1 Understanding the Role of the FACT Complex During Development in C. Elegans Dissertation Presented in Partial Fulfillment of T

Home , FACT (biology)

Understanding the role of the FACT complex during development in C. elegans

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy

in the Graduate School of The Ohio State University

Brittany Zaneta Suggs

Graduate Program in Molecular Genetics

The Ohio State University

2017

Dissertation Committee

Dr. Helen Chamberlin, Advisor

Dr. Sharon Amacher

Dr. Christin Burd

Dr. Robin Wharton

Copyrighted by

Brittany Zaneta Suggs

2017

Abstract

The maternal to zygotic transition is a developmental phase shared by all multicellular organisms. It is during this time that control of the developing embryo is transferred from maternally provided mRNAs and proteins to the zygotic genome. In order for the zygotic genome to be transcribed, transcription factors must be able to access the promoters of their target genes. Prior to this point, the chromatin has been held in a transcriptionally silent state which must be alleviated before transcription can occur.

There are several mechanisms by which chromatin can be rearranged into a more transcriptionally competent state. In this work, I focus on the nucleosome reorganizing

FACT complex.

FACT is a heterodimeric complex composed of SSRP1 and SPT16 and is known to be involved in various functions such as transcription, DNA replication, and DNA repair. Both SSRP1 and SPT16 have been found to be essential for embryonic development, and in their absence, lethality occurs early. While much is known regarding the functions of the FACT complex at the level of the cell, the requirement for FACT during embryogenesis has been a significant impediment to understanding the role of

FACT in development on an organismal scale.

In this study, I have evaluated the developmental consequence of FACT depletion during the embryonic development of the nematode Caenorhabditis elegans using RNAi

ii and genetic mutants. I provide evidence for a requirement for FACT in the formation of the anterior pharynx and in the maintenance of cell cycle length and progression.

Additionally, I investigate the relationship between FACT and APX-1, a well described component of the pharyngeal development pathway, and, from those data, propose two possible models for how FACT may be involved in pharyngeal development. Together, these data begin to show how the cellular functions of FACT impacts the development of the organism as a whole.

iii

Acknowledgments

First, I give honor to God without whom this journey would have been impossible. For this, You receive all glory and praise.

I am deeply grateful for the mentorship of Dr. Helen Chamberlin. Her endless patience and constant encouragement and support have been invaluable through the years. I truly cannot thank you enough.

Thank you to my committee, Dr. Sharon Amacher, Dr. Christin Burd, and Dr.

Robin Wharton, for your suggestions, counsel, and even the difficult questions through the development of this project.

To Karley Mahalak, Allison Webb, Marcos Corchado, Kristin Balmert and Leann

Kelley, my amazing worm guys, I cannot express how grateful I am that I was on this journey with you. Your support—in all its forms—during the tough times and the laughter during the good times will forever be cherished memories. I look forward to our continued friendships.

Thank you to my KCC family. Your prayers were greatly appreciated.

Lastly, but most certainly not least, I would like to thank my family. Mom, dad,

Treena, Rayna, Wayne: We did it! And ‘we’ it most certainly was. Without you, your love, encouragement and continued support, I would not have made it. I love you all more than I could ever express. Thank you.

Vita

February 4, 1989…………………………...... Born-Rison, AR

2007-2011…………………………………….B.S. Biology, Henderson State University

2011-2017……………………………………Graduate Teaching and Research Associate,

The Ohio State University

Fields of Study

Major Field: Molecular Genetics

Table of Contents

Abstract ...... ii Acknowledgments...... iv Vita ...... v List of Tables ...... viii List of Figures ...... ix Chapter 1. Introduction ...... 1 1.1 The Maternal to Zygotic Transition ...... 1 1.2 Destabilization and degradation of maternal components ...... 2 1.2.1 Functions of maternal clearance and the consequences of clearance failure ..... 2 1.2.2 Mechanisms of maternal clearance ...... 3 1.3 Zygotic Genome Activation (ZGA) ...... 5 1.3.1 Functions of the ZGA and the consequences of activation failure ...... 5 1.3.2 Mechanisms of ZGA ...... 6 1.4 Chromatin reorganization ...... 8 1.5 FACT in transcription ...... 12 1.6 FACT and Chromatin Maintenance: ...... 13 1.7 FACT and differentiation ...... 15 1.8 Research question and chapter previews ...... 18 Chapter 2: FACT complex genes have critical maternal and zygotic functions in C. elegans...... 20 2.1 Introduction ...... 20 2.2 Results ...... 21 2.2.1 FACT complex genes in C. elegans include two SSRP1 orthologs ...... 21 2.2.2 SSRP1 orthologs hmg-3 and hmg-4 have redundant functions in embryonic development ...... 23

2.2.3 Anterior pharynx development is defective in hmg-3; hmg-4- or spt-16- depleted embryos ...... 24 2.2.4 HMG-3, HMG-4 and SPT-16 are present across developmental time ...... 25 2.2.5 The embryonic functions of hmg-3 and hmg-4 have a maternal contribution 25 2.2.6 FACT complex genes have required larval functions ...... 27 2.2.7 Depletion of FACT components alters the embryonic cell cycle ...... 28 2.3 Discussion ...... 30 2. 4 Experimental Procedures ...... 33 2.4.1 C. elegans strains, maintenance and construction ...... 33 2.4.2 Creation of GFP-tagged alleles ...... 34 2.4.3 RNA Interference ...... 35 2.4.4 Fluorescent Microscopy ...... 36 2.4.5 Time course confocal microscopy and embryonic lineage analysis ...... 37 Chapter 3: Epistasis analysis proposes multiple models of FACT function ...... 52 3.1 Introduction ...... 52 3.2 Results ...... 54 3.2.1 FACT knockdown reduces area of pharyngeal markers in apx-1 mutants ...... 54 3.2.2 Knockdown of FACT components causes a delay in expression of PHA- 4::GFP ...... 55 3.3 Discussion ...... 56 3.4 Materials and Methods ...... 60 3.4.1 C. elegans strains, maintenance and construction ...... 60 3.4.2 RNA Interference ...... 61 Chapter 4: Discussion ...... 69 4.1 Results overview ...... 69 4.2 Retention of SSRP1 duplicates in C. elegans ...... 70 4.3 Role of maternal FACT in cell cycle progression ...... 71 4.3 FACT during the ZGA ...... 73 4.4 C. elegans FACT and human disease ...... 74 4.5 Final conclusions ...... 75 References ...... 77 Table 1: Primers for CRISPR and RNAi ...... 88

vii

List of Tables

Table 1: Primers for CRISPR and RNAi ...... 88

viii

List of Figures

Figure 1 Identification of FACT complex proteins encoded by the C. elegans genome. . 39

Figure 2 FACT complex genes are essential for normal embryonic development...... 41

Figure 3 Depletion of hmg-3; hmg-4 or spt-16 results in a loss of anterior pharynx...... 42

Figure 4 . HMG-4::GFP and SPT-16::GFP are present in both germline and soma, whereas HMG-3::GFP is germline-restricted...... 44

Figure 5 The pharynx develops normally in hmg-3; hmg-4 or spt-16 mutant embryos derived from heterozygous mothers...... 46

Figure 6 Zygotic expression of FACT complex proteins ...... 47

Figure 7 RNAi depletion of hmg-3; hmg-4 or spt-16 causes lengthening of the embryonic cell cycle...... 49

Figure 8 Notch interactions in pharyngeal development...... 63

Figure 9 Analysis of PHA-4::GFP expression in FACT-deficient apx-1 mutants...... 64

Figure 10 Analysis of myo-2::rfp expression in FACT-deficient apx-1 mutants ...... 65

Figure 11 Knockdown of FACT components delays onset of PHA-4::GFP ...... 67

Figure 12 Possible models to explain FACT function in C. elegans embryos ...... 68

Figure 13 Dendogram representing all genomes included in Treefam for SSRP1 ...... 76

Chapter 1. Introduction

Animal development encompasses the period from fertilization to the formation of the adult body. It is a complex process, requiring the precise coordination of cell growth, division, differentiation, and morphogenesis over and again as cells become tissues, tissues form organs and organs develop into organ systems. Each step must be tightly controlled as uncontrolled cell growth or divisions can lead to various diseases such as cancer.

1.1 The Maternal to Zygotic Transition

Early control of the developing embryo is dependent on mRNAs and proteins provided by the mother during oocyte formation as embryos are generally transcriptionally silent at the beginning of embryonic development (Langley et al., 2014).

These maternal genes have several functions such as initiating biosynthetic processes, guiding the first rounds of divisions, establishing embryonic axes, and specifying preliminary cell fates by the differential segregation of macromolecules (Lee et al., 2014;

Tadros and Lipshitz, 2009). Developmental control eventually shifts to the zygote in a process called the maternal to zygotic transition (MZT).

The MZT has two parts: (1) the destabilization and degradation of maternal transcripts and proteins and (2) the activation of the zygotic genome (zygotic genome activation; ZGA) (Langley et al., 2014; Robertson and Lin, 2015; Tadros and Lipshitz,

2009). Initial transcription from the zygotic genome, called the minor wave, requires input from either a maternal transcription factor (TF) or signaling ligand and generally results in the activation of zygotic TFs which in turn activate other zygotic genes (the major wave of ZGA) that may influence cell differentiation.

The timing of the MZT varies by species. Initiation of zygotic transcription occurs during the sixth cell cycle in Drosophila melanogaster (Ali-Murthy et al., 2013) and

Xenopus (Paranjpe et al., 2013) and as early as the 1-cell embryo in mice (Hamatani et al., 2004; Xue et al., 2013). The variations in MZT onset among species suggest there are diverse mechanisms in place to control the MZT (Langley et al., 2014; Lee et al., 2014).

In the following sections, I will briefly discuss the functions and mechanisms of maternal destabilization and ZGA as well as some potential consequences associated with the failure of either process.

1.2 Destabilization and degradation of maternal components

1.2.1 Functions of maternal clearance and the consequences of clearance failure

Three reasons have been proposed to explain the importance of clearing maternal mRNAs. One such reason is to prevent lethal dosage defects that might arise due to the overlapping expression of maternal and zygotic mRNAs (Lindsley et al., 1972).

Therefore, elimination of maternal transcripts would serve to ‘wipe the slate clean’ as zygotic transcription begins. Second, the presence of maternal mRNAs may prevent the continuation of development beyond a certain stage (Yartseva and Giraldez, 2015).

Cellularization fails and zygotic transcription is not activated to its fullest level in smaug

2 mutants in Drosophila due to the persistence of maternal transcripts (Benoit et al., 2009), and both mice and human embryos fail during pre-implantation development if maternal transcripts are not cleared (Dobson et al., 2004; Yartseva and Giraldez, 2015). Lastly, the elimination of some maternal transcripts may be instructive. For example, in Drosophila,

Cyclin A and B must be depleted in order to slow the cell cycle and to allow for pausing at the appropriate time; otherwise, division continues to occur at a rapid rate (Benoit et al., 2009). These functions are not mutually exclusive; it is likely that one or more of these may govern the cause of maternal clearance.

1.2.2 Mechanisms of maternal clearance

Maternally provided proteins and mRNAs are essential for the proper development of the early embryo. For example, in C. elegans embryos, PIE-1, a maternal protein, is essential for the specification of the germline blastomeres (Mello et al., 1992).

The first four rounds of divisions in the embryo are asymmetric, producing one large somatic daughter and one smaller germline daughter (Mello et al., 1992). PIE-1 functions to repress transcription in the germ cell, thereby preventing the transcription of genes that promote somatic differentiation (Strome, 2005). However, eventually maternal mRNAs must be removed to allow for the establishment of the zygotic program. Two common methods for destabilizing mRNAs is deadenylation and the use of microRNAs (Yartseva and Giraldez, 2015).

The poly(A) tail is an important feature for the stability of the transcript, and for those mRNAs targeted for degradation, deadenylation is often the first step (Schwede et

3 al., 2009). In Drosophila, Smaug (SMG), a maternal protein activated after egg activation, binds to target mRNAs and recruits the CCR4/POP2/NOT-deadenylase complex to facilitate the shortening of the poly(A) tail (Semotok et al., 2008). In

Xenopus, deadenylation occurs through the binding of another maternal protein called

EDEN-BP (Embryonic Deadenylation Element Binding Protein) to its recognition site

(U(A/G) dinucleotide repeats) (Graindorge et al., 2008). EDEN-BP has a human homolog: CUG-BP, which also functions to recruit a deadenylase to its target mRNAs

(Moraes et al., 2006). It is important to note that though the poly(A) tail is removed as the result of each of these protein activities, the actual degradation often requires the presence of zygotically transcribed factors.

Many microRNAs are zygotically transcribed (Yartseva and Giraldez, 2015). It is known that microRNAs can destabilize mRNAs and repress translation, but they also induce deadenylation of their targets (Bartel, 2009). Zebrafish miR-430, for example, has been shown to inhibit the translation of its target mRNAs (Giraldez et al., 2006).

Additionally, shortly after the microRNA binds to the mRNA, the poly(A) tail is removed in a manner seemingly uncoupled from the repression of translation (Subtelny et al.,

2014). Other species such as Drosophila and Xenopus have also been shown to use microRNAs in the clearance of maternal transcripts (Lee et al., 2014)

1.3 Zygotic Genome Activation (ZGA)

1.3.1 Functions of the ZGA and the consequences of activation failure

Maternally provided mRNAs and proteins provide information for the earliest stages of embryonic development. Consequently, as maternal transcripts are cleared, new instructions are required for continued development. This new information comes from the zygotic genome. Genes activated during the ZGA prepare the embryo for gastrulation and for cell specification and differentiation while also continuing housekeeping functions (Lee et al., 2014). A big determinant of which specific genes are activated during the ZGA is the developmental stage of the embryo when activation occurs. For example, in mice, both the minor and major wave of ZGA occurs before two division cycles have completed; therefore, many of the genes expressed are involved in basic cellular processes such as RNA metabolism (Xue et al., 2013). ZGA in zebrafish begins about two hours after fertilization and about two hours before gastrulation, and about half of the expressed genes are involved in housekeeping while the other half is composed of chromatin modifiers and transcription factors (Lee et al., 2014).

Additionally, zygotic transcripts also function in maternal clearance. Indeed, failure to activate the zygotic genome leads to the incomplete clearance of maternal mRNAs in several species (Lee et al., 2014). MicroRNAs, are zygotic in origin and a major component of component of maternal clearance, (discussed previously), and some degradation processes, like that of EDEN-BP, require zygotic proteins for completion

(Yartseva and Giraldez, 2015). Decapping mechanisms, which also target mRNAs for degradation, are also frequently zygotically based (Yartseva and Giraldez, 2015).In

5 conclusion, the ZGA is involved not only in providing new instructions for embryonic development but also in the ending of the maternal program.

1.3.2 Mechanisms of ZGA

There are four main models that aim to explain the mechanisms that govern the onset of ZGA. No one model sufficiently explains all the known data; therefore, organisms likely utilize more than one mechanism to regulate zygotic activation.

The nucleocytoplasmic model proposes that the ratio of nuclear to cytoplasmic material may influence whether transcription is possible (Newport and Kirschner, 1982a,

1982b). Here, some repressing factor is at a certain concentration sufficient for the repression of zygotic transcription. As the cell divides, the amount of chromatin increases while the relative proportion of cytoplasm remains the same as there is no growth stage during early mitoses, and with each division, the concentration of the repressor is diluted until it reaches a level where it can no longer effectively silence zygotic transcription.

Indeed, increasing or decreasing the amount of DNA present in Xenopus embryos leads to early or delayed activation of zygotic transcription, respectively (Newport and

Kirschner, 1982a, 1982b). Alternatively, some evidence suggests the nucleocytoplasmic ratio could be indirectly influencing the rate of cell division. The degradation of Twine in

Drosophila is dependent on the nucleoplasmic ratio and leads to the stabilization of Cdk1 phosphorylation which blocks entry into mitosis and lengthens the cell cycle which may influence ZGA (described below) (Talia et al., 2013).

A second model postulates that zygotic transcription is attempted prior to the

ZGA; however, transcripts are aborted due to insufficient time to complete transcription before the onset of the next nuclear division (Lee et al., 2014; Tadros and Lipshitz, 2009).

This would prevent the transcription of long genes until such a time as the cell cycle length becomes permissive. Inhibition of cell cycle progression in Drosophila does indeed induce premature ZGA in agreement with this model; however, it does not alleviate transcriptional blocks at all early developmental stages, indicating another method of ZGA inhibition in addition to transcript abortion (Edgar and Schubiger, 1986).

The third model describes a maternal clock that is independent of cell cycle.

Instead, it is ‘set’ by fertilization or egg activation, and the ‘time’ is kept by the quantity or activity of a maternal factor or group of factors such that at some threshold, the transcription machinery necessary for ZGA is activated (Howe et al., 1995; Howe and

Newport, 1996). In support of this hypothesis, it has been shown that most of the

Drosophila ZGA is regulated based on absolute developmental time as opposed to the number of divisions as determined by nucleocytoplasmic ratio (Lu et al., 2009).

Additionally, in the one-cell C. elegans embryo, TAF-4, a component of the transcriptional initiation complex, is sequestered by maternal proteins OMA-1/2 (Guven-

Ozkan et al., 2008). This sequestration function is activated by the phosphorylation of

OMA-1/2 by another maternal protein, MBK-2, which occurs only after fertilization

(Nishi and Lin, 2005). Interestingly, it is the same phosphorylation that activates OMA-

1/2 that is responsible for its eventual degradation which releases TAF-4 to activate

7 transcription in somatic blastomeres beginning after the second division (Nishi and Lin,

2005; Seydoux and Fire, 1994; Shirayama et al., 2006).

The last model suggests that ZGA is dependent on chromatin regulation. Prior to the ZGA, the chromatin is not in a state conducive to transcriptional activity due to DNA methylation or various histone modifications (Li et al., 2013; Tadros and Lipshitz, 2009).

The activity of chromatin remodeling factors would then be required before ZGA can occur. Alteration of the chromatin structure by use of various drugs leads to early activation of zygotic transcription (Aoki et al., 1997), and loss of SMARCA4, part of the

SWI/SNF-related chromatin remodeling complex, causes incomplete activation of zygotic transcription in mice (Bultman et al., 2006). Both results support a role for chromatin regulation in the timing of ZGA onset.

1.4 Chromatin reorganization

For each of the four ZGA models mentioned above, the state of the chromatin is of great importance. Chromatin is composed of DNA and associated proteins, the majority of which are histone proteins. There are five major families of histone proteins,

H1, H2A, H2B, H3 and H4. In chromatin, H2A, H2B, H3 and H4 form a histone octamer

(two dimers of H2A-H2B + a tetramer of two H3-H4) around which 146 bps of DNA is wrapped, forming a structure called a nucleosome. Nucleosomes function to compact

DNA into the eukaryotic nucleus and also functions in chromatin regulation. The tightness of the DNA-histone association determines how accessible the DNA is to cellular machinery.

If the DNA cannot be accessed, the presence of proper transcription factors or otherwise proper conditions become less effective. What mechanisms exist by which the chromatin state can be altered? There are two main mechanisms by which chromatin can be modified: the first is by the enzymatic modification of histone proteins. Here, proteins such as histone acetyltransferases or methyltransferases add (or remove) acetyl or methyl groups which decrease or increase, respectively, the histone’s affinity for DNA thereby making the nucleosome less or more restrictive, respectively, for cellular factors. A second mechanism is called chromatin remodeling. There are two classes of chromatin remodelers: ATP-dependent and ATP-independent. The ATP-dependent class of remodelers are large complexes composed of between four to seven subunits and are characterized by the presence of a superfamily II helicase-related ATPase subunit (Tang et al., 2010). A member of this class is the SWI/SNF complex (Tang et al., 2010). An

ATP-independent remodeler is the FACT complex.

FACT is a heterodimeric histone chaperone composed of SSRP1 (structure specific recognition protein 1) and SPT16 (suppressor of ty 16) in metazoans (Brewster et al., 1998; Orphanides et al., 1999; Wittmeyer and Formosa, 1997). This complex is highly conserved across eukaryotes and essential for viability (Cao et al., 2003; Li et al.,

2013; Orphanides et al., 1999).

The FACT complex was originally discovered in yeast. SPT16, also named

CDC68, was identified during a study aimed at uncovering factors involved in the regulation of the cell cycle in Saccharomyces cerevisiae, particularly those genes that would directly affect the START machinery necessary for cell cycle regulation at G1

(Prendergast et al., 1990). Further analysis of the cdc68/spt16 mutant phenotype uncovered a decrease in the transcript abundance of several transcripts encoding factors involved in cell cycle progression. Other studies showed other transcriptional defects not related to cell cycle progression, suggesting a more general, yet still essential role for

CDC68 in transcription (Malone et al., 1991; Rowley et al., 1991).

Cdc68/Spt16 forms a complex with an Hmg-1-like (high mobility group) protein called Pob3 (Brewster et al., 1998; Wittmeyer et al., 1999; Wittmeyer and Formosa,

1997), in a complex called CP (Cdc68-Pob3) (Brewster et al., 1998). As all Cdc68/Spt16 proteins are found in complex with Pob3, the transcriptional activities of Cdc68/Spt16 were ascribed to the CP complex. An orthologous complex called FACT was discovered in human cells (hFACT) as a factor essential for transcription on a chromatin template

(FACT: facilitates chromatin transcription) (Orphanides et al., 1999). hFACT was found to also be a heterodimer, this one composed of SSRP1 (structure specific protein 1), an

HMG-1-like protein and POB3 ortholog, and SPT16 (Orphanides et al., 1999)

The HMG-1 domain of SSRP1 suggested that FACT may be interacting with nucleosomes; proteins with this domain are known to bind to DNA where it enters and exits nucleosomes (Orphanides et al., 1999). Coimmunoprecipitation and gel shift assay support this conclusion: FACT can bind to nucleosomal components (Belotserkovskaya et al., 2003; Hondele et al., 2013; Tsunaka et al., 2016).

Currently there are three main models for how FACT restructures nucleosomes.

In the eviction model, FACT evicts an H2A-H2B dimer from the histone octamer via interaction with SPT16 which results in a hexamer that is less restrictive to cellular

10 machinery (Belotserkovskaya et al., 2003). After polymerase passage, FACT uses its histone chaperone ability to return the H2A-H2B dimer and restore the octamer structure.

The non-eviction or global accessibility model suggests that FACT tethers nucleosome components such that though there is reorganization of the nucleosome, none of the parts are completely evicted from the structure, allowing for the reconstitution of the nucleosome after passage of the cellular machinery (Xin et al., 2009). A third model suggests that FACT function depends on the intranucleosomal placement of the H2A-

H2B dimers rather than an initial dimer displacement (Hsieh et al., 2013; Tsunaka et al.,

2016). Instead, there is evidence that FACT competes with nucleosomal DNA for an interaction site on the H2A-H2B dimer which partially uncoils DNA and allows transcription by RNAP II. For each of the three models, the major distinguishing factor is what happens to the H2A-H2B dimer: is it evicted from the nucleosome (eviction model), shifted out of place but tethered to FACT-nucleosome complex (non-eviction), or does it remain in its place within the nucleosome (competition model)? Further study is required to determine which model most accurately describes the mechanism of FACT or, alternatively, under which conditions each model is favored.

FACT has been found to be important for several basic cellular processes such as transcription (Mason and Struhl, 2003; Saunders et al., 2003), DNA replication (Abe et al., 2011; Tan et al., 2010), and DNA repair (Gao et al., 2017; Kumari et al., 2009). Here,

I will briefly discuss the role of FACT in transcription, cell differentiation, and chromatin maintenance.

1.5 FACT in transcription

Not only does FACT have a role in remodeling nucleosomes for access to DNA by cellular machinery, but it is also involved in actual transcriptional process. FACT has been reported to facilitate the formation of the TATA Binding Protein (TBP)-TFIIA-

TFIIB preinitiation complex in yeast and to complex with the Drosophila GAGA factor which then induces chromatin remodeling at promoters (Biswas et al., 2005; Shimojima et al., 2003). Other studies have shown FACT associates with the preinitiation complex after its formation but before the start of transcriptional elongation; indeed, yeast elongation factor TFIIH has been shown to be important for the recruitment of FACT

(Mason and Struhl, 2003). Colocalization and kinetic monitoring analyses show FACT and RNAP II move through the coding region of the gene together (Mason and Struhl,

2003; Saunders et al., 2003), allowing for nucleosomal restructuring in advance of the transcribing RNAP II and reconstruction in its wake.

The connecting of initiation and elongation is likely a mechanism by which transcriptional fidelity is maintained. In this way, cells can ensure that transcription begins at the promoter, where preinitiation proteins preferential localize, and not at sites internal to the coding region. The presence of FACT in the elongating complex may create a chromatin structure that is restrictive to internal initiation (Mason and Struhl,

2003).

While FACT is involved in transcription, data suggests that FACT is not required for the transcription of all genes. In fact, only about 2% of tested human genes changed in

12 expression by at least 1.5-fold after knockdown of SSRP1 or Spt16 (Garcia et al., 2011;

Li et al., 2007). Most of those genes are downregulated in the absence of FACT which would suggest that this complex is involved in enhancing the expression of its target genes (Li et al., 2007). Furthermore, the need for FACT—or not—may be based on the chromatin structure of that gene (Jimeno-González et al., 2006). Some translationally positioned nucleosomes at the coding regions of genes are less able to be transferred or slid to a new position; in these cases, the reorganizing function of FACT would be required for transcription to occur (Jimeno-González et al., 2006).

1.6 FACT and Chromatin Maintenance:

The association of DNA with histone proteins to form chromatin not only provides a mechanism for DNA condensation but also for gene regulation (Lorch and

Kornberg, 2015). Chromatin, by its very structure, is able to restrict access to genes and prevent their transcription (Lorch and Kornberg, 2015). To alleviate this repression, chromatin must be remodeled in such a way that cellular machinery can assemble and perform its task, whether it be transcription, replication, or DNA repair. Equally important is the need for chromatin states to be maintained. Though all cells contain the entirety of the organism’s genome, not every gene is expressed. Instead, only those genes required for the development, function, or general processes of that cell need be expressed. One mechanism for the repression of unnecessary genes is the tightly condensed, nucleosome saturated state of heterochromatin (Chen and Dent, 2014). On the

13 other hand, those genes that should be expressed can usually be found in a more open state called euchromatin (Chen and Dent, 2014).

Heterochromatin and euchromatin states are not permanent. Production of some genes are only necessary for a certain developmental stage, during which they may be in a euchromatic state, but prior to and after the required period has passed, the gene may be silenced by a heterochromatic state (Chen and Dent, 2014). Transitions between these states may be facilitated by histone marks such as methylation or acetylation (Chen and

Dent, 2014); additionally, the presence of different histone variants can determine chromatin accessibility (Biterge and Schneider, 2014).

A role for FACT in the maintenance of chromatin states has been demonstrated particularly by studies performed in yeast. In one such study, a spt16 mutation was found to be able to suppress the effects of the swi4 mutant (Lycan et al., 1994). SWI4 is a transcriptional activator that, in combination with SWI6, regulates transcription of HO, a mating type-switching endonuclease; therefore, in the absence of SWI4, HO is not transcribed. In a spt16; swi4 double mutant, however, HO is transcribed (Lycan et al.,

1994). Additionally, mutations in SPT16 can also increase transcription from other genes silenced by the loss of various trans-activators (Lycan et al., 1994), and spt16 mutants can bypass the requirement for the upstream activation signal (UAS) in suc2Δuas mutants and allow growth on sucrose (Malone et al., 1991). These data show that in the absence of FACT, genes are usually not transcribed without the input of transcriptional activator are able to be transcribed, indicating the silencing of these genes are not maintained.

This supports FACT involvement in chromatin maintenance.

One possible mechanism for its repressor activity is that FACT maintains the closed chromatin state ensuring the proper localization and volume of nucleosomes at the promoter region. It is known that there is a continuous exchange of nucleosome-bound and free histones occurring even in the absence of replication or transcription (Jamai et al., 2007). FACT, via its histone chaperone ability, can facilitate the replacement of histones in the nucleosome in these instances, ensuring the DNA remains inaccessible to transcriptional machinery except in the presence of a true activation signal (Dion et al.,

2007; Jamai et al., 2007).

1.7 FACT and differentiation

Chromatin structure and transcription are two key components of cell differentiation, or, conversely, in maintaining an undifferentiated state (Garcia et al.,

2011). Considering FACT’s chromatin and transcriptional activities, it is perhaps not surprising that the complex has been implicated in both undifferentiated cell maintenance and cellular differentiation.

In some cases, FACT functions in a supporting role such as that seen in the case of Oct4 and the establishment of pluripotent cells (Shakya et al., 2015). Here, FACT is recruited to the promoters of genes intimately involved in pluripotency regulation such as

Pou5f1, which encodes Oct4, to facilitate the depletion of histone H3 from the promoters

(Shakya et al., 2015). This results in a chromatin structure that inhibits the activity of a

DNA methylase involved in the silencing of Oct4 by methylation of promoter-localized

H3, and promotes the assembly of transcriptional machinery, and, consequently, the differentiation of the cell (Shakya et al., 2015).

Expression of FACT proteins and mRNAs has been demonstrated to be the higher in undifferentiated or less differentiated cells than in fully differentiated cells in several tissue types in higher eukaryotes (Garcia et al., 2011). An analysis of all mRNA expression datasets available through the NCBI Gene Expression Omnibus (GEO) database found that the greatest changes in FACT abundance were related to the terms

“embryonic development” and “stem cells and differentiation” (Garcia et al., 2011). This suggests as embryonic development progresses and stems cells begin to differentiate, the level of FACT decreases and is consistent with results of immunohistochemical (IHC) staining of normal tissues from mouse and humans (Garcia et al., 2011). Little to no IHC staining was seen in the majority of adult tissues with the exception of organs where undifferentiated cells were expected to be found such as the ovary, testes, and intestinal stem cells found at bottom of crypts (Garcia et al., 2011).

Transformation of epithelial cells and fibroblasts is correlated with an upregulation of FACT; indeed, FACT is required for the efficient transformation of those cells, though not sufficient to drive malignant transformation alone (Garcia et al., 2013).

Most tumors, particularly poorly differentiated ones, have a significantly increased expression of FACT compared to normal adult cells, but the amount of FACT increase varies by type (Garcia et al., 2013). Furthermore, level of FACT expression correlates with the tumor metastatic potential in breast and prostate cancers, among others, indicating a role for FACT as a prognostic tool (Garcia et al., 2013). Additionally, FACT

16 may have value as drug target as tumor cells are sensitive to the loss of FACT whereas normal cells are not (Garcia et al., 2013).

While FACT functions in maintaining or establishing pluripotency, FACT is also involved in the initiation of differentiation. Differentiation is the process by which a cell becomes committed to a particular fate by differential expression of genes and occurs multiple times during the lifetime of an organism. In mammalian cells, FACT interacts with MKL1 to promote transcription of genes required for the differentiation of smooth muscle cells (Kihara et al., 2008) and is also recruited to other muscle-specific genes by myogenin (Lolis et al., 2013). In both cases, FACT is involved in the remodeling of the promoter and the elongation by RNAP II thereby facilitating differentiation.

FACT has also been shown to be involved in the differentiation of many cells types, not just muscle. Knockdown of SSRP1a in zebrafish leads to the underdevelopment of the liver and pancreas as well as small eyes, fins and heads

(Koltowska et al., 2013). The number of liver progenitors in ssrp1a mutants is significantly less than in wild type animals; additionally, an early marker of liver differentiation fails to be maintained while a late marker is never expressed, indicating a failure in differentiation that was later shown to be due to cell cycle arrest (Koltowska et al., 2013). Human mesenchymal stem cells require FACT for multipotent differentiation; in the absence of SSRP1, a significant number of genes needed for osteoblast differentiation are not expressed (Hossan et al., 2016). A number of those downregulated genes are part of the Wnt pathway, which has been shown to be important for osteoblast development (Hossan et al., 2016).

1.8 Research question and chapter previews

To date, very few studies have examined the role of FACT in the development of multicellular animals as most experiments have been done in yeast or in cell lines. This has allowed us to understand much about the cellular functions of FACT, such as DNA replication and transcription, but there is still the question of the consequence of FACT deficiency on the process of embryonic and larval development at the level of the organism. It is that question I seek to answer in this study, using C. elegans as my model system.

Caenorhabditis elegans is a free-living, nematode that is commonly found in compost-like environments such as organic-rich garden soil (Blaxter and Denver, 2012).

There are many characteristics that make this organism an excellent experimental system in which to explore many developmental questions such as ours. The entire C. elegans genome has been sequenced (Consortium*, 1998).With a the many genetic tools available in C. elegans, this provides a simple yet elegant system in which to explore pathways and proteins that relate to human health. For example, knockdown of gene expression by RNA interference (RNAi) can be accomplished by a simple feeding

(Kamath et al., 2000), and fluorescent proteins can be visualized easily in live eggs and hatched animals as their shells and cuticles are transparent (Corsi, 2015). A large complement of genetic balancers facilitates the study of lethal or sterile mutations through maintenance as heterozygous stocks. Additionally, C. elegans are hermaphroditic, meaning they produce both eggs and sperm, and have a short life cycle

18 of 3.5 days from fertilized egg to adult (Brenner, 1974). During their adult lifetime, a hermaphrodite can produce as many as 300 hundred eggs in the absence of outside fertilization, allowing for growth of many clones in a short period of time (Corsi, 2015).

Lastly, an invariant body plan and cell fate has allowed the entire cell lineage to be mapped (Sulston et al., 1983). Consequently, any defect in the body structure of the organism can be traced back to its source.

In chapter two, I explore the embryonic and larval functions of the FACT complex by analysis of RNAi and mutant embryos and detail the expression patterns for each subunit using CRISPR to generate endogenously tagged GFP alleles. My data show a role for FACT in the formation of the anterior pharynx as well as in cell cycle progression and that FACT subunits are expressed widely both maternally and zygotically. In chapter three I sought to understand where in pharyngeal development

FACT performs its function(s) as having both maternal and zygotic expression provides the opportunity for FACT to function on either side of the MZT as well as during it. . To that end, I performed epistasis experiments with the strictly maternal APX-1, which is known to function in the first step of pharyngeal development. From this analysis, I proposed three models to explain how FACT may be performing its role in the pharyngeal development of C. elegans. Finally, in chapter four, I discuss key results and the new questions they have raised.

Chapter 2: FACT complex genes have critical maternal and zygotic functions in C. elegans

2.1 Introduction

FACT (facilitates chromatin transcription) is a histone chaperone complex composed of two proteins, SSRP1 (structure specific recognition protein 1; Pob3 in yeast) and SPT16 (suppressor of ty16) (Orphanides et al., 1999; Wittmeyer and Formosa,

1997). Highly conserved and essential across eukaryotes (Cao et al., 2003; Malone et al.,

1991; Wittmeyer and Formosa, 1997), FACT has been found to function in many chromatin processes such as transcription (Mason and Struhl, 2003; Saunders et al.,

2003), DNA replication (Abe et al., 2011; Tan et al., 2010) and DNA repair (Gao et al.,

2017; Kumari et al., 2009; Richard et al., 2016). Recently, the FACT complex has been identified as a potential therapeutic target for cancer as this complex is not expressed in most differentiated mammalian tissues but is overexpressed in cancers such as breast cancer and neuroblastoma, with high levels of expression being associated with a poor prognosis (Attwood et al., 2017; Carter et al., 2015; Fleyshman et al., 2017).

A number of studies have been done to elucidate the mechanisms by which FACT reorganizes nucleosomes to allow access to chromatin. Current data support a model in which FACT acts by invading into the nucleosome, evicting H2A and H2B and thereby creating a hexasome. The FACT-hexasome complex exposes more DNA which is then available to other cellular machinery (Tsunaka et al., 2016; Winkler et al., 2011). 20

Eventually FACT’s histone chaperone function restores the histone octomer structure

(Tsunaka et al., 2016; Winkler et al., 2011). However, while the particulars of nucleosome reorganization by FACT and an increasing number of roles for this complex in various biological processes continue to be uncovered, very little is known about the function of the FACT complex in the development of multicellular organisms at the level of the whole animal. Much of this lack of knowledge is due to the early lethality associated with elimination of either SSRP1 or SPT16. In mice, for example, loss of

Ssrp1 results in embryonic death around day E3.5 (Cao et al., 2003).

To better understand the developmental roles for the FACT complex, I evaluated its role in the nematode Caenorhabditis elegans. I found that the genome of C. elegans is unusual in that it includes two SSRP1 orthologs: hmg-3 and hmg-4. I showed that these two genes exhibit both redundant and individual functions, and that hmg-3, hmg-4, and spt-16 (the SPT16 ortholog) are essential genes. My data support a maternal role for the

FACT complex in the development of the anterior pharynx and in maintaining proper embryonic cell cycle timing. Together, my results provide a framework for study of the

FACT complex during animal development.

2.2 Results

2.2.1 FACT complex genes in C. elegans include two SSRP1 orthologs

The FACT complex is composed of two proteins: SSRP1 and SPT16 (Orphanides et al., 1998). To find genes that encode orthologous proteins in the C. elegans genome, I performed protein BLAST using the human proteins as the query. For hSSRP1, the

21 search returned two hits: SSRP1-A and SSRP1-B, which Wormbase identifies as products of genes hmg-4 and hmg-3, respectively. A Treefam (Ruan et al., 2008) phylogenetic analysis of SSRP1 provided further support for two C. elegans orthologs

(Figure 1A). I examined the protein sequence for HMG-3 and HMG-4 specifically to determine if each of the three domains present in hSSRP1 were present in each prospective ortholog (Figure 1C). HMG-3 and HMG-4 both contain all the domains of hSSRP1 (with a comparable amino acid similarity) and within the domains they are identical to each other (Figure 1C). Overall, HMG-3 and HMG-4 share 81% amino acid sequence identity, and each is 37% and 40% identical to hSSRP1, respectively. RNAseq and gene expression microarray data indicate that RNA for each gene is expressed in embryos (Baugh et al., 2003; Tintori et al., 2016) and larvae (Hillier et al., 2009).These results identify that there are two complete SSRP1 orthologs encoded in the C. elegans genome. Further analysis of an extended SSRP1 phylogenetic tree containing all organisms available through Treefam shows that SSRP1 is conserved broadly across eukaryotes, but that C. elegans is one of only two genomes evaluated (zebrafish being the other) to contain two full length copies of SSRP1.

The human SPT16 protein BLAST returned the product of one C. elegans gene,

SPT-16. The Treefam phylogenetic tree for SPT16 identifies two orthologs in C. elegans,

SPT-16 and F55A3.7 (Figure 1B). However, comparisons of SPT-16 and F55A3.7 to hSPT16 show that only SPT-16 contains all the domains present in hSPT16 (Figure 1D).

Though missing two of the four domains, F55A3.7 is nearly identical to SPT-16 in the domains they share. Reads for F55A3.7 in RNAseq datasets are rare, and it is classified

22 as a pseudogene in Wormbase. In contrast, RNAseq data indicate that spt-16 transcripts are present in both embryos (Tintori et al., 2016) and larvae (Hillier et al., 2009). I conclude that there is a single SPT16 ortholog in the C. elegans genome.

2.2.2 SSRP1 orthologs hmg-3 and hmg-4 have redundant functions in embryonic development

I initially evaluated the function of FACT complex genes using RNA interference

(RNAi). Considering the high sequence similarity between the products of hmg-3 and hmg-4, I also asked if the paralogs exhibit redundant functions. I focused on embryonic development, as in other animals FACT is expressed in undifferentiated cells, with global expression declining as differentiation progresses (Duroux et al., 2004; Garcia et al.,

2011; Lolas et al., 2010). I used RNAi introduced by feeding (Kamath et al., 2000) to wild-type L4 hermaphrodites to knock down each gene individually and as a pair, and scored the effect on their offspring. This method does not distinguish between maternal and zygotic transcripts. Individually, hmg-3(RNAi) and hmg-4(RNAi) produced <10% embryonic lethality (Figure 2). In combination, however, the embryonic lethality increased to 60% (Figure 2). This suggests that hmg-3 and hmg-4 are functionally redundant during embryonic development and that viability through hatching requires at least one SSRP1 ortholog. For spt-16 and F55A3.7 I used a deletion allele

F55A3.7(ok1829) and spt-16(RNAi) that targets sequences not present in F55A3.7. There is no embryonic lethality associated with F55A3.7(ok1829), but 83% of spt-16(RNAi) embryos failed to hatch (Figure 2). I therefore conclude that spt-16 is important for embryonic development. 23

2.2.3 Anterior pharynx development is defective in hmg-3; hmg-4- or spt-16- depleted embryos

I examined hmg-3(RNAi); hmg-4(RNAi) and spt-16(RNAi) embryos that failed to hatch to better understand how these genes impact embryonic development. Embryos from hmg-3(RNAi); hmg-4(RNAi) were surprisingly well ordered. Morphological inspection indicated that several tissue types were present: epidermis is apparent surrounding the embryos, arguing for normal enclosure; intestine cells are identified by the presence of gut granules; at least some muscle cells are present based on the observed twitching movement. Additionally, the grinder (part of the MS-derived posterior pharynx and indicated by black brackets in Figure 3B), is apparent in many embryos. Noticeably absent is the anterior pharynx, derived from cells of the AB lineage. spt-16(RNAi) embryos appeared slightly more disorganized but are still very much like hmg-

3(RNAi);hmg-4(RNAi). Posterior pharynx, intestine, muscle, and epidermis were all present, but anterior pharynx formation and elongation likewise fail to occur in the spt-

16(RNAi) embryos.

I used a myo-2::mcherry transgene to ask whether the lack of anterior pharynx in hmg-3(RNAi);hmg-4(RNAi) and spt-16(RNAi) embryos was due simply to a misplacement or disorganization of pharyngeal cells. myo-2 encodes a pharyngeal specific myosin and is expressed in cells of both the anterior and posterior pharynx

(Okkema et al., 1993). In L1s derived from hmg-3(RNAi) or hmg-4(RNAi) treated mothers, myo-2::mcherry is expressed in both the anterior and posterior pharynx as expected, but in equivalently staged hmg-3(RNAi);hmg-4(RNAi) and spt-16(RNAi) 24 embryos, myo-2::mcherry was seen only in areas corresponding to the posterior pharynx

(Figure 3D-F vs. H-K). An earlier expressed pharyngeal and intestinal marker, PHA-

4::GFP, also does not identify any prospective anterior pharyngeal cells in hmg-

3(RNAi);hmg-4(RNAi) and spt-16(RNAi) embryos (Figure 3N-Q). Together, these data suggest that anterior pharyngeal development is especially sensitive to depletion of

FACT complex genes.

2.2.4 HMG-3, HMG-4 and SPT-16 are present across developmental time

To evaluate FACT complex proteins in vivo, I used CRISPR-mediated genome editing to generate C-terminal GFP-tagged alleles for hmg-3, hmg-4 and spt-16 (gu244, gu245 and gu247, respectively). Proteins from all three genes are localized to cell nuclei and are present beginning at the 1-cell stage and continuing through embryonic development (Figure 3A-D, I-N, Q-V). By approximately the 8E stage, the abundance of

HMG-3::GFP in the somatic cells begins to decrease, reaching undetectable levels by the

2-fold stage. However, HMG-3::GFP persists in the germ line through larval stages and adulthood (Figure 4K-P). This decline in somatic protein was not seen for HMG-4::GFP and SPT-16::GFP; instead, protein persists in both somatic and germ cells through embryonic development and in the larval and adult stages of both hermaphrodites and males (Figure 4W-AF, AM-AV).

2.2.5 The embryonic functions of hmg-3 and hmg-4 have a maternal contribution

In the previous experiment, I found that HMG-3::GFP, HMG-4::GFP and SPT-

16::GFP proteins are present in oocytes and persist through embryonic development,

25 suggesting that the genes are both provided maternally and expressed zygotically in embryos. In C. elegans, ABalp and ABara cells are induced to be precursors to anterior pharyngeal cells using maternally supplied GLP-1/Notch at the 12-cell stage (Mango et al., 1994b; Mello et al., 1994; Neves and Priess, 2005; Priess et al., 1987). However, zygotic gene expression begins as early as the 4-cell stage (Robertson and Lin, 2015;

Robertson et al., 2004). Therefore, the function of hmg-3, hmg-4 and spt-16 in embryonic development generally and anterior pharyngeal development specifically could result from either maternal or zygotic activity.

To test whether maternally provided FACT components are sufficient for proper anterior pharyngeal development or if zygotic input is required, I utilized genetic deletion mutants for each gene: hmg-3(tm2539), hmg-4(tm1783) and spt-16(tm6354). As each gene is essential, the mutant strains are balanced by an hT2(GFP-tagged) balancer such that heterozygous animals are GFP-positive and homozygous mutants are GFP-negative.

Since my experiments with RNAi identified functional redundancy between hmg-3 and hmg-4, I evaluated single mutants as well as hmg-3(tm2539); hmg-4(tm1873) double mutants. I compared the pharynges of homozygous mutant L1s (derived from heterozygous mothers) to that of similarly staged wild-type animals and found no distinguishable difference (Figure 5A-C). Similarly, hmg-3; hmg-4 double mutants survive to hatching at rates similar to each single mutant (Figure 5D). I therefore concluded that maternally provided hmg-3, hmg-4, and spt-16 are sufficient for proper pharyngeal development and embryonic viability whereas zygotic transcripts are dispensable.

To further distinguish the maternal and zygotic contribution of FACT components, I crossed HMG-3::GFP, HMG-4::GFP or SPT-16::GFP males to sperm- defective (spe-9(eb19)) hermaphrodites to evaluate when zygotic products (expressed from the paternal allele) are first detected. Zygotic HMG-3::GFP is rarely seen, even in late stage embryos (~14%), but 100% of larvae examined had fluorescence in their germ cells, indicating that zygotic production of HMG-3 does not occur until late embryonic or early larval development, consistent with the time that the germ cells (Z2/Z3) begin dividing (Figure 6A). In contrast, zygotic HMG-4::GFP and SPT-16::GFP are present in late stage embryos. To determine more specifically at what time zygotic expression is first detectable for HMG-4::GFP and SPT-16::GFP, I screened embryos laid by mated spe-9(eb19) hermaphrodites at one hour intervals. Immediately after eggs are laid, around the beginning of gastrulation, few embryos from either cross showed fluorescence. By the beginning of the bean stage (three hours after eggs are laid), 60% and 88% of embryos show zygotic expression of HMG-4::GFP and SPT-16::GFP, respectively.

2.2.6 FACT complex genes have required larval functions

My data indicate that HMG-3, HMG-4, and SPT-16 continue to be expressed in larval and adult animals. To assess post-embryonic function for these genes, I evaluated the hatchlings from hmg-3(RNAi) or hmg-4(RNAi) treated parents, as well as escapers from spt-16(RNAi). I observed that hmg-3 is required for fertility, as all RNAi animals become sterile adults. RNAi against either hmg-4 or spt-16 leads to an early larval arrest, indicating a role in larval development. Additionally, RNAi against hmg-4 in newly

27 hatched wild type L1s result in sterile adults like those seen in maternal hmg-3(RNAi)

(97%, n=65). This suggests there is a second requirement for hmg-4 in fertility that is distinct from that of hmg-3. These results argue that although hmg-3 and hmg-4 can compensate for each other during embryonic development, they have unique requirements during larval development. My observations are consistent with those from genome-wide RNAi screens in C. elegans (Frand et al., 2005; Kamath et al., 2003;

Maeda et al., 2001).

2.2.7 Depletion of FACT components alters the embryonic cell cycle

Previous work by Krüger et al (Krüger et al., 2015) explored the effect of depletion of chromatin regulators in the early stages of embryonic development in C. elegans, including FACT subunit gene spt-16 (named F55A3.3 in their work). Inhibition of spt-16 resulted in a significant increase in embryonic cell cycle length as well as defects in chromosomal segregation in early mitoses. I wanted to test whether these defects are unique to spt-16 or whether they are shared by depletion of hmg-3; hmg-4, which could suggest a general function of the FACT complex during embryogenesis.

The first four divisions of C. elegans embryonic development are asymmetrical, producing one large somatic daughter and one smaller germ daughter called a P blastomere (Figure 7A). The first division, for example, produces the somatic AB blastomere and the P1 blastomere. The next three divisions produce the EMS, C and D blastomeres, EMS dividing to produce the MS and E blastomeres. Each blastomere gives rise to a lineage characterized by a unique pattern of division and cell cycle length. The

28 anterior portion of the pharynx is derived from the AB lineage, and the posterior portion of the pharynx is derived from the MS lineage.

I tracked cell division timing for the first six rounds of division of the embryonic cells AB, MS and E using a strain containing H2B::GFP in order to more clearly observe the nuclei. I observed a lengthening of cell cycle in all three lineages in hmg-3(RNAi); hmg-4(RNAi) and spt-16(RNAi) embryos. The cell cycle length differences were apparent early in the AB lineage and increased in severity over time, the most prominent divergence from wild type timing occurring at AB6 (Figure 7A). Not only does the AB lineage divide slower in these embryos compared to wild type, but in spt-16(RNAi) embryos, the ABa descendent cells (including precursors to the anterior pharynx) divide significantly slower than those from ABp (Figure 7B). Also consistent with Krüger et al, chromosomal abnormalities were observed in all spt-16(RNAi) embryos, some apparent as early as AB2 (data not shown). For example, I observed a 2-cell embryo containing two large areas of GFP, the nuclei for AB and P1 based on placement, and a smaller third area separate from the other two. In both spt-16(RNAi) and hmg-3(RNAi); hmg-4(RNAi) embryos, several cells in the AB lineage did not complete the sixth division. Nearly all division failures at AB6 in hmg-3(RNAi); hmg-4(RNAi) embryos were due to cells failing to initiate cell division, whereas in spt-16(RNAi) embryos, most cells either failed to initiate or complete the sixth division. A far smaller proportion of cells initiated anaphase but seemed to not separate completely, giving the appearance of a ‘bilobed’ nucleus.

These data support a role for both spt-16 and hmg-3; hmg-4 in cell cycle progression and an additional role for spt-16 in chromosomal segregation. It is not clear whether the

29 differences in severity observed between spt-16(RNAi) and hmg-3(RNAi); hmg-4(RNAi) reflect a more critical role for spt-16, or differences in the effectiveness of knockdown between the two.

2.3 Discussion

I have characterized genes encoding FACT complex proteins in C. elegans. I have shown that within the C. elegans genome, there is a single gene encoding SPT16

(spt-16) and two genes encoding SSRP1 (hmg-3 and hmg-4). Protein products from each gene are localized to nuclei and are broadly expressed in germline and soma for SPT-16 and HMG-4, but restricted to the germline for HMG-3. RNAi depletion of either spt-16 or hmg-3; hmg-4 results in embryos that produce several differentiated cell types, but notably lack cells of the anterior pharynx. Despite the more specific defect with respect to tissue type differentiation, depletion of either spt-16 or hmg-3; hmg-4 results in defects in cell cycle timing across the embryonic lineages. Finally, I show that the embryonic functions for FACT complex genes are dependent on maternal gene activity.

Normal development of the C. elegans embryo includes examples where segregation of distinct factors to daughter cells can distinguish precursors from their siblings, and examples where cell interactions promote initially equivalent cells to adopt different fates (reviewed in (Griffin, 2015; Maduro, 2010; Priess, 2005)). While cell interactions do play a role in normal development of both intestine from the E blastomere and posterior pharynx from the MS blastomere (Broitman-Maduro et al., 2006; Hermann et al., 2000; McGhee, 2013; Neves and Priess, 2005), classic cell isolation experiments

30 demonstrate that after initial specification events, these precursor cells can produce intestine or pharyngeal cells (respectively) in isolation (Goldstein, 1993, 1995; Mello et al., 1992). In contrast, the development of cells of the anterior pharynx from the ABa lineage involves several well-characterized cell interactions at different stages of embryonic development that involve both maternal and zygotic factors (Hutter and

Schnabel, 1994; Mango et al., 1994b; Mello et al., 1994; Neves and Priess, 2005). My results and those of others argue that although depletion of FACT complex genes results in global effects in the timing of embryonic cell divisions (Krüger et al., 2015), production of the anterior pharynx is more sensitive to these effects than is production of other embryonic tissue types. I hypothesize that this may reflect the dependence of normal anterior pharynx development on multiple cell-to-cell communications. This sensitivity could reflect defects in the timing of the initiation of expression for critical zygotic signaling genes, or the fact that cell division timing differences may cause signaling and responding cells to not be present at the same time during development.

Experiments in other organisms have identified both specific and general consequences of FACT complex disruption similar to those observed in C. elegans.

FACT has been identified as critical for maintaining the chromatin structure of a gene

(Formosa et al., 2002; Jamai et al., 2009; Morillo-Huesca et al., 2010), initiation and elongation phases of DNA replication (Abe et al., 2011; Tan et al., 2010), and chromosome segregation (Krüger et al., 2015; Okada et al., 2009; Prendergast et al.,

2016). In zebrafish embryos, knockdown of Ssrp1a causes an accumulation of cells in S phase due to failed DNA synthesis (Koltowska et al., 2013), and in yeast, loss of Spt16

31 resulted in buildup of free histones and a G1-arrest (Morillo-Huesca et al., 2010).

However, other studies have shown that knockdown of FACT subunits does not have a large effect on the overall transcriptome, and FACT interacts with some cell-specific regulatory factors such as myogenin (Jimeno-González et al., 2006; Li et al., 2007; Lolis et al., 2013). Also, similar to the C. elegans case, zebrafish Ssrp1a mutants were initially identified for a specific defect in organogensis, with the more general effects apparent only upon further characterization (Koltowska et al., 2013).

FACT complex genes are notable due to their sequence conservation across eukaryotes, and also because they are generally retained as single copy genes. Beyond the Caenorhabditis genus, only zebrafish is currently known to have two complete, functional SSRP1 gene copies. The presence of two SSRP1 orthologs within the C. elegans genome hints at gene function and the underlying model of gene duplication

(reviewed in (Innan and Kondrashov, 2010)). I show that hmg-3 and hmg-4 are each essential zygotically for fertility, and I propose that these individual functions have lead to the retention of both genes in the C. elegans genome. However, the genes exhibit overlapping expression in the germline and redundant embryonic functions, arguing that the duplication is not retained due to an obvious subfunctionalizion, such as distinct expression patterns, or qualitatively different genetic functions (Force et al., 1999).

Under certain selective conditions there could be an advantage to increasing SSRP1 gene dosage through duplication, and it may be that C. elegans germline development offers one of those conditions (Kondrashov and Koonin, 2004). Notably, in C. elegans the

SSRP1 gene orthologs are present in two copies, whereas there is a single SPT16 gene.

Thus the model that the two gene copies are retained to maintain dosage balance among members of a complex is not supported (Birchler and Veitia, 2007; Papp et al., 2003).

Future work will be necessary to determine whether this is because SSRP1 is limiting in the formation of FACT complex, or because SSRP1 has SPT16-independent functions in this case (Li et al., 2007).

2. 4 Experimental Procedures

2.4.1 C. elegans strains, maintenance and construction

All C. elegans strains were cultured and maintained at 20°C on NGM with E. coli OP50 as a food source. The N2 strain is wild type. Strains used in this study are as follows:

Mutant strains

FX18523 hmg-3(tm2539) I/hT2[bli-4(e937) qIs48]

FX16756 hmg-4(tm1873) III/ hT2[bli-4(e937) qIs48]

FX14839 spt-16(tm6354) I/ hT2[bli-4(e937) qIs48]

RB1524 F55A3.7(ok1829) I

SL438 spe-9(eb19) I; him-5(e1490) V; ebEx126[YAC Y47H9 [spe-9(+) + rol-6(su1006)]

(Singson et al., 1998)

CM2680 hmg-3(tm2539) I;hmg-4(tm1873) III/ hT2[bli-4(e937) qIs48]

CM2680 was constructed by crossing N2 males to FX16756 and selecting F1 non-GFP cross male progeny (hT2 is tagged with myo-2::gfp). These F1 males (hmg-4(tm1873)/+) were then crossed to FX18523, and F2 non-GFP cross male progeny were again selected

(genotype hmg-4(tm1873 or +)/+; hmg-3(tm2539)/+), and crossed back to FX18523. In

33 the F3, GFP-positive (hT2-bearing) hermaphrodites were cloned individually to plates, and evaluated for whether their non-GFP-positive offspring fail to survive past L1 (the phenotype of hmg-4(tm1873) homozygotes). These lines were then genotyped for presence of the hmg-4(tm1873) allele and presence of the hmg-3(tm2539) allele

(predicted at 0.5 frequency) using PCR. CM2680 was selected as a strain bearing both alleles.

Transgenes and tagged strains

SM481 pxIs10 [pha-4::GFP::CAAX + (pRF4) rol-6(su1006)] (Fay et al., 2004)

RW10705 unc-119(ed3) III; zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-

72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)] V; stIs10024 [pie-

1::H2B::GFP::pie-1 3' UTR + unc-119(+)]; stIs10499 [tbx-37::H1-wCherry + unc-

119(+)] (Murray et al., 2008)

CM2450 unc-199(e2498); guEx1457

CM2689 hmg-3(gu244[hmg-3::gfp]) I

CM2690 hmg-4(gu245[hmg-4::gfp]) I

CM2691 hmg-4(gu246[hmg-4::gfp]) III

CM2692 spt-16(gu247[spt-16::gfp]) I

2.4.2 Creation of GFP-tagged alleles

gu244, gu245, gu246 and gu247 are C-terminal GFP-tagged alleles generated via

CRISPR as described by Dickinson et al, 2015 (Dickinson et al., 2015). In summary, the online MIT CRISPR design tool ((Zhang Lab, MIT 2015: http://crispr.mit.edu/)) was

34 used to select sgRNA sites for hmg-3, hmg-4, and spt-16 and inserted by PCR mutagenesis into the Cas9-sgRNA vector pDD162. PCR generated homology arms were inserted by Gibson assembly into the GFP^SEC^3xFlag repair vector pDD282

(NEBuilder HiFi DNA Assembly Cloning Kit E5520S). All primers used are listed in

Supplementary Table 1. Injection mixes consisting of 10 ng/uL repair template plasmid,

50 ng/uL Cas9-sgRNA plasmid and 15 ng/uL myo-2::mCherry (pCFJ90 (Frøkjær-Jensen et al., 2008)) were injected into the gonads of N2 young adult worms. After three days,

250 ug/ml hygromycin (calculated final concentration in the agar) was added to select for transformed F1s. On day 6-10, plates were screened for those containing Roller animals lacking the RFP marker. Adult candidates were transferred to new plates and screened 3 days later for homozygosity. The self-excising cassette was removed by heat shock after which proper insertion of the repair template and homozygosity were confirmed by PCR.

The resultant strains are homozygous viable, fertile and grossly wild type in both appearance and behavior.

2.4.3 RNA Interference

All RNAi experiments were performed by feeding on plates as described by

Kamath et al. 2000 (Kamath et al., 2000). Briefly, hermaphrodites at the L4 stage were placed on 3.5 cm NGM plates with IPTG (final concentration 1mM) and carbenicillin

(final concentration 25 μg/ml) seeded with designated bacteria from a fresh overnight culture. HT115 bacteria bearing the empty L4440 vector was used as a negative control.

For lethality assays, parent worms were removed after 24h and the number of eggs that

35 were present on the plate counted. Any eggs remaining after an additional 24h were scored as dead. RNAi clones for hmg-3 and hmg-4 were from the Ahringer RNAi library

(Source BioScience; hmg-3: I-2N19; hmg-4: III-3P10) and were verified by sequencing.

To generate an RNAi clone for spt-16, PCR was used to amplify a portion of the spt-16 cDNA that does not overlap with sequences in F55A3.7, which was then inserted into the

L4440 RNAi vector and confirmed by sequencing. The clone was then shuttled into the

HT115 host bacterial strain (Kamath and Ahringer, 2003). In hmg-3; hmg-4 double RNAi experiments, equal volumes of bacteria bearing the hmg-3 and hmg-4 RNAi clones were mixed together prior to seeding on plates. All RNAi experiments were conducted at

20°C. spt-16(RNAi) primers are listed in Table 1.

2.4.4 Fluorescent Microscopy

All differential interference contrast (DIC) and epi-fluorescent images were taken on a Zeiss Axioplan 2 microscope. Slides were prepared with agar pads of 3.5% noble agar in water; Larvae were immobilized on slides by adding 10 nM sodium azide to the agar. Embryos were imaged at 100x magnification; larval images were taken at either

40x or 100x. To evaluate maternal and/or zygotic expression of tagged FACT complex proteins, early stage embryos were dissected from young adults and placed on slides; later stage embryos were harvested from mixed-stage plates. Embryos expressing myo-

2::rfp or PHA-4::gfp were selected and evaluated 24h after the L4 parent was placed on

RNAi plates.

To compare zygotic-only to maternal-plus-zygotic protein expression, males from

GFP-tagged strains (CM2689, CM2690, or CM2692) were generated using heat-shock treatment (He, 2011), and allowed to mate with their hermaphrodite siblings to produce male offspring. These males were then plated with spe-3(eb19); him-5(e1490) L4 hermaphrodites (selected as non-Rol from SL438) and allowed to mate for two days before screening of embryos.

2.4.5 Time course confocal microscopy and embryonic lineage analysis

The strain RW10705 was used for lineage analysis, as cell nuclei are fluorescently marked with HIS-72::GFP in this strain. The effectiveness of hmg-3(RNAi); hmg-

4(RNAi) and spt-16(RNAi) was confirmed via a lethality assay before the start of each replicate as described above. Two additional plates with approximately five L4 hermaphrodites were prepared in parallel to the lethality assay so that those animals were ready to be used as soon as the lethality was established. Adults treated with control or experimental RNAi were dissected in egg buffer to recover embryos. Embryos were transferred onto slides with a 3.5% Noble agar pad, and the slide was sealed using petroleum jelly. Images were collected using a LSM 700 laser scanning microscope equipped with Zen software using the Plan-Apochromat 63x/1.40 oil DIC M27 objective and the 488 nm excitation range of a solid state laser. An image was taken every 30 seconds, and each image contained a z-stack of 28 slices. Imaging occurred over 5.5 hours.

Time course movies were imported into Fiji/ImageJ via the Bioformats plugin.

Movie length was cut to the desired period of 400 frames after the first division for control RNAi animals and 500 frames for hmg-3(RNAi); hmg-4(RNAi) and spt-16(RNAi) embryos. Trackmate (Tinevez et al., 2017) , an open source plugin for the tracking of single particles, was used to detect nuclei and to track their divisions. Utilizing the DoG detector with an estimated diameter of 6 pixels and a threshold value of 5 consistently and accurately detected nuclei. To decrease the number of false signals, the leftmost column, which represents the lowest quality signals, at the initial filtering was eliminated and two filters were set on the signals: quality and mean intensity, again eliminating the leftmost column for each. The LAP tracker was used to generate the tracks for each nucleus. Lineages generated via TrackScheme were manually corrected and used to determine the length of the cell cycle for all cells derived from the AB, E, and MS blastomeres through the 6th division of AB.

Figure 1 Identification of FACT complex proteins encoded by the C. elegans genome.

A, B Phylogenetic trees for SSRP1 and SPT16 in model organisms generated by Treefam (Ruan et al., 2008) identify a duplication of genes encoding SSRP1 and SPT16 in the C. elegans genome. C Comparison of amino acid similarities of the three major protein domains found in human SSRP1 (Hsa-SSRP1) to the C. elegans orthologs. Domains are indicated by boxes; the name for each domain is noted above the topmost row. Numbers 39 inside domain boxes indicate the percentage of amino acid similarity between the protein and the one(s) below it; numbers on the left correspond to domain similarity with that of Cel-HMG-3, the right is similarity with Cel-HMG-4. Genomic and RNA-seq data support two full length C. elegans SSRP1 orthologs. D Protein sequence comparison of the three major domains of human SPT16 (Hsa-SPT16) and C. elegans orthologs. Numbers inside the domain boxes indicate the percentage of amino acid similarity between the protein and the one(s) below it; numbers on the left correspond to domain similarity with Cel- SPT-16, the right is similarity with Cel-F55A3.7. Cel-SPT-16 has all four domains present in Hsa-SPT16, but F55A3.7 includes only the Nlob and Spt16 protein domains. This gene structure, combined with RNA-seq data that identify limited transcript abundance of F55A3.7, has resulted in classification of F55A3.7 as a psuedogene. These data suggest that SPT-16 is the C. elegans SPT16 ortholog.

Figure 2 FACT complex genes are essential for normal embryonic development. Embryonic lethality associated with single and double knockdown of FACT components, using RNA interference (RNAi). hmg-3(RNAi) or hmg-4(RNAi) treatment of hermaphrodites caused limited embryonic lethality among offspring but hmg-3(RNAi); hmg-4(RNAi) in combination resulted in high embryonic lethality, indicating an essential embryonic function that is redundant between these two genes. spt-16(RNAi) treatment resulted in significant amounts of embryonic lethality whereas embryos derived from mothers homozygous for the deletion allele F55A3.7(ok1829) are viable. This indicates spt-16 is essential for embryonic development. Data represent at least 100 offspring from 3 trials. Error bars correspond to the standard deviation.

Continued Figure 3 Depletion of hmg-3; hmg-4 or spt-16 results in a loss of anterior pharynx.

Figure 3 continued

A-C Comparison of the terminal phenotype of hmg-3(RNAi); hmg-4(RNAi) or spt- 16(RNAi) embryos with late stage control embryos. Black brackets indicate the posterior bulb of the pharynx. Brighter areas indicated by black arrow are intestine. In hmg- 3(RNAi); hmg-4(RNAi) or spt-16(RNAi) embryos animals, no anterior pharynx is present, and embryos do not elongate. D-K Fluorescence from myo-2::rfp (a marker for differentiated pharyngeal cells) is seen in the pharynx in single hmg-3(RNAi) or hmg- 4(RNAi) larvae but only in posterior pharynx cells corresponding to the grinder (marked by brackets) in hmg-3(RNAi);hmg-4(RNAi) or F55A3.3(RNAi) embryos. L-Q Expression of the early pharyngeal-intestinal marker PHA-4::GFP is observed only in intestine and posterior pharynx in hmg-3(RNAi);hmg-4(RNAi) or F55A3.3(RNAi) embryos, whereas it identifies the anterior pharynx in control animals.

Continued Figure 4 . HMG-4::GFP and SPT-16::GFP are present in both germline and soma, whereas HMG-3::GFP is germline-restricted. 44

Figure 4 continued

A-P HMG-3::GFP (gu244) is nuclear-localized and present broadly in embryos. Over developmental time, the somatic protein intensity is reduced compared to that in the germ cells, and in late embryonic stages it is absent from somatic cells. Presence of the protein in the germline persists through adulthood in both sexes. Q-AF HMG-4::GFP (gu245) is present broadly and in both somatic and germ cells from embryonic through adult stages in both hermaphrodites and males. AG-AV Like HMG-4::GFP, SPT-16::GFP (gu247) is seen in both somatic and germ cells from early embryonic stages through adult stages.

Figure 5 The pharynx develops normally in hmg-3; hmg-4 or spt-16 mutant embryos derived from heterozygous mothers

A: Homozygous hmg-3(tm2539); hmg-4(tm1873) and spt-16(tm6354) mutant larvae derived from heterozygous mothers have normal pharynges, indicating that maternal gene activity is sufficient for normal pharyngeal development. B: hmg-3(tm2539); hmg- 4(tm1873) double mutants hatch at the same frequency as single mutants. Both genes are balanced by hT2, which is marked with a myo-2::GFP transgene. The percent of GFP- L1 larvae derived from heterozygous mother was evaluated, and no significant difference in survivability was observed, indicating that zygotic disruption of both genes does not result in an increase in embryonic lethality. Data represent at least 125 offspring from at least 2 trials. Error bars correspond to the standard deviation.

Figure 6 Zygotic expression of FACT complex proteins Males homozygous for HMG-3::GFP, HMG-4::GFP or SPT-16::GFP were mated to spe- 9(eb19) hermaphrodites to evaluate the onset of zygotic protein expression. A. A comparison of the percent of HMG-3::GFP-positive animals at late embryonic and early larval stages indicates that zygotic expression initiates only in late embryonic/early larval stages, coincident with the initiation of germline cell division. Data represent at least 30

47 offspring at each timepoint. B. Offspring from spe-9 hermaphrodites mated with either HMG-4::GFP- or SPT-16::GFP-bearing males were evaluated at different timepoints after the parent had laid eggs for one hour. Zygotic expression for HMG-4::GFP and SPT-16::GFP begins much earlier than for HMG-3::GFP, and is apparent in somatic cells as well as germline. Data represent at least 30 offspring at each timepoint.

Continued Figure 7 RNAi depletion of hmg-3; hmg-4 or spt-16 causes lengthening of the embryonic cell cycle.

Figure 7 continued

A. Cell cycle duration for all cells of the AB lineage through the 6th division. The graph shows medial, maximal and minimal cell cycle durations for control (blue), hmg- 3(RNAi); hmg-4(RNAi) (green) and spt-16(RNAi) (orange). N=3 animals for each condition. Missing information (e.g. for spt-16(RNAi) at AB6) indicates some cells failed to divide. B. Comparison of ABa- and ABp-derived AB6 cells (e.g., ABalaaa) cell cycle length for each condition. No significant difference was observed in control or hmg- 3(RNAi); hmg-4(RNAi) whereas cells derived from ABa (the precursor to anterior pharynx cells) exhibited a longer cell cycle length compared to those derived from ABp in spt-16(RNAi) (p<0.05, t-test) Data represent the number of cells per lineage per condition as follows: control ABa=48, ABp=48; hmg-3(RNAi); hmg-4(RNAi) ABa=41, ABp=41; spt-16(RNAi) ABa= 16, ABp=20. Error bars correspond to the standard deviation. C. The AB6 cells in spt-16 and hmg-3; hmg-4 depleted embryos exhibit cell 50 division errors. Most errors in spt-16(RNAi) embryos were failed attempts at division with chromosomes reaching metaphase but failing to separate and eventually decondensing to one nucleus. Nearly all errors in hmg-3(RNAi); hmg-4(RNAi) errors were a failure to attempt to divide.

Chapter 3: Epistasis analysis proposes multiple models of FACT function

3.1 Introduction

The facilitates chromatin transcription (FACT) complex is a heterodimeric histone chaperone that has been found to function in many basic cellular processes such as DNA replication (Abe et al., 2011; Tan et al., 2010), DNA repair (Gao et al., 2017;

Kumari et al., 2009), and transcription (Mason and Struhl, 2003; Saunders et al., 2003).

FACT is composed of SSRP1 (Structure Specific Protein 1) and SPT16 (Suppressor of

Ty 16) and is highly conserved across eukaryotes (Cao et al., 2003; Wittmeyer and

Formosa, 1997). Loss of either one of the two components results in lethality during embryonic development such as that seen in mice (Cao et al., 2003), a significant impediment to understanding the role of this complex in the development of multicellular organisms.

In chapter two, I showed a role for FACT in the pharyngeal development of C. elegans such that the anterior pharynx fails to form in FACT-deficient embryos. The pharynx is the bilobed tubular feeding structure of the worm and is derived from two cell lineages, the AB and the MS (Mango, 2007) (Figure 8). There are two Notch interactions required for the proper formation of the anterior pharynx, and both require the maternally provided glp-1 receptor which is expressed in both ABa and ABp as well as their descendants (Priess et al., 1987; Priess, 2005). The first interaction occurs at the four-cell stage (Mello et al., 1994; Priess, 2005). P2 expresses the maternal ligand APX-1 which is

52 received by the contacting ABp (Mello et al., 1994). Soon after, members of the REF-1 family, a group of transcriptional repressors, are zygotically expressed and prevent the transcription of genes associated with the pharyngeal fate in all ABp descendant cells

(Neves and Priess, 2005). A second Notch interaction occurs at the 12-cell stage when two of the four ABa granddaughters contact the ligand-expressing cell called MS (Mello et al., 1992; Neves and Priess, 2005; Priess, 2005). This second interaction, facilitated by an unknown zygotic ligand (Priess, 2005), and expression of transcription factor gene pair tbx-37/38 (Good et al., 2004) work together to activate the pharyngeal organ identify factor pha-4 (Gaudet and Mango, 2002). pha-4 specifies the pharyngeal fate and activates the expression of many genes involved in the development of the pharynx at both early and late steps in the process (Gaudet and Mango, 2002).

In this study, I sought to understand how the FACT complex functions in relation to the processes important in C. elegans pharyngeal development, using genetic epistasis methods. I have initially focused on its relationship with apx-1 as its role in the first

Notch interaction of the AB lineage has been well described. I knocked down expression of FACT components by RNAi in apx-1 mutants and assessed the expression of two pharyngeal markers, myo-2::mCherry and PHA-4::GFP. I also show a delay in the onset of pha-4, a gene essential for the specification of the pharynx, in FACT-depleted embryos.

3.2 Results

3.2.1 FACT knockdown reduces area of pharyngeal markers in apx-1 mutants

In chapter 2, I show a role for FACT in C. elegans pharyngeal development such that loss of either FACT component results in the failure to form the anterior pharynx.

The maternally-provided Notch ligand APX-1 is known to function early in the pharyngeal development pathway by preventing the ABp descendants from adopting the pharyngeal fate; therefore, apx-1 mutants have excess pharyngeal cells. In order to place

FACT in the pharyngeal development pathway, I performed an epistasis analysis using apx-1(zu183), a genetic deletion allele, and RNAi for hmg-3;hmg-4 or spt-16 and used the early pharyngeal-intestinal expressing PHA-4::GFP marker and late pharyngeal expressing myo-2::mCherry to determine the amount of pharynx present. The embryos were scored one day after parents were laid on the RNAi. Loss of apx-1 is lethal; consequently, mutant strains are balanced by the eT1 balancer, and marked in cis with dpy-11(e224), allowing for selection of homozygous mutants by the Dpy phenotype.

Homozygous apx-1 mutants expressing PHA-4::GFP were subjected to RNAi against hmg-3; hmg-4 or spt-16 were at the L4 stage, and the area of GFP expression in laid embryos was measured after 24h. Morphological analysis at this early stage is difficult as differentiation has not yet occurred in many embryos; therefore, I based my conclusions only on comparison of the area of expression. The untreated apx-1 embryos expressed a larger area of PHA-4::GFP than all other conditions. The hmg-3(RNAi); hmg-

4(RNAi) and spt-16(RNAi) embryos had a smaller area of expression (Figure 9), both statistically similar to one another but different from the control and apx-1 embryos.

Interestingly, knockdown of hmg-3; hmg-4 or spt-16 in the apx-1 mutants returns PHA-

4::GFP expression to a level that is statistically similar to the wild-type control. It is important to note that PHA-4::GFP is not restricted to the pharynx but is also expressed in the intestine. Therefore, the actual area of pharyngeal expression is likely smaller than wild type. Homozygous apx-1 mutants expressing myo-2::mcherry were treated only with hmg-3(RNAi); hmg-4(RNAi) as the phenotype between hmg-3(RNAi); hmg-4(RNAi) and spt-16(RNAi) has been consistently the same. The morphology of untreated apx-1 mutants showed an excess pharynx phenotype (brackets in Figure 10C,D) whereas the hmg-3(RNAi); hmg-4(RNAi) embryos lacked anterior pharynx (Figure 10E,F), and the area of mCherry expression for each condition corresponded to those phenotypes: less myo-2::mCherry in the hmg-3; hmg-4 knockdowns than in the apx-1 mutants. However, while the morphology of the apx-1(zu183); hmg-3(RNAi); hmg-4(RNAi) embryos appear like apx-1 single mutants, the expression of myo-2::mCherry is statistically similar to that of apx-1(+) animals treated with hmg-3(RNAi); hmg-4(RNAi) (Figure 10G,H). Therefore, the morphology suggests apx-1 is epistatic to hmg-3; hmg-4, but the myo-2::mCherry expression is more consistent with either hmg-3; hmg-4 acting epistatically to apx-1.

3.2.2 Knockdown of FACT components causes a delay in expression of PHA- 4::GFP

PHA-4 is an organ identity factor essential for specification of pharyngeal cells derived from both the AB and MS lineages (Mango et al., 1994a). My previous work has shown that loss of the FACT complex causes a delay in the cell cycle that can be detected as early as the 8-cell stage (described in chapter 2). To determine if expression of PHA-4 55 was also delayed, I placed L4 hermaphrodites expressing PHA-4::GFP on empty vector control, hmg-3(RNAi); hmg-4(RNAi) or spt-16(RNAi) plates overnight before allowing them to lay eggs for one hour on fresh RNAi plates. Embryos were screened every hour for over the course of four hours with time zero (T0) being immediately after the laying period. Few eggs showed GFP expression at time zero, at the start of gastrulation, in any condition (Figure 11). By time two, two hours after the laying period, 98% of control embryos were fluorescent (Figure 11, blue line). In contrast, only 69% of hmg-

3(RNAi);hmg-4(RNAi) embryos (Figure 11, orange line) and 56% of spt-16(RNAi) embryos (Figure 11, gray line) expressed PHA-4::GFP.

3.3 Discussion

My previous studies have shown a delay in cell cycle progression in FACT- depleted embryos. Here I find the expression of pharyngeal specifier pha-4 is also delayed. This is not unexpected as expression of pha-4 is the culmination of the activating Notch signal, which is dependent on cell-cell signaling, and tbx-37/38 transcriptional activity, both of which might be perturbed as a consequence of the cell cycle delays (Priess et al., 1987; Priess, 2005). Interestingly, though both the anterior and posterior pharynx requires pha-4 for pharyngeal specification (Horner et al., 1998;

Mango et al., 1994a), development of the posterior pharynx does not appear to be impacted by the delay in expression in hmg-3(RNAi); hmg-4(RNAi) or spt-16(RNAi) embryos. I hypothesize that the defects in anterior pharyngeal development is not due to

56 the delay in pha-4 expression but because of failures in cell cycle progression in the AB lineage as detailed in chapter two.

The FACT/apx-1 epistasis analysis produced conflicting results. In apx-1(zu183); hmg-3(RNAi); hmg-4(RNAi) embryos, morphology was similar to apx-1 mutants; however, myo-2::mCherry expression was statistically similar to that of hmg-

3(RNAi);hmg-4(RNAi) embryos. Further analysis with the early expressing PHA-4::GFP marker showed an average area of fluorescence similar to wild type. One limitation of the experimental methodology that may impact these results is how the expression values were measured. I calculated the area of fluorescence for each embryo based on a single plane image which may not have provided as accurate a representation of the actual area of expression as would a 3D rendering. Experimental design of future studies will take this into account.

However, it may be that these conflicting results are a factual representation of what is occurring with respect to pharyngeal development in the FACT-depleted apx-1 mutants. I proposed three models for how FACT may influence the development of the pharynx. In the first model, the absence of the anterior pharynx in FACT-depleted embryos is due to the sensitivity of the AB lineage to loss of the FACT complex. My analysis of cell cycle timing in chapter two indicated a significant number of AB-derived cells fail to complete the sixth division. I hypothesize that though apx-1 mutants have

ABp cells that can respond to the activating Notch signal, loss of the FACT complex leads to division failure in some receiving cells prior to activation of pha-4 at the 44-cell stage, thereby returning the average area of expression to wild type levels. I presume

57 there are continued failures in divisions at timepoints beyond my lineage analysis; the loss of additional AB cells during differentiation would further reduce the number of pharyngeal cells until the number of cells expressing differentiation marker myo-2 resembles that of hmg-3(RNAi);hmg-4(RNAi) embryos. While I do not have data regarding divisions after MS2, it is possible that the MS lineage does not have the same division failures seen in the AB, allowing for proper posterior pharynx formation.

Alternatively, FACT could be required for the transcription of genes involved in the degradation or inactivation of APX-1 in the EMS at the four-cell stage (Figure 12A).

At the two-cell stage, APX-1 is present on the cortex of P1 (Mickey et al., 1996). After

P1 divides into daughters EMS and P2, APX-1 is found on the membrane at the point of contact between P2 and ABp (Mickey et al., 1996); it is also found in cytoplasmic punctate structures in the EMS, but is rapidly lost (Mickey et al., 1996) ABa and ABp are equivalent at this stage, both expressing the Notch receptor GLP-1, and are therefore capable of receiving and responding to the APX-1 signal (Mango et al., 1994b; Mello et al., 1994; Mickey et al., 1996). Degradation (or inactivation) of APX-1 in the EMS would ensure ABa and its descendants remain competent to respond to the second Notch signal at the 12-cell stage. Degradation of APX-1 could occur via a zygotic pathway as zygotic transcription is known to begin at the four-cell stage. In this model, FACT depletion would allow APX-1 to perdure in the EMS and signal to ABa, blocking the pharyngeal fate in this lineage and resulting in no anterior pharynx without impacting posterior pharynx development.

Lastly, FACT could be involved in the activation of the pharyngeal fate by facilitating the transcription of genes involved in later stages of pharyngeal differentiation

(Figure 12B). There have been reports in which the FACT complex has been found to be recruited to muscle-specific genes to promote muscle differentiation in mammalian cells

(Lolis et al., 2013). Additionally, in ssrp1a deficient zebrafish embryos, a gene expressed in differentiating hepatoblasts is present at 48 hours post-fertilization but is lost by 96 hours, indicating a failure in differentiation progression (Koltowska et al., 2013). A similar situation may be occurring in C. elegans; while early pharyngeal specification steps may occur properly, expression of genes needed for later stages of differentiation may not be initiated or maintained, halting anterior pharyngeal formation. The lack of perturbation in posterior pharynx development could be due to FACT not being required for the expression of genes involved in that developmental pathway.

Each of the three models of FACT function proposed explain the results reported here at least partially. Therefore, I believe these models need not be mutually exclusive.

However, to gain a more complete understanding of FACT involvement specifically in the formation of the anterior pharynx of C. elegans as well as more generally in the development of multicellular organisms, each of the models must be considered independently of the others. The model of FACT-dependent degradation of APX-1 can be evaluated by observing the behavior of APX-1 in the EMS in wild type and FACT-depleted embryos perhaps with antibody staining or in real time with endogenous levels of fluorescently tagged APX-1. The remaining two models will be more difficult to evaluate separately as it will require an uncoupling of FACT’s cell cycle and transcriptional

59 functions. This will require more thorough understanding of FACT’s functions, mechanisms of recruitment, and binding partners for each of these processes. Then, I can begin to perturb specific interactions and assess the impact on the developing embryo.

3.4 Materials and Methods

3.4.1 C. elegans strains, maintenance and construction

All C. elegans strains were cultured and maintained at 20C on NGM with E. coli OP50 as a food source. The N2 strain is wild type. Strains used in this study are as follows:

Mutant and transgenic strains:

JJ746 apx-1(zu183) dpy-11(e224)/eT1 let-500 (Mello et al., 1994)

SM481 pxIs10 [pha-4::GFP::CAAX + (pRF4) rol-6(su1006)]

CM2450 unc-119(e2498); guEx1457 (this work)

CM2614 apx-1(zu183) dpy-11(e224)/eT1 let-500; guEx1511

CM2675 apx-1(zu183) dpy-11(e224)/eT1 let-500; pxIs10 [pha-4::GFP::CAAX + (pRF4) rol-6(su1006)]

guEx1457 and guEx1511 were generated by introduction of DNA into the syncytial gonad using standard microinjection methods (Mello et al., 1991). The injection mix included 75 ng/ul pAW22(nhr-232::gfp), 15 ng/ul unc-119(+) plasmid, and

5 ng/ul pCFJ90 (myo-2::mCherry). guEx1457 was generated by microinjection into

RH10 unc-119(e2498) and CM2614 was generated by microinjection into JJ614.

CM2675 was constructed by crossing N2 (wild type) males with SM481 hermaphrodites, and selecting F1 cross (Rol) males. These males were crossed to JJ614 hermaphrodites, and F2 Rol males were crossed back to the parental JJ614 strain. F3 Rol

L4 hermaphrodites were selected individually to plates, and their F4 offspring were evaluated. A strain that segregated only Dpy Mel, and heterozygotes was identified, and

Rol offspring were selected individually to plates to evaluate their offspring, in order to identify a strain homozygous for the pxIs10 transgene.

3.4.2 RNA Interference

All RNAi experiments were performed by feeding on plates as described (Kamath et al., 2000). Briefly, hermaphrodites at the L4 stage were placed on 3.5 cm NGM plates with IPTG (final concentration 1mM) and carbenicillin (final concentration 25 μg/ml) seeded with designated bacteria from a fresh overnight culture. HT115 bacteria bearing the empty L4440 vector was used as a negative control. For lethality assays, parent worms were removed after 24h and the number of eggs that were present on the plate counted. Any eggs remaining after an additional 24h were scored as dead.

RNAi clones for hmg-3 and hmg-4 were from the Ahringer RNAi library (hmg-3:

I-2N19; hmg-4: III-3P10) and were verified by sequencing. A RNAi clone for spt-16 was generated as described in chapter 2. In double hmg-3(RNAi); hmg-4(RNAi) experiments, equal volumes of bacteria bearing the hmg-3 and hmg-4 RNAi clones were mixed together prior to seeding on plates. All RNAi experiments were conducted at 20°C.

3.4.3 Fluorescent Microscopy and expression analysis

61 agar. Embryos were imaged at 100x magnification in a single plane; larval images were taken at 40x. Embryos expressing myo-2::mCherry or pha-4::gfp were selected and evaluated 24h after the L4 parent was placed on RNAi plates.

Images were imported into ImageJ (Schindelin et al., 2015). Fluorescent portions of the embryos were selected using the freehand drawing tool and the area calculated by the program’s ‘measure’ function.

Figure 8 Notch interactions in pharyngeal development. Diagram of the two Notch signals involved in the development of the anterior pharynx in C. elegans. Cells outlined in blue have the GLP-1 receptor. Notch signal is sent in the direction of the arrow(s): from the cell containing the blunt end to the cells containing the arrow head. Modified from Wormbook.org. (Priess, 2005)

Figure 9 Analysis of PHA-4::GFP expression in FACT-deficient apx-1 mutants.

A: Quantification of the area of expression of PHA-4::GFP. Boxes represent the median and first and third quartile. Error bars represent the minimal and maximal values. Shapes indicate groups of statistical similarity. Each group is statically different from the others. (T-test, p≤0.0005) B-I: Representative images from each condition. Image of spt- 16(RNA) embryo excluded as it is the same as hmg-3(RNAi); hmg-4(RNAi) embryo.

Figure 10 Analysis of myo-2::rfp expression in FACT-deficient apx-1 mutants

A-H: Comparison of embryos from apx-1 homozygous mutants, hmg-3(RNAi); hmg- 4(RNAi) and apx-1(zu183); hmg-3(RNAi); hmg-4(RNAi). Black and white brackets indicate the pharynx. apx-1 mutants have excess anterior pharynx whereas hmg-3(RNAi); hmg-4(RNAi) embryos have no anterior pharynx. Combination of hmg-3(RNAi); hmg-

4(RNAi) and the apx-1 mutation results in embryos that appear morphologically like apx- 1 but express myo-2::rfp like hmg-3(RNAi); hmg-4(RNAi) embryos. I: Quantification of the area of expression of myo-2::rfp. Boxes represent the median and first and third quartile. Error bars represent the minimal and maximal values. Shapes indicate groups of statistical similarity. Each group is statistically different from the others. (T-test, p≤0.0001)

Figure 11 Knockdown of FACT components delays onset of PHA-4::GFP

A: Embryos expressing PHA-4::GFP with RNAi against hmg-3/hmg-4 or spt-16 were evaluated at different timepoint after the parents had laid for one hour. hmg-3(RNAi); hmg-4(RNAi) and spt-16(RNAi) embryos had a delayed expression of PHA-4::GFP compared to the control animals. B: Representative images for each condition at time 2. All control embryos are expressing, but only some of the RNAi embryos show expression.

Figure 12 Possible models to explain FACT function in C. elegans embryos

A: FACT as an inhibitor; model in which FACT may be functioning in the EMS at the 4- cell stage in the transcription of a gene that can inactivate APX-1 thereby preventing the Notch signal from inhibiting the pharyngeal fate in the ABA. B: FACT as an activator; model in which FACT functions ABa-descendants to activate genes necessary to develop the pharynx. Cells outlined in blue have the GLP-1 receptor. Notch single is sent in the direction of the arrow(s): from the cell containing the blunt end to the cells containing the arrow head.

Chapter 4: Discussion

4.1 Results overview

In this work, I sought to understand the role of the FACT complex during the development of C. elegans. The C. elegans genome contains two SSRP1 gene orthologs, hmg-3 and hmg-4, suggesting a duplication event has occurred within this gene.

Knockdown of hmg-3; hmg-4 or the SPT-16 gene ortholog spt-16 by RNAi caused embryonic lethality and embryos failed to form the anterior portion of the pharynx. Each

FACT subunit has a maternal and zygotic component and was expressed widely during most of embryonic development. In late embryonic stages, hmg-3 became restricted to the germline while both hmg-4 and spt-16 continued somatic expression in addition to the germline expression.

Maternally provided FACT was sufficient for embryonic viability and pharyngeal development; however, knockdown of hmg-3, hmg-4 or spt-16 in first stage larva (L1) indicated a post-embryonic requirement for each gene. Both hmg-3 and hmg-4 are needed individually for fertility, and hmg-4 as well as spt-16 are necessary for progression through larval development. FACT is also involved in cell cycle progression. Without

FACT, the embryonic cell cycle timing slowed in all tested lineages, and several AB- derived cells failed to divide beginning at the fifth division of the AB lineage (AB5).

The excess pharynx phenotype of apx-1 mutants was reduced in combination with

FACT subunit knockdown. In these embryos, early pharyngeal marker PHA-4::GFP was expressed at wild type-like levels, and late stage marker myo-2::mcherry was expressed at levels most similar to that of hmg-3(RNAi); hmg-4(RNAi) or spt-16(RNAi) embryos, indicating a decreasing number of expressing cells as the embryo proceeded through development.

In the remainder of this chapter, I will discuss a few of the new questions the results of my study have prompted.

4.2 Retention of SSRP1 duplicates in C. elegans

Most gene duplications result in one copy becoming inactive (Woollard, 2005). For both copies to be maintained, there must be some pressure that selects for retention such as one copy acquiring a new function (neofunctionalization) or both copies being compromised in a way that both are now required to do the function of the ancestral gene

(subfunctionalization) (Woollard, 2005). Furthermore, gene duplicates expressed during early embryonic development are more likely to be silenced than those expressed in late stages or after hatching (Woollard, 2005).

Both hmg-3 and hmg-4 are expressed during early embryogenesis in an overlapping pattern, and while they are 81% identical across the entirety of their amino acid sequence, they are 100% identical in their three shared protein domains (Figure 1C).

My analyses did not uncover any individual requirement for either gene during embryonic development; instead, it appears only one maternally provided SSRP1

70 ortholog is necessary for embryonic viability and proper pharyngeal development.

Considering this, why has the expression of hmg-3 and hmg-4 been maintained during embryonic development?

One hypothesis is that the embryonic expression of both hmg-3 and hmg-4 is a by- product of their roles in fertility. It is possible that in the performance of their fertility duties, hmg-3 and hmg-4 are packaged in the developing oocyte, not as a deliberate inclusion of both genes, but simply because both are present. This would imply that if one copy could satisfy the germ line requirements of both, only one gene would be expressed during early embryonic development.

Other Caenorhabditis species such as C. briggsae and C. remanei have evidence of a SSRP1 duplication, which may suggest that the duplication event occurred early in

Caenorhabditis history (Figure 13). Nevertheless, only in C. elegans has all the domains of both copies been preserved. If one gene is sufficient and hmg-3 and hmg-4 are identical in their protein domains, why are both necessary for fertility in C. elegans? Has one acquired a new and essential function(s)? Or perhaps have mutations interrupted some essential function in such a way that both are required? These questions provide the opportunity for the study of not only gene duplication but also network evolution between species. What are the underlying pathway differences that have allowed one copy to be sufficient in other Caenorhabditis species but not in C. elegans?

4.3 Role of maternal FACT in cell cycle progression

My expression analysis of HMG-3, HMG-4 and SPT-16 showed each protein is expressed beginning in developing oocytes and continuing throughout the lifetime of the 71 animal (Figure 4). Being present at such an early stage of development indicates that these are maternally provided proteins as zygotic transcription does not begin until the 4- cell stage in C. elegans (Baugh et al., 2003). Maternal proteins function in a variety of processes crucial to the success of embryonic development such as determination of the body axis, early specifications of cell lineages, the activation of the zygotic genome during the maternal to zygotic transition (MZT), and, most noticeably from my studies, control of the cell cycle (Robertson and Lin, 2015; Tadros and Lipshitz, 2009).

Regulation and successful completion of the cell cycle is dependent on many factors. Consequently, a cell cycle failure could be the result of any number of defects.

FACT is known to function in several processes related to the cell cycle such as the initiation of DNA replication (Tan et al., 2010), maintaining the rate of replication forks

(Abe et al., 2011), proper centromere formation (Lejeune et al., 2007), and chromosome separation (Okada et al., 2009; Prendergast et al., 2016). Therefore, it is perhaps not surprising to find that RNAi depletion of FACT components leads to cell cycle delay and, eventually, failure. But what is the source of the cell cycle delay? One possible hypothesis is that the processes in which FACT is currently known to participate—DNA replication, DNA repair, etc.—are slowed in the absence of the FACT complex. This slowing causes the cell to pause at a cell cycle checkpoint until the proper conditions have been met; this would cause the overall length of the cell cycle to increase.

Additionally, failure to meet the requirements of a checkpoint could be the reason many cells of the AB lineage failed to attempt or failed to complete the sixth division. If this is indeed the case, it will be interesting to see if there is one specific process in which

FACT is involved that causes the delay or whether it is the result of the perturbation of several functions.

4.3 FACT during the ZGA

While FACT is involved in several types of processes, it is a transcriptional complex, and it is also present during the time of the zygotic genome activation (ZGA).

Therefore, it is not unreasonable to propose that FACT may be involved in the ZGA.

What is interesting is that there are not more gross abnormalities in FACT-deficient embryos; in fact, they are quite well-ordered (Figure 3). This could be due to two main possibilities. First, FACT could not be widely involved in the ZGA. There is precedence in the literature for the recruitment of the FACT complex to specific genes (Kihara et al.,

2008; Lolis et al., 2013), and there is data that supports FACT being involved in the transcription of only a small number of genes (Garcia et al., 2011; Jimeno-González et al., 2006). Therefore, it is possible that FACT is targeted to a subset of genes. These genes may be involved in the development of the pharynx and/or other general developmental processes unrelated to the specification of other cell types. An alternative explanation is that while FACT may be involved in the specification of other cells, it is not required. In the absence of FACT, other factors would transcribe the genes necessary for a particular fate, allowing for multiple avenues to a final destination.

What changes to the transcriptome occurs in the absence of the FACT complex during the ZGA? Does FACT maintain its selectivity during this phase of rapid activation, or is it more promiscuous? How necessary is FACT for the transcription of its

73 targets? These questions may help to explain the specificity of the FACT phenotype in C. elegans despite its wide expression.

4.4 C. elegans FACT and human disease

During the cell cycle analysis, I was surprised to find not all cell lineages of the C. elegans embryo respond the same way to loss of the FACT complex. While all three lineages displayed a lengthening of the cell cycle, only in the AB did cells fail to divide.

It is possible the time frame of my assay was not long enough to detect division failures in other lineages, but if the effect on cell cycle progression was uniformly cumulative— that is, if the defects began at the one cell stage and grew progressively worse with each division—then at the time when divisions began to fail in the AB (AB6), cells within the

MS and E lineages should have also failed to divide around the same time. However, this is not consistent with my data. Additionally, other tissue types are present to some extent in those embryos whereas the anterior pharynx is completely absent which indicates a sensitivity in the AB to loss of FACT.

This raises an important question regarding the differential effect of FACT- depletion in various cell types. As there is interest in using FACT as a drug target in cancers, the answer to this question is of high importance. Are some tissues more sensitive to the loss of FACT than others, and what is the consequence of losing FACT in those tissues? What causes this sensitivity, and are there ways to mitigate the effects?

Further lineages analysis in FACT-deficient embryos may provide answers to these questions and others.

4.5 Final conclusions

In this study, I have begun to explore the role of the FACT complex during the development of C. elegans. My data has shown FACT to be involved in pharyngeal development and the progression of cell cycle, but are these major functions of the FACT complex during the development or are there others? Are these functions of the same importance in all organisms or just in C. elegans? I believe this work has provided a foundation for the answering of these questions, those proposed in the preceding sections and still others not yet asked. In understanding the impact of the FACT complex on the development of multicellular organisms, perhaps we can begin to understand its role in diseases such as cancer.

Figure 13 Dendogram representing all genomes included in Treefam for SSRP1 76

References

Abe, T., Sugimura, K., Hosono, Y., Takami, Y., Akita, M., Yoshimura, A., Tada, S., Nakayama, T., Murofushi, H., Okumura, K., Takeda, S., Horikoshi, M., Seki, M., Enomoto, T., 2011. The Histone Chaperone Facilitates Chromatin Transcription (FACT) Protein Maintains Normal Replication Fork Rates. J. Biol. Chem. 286, 30504–30512. https://doi.org/10.1074/jbc.M111.264721 Ali-Murthy, Z., Lott, S.E., Eisen, M.B., Kornberg, T.B., 2013. An Essential Role for Zygotic Expression in the Pre-Cellular Drosophila Embryo. PLoS Genet. 9. https://doi.org/10.1371/journal.pgen.1003428 Aoki, F., Worrad, D.M., Schultz, R.M., 1997. Regulation of Transcriptional Activity during the First and Second Cell Cycles in the Preimplantation Mouse Embryo. Dev. Biol. 181, 296–307. https://doi.org/10.1006/dbio.1996.8466 Attwood, K., Fleyshman, D., Prendergast, L., Paszkiewicz, G., Omilian, A.R., Bshara, W., Gurova, K., 2017. Prognostic value of histone chaperone FACT subunits expression in breast cancer. Breast Cancer Targets Ther. 9, 301–311. https://doi.org/10.2147/BCTT.S126390 Bartel, D.P., 2009. MicroRNA Target Recognition and Regulatory Functions. Cell 136, 215–233. https://doi.org/10.1016/j.cell.2009.01.002 Baugh, L.R., Hill, A.A., Slonim, D.K., Brown, E.L., Hunter, C.P., 2003. Composition and dynamics of the Caenorhabditis elegans early embryonic transcriptome. Development 130, 889–900. https://doi.org/10.1242/dev.00302 Belotserkovskaya, R., Oh, S., Bondarenko, V.A., Orphanides, G., Studitsky, V.M., Reinberg, D., 2003. FACT Facilitates Transcription-Dependent Nucleosome Alteration. Science 301, 1090–1093. https://doi.org/10.1126/science.1085703 Benoit, B., He, C.H., Zhang, F., Votruba, S.M., Tadros, W., Westwood, J.T., Smibert, C.A., Lipshitz, H.D., Theurkauf, W.E., 2009. An essential role for the RNA- binding protein Smaug during the Drosophila maternal-to-zygotic transition. Dev. Camb. Engl. 136, 923–932. https://doi.org/10.1242/dev.031815 Birchler, J.A., Veitia, R.A., 2007. The Gene Balance Hypothesis: From Classical Genetics to Modern Genomics. Plant Cell Online 19, 395–402. https://doi.org/10.1105/tpc.106.049338 Biswas, D., Yu, Y., Prall, M., Formosa, T., Stillman, D.J., 2005. The Yeast FACT Complex Has a Role in Transcriptional Initiation. Mol. Cell. Biol. 25, 5812–5822. https://doi.org/10.1128/MCB.25.14.5812-5822.2005 Biterge, B., Schneider, R., 2014. Histone variants: key players of chromatin. Cell Tissue Res. 356, 457–466. https://doi.org/10.1007/s00441-014-1862-4

Blaxter, M., Denver, D.R., 2012. The worm in the world and the world in the worm. BMC Biol. 10, 57. https://doi.org/10.1186/1741-7007-10-57 Brenner, S., 1974. The Genetics of CAENORHABDITIS ELEGANS. Genetics 77, 71– 94. Brewster, N.K., Johnston, G.C., Singer, R.A., 1998. Characterization of the CP Complex, an Abundant Dimer of Cdc68 and Pob3 Proteins That Regulates Yeast Transcriptional Activation and Chromatin Repression. J. Biol. Chem. 273, 21972– 21979. https://doi.org/10.1074/jbc.273.34.21972 Broitman-Maduro, G., Lin, K.T.-H., Hung, W.W.K., Maduro, M.F., 2006. Specification of the C. elegans MS blastomere by the T-box factor TBX-35. Development 133, 3097–3106. https://doi.org/10.1242/dev.02475 Bultman, S.J., Gebuhr, T.C., Pan, H., Svoboda, P., Schultz, R.M., Magnuson, T., 2006. Maternal BRG1 regulates zygotic genome activation in the mouse. Genes Dev. 20, 1744–1754. https://doi.org/10.1101/gad.1435106 Cao, S., Bendall, H., Hicks, G.G., Nashabi, A., Sakano, H., Shinkai, Y., Gariglio, M., Oltz, E.M., Ruley, H.E., 2003. The High-Mobility-Group Box Protein SSRP1/T160 Is Essential for Cell Viability in Day 3.5 Mouse Embryos. Mol. Cell. Biol. 23, 5301–5307. https://doi.org/10.1128/MCB.23.15.5301-5307.2003 Carter, D.R., Murray, J., Cheung, B.B., Gamble, L., Koach, J., Tsang, J., Sutton, S., Kalla, H., Syed, S., Gifford, A.J., Issaeva, N., Biktasova, A., Atmadibrata, B., Sun, Y., Sokolowski, N., Ling, D., Kim, P.Y., Webber, H., Clark, A., Ruhle, M., Liu, B., Oberthuer, A., Fischer, M., Byrne, J., Saletta, F., Thwe, L.M., Purmal, A., Haderski, G., Burkhart, C., Speleman, F., Preter, K.D., Beckers, A., Ziegler, D.S., Liu, T., Gurova, K.V., Gudkov, A.V., Norris, M.D., Haber, M., Marshall, G.M., 2015. Therapeutic targeting of the MYC signal by inhibition of histone chaperone FACT in neuroblastoma. Sci. Transl. Med. 7, 312ra176-312ra176. https://doi.org/10.1126/scitranslmed.aab1803 Chen, T., Dent, S.Y.R., 2014. Chromatin modifiers: regulators of cellular differentiation. Nat. Rev. Genet. 15, 93–106. https://doi.org/10.1038/nrg3607 Consortium*, T.C. elegans S., 1998. Genome Sequence of the Nematode C. elegans: A Platform for Investigating Biology. Science 282, 2012–2018. https://doi.org/10.1126/science.282.5396.2012 Corsi, A.K., 2015. A Transparent window into biology: A primer on Caenorhabditis elegans. WormBook 1–31. https://doi.org/10.1895/wormbook.1.177.1 Dickinson, D.J., Pani, A.M., Heppert, J.K., Higgins, C.D., Goldstein, B., 2015. Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Genetics 200, 1035–1049. https://doi.org/10.1534/genetics.115.178335 Dion, M.F., Kaplan, T., Kim, M., Buratowski, S., Friedman, N., Rando, O.J., 2007. Dynamics of Replication-Independent Histone Turnover in Budding Yeast. Science 315, 1405–1408. https://doi.org/10.1126/science.1134053 Dobson, A.T., Raja, R., Abeyta, M.J., Taylor, T., Shen, S., Haqq, C., Pera, R.A.R., 2004. The unique transcriptome through day 3 of human preimplantation development. Hum. Mol. Genet. 13, 1461–1470. https://doi.org/10.1093/hmg/ddh157

Duroux, M., Houben, A., Růžička, K., Friml, J., Grasser, K.D., 2004. The chromatin remodelling complex FACT associates with actively transcribed regions of the Arabidopsis genome. Plant J. 40, 660–671. https://doi.org/10.1111/j.1365- 313X.2004.02242.x Edgar, B.A., Schubiger, G., 1986. Parameters controlling transcriptional activation during early drosophila development. Cell 44, 871–877. https://doi.org/10.1016/0092- 8674(86)90009-7 Fay, D.S., Qiu, X., Large, E., Smith, C.P., Mango, S., Johanson, B.L., 2004. The coordinate regulation of pharyngeal development in C. elegans by lin-35/Rb, pha- 1, and ubc-18. Dev. Biol. 271, 11–25. https://doi.org/10.1016/j.ydbio.2004.03.022 Fleyshman, D., Prendergast, L., Safina, A., Paszkiewicz, G., Commane, M., Morgan, K., Attwood, K., Gurova, K., Fleyshman, D., Prendergast, L., Safina, A., Paszkiewicz, G., Commane, M., Morgan, K., Attwood, K., Gurova, K., 2017. Level of FACT defines the transcriptional landscape and aggressive phenotype of breast cancer cells. Oncotarget 8, 20525–20542. https://doi.org/10.18632/oncotarget.15656 Force, A., Lynch, M., Pickett, F.B., Amores, A., Yan, Y., Postlethwait, J., 1999. Preservation of Duplicate Genes by Complementary, Degenerative Mutations. Genetics 151, 1531–1545. Formosa, T., Ruone, S., Adams, M.D., Olsen, A.E., Eriksson, P., Yu, Y., Rhoades, A.R., Kaufman, P.D., Stillman, D.J., 2002. Defects in SPT16 or POB3 (yFACT) in Saccharomyces cerevisiae Cause Dependence on the Hir/Hpc Pathway: Polymerase Passage May Degrade Chromatin Structure. Genetics 162, 1557– 1571. Frand, A.R., Russel, S., Ruvkun, G., 2005. Functional Genomic Analysis of C. elegans Molting. PLOS Biol. 3, e312. https://doi.org/10.1371/journal.pbio.0030312 Frøkjær-Jensen, C., Davis, M.W., Hopkins, C.E., Newman, B., Thummel, J.M., Olesen, S.-P., Grunnet, M., Jorgensen, E.M., 2008. Single copy insertion of transgenes in C. elegans. Nat. Genet. 40, 1375–1383. https://doi.org/10.1038/ng.248 Gao, Y., Li, C., Wei, L., Teng, Y., Nakajima, S., Chen, X., Xu, J., Legar, B., Ma, H., Spagnol, S.T., Wan, Y., Dahl, K.N., Liu, Y., Levine, A.S., Lan, L., 2017. SSRP1 Cooperates with PARP and XRCC1 to Facilitate Single-Strand DNA Break Repair by Chromatin Priming. Cancer Res. 77, 2674–2685. https://doi.org/10.1158/0008-5472.CAN-16-3128 Garcia, H., Fleyshman, D., Kolesnikova, K., Safina, A., Commane, M., Paszkiewicz, G., Omelian, A., Morrison, C., Gurova, K., Garcia, H., Fleyshman, D., Kolesnikova, K., Safina, A., Commane, M., Paszkiewicz, G., Omelian, A., Morrison, C., Gurova, K., 2011. Expression of FACT in mammalian tissues suggests its role in maintaining of undifferentiated state of cells. Oncotarget 2, 783–796. https://doi.org/10.18632/oncotarget.340 Garcia, H., Miecznikowski, J.C., Safina, A., Commane, M., Ruusulehto, A., Kilpinen, S., Leach, R.W., Attwood, K., Li, Y., Degan, S., Omilian, A.R., Guryanova, O., Papantonopoulou, O., Wang, J., Buck, M., Liu, S., Morrison, C., Gurova, K.V., 2013. Facilitates Chromatin Transcription Complex Is an “Accelerator” of Tumor 79

Transformation and Potential Marker and Target of Aggressive Cancers. Cell Rep. 4, 159–173. https://doi.org/10.1016/j.celrep.2013.06.013 Gaudet, J., Mango, S.E., 2002. Regulation of Organogenesis by the Caenorhabditis elegans FoxA Protein PHA-4. Science 295, 821–825. https://doi.org/10.1126/science.1065175 Giraldez, A.J., Mishima, Y., Rihel, J., Grocock, R.J., Dongen, S.V., Inoue, K., Enright, A.J., Schier, A.F., 2006. Zebrafish MiR-430 Promotes Deadenylation and Clearance of Maternal mRNAs. Science 312, 75–79. https://doi.org/10.1126/science.1122689 Goldstein, B., 1995. An analysis of the response to gut induction in the C. elegans embryo. Development 121, 1227–1236. Goldstein, B., 1993. Establishment of gut fate in the E lineage of C. elegans: the roles of lineage-dependent mechanisms and cell interactions. Development 118, 1267– 1277. Good, K., Ciosk, R., Nance, J., Neves, A., Hill, R.J., Priess, J.R., 2004. The T-box transcription factors TBX-37 and TBX-38 link GLP-1/Notch signaling to mesoderm induction in C. elegans embryos. Development 131, 1967–1978. https://doi.org/10.1242/dev.01088 Graindorge, A., Le Tonquèze, O., Thuret, R., Pollet, N., Osborne, H.B., Audic, Y., 2008. Identification of CUG-BP1/EDEN-BP target mRNAs in Xenopus tropicalis. Nucleic Acids Res. 36, 1861–1870. https://doi.org/10.1093/nar/gkn031 Griffin, E.E., 2015. Cytoplasmic localization and asymmetric division in the early embryo of Caenorhabditis elegans. Wiley Interdiscip. Rev. Dev. Biol. 4, 267–282. https://doi.org/10.1002/wdev.177 Guven-Ozkan, T., Nishi, Y., Robertson, S.M., Lin, R., 2008. Global Transcriptional Repression in C. elegans Germline Precursors by Regulated Sequestration of TAF-4. Cell 135, 149–160. https://doi.org/10.1016/j.cell.2008.07.040 Hamatani, T., Carter, M.G., Sharov, A.A., Ko, M.S.H., 2004. Dynamics of Global Gene Expression Changes during Mouse Preimplantation Development. Dev. Cell 6, 117–131. https://doi.org/10.1016/S1534-5807(03)00373-3 He, F., 2011. Making Males of C. elegans. BIO-Protoc. 1. https://doi.org/10.21769/BioProtoc.58 Hermann, G.J., Leung, B., Priess, J.R., 2000. Left-right asymmetry in C. elegans intestine organogenesis involves a LIN-12/Notch signaling pathway. Development 127, 3429–3440. Hillier, L.W., Reinke, V., Green, P., Hirst, M., Marra, M.A., Waterston, R.H., 2009. Massively parallel sequencing of the polyadenylated transcriptome of C. elegans. Genome Res. 19, 657–666. https://doi.org/10.1101/gr.088112.108 Hondele, M., Stuwe, T., Hassler, M., Halbach, F., Bowman, A., Zhang, E.T., Nijmeijer, B., Kotthoff, C., Rybin, V., Amlacher, S., Hurt, E., Ladurner, A.G., 2013. Structural basis of histone H2A-H2B recognition by the essential chaperone FACT. Nature 499, 111–114. https://doi.org/10.1038/nature12242 Horner, M.A., Quintin, S., Domeier, M.E., Kimble, J., Labouesse, M., Mango, S.E., 1998. pha-4, anHNF-3 homolog, specifies pharyngeal organ identity 80

inCaenorhabditis elegans. Genes Dev. 12, 1947–1952. https://doi.org/10.1101/gad.12.13.1947 Hossan, T., Nagarajan, S., Baumgart, S.J., Xie, W., Magallanes, R.T., Hernandez, C., Chiaroni, P.-M., Indenbirken, D., Spitzner, M., Thomas-Chollier, M., Grade, M., Thieffry, D., Grundhoff, A., Wegwitz, F., Johnsen, S.A., 2016. Histone Chaperone SSRP1 is Essential for Wnt Signaling Pathway Activity During Osteoblast Differentiation. STEM CELLS 34, 1369–1376. https://doi.org/10.1002/stem.2287 Howe, J.A., Howell, M., Hunt, T., Newport, J.W., 1995. Identification of a developmental timer regulating the stability of embryonic cyclin A and a new somatic A-type cyclin at gastrulation. Genes Dev. 9, 1164–1176. https://doi.org/10.1101/gad.9.10.1164 Howe, J.A., Newport, J.W., 1996. A developmental timer regulates degradation of cyclin E1 at the midblastula transition during Xenopus embryogenesis. Proc. Natl. Acad. Sci. 93, 2060–2064. Hsieh, F.-K., Kulaeva, O.I., Patel, S.S., Dyer, P.N., Luger, K., Reinberg, D., Studitsky, V.M., 2013. Histone chaperone FACT action during transcription through chromatin by RNA polymerase II. Proc. Natl. Acad. Sci. 110, 7654–7659. https://doi.org/10.1073/pnas.1222198110 Hutter, H., Schnabel, R., 1994. glp-1 and inductions establishing embryonic axes in C. elegans. Development 120, 2051–2064. Innan, H., Kondrashov, F., 2010. The evolution of gene duplications: classifying and distinguishing between models. Nat. Rev. Genet. 11, 97–108. https://doi.org/10.1038/nrg2689 Jamai, A., Imoberdorf, R.M., Strubin, M., 2007. Continuous Histone H2B and Transcription-Dependent Histone H3 Exchange in Yeast Cells outside of Replication. Mol. Cell 25, 345–355. https://doi.org/10.1016/j.molcel.2007.01.019 Jamai, A., Puglisi, A., Strubin, M., 2009. Histone Chaperone Spt16 Promotes Redeposition of the Original H3-H4 Histones Evicted by Elongating RNA Polymerase. Mol. Cell 35, 377–383. https://doi.org/10.1016/j.molcel.2009.07.001 Jimeno-González, S., Gómez-Herreros, F., Alepuz, P.M., Chávez, S., 2006. A Gene- Specific Requirement for FACT during Transcription Is Related to the Chromatin Organization of the Transcribed Region. Mol. Cell. Biol. 26, 8710–8721. https://doi.org/10.1128/MCB.01129-06 Kamath, R.S., Ahringer, J., 2003. Genome-wide RNAi screening in Caenorhabditis elegans. Methods, RNA interference 30, 313–321. https://doi.org/10.1016/S1046- 2023(03)00050-1 Kamath, R.S., Fraser, A.G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, A., Le Bot, N., Moreno, S., Sohrmann, M., Welchman, D.P., Zipperlen, P., Ahringer, J., 2003. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421, 231–237. https://doi.org/10.1038/nature01278 Kamath, R.S., Martinez-Campos, M., Zipperlen, P., Fraser, A.G., Ahringer, J., 2000. Effectiveness of specific RNA-mediated interference through ingested double-

stranded RNA in Caenorhabditis elegans. Genome Biol. 2, research0002. https://doi.org/10.1186/gb-2000-2-1-research0002 Kihara, T., Kano, F., Murata, M., 2008. Modulation of SRF-dependent gene expression by association of SPT16 with MKL1. Exp. Cell Res. 314, 629–637. https://doi.org/10.1016/j.yexcr.2007.10.004 Koltowska, K., Apitz, H., Stamataki, D., Hirst, E.M.A., Verkade, H., Salecker, I., Ober, E.A., 2013. Ssrp1a controls organogenesis by promoting cell cycle progression and RNA synthesis. Development 140, 1912–1918. https://doi.org/10.1242/dev.093583 Kondrashov, F.A., Koonin, E.V., 2004. A common framework for understanding the origin of genetic dominance and evolutionary fates of gene duplications. Trends Genet. 20, 287–290. https://doi.org/10.1016/j.tig.2004.05.001 Krüger, A.V., Jelier, R., Dzyubachyk, O., Zimmerman, T., Meijering, E., Lehner, B., 2015. Comprehensive single cell-resolution analysis of the role of chromatin regulators in early C. elegans embryogenesis. Dev. Biol. 398, 153–162. https://doi.org/10.1016/j.ydbio.2014.10.014 Kumari, A., Mazina, O.M., Shinde, U., Mazin, A.V., Lu, H., 2009. A role for SSRP1 in recombination-mediated DNA damage response. J. Cell. Biochem. 108, 508–518. https://doi.org/10.1002/jcb.22280 Langley, A.R., Smith, J.C., Stemple, D.L., Harvey, S.A., 2014. New insights into the maternal to zygotic transition. Development 141, 3834–3841. https://doi.org/10.1242/dev.102368 Lee, M.T., Bonneau, A.R., Giraldez, A.J., 2014. Zygotic genome activation during the maternal-to-zygotic transition. Annu. Rev. Cell Dev. Biol. 30, 581–613. https://doi.org/10.1146/annurev-cellbio-100913-013027 Lejeune, E., Bortfeld, M., White, S.A., Pidoux, A.L., Ekwall, K., Allshire, R.C., Ladurner, A.G., 2007. The Chromatin-Remodeling Factor FACT Contributes to Centromeric Heterochromatin Independently of RNAi. Curr. Biol. 17, 1219– 1224. https://doi.org/10.1016/j.cub.2007.06.028 Li, L., Lu, X., Dean, J., 2013. The Maternal to Zygotic Transition in Mammals. Mol. Aspects Med. 34, 919–938. https://doi.org/10.1016/j.mam.2013.01.003 Li, Y., Zeng, S.X., Landais, I., Lu, H., 2007. Human SSRP1 Has Spt16-dependent and - independent Roles in Gene Transcription. J. Biol. Chem. 282, 6936–6945. https://doi.org/10.1074/jbc.M603822200 Lindsley, D.L., Sandler, L., Baker, B.S., Carpenter, A.T.C., Denell, R.E., Hall, J.C., Jacobs, P.A., Miklos, G.L.G., Davis, B.K., Gethmann, R.C., Hardy, R.W., Hessler, A., Miller, S.M., Nozawa, H., Parry, D.M., Gould-Somero, M., 1972. Segmental Aneuploidy and the Genetic Gross Structure of the Drosophila Genome. Genetics 71, 157–184. Lolas, I.B., Himanen, K., Grønlund, J.T., Lynggaard, C., Houben, A., Melzer, M., Van Lijsebettens, M., Grasser, K.D., 2010. The transcript elongation factor FACT affects Arabidopsis vegetative and reproductive development and genetically interacts with HUB1/2. Plant J. 61, 686–697. https://doi.org/10.1111/j.1365- 313X.2009.04096.x 82

Lolis, A.A., Londhe, P., Beggs, B.C., Byrum, S.D., Tackett, A.J., Davie, J.K., 2013. Myogenin Recruits the Histone Chaperone Facilitates Chromatin Transcription (FACT) to Promote Nucleosome Disassembly at Muscle-specific Genes. J. Biol. Chem. 288, 7676–7687. https://doi.org/10.1074/jbc.M112.426718 Lorch, Y., Kornberg, R.D., 2015. Chromatin-remodeling and the initiation of transcription. Q. Rev. Biophys. 48, 465–470. https://doi.org/10.1017/S0033583515000116 Lu, X., Li, J.M., Elemento, O., Tavazoie, S., Wieschaus, E.F., 2009. Coupling of zygotic transcription to mitotic control at the Drosophila mid-blastula transition. Development 136, 2101–2110. https://doi.org/10.1242/dev.034421 Lycan, D., Mikesell, G., Bunger, M., Breeden, L., 1994. Differential effects of Cdc68 on cell cycle-regulated promoters in Saccharomyces cerevisiae. Mol. Cell. Biol. 14, 7455–7465. https://doi.org/10.1128/MCB.14.11.7455 Maduro, M.F., 2010. Cell fate specification in the C. elegans embryo. Dev. Dyn. 239, 1315–1329. https://doi.org/10.1002/dvdy.22233 Maeda, I., Kohara, Y., Yamamoto, M., Sugimoto, A., 2001. Large-scale analysis of gene function in Caenorhabditis elegans by high-throughput RNAi. Curr. Biol. 11, 171–176. https://doi.org/10.1016/S0960-9822(01)00052-5 Malone, E.A., Clark, C.D., Chiang, A., Winston, F., 1991. Mutations in SPT16/CDC68 suppress cis- and trans-acting mutations that affect promoter function in Saccharomyces cerevisiae. Mol. Cell. Biol. 11, 5710–5717. https://doi.org/10.1128/MCB.11.11.5710 Mango, S., 2007. The C. elegans pharynx: a model for organogenesis. WormBook. https://doi.org/10.1895/wormbook.1.129.1 Mango, S.E., Lambie, E.J., Kimble, J., 1994a. The pha-4 gene is required to generate the pharyngeal primordium of Caenorhabditis elegans. Development 120, 3019–3031. Mango, S.E., Thorpe, C.J., Martin, P.R., Chamberlain, S.H., Bowerman, B., 1994b. Two maternal genes, apx-1 and pie-1, are required to distinguish the fates of equivalent blastomeres in the early Caenorhabditis elegans embryo. Development 120, 2305–2315. Mason, P.B., Struhl, K., 2003. The FACT Complex Travels with Elongating RNA Polymerase II and Is Important for the Fidelity of Transcriptional Initiation In Vivo. Mol. Cell. Biol. 23, 8323–8333. https://doi.org/10.1128/MCB.23.22.8323- 8333.2003 McGhee, J.D., 2013. The Caenorhabditis elegans intestine. Wiley Interdiscip. Rev. Dev. Biol. 2, 347–367. https://doi.org/10.1002/wdev.93 Mello, C.C., Draper, B.W., Krause, M., Weintraub, H., Priess, J.R., 1992. The pie-1 and mex-1 genes and maternal control of blastomere identity in early C. elegans embryos. Cell 70, 163–176. https://doi.org/10.1016/0092-8674(92)90542-K Mello, C.C., Draper, B.W., Prless, J.R., 1994. The maternal genes apx-1 and glp-1 and establishment of dorsal-ventral polarity in the early C. elegans embryo. Cell 77, 95–106. https://doi.org/10.1016/0092-8674(94)90238-0

Mickey, K.M., Mello, C.C., Montgomery, M.K., Fire, A., Priess, J.R., 1996. An inductive interaction in 4-cell stage C. elegans embryos involves APX-1 expression in the signalling cell. Development 122, 1791–1798. Moraes, K.C.M., Wilusz, C.J., Wilusz, J., 2006. CUG-BP binds to RNA substrates and recruits PARN deadenylase. RNA 12, 1084–1091. https://doi.org/10.1261/rna.59606 Morillo-Huesca, M., Maya, D., Muñoz-Centeno, M.C., Singh, R.K., Oreal, V., Reddy, G.U., Liang, D., Géli, V., Gunjan, A., Chávez, S., 2010. FACT Prevents the Accumulation of Free Histones Evicted from Transcribed Chromatin and a Subsequent Cell Cycle Delay in G1. PLoS Genet. 6. https://doi.org/10.1371/journal.pgen.1000964 Murray, J.I., Bao, Z., Boyle, T.J., Boeck, M.E., Mericle, B.L., Nicholas, T.J., Zhao, Z., Sandel, M.J., Waterston, R.H., 2008. Automated analysis of embryonic gene expression with cellular resolution in C. elegans. Nat. Methods 5, 703–709. https://doi.org/10.1038/nmeth.1228 Neves, A., Priess, J.R., 2005. The REF-1 Family of bHLH Transcription Factors Pattern C. elegans Embryos through Notch-Dependent and Notch-Independent Pathways. Dev. Cell 8, 867–879. https://doi.org/10.1016/j.devcel.2005.03.012 Newport, J., Kirschner, M., 1982a. A major developmental transition in early xenopus embryos: II. control of the onset of transcription. Cell 30, 687–696. https://doi.org/10.1016/0092-8674(82)90273-2 Newport, J., Kirschner, M., 1982b. A major developmental transition in early xenopus embryos: I. characterization and timing of cellular changes at the midblastula stage. Cell 30, 675–686. https://doi.org/10.1016/0092-8674(82)90272-0 Nishi, Y., Lin, R., 2005. DYRK2 and GSK-3 phosphorylate and promote the timely degradation of OMA-1, a key regulator of the oocyte-to-embryo transition in C. elegans. Dev. Biol. 288, 139–149. https://doi.org/10.1016/j.ydbio.2005.09.053 Okada, M., Okawa, K., Isobe, T., Fukagawa, T., 2009. CENP-H–containing Complex Facilitates Centromere Deposition of CENP-A in Cooperation with FACT and CHD1. Mol. Biol. Cell 20, 3986–3995. https://doi.org/10.1091/mbc.E09-01-0065 Okkema, P.G., Harrison, S.W., Plunger, V., Aryana, A., Fire, A., 1993. Sequence requirements for myosin gene expression and regulation in Caenorhabditis elegans. Genetics 135, 385–404. Orphanides, G., LeRoy, G., Chang, C.-H., Luse, D.S., Reinberg, D., 1998. FACT, a Factor that Facilitates Transcript Elongation through Nucleosomes. Cell 92, 105– 116. https://doi.org/10.1016/S0092-8674(00)80903-4 Orphanides, G., Wu, W.-H., Lane, W.S., Hampsey, M., Reinberg, D., 1999. The chromatin-specific transcription elongation factor FACT comprises human SPT16 and SSRP1 proteins. Nature 400, 284–288. https://doi.org/10.1038/22350 Papp, B., Pál, C., Hurst, L.D., 2003. Dosage sensitivity and the evolution of gene families in yeast. Nature 424, 194–197. https://doi.org/10.1038/nature01771 Paranjpe, S.S., Jacobi, U.G., van Heeringen, S.J., C Veenstra, G.J., 2013. A genome-wide survey of maternal and embryonic transcripts during Xenopus tropicalis development. BMC Genomics 14, 762. https://doi.org/10.1186/1471-2164-14-762 84

Prendergast, L., Müller, S., Liu, Y., Huang, H., Dingli, F., Loew, D., Vassias, I., Patel, D.J., Sullivan, K.F., Almouzni, G., 2016. The CENP-T/-W complex is a binding partner of the histone chaperone FACT. Genes Dev. 30, 1313–1326. https://doi.org/10.1101/gad.275073.115 Priess, J.R., 2005. Notch signaling in the C. elegans embryo. WormBook. https://doi.org/10.1895/wormbook.1.4.1 Priess, J.R., Schnabel, H., Schnabel, R., 1987. The glp-1 locus and cellular interactions in early C. elegans embryos. Cell 51, 601–611. https://doi.org/10.1016/0092- 8674(87)90129-2 Richard, J.L.C., Shukla, M.S., Menoni, H., Ouararhni, K., Lone, I.N., Roulland, Y., Papin, C., Simon, E.B., Kundu, T., Hamiche, A., Angelov, D., Dimitrov, S., 2016. FACT Assists Base Excision Repair by Boosting the Remodeling Activity of RSC. PLOS Genet. 12, e1006221. https://doi.org/10.1371/journal.pgen.1006221 Robertson, S., Lin, R., 2015. Chapter One - The Maternal-to-Zygotic Transition in C. elegans, in: Lipshitz, H.D. (Ed.), Current Topics in Developmental Biology, The Maternal-to-Zygotic Transition. Academic Press, pp. 1–42. https://doi.org/10.1016/bs.ctdb.2015.06.001 Robertson, S.M., Shetty, P., Lin, R., 2004. Identification of lineage-specific zygotic transcripts in early Caenorhabditis elegans embryos. Dev. Biol. 276, 493–507. https://doi.org/10.1016/j.ydbio.2004.09.015 Rowley, A., Singer, R.A., Johnston, G.C., 1991. CDC68, a yeast gene that affects regulation of cell proliferation and transcription, encodes a protein with a highly acidic carboxyl terminus. Mol. Cell. Biol. 11, 5718–5726. Ruan, J., Li, H., Chen, Z., Coghlan, A., Coin, L.J.M., Guo, Y., Hériché, J.-K., Hu, Y., Kristiansen, K., Li, R., Liu, T., Moses, A., Qin, J., Vang, S., Vilella, A.J., Ureta- Vidal, A., Bolund, L., Wang, J., Durbin, R., 2008. TreeFam: 2008 Update. Nucleic Acids Res. 36, D735–D740. https://doi.org/10.1093/nar/gkm1005 Saunders, A., Werner, J., Andrulis, E.D., Nakayama, T., Hirose, S., Reinberg, D., Lis, J.T., 2003. Tracking FACT and the RNA Polymerase II Elongation Complex Through Chromatin in Vivo. Science 301, 1094–1096. https://doi.org/10.1126/science.1085712 Schindelin, J., Rueden, C.T., Hiner, M.C., Eliceiri, K.W., 2015. The ImageJ ecosystem: An open platform for biomedical image analysis. Mol. Reprod. Dev. 82, 518–529. https://doi.org/10.1002/mrd.22489 Schwede, A., Manful, T., Jha, B.A., Helbig, C., Bercovich, N., Stewart, M., Clayton, C., 2009. The role of deadenylation in the degradation of unstable mRNAs in trypanosomes. Nucleic Acids Res. 37, 5511–5528. https://doi.org/10.1093/nar/gkp571 Semotok, J.L., Luo, H., Cooperstock, R.L., Karaiskakis, A., Vari, H.K., Smibert, C.A., Lipshitz, H.D., 2008. Drosophila Maternal Hsp83 mRNA Destabilization Is Directed by Multiple SMAUG Recognition Elements in the Open Reading Frame. Mol. Cell. Biol. 28, 6757–6772. https://doi.org/10.1128/MCB.00037-08 Seydoux, G., Fire, A., 1994. Soma-germline asymmetry in the distributions of embryonic RNAs in Caenorhabditis elegans. Development 120, 2823–2834. 85

Shakya, A., Callister, C., Goren, A., Yosef, N., Garg, N., Khoddami, V., Nix, D., Regev, A., Tantin, D., 2015. Pluripotency Transcription Factor Oct4 Mediates Stepwise Nucleosome Demethylation and Depletion. Mol. Cell. Biol. 35, 1014–1025. https://doi.org/10.1128/MCB.01105-14 Shimojima, T., Okada, M., Nakayama, T., Ueda, H., Okawa, K., Iwamatsu, A., Handa, H., Hirose, S., 2003. Drosophila FACT contributes to Hox gene expression through physical and functional interactions with GAGA factor. Genes Dev. 17, 1605–1616. https://doi.org/10.1101/gad.1086803 Shirayama, M., Soto, M.C., Ishidate, T., Kim, S., Nakamura, K., Bei, Y., van den Heuvel, S., Mello, C.C., 2006. The Conserved Kinases CDK-1, GSK-3, KIN-19, and MBK-2 Promote OMA-1 Destruction to Regulate the Oocyte-to-Embryo Transition in C. elegans. Curr. Biol. 16, 47–55. https://doi.org/10.1016/j.cub.2005.11.070 Singson, A., Mercer, K.B., L’Hernault, S.W., 1998. The C. elegans spe-9 Gene Encodes a Sperm Transmembrane Protein that Contains EGF-like Repeats and Is Required for Fertilization. Cell 93, 71–79. https://doi.org/10.1016/S0092-8674(00)81147-2 Strome, S., 2005. Specification of the germ line. WormBook. https://doi.org/10.1895/wormbook.1.9.1 Subtelny, A.O., Eichhorn, S.W., Chen, G.R., Sive, H., Bartel, D.P., 2014. Poly(A)-tail profiling reveals an embryonic switch in translational control. Nature 508, 66–71. https://doi.org/10.1038/nature13007 Sulston, J.E., Schierenberg, E., White, J.G., Thomson, J.N., 1983. The embryonic cell lineage of the nematode Caenorhabditis elegans. Dev. Biol. 100, 64–119. https://doi.org/10.1016/0012-1606(83)90201-4 Tadros, W., Lipshitz, H.D., 2009. The maternal-to-zygotic transition: a play in two acts. Development 136, 3033–3042. https://doi.org/10.1242/dev.033183 Talia, S.D., She, R., Blythe, S.A., Lu, X., Zhang, Q.F., Wieschaus, E.F., 2013. Post- translational control of Cdc25 degradation terminates Drosophila’s early cell cycle program. Curr. Biol. CB 23, 127–132. https://doi.org/10.1016/j.cub.2012.11.029 Tan, B.C.-M., Liu, H., Lin, C.-L., Lee, S.-C., 2010. Functional cooperation between FACT and MCM is coordinated with cell cycle and differential complex formation. J. Biomed. Sci. 17, 11. https://doi.org/10.1186/1423-0127-17-11 Tang, L., Nogales, E., Ciferri, C., 2010. Structure and function of SWI/SNF chromatin remodeling complexes and mechanistic implications for transcription. Prog. Biophys. Mol. Biol. 102, 122–128. https://doi.org/10.1016/j.pbiomolbio.2010.05.001 Tinevez, J.-Y., Perry, N., Schindelin, J., Hoopes, G.M., Reynolds, G.D., Laplantine, E., Bednarek, S.Y., Shorte, S.L., Eliceiri, K.W., 2017. TrackMate: An open and extensible platform for single-particle tracking. Methods, Image Processing for Biologists 115, 80–90. https://doi.org/10.1016/j.ymeth.2016.09.016 Tintori, S.C., Osborne Nishimura, E., Golden, P., Lieb, J.D., Goldstein, B., 2016. A Transcriptional Lineage of the Early C. elegans Embryo. Dev. Cell 38, 430–444. https://doi.org/10.1016/j.devcel.2016.07.025 86

Tsunaka, Y., Fujiwara, Y., Oyama, T., Hirose, S., Morikawa, K., 2016. Integrated molecular mechanism directing nucleosome reorganization by human FACT. Genes Dev. 30, 673–686. https://doi.org/10.1101/gad.274183.115 Winkler, D.D., Muthurajan, U.M., Hieb, A.R., Luger, K., 2011. Histone Chaperone FACT Coordinates Nucleosome Interaction through Multiple Synergistic Binding Events. J. Biol. Chem. 286, 41883–41892. https://doi.org/10.1074/jbc.M111.301465 Wittmeyer, J., Formosa, T., 1997. The Saccharomyces cerevisiae DNA polymerase alpha catalytic subunit interacts with Cdc68/Spt16 and with Pob3, a protein similar to an HMG1-like protein. Mol. Cell. Biol. 17, 4178–4190. Wittmeyer, J., Joss, L., Formosa, T., 1999. Spt16 and Pob3 of Saccharomyces cerevisiae Form an Essential, Abundant Heterodimer That Is Nuclear, Chromatin- Associated, and Copurifies with DNA Polymerase α. Biochemistry (Mosc.) 38, 8961–8971. https://doi.org/10.1021/bi982851d Woollard, A., 2005. Gene duplications and genetic redundancy in C. elegans. WormBook. https://doi.org/10.1895/wormbook.1.2.1 Xin, H., Takahata, S., Blanksma, M., McCullough, L., Stillman, D.J., Formosa, T., 2009. yFACT Induces Global Accessibility of Nucleosomal DNA without H2A-H2B Displacement. Mol. Cell 35, 365–376. https://doi.org/10.1016/j.molcel.2009.06.024 Xue, Z., Huang, K., Cai, C., Cai, L., Jiang, C., Feng, Y., Liu, Z., Zeng, Q., Cheng, L., Sun, Y.E., Liu, J., Horvath, S., Fan, G., 2013. Genetic programs in human and mouse early embryos revealed by single-cell RNA sequencing. Nature 500, 593– 597. https://doi.org/10.1038/nature12364 Yartseva, V., Giraldez, A.J., 2015. The maternal-to-zygotic transition during vertebrate development: a model for reprogramming. Curr. Top. Dev. Biol. 113, 191–232. https://doi.org/10.1016/bs.ctdb.2015.07.020

Table 1: Primers for CRISPR and RNAi

CRISPR/Cas9 Primers (5' -> 3') Guide RNAs Hmg-3 5' CGATTCACCAGAAGACTCGGGTTTTAGAGCTAGAAATAGCAAGT Hmg-4 5' CTCCGATGGATCTGATGAATGTTTTAGAGCTAGAAATAGCAAGT Spt16 5' TACTTTCTGCGTTTGTGCGAGTTTTAGAGCTAGAAATAGCAAGT CRCas 3' CAAGACATCTCGCAATAGG Homology Arms Hmg-3 5' Region 1 ACGTTGTAAAACGACGGCCAGTCGCCGGCATGGCTCAGAGAAAGATGCTTCAG Hmg-3 3' Region 1 CATCGATGCTCCTGAGGCTCCCGATGCTCCATCTGACTCACCAGAAGACTCGGAG Hmg-3 5' Region 2 CGTGATTACAAGGATGACGATGACAAGAGATGATTTTCTGACTAAATATTTTATTGTTGCTTTTTATTCG Hmg-3 3' Region 2 GGAAACAGCTATGACCATGTTATCGATTTCTCTGGATTGATGCCTGTTCGAG Hmg-4 5' Region 1 ACGTTGTAAAACGACGGCCAGTCGCCGGCAGCGAAGAAAGGGTGAACCTAAAGAG Hmg-4 3' Region 1 CATCGATGCTCCTGAGGCTCCCGATGCTCCATCTGAATCATCTGATTCATCAGATCCATCGGAGC Hmg-4 5' Region 2 CGTGATTACAAGGATGACGATGACAAGAGATAAATTATTAATTTTGTTTCTTTTAAACTCGTGTACTATCG Hmg-4 3' Region 2 GGAAACAGCTATGACCATGTTATCGATTTCTCTCCGACCAAAGAATCAGC Spt-16 5' Region 1 ACGTTGTAAAACGACGGCCAGTCGCCGGCACCTACATTCATCGTCACACTCTCC Spt-16 3' Region 1 CATCGATGCTCCTGAGGCTCCCGATGCTCCTTTTCTGCGTTTGTGCGATGG Spt-16 5' Region 2 CGTGATTACAAGGATGACGATGACAAGAGATAAATCCTGTTTGTATAATTTCCTCCGTTTTATTC Spt-16 3' Region 2 GGAAACAGCTATGACCATGTTATCGATTTCCCCACAAATCCACCGCAATC RNAi Primers (5' -> 3') Spt-16 5' CGAATCAACTTTGCCACTCC Spt-16 3' TCCAGACTTGCTGAATGTG