp1 site. The same primer set that was used in A was used to amplify the 174-bp region extract in EMSA (Fig. 3C, Lane 1). These complexes were competed that included the 5Ј Sp1 site. C, ChIP analysis of the HS4 3Ј Sp1 site. The PCR primers with a 100-fold molar excess of unlabeled wild-type sequence (Fig. amplified a 183-bp sequence that included the 3Ј Sp1 site. 6669

Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2003 American Association for Cancer Research. DEREGULATION OF Bcl-2 EXPRESSION set of primers was used to analyze for in vivo Sp1 binding to the region of HS4 encompassing the 3Ј Sp1 site. As shown in Fig. 4C, the Sp1 antibody could precipitate a sequence that could be PCR-amplified using this second set of primers. Due to the close proximity of the two Sp1 sites, the ChIP assay does not allow us to distinguish between occupancy at one site or the other. Although the results of these assays do not establish the exact binding sites of either NF-␬B or Sp1, they do demonstrate the in vivo interaction of the NF-␬B and Sp1 transcription factors with these regions of the human IgH HS4 sequence in t(14;18) cells. Deletion Analysis of HS1,2. The other region of the IgH enhancer that contributed the most positive regulatory activity to the bcl-2 promoter was HS1,2. To identify the elements mediating this activity, we constructed a series of 5Ј deletions of this region (Fig. 5A). Transfection of these deletion constructs into DHL-4 cells resulted in the identification of one positive regulatory region between bases 800 and 811 in HS1,2 (Fig. 5B). Analysis of the sequence within this region showed that it contained a NF-␬B binding site that has been described previously (32–34). Although we also constructed a series of 3Ј deletions within HS1,2, transfection of these constructs did not reveal any other major positive regulatory regions (data not shown). We therefore concluded that the sequence containing the NF-␬B binding site was the primary regulatory region of HS1,2 mediating positive activity on the bcl-2 promoter. In Vitro and in Vivo Interaction of NF-␬B with HS1,2 in t(14;18) Cells. To identify which NF-␬B family members interacted with the Fig. 6. In vitro and in vivo protein binding analysis of the HS1,2 active site. A, EMSA HS1,2 site in DHL-4 cells, we performed EMSA with a labeled probe of the HS1,2 NF-␬B site. Lane 1 contains no competitor; Lanes 2–5 contain a 100-fold molar excess of cold HS1,2 NF-␬B site (WT), mutated NF-␬B site (Mut), a NF-␬B consensus sequence, and a nonspecific sequence (NS), respectively; Lanes 6–12 contain antibodies to p50, p52, RelA, c-Rel, RelB, Sp1, and a non-transcription factor protein (␣NS), respectively. B, ChIP analysis of the human IgH HS1,2 NF-␬B site. Cross-linked chromatin was fractionated using the indicated specific antibodies. The PCR primers amplified a 181-bp sequence that included the NF-␬B site.

containing the HS1,2 NF-␬B binding site. From this analysis, we observed specific protein complex formation on this probe (Fig. 6A, Lane 1). This complex could be competed with the addition of a 100-fold molar excess of unlabeled wild-type probe or a probe containing the NF-␬B consensus sequence (Fig. 6A, Lanes 2 and 4). However, the complex could not be competed with a 100-fold molar excess of a probe containing a mutation to the HS1,2 NF-␬B binding site or with a nonspecific sequence (Fig. 6A, Lanes 3 and 5). The addition of antibodies specific for NF-␬B family members p50 and c-Rel resulted in supershifts of the complex, indicating the presence of these proteins in the complex (Fig. 6A, Lanes 6 and 9). To determine whether the same proteins interacted with the human IgH HS1,2 sequence in vivo, we performed a ChIP assay using primers that would specifically amplify the HS1,2 region encompassing the corresponding NF-␬B binding site. The primers produced a 181-bp amplicon that could be observed with the positive control (total chromatin), but not with the three negative controls (no chromatin, no antibody, and ␣IgG; Fig. 6B). However, immunoprecipitation using antibodies specific for p50, p52, c-Rel, RelA, and RelB all resulted in the isolation of the sequence containing the HS1,2 NF-␬B binding site (Fig. 6B). From these data, we concluded that NF-␬B interacted with the HS1,2 sequence in DHL-4 cells. Functional Analyses of the HS1,2 and HS4 NF-␬B and Sp1 Binding Sites. To determine the relevance of the NF-␬B and Sp1 binding sites in the HS4 region to bcl-2 promoter activity, mutations were created within those sites in separate reporter constructs, and all Fig. 5. Identification of the active regions in HS1,2 with the bcl-2 promoter. A, diagram of the HS1,2 5Ј deletion constructs with the location of the NF-␬B site indicated. B, results three sites were mutated in a single construct (Fig. 7A). As shown in of transient transfection analysis with the bcl-2 promoter and the 5Ј deletions of HS1,2 in Fig. 7B, mutation of the HS4 NF-␬B site reduced bcl-2 promoter DHL-4 cells. The activity of the bcl-2 promoter with all four enhancer regions (HS1–HS4) Ј was assigned a value of 100, and the activity from the other transfections was plotted activity by 62%. Mutation of the 3 Sp1 site resulted in a 49% relative to that value. decrease in bcl-2 promoter activity, whereas mutation of the 5Ј Sp1 6670

site resulted in a 25% decrease in activity. A construct containing mutations to all three regulatory sites in HS4 exhibited only 30% promoter activity compared with the wild-type construct. This was essentially the same as the activity of a construct that contained only HS1,2 and HS3, suggesting that the NF-␬B and two Sp1 sites were the critical elements mediating bcl-2 deregulation by HS4. Similar functional analysis was performed with the HS1,2 NF-␬B binding site (Fig. 7A). The mutation of this site resulted in a 30% decrease in promoter activity as compared with the wild-type enhancer sequence (Fig. 7C). By replacing the wild-type HS1,2 and HS4 sequences with the mutated sequences, bcl-2 promoter activity was reduced to 26% (Fig. 7C). This was similar to the activity of a construct containing the bcl-2 promoter with only the HS3 enhancer region (Fig. 7C). To further verify the importance of NF-␬B in mediating bcl-2 deregulation in t(14;18) cells, the HS1234 construct was cotransfected with an expression vector containing the cDNA for the I␬B␣ super-repressor. This expression vector, which produces a mutant I␬B␣ protein that retains the NF-␬B p50/p65 heterodimer in the cytoplasm, was able to reduce the activity of the IgH enhancer-bcl-2 promoter construct by 60% (Fig. 7C). This was greater than the decrease in activity we had observed previously with constructs containing only the bcl-2 promoter (12), indicating that NF-␬B most likely acts through the IgH 3Ј enhancer sequences as well as through the promoter. However, the decrease in activity induced by I␬B␣-SR was not as great as that observed with the construct containing mutations to the HS1,2 and HS4 NF-␬B and Sp1 sites (mHS1,2ϩmHS4), supporting the importance of the two HS4 Sp1 sites. Other studies have shown that promoter activation and generation of DNase I hypersensitive regions may be dependent on the presence of chromatin (45, 46). To assess whether the activity observed from the transiently transfected mutant constructs was reflected by constructs capable of chromatin restructuring, the wild-type and mutated enhancer sequences were cloned into an episomal vector containing the EBNA-1 cDNA and the EBV origin of replication. Transfection of these constructs into DHL-4 cells resulted in bcl-2 promoter activities similar to those activities observed with the transient transfection assays (Fig. 7D), thereby supporting our observations from those results. The reduction in promoter activity induced by the mutations was somewhat less with the episomal vectors as compared with the transiently transfected vectors, indicating the possibility that other factors can mediate bcl-2 activation from the enhancer sequences. Nevertheless, the results obtained from both sets of constructs demonstrate that the NF-␬B and Sp1 binding sites of HS1,2 and HS4 are important for bcl-2 up-regulation in t(14;18) cells in the presence and absence of organized chromatin.

DISCUSSION Although it has been assumed that the deregulated bcl-2 expression in t(14;18) cells is mediated in part by the immunoglobulin heavy chain gene regulatory region, this has not been demonstrated, nor was it known which elements of that region were responsible for the deregulation. In these studies, we found that the four DNase I-hyper- Ј Fig. 7. Functional analyses of the HS4 NF-␬B and Sp1 sites and the HS1,2 NF-␬B site. sensitive regions within the IgH 3 enhancer were able to activate the A, diagram of the bcl-2 promoter-IgH enhancer constructs with the mutated sites indicated. B, results from transient transfections of DHL-4 cells with reporter constructs containing mutations to the regulatory elements within the HS4 enhancer. The activity of the bcl-2 promoter with all four enhancer regions (HS1–HS4) was assigned a value of 100, and the activity from the other transfections was plotted relative to that value. C, DHL-4 plotted relative to the activity of the HS1234 construct transfected with an empty transient transfection results from a reporter construct containing a mutation to the HS1,2 expression vector, which was given a value of 100. D, luciferase activity of episomal NF-␬B binding site with the wild-type sequences of HS3 and HS4 (HS12 mNF-␬B)or reporter constructs transfected into DHL-4 cells. HS1,2 and HS4 sequences containing with wild-type HS3 and mutated HS4 sequences (mHS12ϩmHS4). The mutant HS4 mutations to NF-␬B and/or Sp1 sites were cloned into an episomal reporter vector. sequence contained changes to the HS4 NF-␬B and the two Sp1 binding sites. The activity Transfected cells were treated with hygromycin 24 h after transfection, and selected cells of the mutant constructs was normalized to the activity of the wild-type construct were assayed for luciferase activity 4 days after transfection. The activities of the reporter (HS1234), which was assigned a value of 100. The HS1234 construct was also transfected constructs containing mutant enhancer sequences were normalized to the activity of the with the I␬B␣-SR expression vector. The activity derived from this transfection was construct containing the wild-type sequence, which was designated as 100. 6671

Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2003 American Association for Cancer Research. DEREGULATION OF Bcl-2 EXPRESSION bcl-2 promoter in the t(14;18) cell line DHL-4. Of those four hyper- activation of the bcl-2 promoter by the IgH enhancers (10). In this sensitive regions, we demonstrated that HS4 had the most influence study, we found that transfection of the I␬B␣-SR expression vector on bcl-2 promoter activity. This is similar to the situation in pre-B and resulted in decreased activity of the IgH enhancer- bcl-2 reporter plasmacytoma cells, where HS4 is the most active enhancer region. construct. Although it is difficult to assess whether this repression was We also showed that the HS1,2 region was capable of activating the mediated by sequences in the enhancer or in the promoter, the per- promoter independently. By itself, HS3 increased bcl-2 promoter centage decrease observed with the enhancer construct was greater activity by only a minor amount. Other studies of HS3 have shown than what we had previously observed when only the bcl-2 promoter that it is contains elements that act as negative effectors of the IgH 3Ј was present. This suggests that NF-␬B can activate bcl-2 through enhancer (37), and preliminary studies in our laboratory have con- enhancer sequences as well. Given that nuclear levels of NF-␬B are firmed this. However, it is possible that the HS3 region was not active abnormally high in t(14;18) cells, whereas no difference has been in our model system or those used in other studies. It is also likely that observed with Sp1 expression (data not shown), it seems reasonable to there are regions of the IgH 3Ј enhancers other than the HS sequences expect that NF-␬B may play a more significant role in bcl-2 deregu- that are capable of driving transcription. DNase I-hypersensitive re- lation. A number of therapies targeting NF-␬B activity have recently gions are associated with an open chromatin structure and therefore been developed. The results we present here suggest that these ther- chromatin remodeling factors, but there are other sequences that are apies may be useful in the treatment of t(14;18) lymphomas. active without the presence of such factors. Nonetheless, this is the first study to show specific elements in the HS1,2 and HS4 regions ACKNOWLEDGMENTS that are capable of mediating bcl-2 up-regulation. Our analyses of the IgH 3Ј enhancers showed that NF-␬B sites in We thank Kayoko Kanda for assistance in mutating the NF-␬B sites and HS1,2 and HS4 and two Sp1 sites in HS4 were largely responsible for Minh Ho for preparation of nuclear extracts. the positive influence on the bcl-2 promoter. We demonstrated by EMSA the in vitro interaction of the NF-␬B and Sp1 transcription REFERENCES factors with specific IgH 3Ј enhancer sequences and by ChIP assay the in vivo interaction of those factors with regions of the enhancers 1. Cleary, M. L., Smith, S. D., and Sklar, J. Cloning and structural analysis of cDNAs ␬ for bcl-2 and a hybrid bcl-2/immunoglobulin transcript resulting from the t(14;18) containing those sequences. The NF- B and Sp1 elements are con- translocation. Cell, 47: 19–28, 1986. served in the human IgH enhancers as well as in the murine IgH 2. Tsujimoto, Y., and Croce, C. Analysis of the structure, transcripts, and protein enhancers, suggesting that they play important roles in the regulation products of bcl-2, the gene involved in human follicular lymphoma. Proc. Natl. Acad. Sci. USA, 83: 5214–5218, 1986. of IgH gene expression. Whereas it has been established that the 3. Tsujimoto, Y., Gorham, J., Cossman, J., Jaffe, E., and Croce, C. M. The t(14;18) NF-␬B sites are required for HS1,2 and HS4 enhancer activity on the chromosome translocations involved in B-cell neoplasms result from mistakes in VDJ ␭ joining. Science (Wash. DC), 229: 1390–1393, 1985. 1 promoter during all stages of B-cell development, the two Sp1 sites 4. Hockenberry, D., Nunez, G., Milliman, C., Schreiber, R. D., and Korsmeyer, S. J. we identified in this study have not been described previously. Our Bcl-2 is an inner mitochondrial membrane protein that blocks programmed cell death. studies with chromatin templates showed that mutation of the NF-␬B Nature (Lond.), 348: 334–336, 1990. 5. Vaux, D. L., Cory, S., and Adams, J. M. Bcl-2 gene promotes haemopoietic cell and Sp1 sites did not completely abolish the activation of the bcl-2 survival and cooperates with c-myc to immortalize pre-B cells. Nature (Lond.), 335: promoter, suggesting that there are chromatin-dependent elements 440–442, 1988. within the IgH 3Ј enhancers that contribute to bcl-2 deregulation. 6. Desoize, B. Anticancer drug resistance and inhibition of apoptosis. Anticancer Res., 14: 2291–2294, 1994. Although the NF-␬B and Sp1 elements described in these studies 7. Reed, J. C., Kitada, S., Takayama, S., and Miyashita, T. Regulation of chemoresis- appeared to be functional without chromatin formation in transient tance by the bcl-2 oncoprotein in non-Hodgkin’s lymphoma and lymphocytic leuke- mia cell lines. Ann. Oncol., 5 (Suppl. 1): S61–S65, 1994. assays, it is likely that both are involved in coactivator recruitment and 8. Schmitt, C. A., and Lowe, S. W. Bcl-2 mediates chemoresistance in matched pairs of chromatin restructuring, along with basal transcription factor recruit- primary E␮-myc lymphomas in vivo. Blood Cells Mol. Dis., 27: 206–216, 2001. ment. In the HIV 5Ј long terminal repeat, both NF-␬B and Sp1 9. Schmitt, C. A., Rosenthal, C. T., and Lowe, S. W. Genetic analysis of chemoresistance in primary murine lymphomas. Nat. Med., 6: 1029–1035, 2000. binding are required to establish nuclease-hypersensitive sites and for 10. Ji, L., Mochon, E., Arcinas, M., and Boxer, L. M. CREB proteins function as positive chromatin remodeling in the enhancer (47, 48). Formation of these regulators of the translocated bcl-2 allele in t(14;18) lymphomas. J. Biol. Chem., 271: hypersensitive sites and nucleosome disruption are necessary for 22687–22691, 1996. 11. Wilson, B. E., Mochon, E., and Boxer, L. M. Induction of bcl-2 expression by transcriptional activity mediated by the long terminal repeat. Another phosphorylated CREB proteins during B-cell activation and rescue from apoptosis. study of the tumor necrosis factor ␣-responsive A20 gene promoter Mol. Cell. Biol., 16: 5546–5556, 1996. 12. Heckman, C. A., Mehew, J. W., and Boxer, L. M. NF-␬B activates bcl-2 expression has shown that Sp1 binding is required for constitutive association of in t(14;18) lymphoma cells. Oncogene, 21: 3898–3908, 2002. the general transcription apparatus to the promoter and is also neces- 13. Riccio, A., Ahn, S., Davenport, C. M., Blendy, J. A., and Ginty, D. D. Mediation by sary for transcriptional induction by NF-␬B (49). Additionally, both a CREB family transcription factor of NGF-dependent survival of sympathetic neurons. Science (Wash. DC), 286: 2358–2361, 1999. factors are known to interact with coactivators that are responsible for 14. Huang, H., Cheville, J. C., Pan, Y., Roche, P. C., Schmidt, L. J., and Tindall, D. J. changes in chromatin structure. For example, the cooperation of Sp1 PTEN induces chemosensitivity in PTEN-mutated prostate cancer cells by suppres- with BRG1-containing SWI/SNF chromatin remodeling complexes sion of bcl-2 expression. J. Biol. Chem., 276: 38830–38836, 2001. 15. Mehrhof, F. B., Muller, F. U., Bergmann, M. W., Li, P., Wang, Y., Schmitz, W., can be essential for specific promoter activation (50–52). Likewise, Dietz, R., and von Harsdorf, R. In cardiomyocyte hypoxia, insulin-like growth interaction of both Sp1 and RelA with the p300 histone acetyltrans- factor-I-induced antiapoptotic signaling requires phosphatidylinositol-3-OH-kinase- dependent and mitogen-activated protein kinase-dependent activation of the transcrip- ferase can result in gene activation (53, 54), whereas interaction of tion factor cAMP response element-binding protein. Circulation, 104: 2088–2094, RelA or p50 with the histone deacetylase HDAC-1 leads to suppres- 2001. sion of gene expression (55). It will be interesting to elucidate in 16. Dong, L., Wang, W., Wang, F., Stoner, M., Reed, J. C., Harigai, M., Samudio, I., Kladde, M. P., Vyhlidal, C., and Safe, S. Mechanisms of transcriptional activation of future studies possible coactivator associations as well as the exact bcl-2 gene expression by 17␤-estradiol in breast cancer cells. J. Biol. Chem., 274: mechanism of gene activation. 32099–32107, 1999. We have shown previously that NF-␬B is constitutively active in 17. Pugazhenthi, S., Miller, E., Sable, C., Heidenreich, K. A., Boxer, L. M., and Reusch, J. E. B. Insulin-like growth factor induces bcl-2 promoter through the transcription t(14;18) cells and acts to up-regulate bcl-2 expression through CREB factor cAMP-response element-bindng protein. J. Biol. Chem., 274: 27529–27535, and Sp1 binding sites in the bcl-2 promoter, whereas the NF-␬B 1999. ␬ ␣ 18. Pugazhenthi, S., Nesterova, A., Sable, C., Heidenreich, K. A., Boxer, L. M., Heasley, inhibitor I B -SR can decrease endogenous bcl-2 expression (12). L. E., and Reusch, J. E. B. Akt/protein kinase B up-regulates bcl-2 expression through Mutation of the CRE site in the bcl-2 promoter region decreased the cAMP-response element-binding protein. J. Biol. Chem., 275: 10761–10766, 2000. 6672

19. Heckman, C., Mochon, E., Arcinas, M., and Boxer, L. M. The WT1 protein is a cation of Bach2 as a B-cell-specific partner for small Maf proteins that negatively negative regulator of the normal bcl-2 allele in t(14;18) lymphomas. J. Biol. Chem., regulate the immunoglobulin heavy chain gene 3Ј enhancer. EMBO J., 17: 5734– 272: 19609–19614, 1997. 5743, 1998. 20. Hewitt, S. M., Hamada, S., McDonnell, T. J., Rauscher, F. J. I., and Saunders, G. F. 38. Grant, P. A., Thompson, C. B., and Pettersson, S. IgM receptor-mediated transacti- Regulation of the proto-oncogenes bcl-2 and c-myc by the Wilms’ tumor suppressor vation of the IgH 3Ј enhancer couples a novel Elf-1-AP-1 protein complex to the gene, WT1. Cancer Res., 55: 5386–5389, 1995. developmental control of enhancer function. EMBO J., 14: 4501–4513, 1995. 21. Mayo, M. W., Wang, C. Y., Drouin, S. S., Madrid, L. V., Marshall, A. F., Reed, J. C., 39. Grant, P. A., Arulampalam, V., Ahrlund-Richter, L., and Pettersson, S. Identification Weissman, B. E., and Baldwin, A. S. WT1 modulates apoptosis by transcriptionally of Ets-like lymphoid specific elements within the immunoglobulin heavy chain 3Ј upregulating the bcl-2 proto-oncogene. EMBO J., 18: 3990–4003, 1999. enhancer. Nucleic Acids Res., 20: 4401–4408, 1992. 22. Arulampalam, V., Eckhardt, L., and Pettersson, S. The enhancer shift: a model to 40. Linderson, Y., Cross, D., Neurath, M. F., and Pettersson, S. NFE, a new transcrip- explain the developmental control of IgH gene expression in B-lineage cells. Immu- tional activator that facilitates p50 and c-Rel-dependent IgH 3Ј enhancer activity. Eur. nol. Today, 18: 549–554, 1997. J. Immunol., 27: 468–475, 1997. 23. Madisen, L., and Groudine, M. Identification of a locus control region in the 41. Kanda, K., Hu, H-M., Zhang, L., Grandchamps, J., and Boxer, L. M. NF-␬B activity immunoglobulin heavy-chain locus that deregulates c-myc expression in plasmacy- is required for the deregulation of c-myc expression by the immunoglobulin heavy toma and Burkitt’s lymphoma cells. Genes Dev., 8: 2212–2226, 1994. Ј␣ chain enhancer. J. Biol. Chem., 275: 32338–32346, 2000. 24. Michaelson, J. S., Giannini, S. L., and Birshtein, B. K. Identification of 3 -hs4, a ␬ novel Ig heavy chain enhancer element regulated at multiple stages of B cell 42. Ji, L., Arcinas, M., and Boxer, L. M. NF- B sites function as positive regulators of differentiation. Nucleic Acids Res., 23: 975–981, 1995. expression of the translocated c-myc allele in Burkitt’s lymphoma. Mol. Cell. Biol., 25. Pettersson, S., Cook, G. P., Bruggemann, M., Williams, G. T., and Neuberger, M. S. 14: 7967–7974, 1994. A second B cell-specific enhancer 3Ј of the immunoglobulin heavy chain locus. 43. Phan, S. C., Feeley, B., Withers, D., and Boxer, L. M. Identification of an inducible Nature (Lond.), 344: 165–168, 1990. regulator of c-myb expression during T- cell activation. Mol. Cell. Biol., 16: 2387– 26. Saleque, S., Singh, M., Litter, R. D., Giannini, S. L., Michaelson, J. S., and Birshtein, 2393, 1996. B. K. Dyad symmetry within the mouse 3Ј IgH regulatory region includes two 44. Boyd, K. E., and Farnham, P. J. Coexamination of site-specific transcription factor virtually identical enhancers (C ␣3ЈE and hs3). J. Immunol., 158: 4780–4787, 1997. binding and promoter activity in living cells. Mol. Cell. Biol., 19: 8393–8399, 1999. 27. Chauveau, C., Pinaud, E., and Cogne, M. Synergies between regulatory elements of 45. Armstrong, J. A., Bieker, J. J., and Emerson, B. M. A SWI/SNF-related chromatin the immunoglobulin heavy chain locus and its palindromic 3Ј locus control region. remodeling complex, E-RC1, is required for tissue-specific transcriptional regulation Eur. J. Immunol., 28: 3048–3056, 1998. by EKLF in vitro. Cell, 95: 93–104, 1998. 28. Ong, J., Stevens, S., Roeder, R. G., and Eckhardt, L. A. 3Ј Immunoglobulin heavy 46. Liu, R., Liu, H., Chen, X., Kirby, M., Brown, P. O., and Zhao, K. Regulation of CSF1 chain enhancer elements shift synergistic interactions during B cell development. promoter by the SWI/SNF-like BAF complex. Cell, 106: 309–318, 2001. J. Immunol., 160: 4896–4903, 1998. 47. Pazin, M. J., Sheridan, P. L., Cannon, K., Cao, Z., Keck, J. G., Kadanaga, J. T., and 29. Chen, C., and Birshtein, B. K. Virtually identical enhancers containing a segment of Jones, K. A. NF-␬B-mediated chromatin reconfiguration and transcriptional activa- homology to murine 3Ј IgH-E(hs1,2) lie downstream of human Ig C␣1 and C␣2 tion of the HIV-1 enhancer in vitro. Genes Dev., 10: 37–49, 1996. genes. J. Immunol., 159: 1310–1318, 1997. 48. Widlak, P., Gaynor, R. B., and Garrard, W. T. In vitro chromatin assembly of the 30. Mills, F., Harindranath, N., Mitchell, M., and Max, E. Enhancer complexes located HIV-1 promoter. ATP-dependent polar repositioning of nucleosomes by Sp1 and ␣ downstream of both human immunoglobulin C genes. J. Exp. Med., 186: 845–858, NF-␬B. J. Biol. Chem., 272: 17654–17661, 1997. 1997. 49. Ainbinder, E., Revach, M., Wolstein, O., Moshonov, S., Diamant, N., and Dikstein, 31. Pinaud, E., Aupetit, C., Chauveau, C., and Cogne, M. Identification of a homolog of R. Mechanism of rapid transcriptional induction of tumor necrosis factor ␣-respon- ␣ Ј Ј the C 3 /hs3 enhancer and of an allelic variant of the 3 IgH/hs1,2 enhancer down- sive genes by NF-␬B. Mol. Cell. Biol., 22: 6354–6362, 2002. ␣ stream of the human immunoglobulin 1 gene. Eur. J. Immunol., 27: 2981–2985, 50. Kadam, S., McAlpine, G. S., Phelan, M. L., Kingston, R. E., Jones, K. A., and 1997. Emerson, B. M. Functional selectivity of recombinant mammalian SWI/SNF sub- 32. Laurencikiene, J., Deveikaite, V., and Severinson, E. HS1,2 enhancer regulation of units. Genes Dev., 14: 2441–2451, 2000. germline ⑀ and ␥2b promoters in murine B lymphocytes: evidence for specific 51. Liu, H., Kang, H., Liu, R., Chen, X., and Zhao, K. Maximal induction of a subset of promoter-enhancer interactions. J. Immunol., 167: 3257–3265, 2001. interferon target genes requires the chromatin-remodeling activity of the BAF com- 33. Michaelson, J. S., Singh, M., Snapper, C. M., Sha, W. C., Baltimore, D., and Birshtein, B. K. Regulation of 3Ј IgH enhancers by a common set of factors, including plex. Mol. Cell. Biol., 22: 6471–6479, 2002. ␬B-binding proteins. J. Immunol., 156: 2828–2839, 1996. 52. Kadam, S., and Emerson, B. M. Transcriptional specificity of human SWI/SNF BRG1 34. Zelazowski, P., Shen, H., and Snapper, C. M. NF-kB/p50 and NF-kB/c-Rel differ- and BRM chromatin remodeling complexes. Mol. Cell, 11: 377–389, 2003. entially regulate the activity of the 3Ј␣E-hs1,2 enhancer in normal murine B cells in 53. Gerritsen, M. E., Williams, A. J., Neish, A. S., Moore, S., Shi, Y., and Collins, T. an activation-dependent manner. Int. Immunol., 12: 1167–1172, 2000. CREB-binding protein/p300 are transcriptional coactivators of p65. Proc. Natl. Acad. 35. Singh, M., and Birshtein, B. K. NF-HB (BSAP) is a repressor of the murine Sci. USA, 94: 2927–2932, 1997. immunoglobulin heavy-chain 3Ј␣ enhancer at early stages of B-cell differentiation. 54. Kundu, T. K., Palhan, V. B., Wang, Z., An, W., Cole, P. A., and Roeder, R. G. Mol. Cell. Biol., 13: 3611–3622, 1993. Activator-dependent transcription from chromatin in vitro involving targeted histone 36. Singh, M., and Birshtein, B. K. Concerted repression of an immunoglobulin heavy- acetylation by p300. Mol. Cell, 6: 551–561, 2000. chain enhancer, 3Ј␣E(hs1,2). Proc. Natl. Acad. Sci. USA, 93: 4392–4397, 1996. 55. Zhong, H., May, M. J., Jimi, E., and Ghosh, S. The phosphorylation status of nuclear 37. Muto, A., Hoshino, H., Madisen, L., Yanai, N., Obinata, M., Karasuyama, H., NF-␬B determines its association with CBP/p300 or HDAC-1. Mol. Cell, 9: 625– Hayashi, N., Nakauchi, H., Yamamoto, M., Groudine, M., and Igarashi, K. Identifi- 636, 2002.

6673

Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2003 American Association for Cancer Research. Critical Elements of the Immunoglobulin Heavy Chain Gene Enhancers for Deregulated Expression of Bcl-2

Caroline A. Heckman, Thai Cao, Lina Somsouk, et al.

Cancer Res 2003;63:6666-6673.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/63/20/6666

Cited articles This article cites 55 articles, 33 of which you can access for free at: http://cancerres.aacrjournals.org/content/63/20/6666.full#ref-list-1

Citing articles This article has been cited by 3 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/63/20/6666.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/63/20/6666. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.