Molecular Stress Signaling in Breast Epithelial Cells

MOLECULAR STRESS SIGNALING IN BREAST EPITHELIAL CELLS

Characterization of the Regulation of the Breast Cancer Susceptibility Gene 1

(BRCA1) by Stress Signaling

and

Design of an Epidemiological Study Examining the Effect of Glucocorticoid

Receptor Genetic Variants on Breast Cancer Risk

Lilia Antonova

A thesis submitted to the Department of Pathology and Molecular Medicine

in conformity with the requirements for the

Degree of Doctor of Philosophy

Queen’s University

Kingston, Ontario, Canada

December, 2007

ABSTRACT

Breast cancer is a complex disease, whose etiology is not well understood. A number of factors have been found to contribute to its development. Psychological stress has been recognized as such a factor in epidemiological studies, but few molecular mechanisms have been proposed to explain its association to breast cancer risk. This work addresses the lack of knowledge in the area of stress and breast cancer with the use of molecular and epidemiological techniques. Molecular experiments allowed the identification of a link between stress signaling and intracellular signaling pathways known to be affected in breast cancer development. Namely, the stress hormone hydrocortisone (cortisol) was found to down-regulate the Breast Cancer Susceptibility

Gene 1 (BRCA1). Further study allowed identification of some of the mechanisms involved. Binding of the transcription factors GABPa/b and USF2 at specific sites of the

BRCA1 promoter (the RIBS and UP sites) was shown to be negatively affected by hydrocortisone. In addition, a novel hormone-independent function of the receptor for hydrocortisone, the glucocorticoid receptor, was identified in the context of BRCA1 regulation. GR was determined to act as a positive regulator of BRCA1 in the absence of hydrocortisone through the RIBS and UP sites. Taken altogether these results represent a novel molecular mechanism linking stress signaling to breast cancer development.

The second objective of this work was to design an epidemiological study which would determine whether stress-susceptible individuals are at higher risk of developing breast cancer. This study would be the first of its kind in the case of breast cancer and would allow the development of a genetic method of measuring stress exposure which can be used in future studies. The study was designed to look at glucocorticoid receptor

ii polymorphisms known to produce phenotypic differences in GR activity in a population of women with incident breast cancer and population-based controls. In conclusion, the present work suggests an integrative model of the effect of stress on breast cancer development which incorporates genetic predisposition to the effects of stress and downstream changes in the expression and activity of the Breast Cancer Susceptibility

Gene 1.

iii ACKNOWLEDGEMENTS

First and foremost I would like to thank my supervisors, Dr. Christopher R.

Mueller and Dr. Kristan Aronson.

I am deeply grateful to Dr. Mueller for always being there to listen and advise, for constantly encouraging novel ideas, and for giving me the opportunity to embark on this journey, which I have found exciting at every step of the way. I have been greatly inspired by the originality of his scientific approach and by his courage to explore scientific areas never addressed before. Being a part of the Muller lab family has been a privilege.

I would like to express my gratitude to Dr. Aronson for introducing me to a new field of study with patience, plenty of encouragement, and positive feedback. The skills that I have acquired in the course of this project are invaluable and I am greatly thankful for the opportunity to work with her.

The friendship and support of the members of our lab has contributed so much towards making this process an enjoyable and successful experience. Many thanks to Jim

Gore and Gwen MacDonald for having the answer to every question and for always been willing to share that knowledge. Gwen, Sherri, Val, Nicole, and Crista, you are the best and I will miss you greatly. I would like to thank Jalna Meens for being the lovely person that she is, for offering me a place to stay, and for never saying no to dancing the night away. I am also grateful to Michelle Sam, for being a wonderful friend, for always listening and having something funny to say, and for sharing my passion for books. My

Kingston experience would not have been the same without her.

I would also like to express my appreciation to Dr. Bruce Elliott who, as a member of my supervisory committee, has offered many helpful suggestions throughout

iv the years and to the agencies which have supported my research, the Canadian Breast

Cancer Foundation-Ontario Chapter, and the Canadian Institute of Health Research.

Finally, I would like to convey my deeply felt thanks to my family. To my wonderful, supportive, and sweet husband, whose constant encouragement and strength is what has allowed me to complete this journey successfully. Daniel, I cannot express the amount of gratitude and love that I have for you. You are my soulmate.; To my parents, for always telling me to reach higher, for teaching me that anything is achievable, and for having the courage to begin anew. Without all of that, this would not have been possible;

To my brother, for being somebody that I can always look up to and for teaching me about so many things, including science fiction, computer games, and Pink Floyd. And finally, to my grandparents, two of the loveliest people I know. The memories and love that you have given me are always close to my heart. And last but not least, to my little rabbit Zayo-Bayo, who always gives me unconditional love.

To my husband Daniel in whose warm heart and brown eyes

I have found my best friend;

And to my family, whose support I cherish more than I can express.

I love you all with all my heart.

TABLE OF CONTENTS

ABSTRACT……………………………………………………………………………….ii

ACKNOWLEDGEMENTS………………………………………………………………iv

DEDICATION……………………………………………………………………………vi

TABLE OF CONTENTS………………………………………………………………...vii

LIST OF FIGURES………………………………………………………………………xii

LIST OF TABLES………………………………………………………………………xiv

LIST OF ABBREVIATIONS……………………………………………………………xv

PREFACE…………………………………………………………………………….. xviii

OBJECTIVES…………………………………………………………………………...xix

CHAPTER 1. GENERAL INTRODUCTION……………………………………………1

1.1 Overview…………………………………………………………………1

1.2 The physiological role of hydrocortisone in the mammary gland……….4

1.3 The Glucocorticoid Receptor…………………………………………….7

1.3.1 Glucocorticoid receptor: overview………………………7

1.3.2 Mechanisms of GR regulation and signaling…………...10

1.3.3 Involvement of GR in apoptosis………………………...14

1.4 The Breast Cancer Susceptibility Gene 1……………………………….15

1.4.1 BRCA1 Function………………………………………..15

1.4.2 1.4.2 Structure of the BRCA1 gene and promoter……..19

1.4.3 Regulation of BRCA1 gene expression…………………21

1.4.3.1 Hormonal regulation of BRCA1 gene expression…………………………………..21

vii 1.4.3.2 Transcriptional regulation of BRCA1 gene expression…………………………………..23 1.5 Hypothesis………………………………………………………………27

CHAPTER 2. HYDROCORTISONE DOWN-REGULATES THE TUMOUR SUPRESSOR GENE BRCA1 IN MAMMARY CELLS: A POSSIBLE LINK BETWEEN STRESS AND BREAST CANCER………………………………………..28

2.1 Abstract………………………………………………………………...28

2.2 Introduction…………………………………………………………….29

2.3 Materials and Methods…………………………………………………32

2.3.1 Cell culture and treatments……………………………...32

2.3.2 Transient Transfections and Luciferase Assays………...33

2.3.3 Reverse Transcription and Real-Time PCR…………….33

2.3.4 Antibodies………………………………………………34

2.3.5 Nuclear Extract Preparation and EMSA Assays………..35

2.3.6 Western Blots…………………………………………...35

2.3.7 Statistical Analysis……………………………………...36

2.4 Results…………………………………………………………………...36

2.4.1 Characterization of EPH4 cells stably transfected with the BRCA1 proximal promoter……………………………..36

2.4.2 Glucocorticoids down-regulate exogenous BRCA1 promoter activity in EPH4-L6 non-malignant mouse mammary cells………………………………………….37

2.4.3 Continuous hydrocortisone presence is needed for long- term down-regulation in BRCA1 exogenous promoter activity…………………………………………………..43

2.4.4 Hydrocortisone has only a minimal effect on BRCA1 exogenous promoter activity in malignant mouse mammary cell lines……………………………………..45

2.4.5 Endogenous BRCA1 response to hydrocortisone parallels

viii that of exogenous BRCA1, and differs in non-malignant and malignant cells……………………………………...45 2.4.6 Hydrocortisone responsive sites within the BRCA1 promoter………………………………………………...47 2.4.7 Transcription Factors Involved in Hydrocortisone Signaling at the BRCA1 Promoter……………………..52

2.5 Discussion……………………………………………………………...56

2.6 Conclusions…………………………………………………………….59

CHAPTER 3. THE GLUCOCORTICOID RECEPTOR AS A REGULATOR OF BRCA1 EXPRESSION…………………………………………………………………..61

3.1 Abstract…………………………………………………………………61

3.2 Introduction……………………………………………………………..62

3.3 Materials and Methods………………………………………………….65

3.3.1 Cell Culture and Treatments…………………………….65

3.3.2 Transient Transfections and Luciferase Assays………...67

3.3.3 siRNA Western Blot…………………………………….68

3.3.4 Reverse Transcription and Real-time PCR……………..68

3.3.5 Immunofluorescence Assay…………………………….69

3.3.6 Chromatin Immunoprecipitation (ChIP) Assay………...69

3.4 Results…………………………………………………………………..70

3.4.1 Hydrocortisone represses BRCA1 gene expression in non- malignant human breast cells…………………………...70

3.4.2 The effect of hydrocortisone on BRCA1 expression in human breast cells is dependent on cell malignancy……72

3.4.3 The exogenous glucocorticoid receptor has a regulatory effect on BRCA1 expression, which differs between non- malignant and malignant mammary cells, but is independent of GR DNA binding activity and ligand availability………………………………………………74

ix 3.4.4 The effect of hydrocortisone and glucocorticoid receptor presence on BRCA1 expression differs between ovarian and breast cells………………………………………….78

3.4.5 Promoter elements involved in regulation of BRCA1 expression by GR……………………………………….80

3.4.6 GR binds directly to the BRCA1 promoter……………..84

3.5 Discussion………………………………………………………………84

CHAPTER 4. DESIGN OF AN EPIDEMIOLOGICAL STUDY LOOKING AT THE EFFECT OF POLYMORPHISMS IN THE GLUCOCORTIOCOID RECEPTOR GENE ON BREAST CANCER RISK…………………………………………………………..94

4.1 Abstract…………………………………………………………………94

4.1.1 Research Question………………………………………94

4.1.2 General Background…………………………………….94

4.1.3 Current knowledge on the association between stress and breast cancer development……………………………...96

4.1.3.1 Epidemiological evidence for a stress - breast cancer association…………………………..96

4.1.3.2 Molecular models for the effect of stress on breast cancer risk………………………….100

4.1.4 Biological Background and Biological Mechanism for the Proposed Research…………………………………….101

4.1.5 Conceptual Model for the Effect of GR Polymorphism Presence on Breast Cancer Development……………..105

4.1.6 Rationale for the Proposed Research………………….106

4.1.7 Objective……………………………………………...108

4.2 Study Design…………………………………………………………..108

4.2.1 Overview………………………………………………..108

4.2.2 Sampling………………………………………………...111

x 4.2.2.1 Source population………………………111

4.2.2.2 Cases……………………………………112

4.2.2.3 Controls………………………………...112

4.2.3 Exposure measurement………………………………….112

4.2.3.1 Selection of Polymorphisms to be Tested…………………………………………...113

4.2.4 Power Calculation………………………………………121

4.2.5 Analysis…………………………………………………125

4.3 Study Strengths and Limitations………………………………………125

4.3.1 Selection Bias…………………………………………...126

4.3.2 Information Bias………………………………………...127

4.3.3 Confounding…………………………………………….128

4.3.4 The effect of stress exposure on the possible association between GR polymorphisms and breast cancer risk…...129

4.3.5 Summary of strengths and limitations…………………130

4.4 Summary and Contributions of Research…………………………….132

CHAPTER 5. GENERAL DISCUSSION……………………………………………...134

5.1 Regulation of the BRCA1 promoter by the stress signaling pathway………………………………………………………………135

5.2 Integrating the results of this work into the current knowledge of molecular stress signaling in breast cells…………………………….138

5.3 A model of disease development……………………………………..140

5.4 Future directions and contributions of research……………………...141

REFERENCES………………………………………………………………………….143

APPENDIX A – STATISTICAL ANALYSIS AND DENSITOMETRY……………..164

APPENDIX B – BRCA1 PROMOTER ELEMENT CONSTRUCTS ………………...166

xi LIST OF FIGURES

Figure 1 Structure and development of the mammary gland………………………..5

Figure 2 Functional domains of the glucocorticoid receptor………………………..8

Figure 3 Modes of transcriptional regulation by the glucocorticoid receptor

(GR)………………………………………………………………………12

Figure 4 BRCA1 functional domains and interacting proteins…………………….17

Figure 5 Structure of the human and mouse BRCA1 loci…………………………20

Figure 6 Structure and transcriptional regulators of the BRCA1 promoter………..24

Figure 7 Glucocorticoids represses BRCA1 promoter activity in a concentration- dependent manner………………………………………………………...38

Figure 8 The NBR2 promoter is regulated coordinately with BRCA1 in the presence of hydrocortisone……………………………………………….40

Figure 9 Hydrocortisone repression of BRCA1 promoter activity in the presence of lactogenic hormones and in differentiated cells………………………….42

Figure 10 Hydrocortisone represses BRCA1 promoter activity regardless of growth conditions………………………………………………………………...44

Figure 11 Continuous hydrocortisone presence is required for long-term down- regulation of the BRCA1 promoter………………………………………46

Figure 12 Exogenous and endogenous BRCA1 promoter activity is regulated differently in non-malignant and malignant mouse mammary cells……..48

Figure 13 Protein complexes at the RIBS and UP regulatory elements of the BRCA1 promoter are lost upon hydrocortisone treatment………………………...50

Figure 13 Protein complexes at the RIBS and UP regulatory elements of the BRCA1 cont. promoter are lost upon hydrocortisone treatment………………………...51

Figure 14 The RIBS and UP regulatory elements of the BRCA1 promoter are functionally involved in hydrocortisone regulation of BRCA1 promoter activity……………………………………………………………………53

Figure 15 The transcription factors USF2 and GABPα/β bind to the hydrocortisone- responsive elements………………………………………………………55

xii Figure 16 GABPα/β and USF2 overexpression does not alter hydrocortisone-induced repression of BRCA1 promoter activity and the subunit protein levels are not altered by hydrocortisone…………………………………………….57

Figure 17 Hydrocortisone represses BRCA1 promoter activity and BRCA1 mRNA levels in non-malignant human mammary cells grown on monolayer…..71

Figure 18 Hydrocortisone down-regulates BRCA1 expression in differentiated non- malignant human mammary cells………………………………………..73

Figure 19 The effect of hydrocortisone on BRCA1 expression is dependent on cell malignancy……………………………………………………………….75

Figure 20 The glucocorticoid receptor (GR) upregulates BRCA1 promoter Activity…………………………………………………………………..77

Figure 21 The glucocorticoid receptor up-regulates BRCA1 promoter activity in the absence of ligand and independently of its DNA –binding function in human non-malignant cells………………………………………………79

Figure 22 The glucocorticoid receptor is present in both the cytoplasm and nucleus of EPH4 mammary cells in the absence of hydrocortisone………………81

Figure 23 Different regulation of the BRCA1 gene by hydrocortisone and the glucocorticoid receptor in ovarian cells………………………………….83

Figure 24 Promoter elements involved in the GR-induced upregulation of BRCA1 promoter activity…………………………………………………………85

Figure 25 The glucocorticoid receptor is present at the BRCA1 promoter…………87

Figure 26 Possible mechanisms of stress signaling at the BRCA1 promoter……….92

Figure 27 Biological model for the effect of GR polymorphisms on breast cancer risk………………………………………………………………………104

Figure 28 Conceptual model for the effect of GR polymorphisms on breast cancer development…………………………………………………………….107

Figure 29 Structure of the glucocorticoid receptor (GR) gene and GR function- altering polymorphisms…………………………………………………114

Figure 30a Possible mechanisms of stress signaling in breast cells………………...139

Figure 30b A model of stress-induced breast cancer development………………...139

xiii LIST OF TABLES

Table 1 Chapter 3 Culture conditions for cell lines used in this chapter…………66

Table 2 Chapter 4 Glucocorticoid receptor locus polymorphisms to be included in the study………………………………………………………………...120

Table 3 Chapter 4 Number of cases to be included in the study for various predicted odds ratios…………………………………………………….122

xiv LIST OF ABBREVIATIONS

# 53BP1 p53-binding protein

A A Adenine AcH3 Acetylated Histone 3 ACTH Adrenocorticotropin hormone AP-1 Activator Protein 1 AT-rich Adenine/Thymine rich DNA region ATM ataxia telangiectasia mutated

B BARD1 BRCA1-Associated RING Domain protein 1 BASC BRCA1-Associated Surveillance Complex BLM Bloom’s syndrome protein bp base pairs BRCA1 Breast Cancer Susceptibility Gene 1 BRCC BARD1-Containing Complex BRCT BRCA1 C-Terminal domain BRE Brain and Reproductive organ-Expressed protein BSA Bovine Serum Albumin

C C Cytosine CBP CREB-Binding Protein CDK Cyclin-Dependent Kinase ChIP Chromatin Immunoprecipitation CI Confidence Interval CMV-luc cytomegalovirus-luciferase CNS Conserved Non-coding Sequence CRE cAMP Response Element CREB cAMP Response Element Binding Protein C-terminal Carboxy-terminal

D DAP3 Death-Associated Protein 3 DMEM Dulbecco’s modified Eagle medium DNA Deoxyribonucleic Acid dNTPs dinucleotide triphosphates

E E2F E2 transcription factor EDTA ethylenediaminetetra-acetic acid disodium salt EMSA Electromobility Shift Assay ERK Extracellular signal-Regulated Kinase

F FBS Fetal Bovine Serum FOXO3a Forkhead transcription factor 3a

xv G G Guanine G1 Growth phase 1 GABP GA-Binding Protein GAR HRP goat anti-rabbit horse radish peroxidase GR Glucocorticoid Receptor GREs Glucocorticoid Response Elements GRIP Glucocorticoid Receptor-Interacting Protein GRwt GR wild-type

H HA Hemoglutinin A HAT Histone Acetylase HDAC Histone Deacetylase HMGA1 High Mobility Group Protein 1 HPA hypothalamic-pituitary-adrenal axis HR Hazard Ratio hsp Heat Shock Protein

I IkB-α Inhibitor - kB

J JNK c-Jun N-terminal Kinase

L L6 full length BRCA1 proximal promoter L6∆R L6 promoter RIBS deletion

M M Mitosis phase M Molar MAPK Mitogen-Activated Protein Kinase MMTV Mouse Mammary Tumour Virus MPK-1 MAP Kinase phosphatase – 1 MRN MRE11/RAD50/NBS1 repair complex m-RNA messenger Ribonucleic Acid

N NBR1 next to BRCA1 gene 1 NBR2 next to BRCA1 gene 2 NF-kB Nuclear Factor Kappa B nGREs negative GREs N-terminal Amino-terminal

O OFBCR Ontario Familial Breast Cancer Registry OR Odds Ratio

P PBS Phosphate Buffered Saline PCR Polymerase Chain Reaction Pen/Strep penicillin/streptomycin PTEN phosphatase and tensin homologue

xvi R Rb Retinoblastoma RFC Replication Factor C RFLP Restriction Fragment Length Polymorphism RT-PCR reverse-transcription polymerase chain reaction

S Ser Serine SGK-1 Serum and Glucocorticoid-regulated Kinase-1 siRNA small inhibitory RNA SNP Single Nucleotide Polymorphism SRC-1 Steroid Receptor Coactivator – 1

T T Thymine TGFβ Transforming Growth Factor β Thr Threonine TNFα Tumour Necrosis Factor α TP53 Tumour Protein 53

U USF2 Upstream Stimulatory Factor 2

xvii PREFACE

This thesis was written in manuscript format, according to the regulations outlined in the Queen’s University School of Graduate Studies and Research Handbook. Chapter two has been provisionally accepted for publication in Genes, Chromosomes and Cancer with minor revisions and is prepared in the format required for that journal. Chapter three is currently being prepared for submission. Chapter four was written in the format of a

CIHR grant proposal and will be used for a future epidemiological study. The contributions of other investigators to each study are outlined in the Statement of Co- authorship preceding each chapter.

xviii OBJECTIVES

Three main objectives developed in the course of this work. The first was to evaluate the role of hydrocortisone in regulating the expression of the BRCA1 gene in mouse mammary cells and to identify the molecular mechanisms involved (Chapter 2).

The second objective was to determine whether a similar mode of regulation occurs in human breast and ovarian cells and to establish the role of the glucocorticoid receptor in that process (Chapter 3). The final objective was to develop an epidemiological study design which would examine the effect of glucocorticoid receptor polymorphisms on breast cancer risk (Chapter 4).

xix

CHAPTER 1

GENERAL INTRODUCTION

1.1 Overview

Breast cancer is the most common female malignancy in the world 1. In Canada, more than 22, 000 women are diagnosed with breast cancer, and more than 5,000 die from it each year. Approximately 95, 300 potential years of life lost are attributed to this disease. Recent advances in screening programs, mammography, and adjuvant therapy, have led to improvements in the incidence and mortality rates in Canada. Incidence rates have stabilized and even slightly decreased since 1990. Similarly, mortality rates have fallen by 25% since 1986. Despite these significant steps forward, breast cancer remains an important health issue in our society as the most commonly diagnosed malignancy, and as a major cause of premature mortality in Canadian women. A great amount of funding and effort have been invested into the identification of environmental and physiological factors contributing to breast cancer development.

A putative breast cancer risk factor is psychological stress. Epidemiological studies indicate that exposure to stressful life events is associated with an increase in the risk of breast cancer development of approximately two-fold 2,3. Considering that about

30% of Canadian women fall into the highest quartile of stress exposure 4, this finding may indicate that stress contributes to the development of a significant number of breast cancer cases. Physiological plausibility for the connection between stress exposure and breast cancer is lent by the fact that the most important mediator of the stress response, the adrenal hormone hydrocortisone, plays a role in certain stages of breast cell growth and differentiation 5,6. Thus, prolonged presence of hydrocortisone in the body in periods

of stress may cause adverse changes in breast epithelial cell behaviour. Scant molecular evidence, however, is available to support and explain this theory. Psychological stress has been shown to produce changes in apoptotic and DNA repair capacity in certain non- mammary tissues 7,8. In breast cells in particular, hydrocortisone, appears to suppress apoptosis 7. Therefore, it is possible that by interfering with these regulatory pathways, stress contributes to the propagation of mammary cells carrying genetic mutations.

However, the molecular signals linking hydrocortisone to DNA repair and programmed cell death genes have yet to be identified.

This work aims to address the gap in knowledge regarding hydrocortisone signaling in mammary epithelial cells through two different approaches:

1. By investigating the role of hydrocortisone in regulating the expression of the

tumour suppressor gene Breast Cancer Susceptibility Gene 1 (BRCA1).

BRCA1 has an established involvement in both breast cancer development

and in the processes of DNA repair and apoptosis. Low BRCA1 expression has

been observed in the majority of sporadic breast cancer cases 9-12. In addition, low

levels of BRCA1 have been correlated with breast cell transformation and tumour

development in animal models, and recovery of BRCA1 expression has been

shown to reverse cell malignancy 9,13. The BRCA1 protein plays a role in both

p53-dependent and independent apoptosis, and in DNA repair pathways triggered

by DNA damaging agents including ionizing radiation, hydrogen peroxide, and γ-

irradiation 14-17. For these reasons, BRCA1 was selected as a possible stress-

regulated gene, whose loss would contribute to the disruption of regulatory

processes within breast cells.

2. By designing an epidemiological study looking at the effect of naturally

occurring variations in the intracellular receptor for hydrocortisone, the

glucocorticoid receptor, on breast cancer risk.

Intracellular hydrocortisone signaling is dependent on binding of the

hormone to the glucocorticoid receptor and on downstream gene regulation by

that complex 18. Genetic variations that alter the structure or expression of the

glucocorticoid receptor interfere with its ability to properly bind its ligand or to

effect downstream signaling. To date, 18 different single nucleotide

polymorphisms, and four major haplotypes have been identified at the

glucocorticoid receptor locus 19-21. Some of those have been linked to decreased

or increased hydrocortisone and stress sensitivity 21-23. Furthermore, some genetic

variants have been associated with increased susceptibility to stress-related

diseases, including coronary artery disease, obesity, and rheumatoid arthritis 23-25.

We hypothesize that, likewise, such polymorphisms may affect a woman’s risk of

breast cancer development by altering her sensitivity to stress.

Stress signaling varies between different tissues 26,27, and little is known about the particular intracellular signals triggered by hydrocortisone in breast cells. Since hydrocortisone is known to affect breast physiology and to contribute to breast cancer risk, there is a need to identify the genes misregulated during prolonged hydrocortisone exposure. This may allow for the development of preventative breast cancer therapies and treatment strategies targeted at particular steps of the signaling pathway.

Polymorphic variations in regulatory genes have been shown to contribute to disease development by altering the expression or protein product activity of those genes

28. Specifically, genetic variants of breast hormone receptor genes, including the estrogen and prolactin receptors, have been correlated with breast cancer risk 29-33. Therefore, it is possible that glucocorticoid receptor polymorphisms alter individual sensitivity to hydrocortisone and, thus, affect breast cancer risk. Identification of such an association would provide further evidence for a link between breast cancer and stress. In addition, it would allow for the isolation of a stress-susceptible subpopulation in epidemiological stress research, therefore, improving exposure classification and study validity.

Finally, this research contributes to the understanding of BRCA1 transcriptional regulation. The BRCA1 gene is targeted by a variety of hormonal and intracellular signals in accordance to its key regulatory role in the maintenance of genomic integrity.

Elucidation of the molecular pathways contributing to its down-regulation in sporadic breast cancer development, would permit for the design of therapeutic strategies targeting those pathways, and would further our understanding of breast cancer biology.

1.2 The physiological role of hydrocortisone in the mammary gland

The mammary gland begins to form early during embryogenesis and continues to develop in defined stages that are correlated to sexual development and reproduction 34-36.

These include embryonic, pubertal, pregnancy, and lactation. Different hormonal regulators are involved in the progression of each stage. Two compartments comprise the adult mammary gland, the epithelium and the surrounding stroma. The epithelial compartment consists of a branched ductal system with decreasingly smaller ductules, which terminate in lobules (Fig. 1) 34. Lobules, in turn, consist of alveoli, which are constructed of secretory epithelial cells. During adolescence, the ductal system proliferates extensively due to the influence of the hormones estrogen and progesterone

TEB

Epithelial Compartment Stromal Compartment Estrogen Estrogen Prolactin ? Progesterone Placental Cortisol progesterone

Figure 1. Structure and development of the mammary gland. The embryonic anlage consists of epithelium (dark knob) and stroma (gray surrounding). The oval shown in the post natal stages depicts the mammary fat pad, and the ductal tree is shown in green (D). The solid green circle represents the nipple. The ends of growing ducts form terminal end buds (TEB) during puberty. Lobuloalveolar structures are presented as yellow circles. Hormones which induce the various stages of development are shown under the arrows. Estrogen and progesterone promote ductal system proliferation during puberty. During pregnancy estrogen and placental progesterone induce lobuloalveolar differentiation. Prolactin and cortisol prepare the mammary cells for lactation and stimulate milk protein production following parturition. The hormones regulating involution are not well defined. (Modified from Hennighausen L. et al., 2001, Developmental Cell, Vol. 1, p. 467-475).

which stimulate cell division at the ductal tips. The lobuloalveolar compartment, however, does not develop until the second half of pregnancy. That is when, under the stimulation of estrogen and placental progesterone, the lobuloalveolar cells, become differentiated and capable of milk production.

The role of hydrocortisone in the mammary gland is in the latter part of pregnancy and during lactation. At that stage placental lactogens stimulate DNA synthesis in the mammary cells, and cortisol induces the formation of the rough endoplasmic reticulum, where milk proteins will be synthesized 36. Prolactin release upon birth causes lobular differentiation, and the secretion of early milk proteins, such as β-casein. Hydrocortisone, on the other hand, predominantly regulates the expression of late milk proteins, although it has been shown to play an important role in the regulation of β-casein expression as well 37. However, studies carried out in mice expressing a modified glucocorticoid receptor demonstrated that the DNA-binding function of the receptor is necessary for ductal development more so than for lobulo-alveolar differentiation and lactation 38. This suggests that hydrocortisone may have a function in earlier stages of breast development, as well.

Consistent with its role in stimulating lactation, hydrocortisone has been shown to suppress apoptosis and involution in the mammary gland 39. Molecular findings to date regarding the role of the hydrocortisone receptor in regulating apoptotic activity in the breast and other tissues are reviewed in detail in section 1.3.3. In addition to suppressing pro-apoptotic pathways in the mammary gland, hydrocortisone has been shown to stimulate pro-survival pathways in non-malignant mammary epithelial cells in vitro 40.

In accordance with these genetic instability-inducing effects, glucocorticoids have been found to stimulate invasiveness, motility, and adhesion in human breast tumours 41, and to

inhibit chemotherapy induced apoptosis 42. Furthermore, the glucocorticoid receptor was found to be overexpressed in 94.4% of metaplastic carcinomas, and in 92.3% of malignant phyllodes tumours, implying a link to the development of those types of breast malignancies 43.

1.3 The Glucocorticoid Receptor

1.3.1 Glucocorticoid receptor: overview

The glucocorticoid receptor (GR) is a member of the Type I (steroid) subfamily of nuclear receptors, which also includes the mineralocorticoid, progesterone, androgen, and estrogen receptors 44. Steroid receptors are structurally and functionally related containing conserved protein domains with specific properties. A centrally located DNA binding domain (60-70 amino acids), is flanked by an approximately 250-amino acid carboxy (C) -terminal ligand binding domain, and by an amino (N) -terminal domain which varies in size and sequence between receptors. The presence of all of these domains allows steroid receptors to function as transcriptional regulators. In the case of

GR, the N-terminal domain (AF-1) functions as a transactivation domain, necessary for transcriptional enhancement and association of the receptor with other transcriptional regulators, the central DNA-binding domain consists of two zinc finger regions needed for receptor binding to target promoters and for homodimerization on DNA, and the C- terminal domain contains the nuclear localization signal and a second ligand-dependent transactivation domain (AF-2) 45 (Fig. 2). The human GR gene is expressed in two protein isoforms generated by alternative splicing, GRα and GRβ 46. GRα consists of 777 amino acids and is capable of binding glucocorticoid targets. GRβ, on the other

1 421 486526 777

NH2 Modulatory DBD H LBDLBD COOH

AF-1 AF-2

NLS

Figure 2. Functional domains of the glucocorticoid receptor. The N-terminus of the protein consists almost entirely of the constitutive transcriptional activation domain (AF- 1). The C-terminus encodes the ligand-binding domain (LBD), a ligand-dependent transcriptional activation sequence (AF-2), and a nuclear localization signal (NLS). H, hinge region. DBD, DNA binding domain. The numbers indicate amino acid residues.

hand, is only 742 amino acids, lacks the C-terminal domain and is, thus, incapable of ligand binding. Due to the ability of the β isoform to dimerize with GRα, it is thought to act as a dominant negative regulator of GRα-mediated transactivation in certain tissues 47.

GRα has been shown to be expressed at a much higher concentration than GRβ and is found in virtually every cell type in mammals, with highest concentrations in the lung, spleen, brain, and liver 48. Therefore, it is considered as the wild-type GR receptor and the abbreviation GR will henceforth refer to the α isoform.

In vivo evidence demonstrates that GR activity is necessary for life 49. GR knockout mice show severe abnormalities, most noticeably in lung development, and die shortly after birth. However, it was shown that the DNA-binding activity of GR is not essential for viability in mice 50. This indicates that many physiologically essential glucocorticoid effects are mediated through GR protein-protein interactions instead of through binding of the receptor to target promoters. Consistent with that observation, dimerization of GR molecules, the predominant mode of GR DNA binding, is not required for all GR activities in vivo 51. In vitro results also demonstrate that transrepression and transactivation by the GR are mediated by different receptor domains. Point mutations in the GR DNA-binding domain abolish its transactivating activity, but do not affect its transrepressing activity 52. Therefore, whereas transactivation by GR is solely dependent on DNA binding, transrepression is mostly dependent on protein-protein interactions with other transcription factors and it is the latter which largely accounts for the role of GR in embryonic development. DNA binding-independent transrepression has also been implicated as the main mechanism of GR signaling responsible for the suppressive effect of glucocorticoids on immune system function 46.

In the classical steroid hormone model of GR activation, GR is located in the cytoplasm of the cell in the absence of glucocorticoid ligand in a complex with chaperone heat shock proteins, including hsp-90, hsp-70, and hsp-40 53. Upon ligand binding, GR dissociates from the chaperone complex and travels into the nucleus where it affects its functions as a transcriptional regulator. However, it has been shown that regardless of ligand presence, a dynamic equilibrium exists between cytosolic and nuclear GR 54.

Importantly, improvement of experimental conditions has allowed the observation that the majority of GR is, in fact, located in the nucleus in the absence of glucocorticoid ligand 55.

1.3.2 Mechanisms of GR regulation and signaling

GR signaling is regulated at the levels of both GR mRNA and protein expression, and of GR protein activity. GR is considered to be constitutively expressed in most cell types 48. However, the levels of its expression can be up- or down-regulated by glucocorticoid signaling and by the activity of GR itself. For example, GR mRNA levels have been shown to decrease upon treatment with glucocorticoids 48,56,57. Glucocorticoids also decrease the half-life of the GR protein by 30 to 50% and stimulate its degradation by the proteasome-ubiquitin pathway. In addition, the GR protein has been shown to bind the promoter of the GR gene and to up-regulate its own expression.

A second mode of GR regulation is by protein phosphorylation. Upon ligand binding GR phosphorylation increases 4-fold 58,59. Loss of this modification, due to treatment with the glucocorticoid antagonist RU38486, results in loss of the transcriptional induction of GR-responsive genes. Phosphorylation also mediates the control of GR activity by regulatory kinases. Phosphorylation of Thr171 and Ser246 of

the GR protein by the Mitogen-Activated Protein Kinase (MAPK) family members c-jun

N-terminal kinase (JNK), and by extracellular signal-regulated kinase (ERK), leads to inactivation of the receptor 60,61. Conversely, phosphorylation of Ser224 and Ser232 by cyclin-dependent kinases (CDKs) leads to GR activation 60. Interestingly, GR has been shown to, in turn, repress the activation of the JNK, ERK and p38 MAPKs by inducing the transcription of the MAPK inhibitor MAP kinase phosphatase-1 (MKP-1) 62. Thus, the GR and MAPK signaling pathways appear to be mutually repressive.

GR down-stream signaling occurs through direct DNA binding to the promoters of target genes or through interaction of GR with other transcription factors present at the promoter (Fig. 3) 46. GR transactivation is most often carried out through binding of GR as a homodimer to conserved Glucocorticoid Response Elements (GREs) in target promoters 63. The consensus GRE sequence is a palindromic 15bp motif:

AGAACAnnnTGTTCT (where n is any nucleotide). GR transrepression can be accomplished by direct GR binding to a negative GRE (nGRE). However, very few glucocorticoid-regulated genes have been reported to contain nGREs. In contrast, the majority of GR-mediated gene repression is brought about by protein-protein interactions between GR and other transcription factors 64.

The two best characterized GR protein-binding partners are the nuclear factor kappa B (NF-kB) and the activator protein 1 (AP-1) 65. Both factors lie downstream of

MAPK pathways 66 suggesting multiple levels of interaction between GR and MAPK signaling. In the majority of cases, NF-kB and AP-1 have the opposite effect on gene expression to GR. For example GR up-regulates anti-inflammatory genes, whereas both

NF-kB and AP-1 cause down-regulation of these genes 67. The cross-talk between GR

HC HC GR GR

GRE

0 9 Nucleus P S HSP90 HC HC H GR GR

0 9 P nGRE GR S HC H HSP90 GR HC HC HC HC HC GR GR GR GR TF TF

TF TF

Figure 3. Modes of transcriptional regulation by the glucocorticoid receptor (GR). Upon binding of hydrocortisone (HC) to GR, the receptor dissociates from a cytoplasmic chaperone complex of heat shock proteins (HSP90) and moves into the cell nucleus. The liganded GR can affect target gene expression by direct binding to positive or negative promoter glucocorticoid response elements (GREs or nGREs), interaction with promoter- bound transcription factors (TF), or by affecting the upstream expression of repressing or activating transcription factors. Transactivating functions of GR are most often carried out by GRE binding, and transrepressing functions by interactions with promoter-bound transcription factors.

and NFkB/AP-1 signaling occurs at several stages. Direct protein interaction, leading to interference with GR activity, has been described between components of AP-1 and GR

67. In addition, GR upregulates the expression of the NF-kB inhibitor IkB-α 68 and directly represses NF-kB transcriptional activity by interacting with one of its protein subunits 69. Finally, GR competes with both NF-kB and AP-1 for the binding of coactivator proteins, such as cAMP response element binding protein (CREB)–binding protein (CBP), p300, and steroid receptor coactivator-1 (SRC-1) 70.

The interactions of GR with other transcription factors allow it to modify target gene expression by inducing chromatin modification. For example, the GR coactivators

CBP, p300 and SRC-1 all contain histone acetylase (HAT) activity 69. Thus, in GR- mediated transactivation, acetylation of histones by HATs causes nucleosomal rearrangement and DNA unwinding, in turn allowing the transcriptional machinery access to the gene promoter. GR has further been shown to be capable of stimulating nucleosomal rearrangement by interacting with non-HAT containing cofactors, such as

SWI/SNF, pCIF, and GRIP, which can alter nucleosome binding by HATs 71.

GR transrepression can be accomplished by interaction of the receptor with the histone deacetylase-2 (HDAC-2) 72. Alternatively, GR can repress the activity of the

HAT protein p65, thus preventing chromatin rearrangement. GR can also directly inhibit the function of the transcriptional machinery by interfering with the phosphorylation of the RNA Polymerase II C-terminal domain which is necessary for polymerase activation

73.

1.3.3 Involvement of GR in apoptosis

Few breast tissue-specific molecular pathways have been proposed for the anti- apoptotic effect of GR in such cells. However, the glucocorticoid receptor has been shown to control several genes involved in the regulation of apoptosis in a tissue specific manner. In an example of such cell specific regulation, GR suppresses the levels of the anti-apoptotic protein Bcl-2 in LTR-6 myeloid leukemia cells 74, but enhances its levels in

T lymphocytes and ovarian granulose cells 74,75. Bcl-2 is thought to block apoptosis by inhibiting the release of mitochondrial apoptotic factors capable of activating caspase 9

(such as cytochrome c) 76. Thus GR induces and suppresses apoptosis, respectively, in those different cell types. GR also regulates the expression of other Bcl-2 family members. It suppresses the pro-apoptotic gene Bcl-xS in human gastric cancer cells, and enhances the levels of the anti-apoptotic Bcl-xL protein, thus decreasing apoptotic ability in those cells 77. In addition, the pro-apoptotic protein DAP3 was found to bind GR in

COS-7 kidney fibroblast cells and enhance its transactivating function 78.

Another way in which GR may affect apoptosis is by modulating the activity of the transcription factors NF-kB and AP-1. In hepatoma cells, the synthetic glucocorticoid dexamethasone increases the nuclear translocation, and thus activity, of NF-kB 79. This factor is thought to suppress apoptotic pathways induced by the cytokine Tumour

Necrosis Factor α (TNFα) 80. Cells with inactivated NF-kB are sensitive to TNFα – induced apoptosis 81. The transcription factor AP-1 is known to be involved in cell survival 82. GR was shown to repress AP-1 activity in T cell leukemia cell lines, leading to the induction of apoptosis 82. In addition, tissue-specific apoptotic effects of GR may be partially explained by a dependence of GR transcriptional activity on the particular cell’s ratio of the AP-1 proteins c-jun and c-fos 83.

In the mouse mammary gland, treatment with glucocorticoids was shown to result in induction of the mRNA levels of the AP-1 family members c-fos, jun B, and jun D, and of AP-1 DNA binding activity 39. Some AP-1 target genes were thus strongly inhibited, leading to suppression of apoptosis and of mammary gland involution. This may represent a mammary cell-specific pathway of GR anti-apoptotic activity. It is of interest to note that the BRCA1 gene appears to be an AP-1 target gene, since we have demonstrated binding of the AP-1 heterodimer c-Jun/FRA2 to its promoter (unpublished data).

Finally, GR was shown to signal through the serum and glucocorticoid-regulated kinase-1 (SGK-1) to decrease the pro-apoptotic activity of Forkhead transcription factor

3a (FOXO3a) in the breast cancer cell line SKBR-3 84.

1.4 The Breast Cancer Susceptibility Gene 1

1.4.1 BRCA1 Function

The BRCA1 gene encodes a protein of 1863 amino acids, which functions in the maintenance of genomic stability 85. Loss-of-function mutations resulting in low levels of

BRCA1 produce phenotypic changes indicative of disrupted regulatory mechanisms within the cell 86. Such changes include cell growth retardation, increased apoptosis, defective DNA damage repair, abnormal centrosome duplication, defective G1/M cell cycle checkpoint, impaired spindle checkpoint, chromosome damage and aneuploidy.

Similar phenotypic characteristics are observed in BRCA1-associated breast tumours, demonstrating a pre-disposition for malignant transformation in cells containing aberrant

BRCA1 activity 87,88. The structure of the BRCA1 protein is adapted for diverse

intracellular functions. It includes an N-terminal RING finger domain common for proteins involved in ubiquitylation, two BRCA1 C-terminal (BRCT) domains allowing interaction with DNA repair, cell-cycle checkpoint and apoptosis proteins, two centrally situated nuclear localization signals, and a highly acidic C-terminal region characteristic of many transcription factors 89 (Fig. 4). Accordingly, some of the main functions of

BRCA1 include participation in several types of DNA damage repair, cell cycle- checkpoint establishment in response to DNA damage, apoptosis, protein ubiquitylation in response to DNA replication stress, and regulation of the expression of other genes involved in cell cycle-regulatory processes 90.

The specific role of BRCA1 in the cell can most easily be reviewed by describing the involvement of BRCA1 in several large multi-protein complexes (Fig. 4). The ubiquitylation activity of BRCA1 is dependent on its association with the BRCA1 associated RING domain protein (BARD1) 91. The BRCA1-BARD1 heterodimer is an active ubiquitin polymerase on its own, but can achieve higher ubiquitylation efficiency if it joins the proteins BRCC36 and BRE in a complex called BARD1 containing complex

(BRCC) 92. BRCC has been found to exhibit ubiquitin ligation activity in response to

DNA damage and check-point progression. The functional purpose of BRCA1-mediated ubiquitylation is thought to lie in the regulation of gene expression 93. BRCA1 may ubiquitylate transcriptional regulators of genes involved in DNA damage repair or checkpoint establishment, thus, targeting them for protein degradation through the proteasome. In such a way, BRCA1 would affect target gene expression by limiting the amount of key transcription factors. An alternate possibility stems from the observation that BRCA1 can ubiquitylate histone monomers 94. This form of nucleosome modification has been shown to lead to the transcriptional repression of target genes. In

NLS NLS BRCT domains

8 96 4521,079 1,280 1,524

RING DNA NH2 SCD COOH finger binding

200 300 1,646 1,859

BARD1 p53 BASC RNA polymerase II RB RAD50 HDAC1/HDAC2 ATM p53 SWI/SNF RB

Figure 4. BRCA1 functional domains and interacting proteins. The N-terminal RING finger domain of the BRCA1 protein is involved in ubiquitylation. This function is enhanced by binding of BARD1 to this region. The central region of BRCA1, which includes a DNA-binding domain and an SQ-cluster domain (SCD, preferred site for phosphorylation), contributes to the DNA-repair functions of BRCA1 through interactions with the BASC and MRN repair complexes. This is also where regulation by damage response pathways initiated by the kinases ATR and ATM occurs. The SWI/SNF chromatin remodeling complex binds BRCA1 between amino acids 260 and 553. Interaction with the transcriptional machinery and histone deacetylases (HDACs) is mediated by the two ~110 base pair-long C-terminal BRCT domains. Cell cycle regulatory proteins, such as p53 and RB bind BRCA1 at both the nuclear localization signal (NLS) and BRCA1 C-terminal (BRCT) regions.

addition to associating with proteins capable of ubiquitin activity, BRCA1 can modulate transcriptional activity by associating with chromatin remodeling complexes, such as

SWI/SNF, or by direct association with the transcriptional machinery 95. Thus, BRCA1 has been shown to form a complex with RNA Polymerase II and RNA helixase A 96,97 and to, thus, bridge transcription factors bound to enhancer elements within the target promoter to those transcriptional machinery proteins.

BRCA1 plays a role in DNA repair partially by participating in two large multiprotein complexes: the BRCA1 associated surveillance complex (BASC), and the

MRE11/RAD50/NBS1 (MRN) repair complex. The BASC complex is composed of proteins involved in mismatch repair (MSH2, MSH6, MLH1), DNA double-strand break repair (ATM), DNA replication (RFC), and DNA recombination (BLM) 98. The association of BRCA1 with the MRN complex has been shown to be important for double-strand break repair 99. An overall model has been proposed for the involvement of

BRCA1 in the maintenance of genomic integrity, in which BRCA1 participates in the repair of DNA damage at multiple levels 93. Its repair activity, thus, includes: activation of genes encoding DNA repair proteins, scanning of transcribed genes in association with the transcriptional machinery for DNA damage, initiation of a repair response upon detection of damage, ubiquitylation and thus targeting for degradation of the polymerase enzyme at DNA damage sites, and recruitment of repair factors to the site, including members of the MRN and BASC complexes. In accordance with this model, BRCA1 has been shown to relocalize to DNA replication complexes upon DNA damage 100, to interact with histone H2AX at damage sites, thus promoting chromatin unfolding and access of repair proteins to DNA damage sites 95, and to participate in damage response signaling pathways initiated by the kinases ATR and ATM 101.

Unlike its participation in the intracellular processes described above, the activity of BRCA1 in apoptosis is reliant not on binding to multiprotein complexes but on the initiation of downstream signaling cascades. This has been shown to occur in both a p53- dependent and a p53-independent manner. In the p53-dependent pathway, BRCA1 interacts with and increases the transactivating capacity of p53 14. This, in turn, leads to the induction of apoptosis through increased transcription from the pro-apoptotic genes p21WAF1/CIP1 and bax. p53-indepent apoptosis is achieved by BRCA1 through stimulation of the MAP kinase Jnk 102-104. BRCA1-induced Jnk signaling results in the activation of a number of apoptotic caspases, including caspase-3, caspase-8, and caspase-9, and in apoptosis.

1.4.2 Structure of the BRCA1 gene and promoter

The Breast Cancer Susceptibility 1 gene is located on chromosome 17q21 in humans and on chromosome 11 in mice. The human gene comprises 24 exons and spans over 80kb of genomic DNA, with BRCA1 intronic sequences totaling over 90% of the gene (Fig. 5) 105. In mice the Brca1 gene is transcribed from a single 289bp promoter α, which is bidirectional and shared with the upstream Nbr1 (next to BRCA1) gene. The function of the Nbr1 gene has not been identified, although it is known to be upregulated during lactation and, thus, may play a role in lactogenesis 106. The human BRCA1 locus appears to have undergone partial duplication during evolutionary development. Thus, the locus consists of an active BRCA1 gene lying head-to-head with a new gene, the 30kb

NBR2 gene, and an inactive pseudo-BRCA1 gene lying head-to-head with the human

NBR1 gene 107. The function of the NBR2 gene is not known. However, no NBR2 mutations have been found in human breast and ovarian cancers 107 . Two promoters (α

HUMAN BRCA1 LOCUS

NBR1 NBR2 BRCA1 PSEUDO-BRCA1

2 1B 1A 1A 1B 2 4 3 2 1 1A 1B 2 24 3

MOUSE BRCA1 LOCUS

5 4 3 2 1 1 2

Figure 5. Structure of the human and mouse BRCA1 loci. The BRCA1 promoter is bi-directional, regulating the transcription of the next-to-BRCA1 2 (NBR2) gene as well. The human BRCA1 locus has undergone a partial duplication during evolutionary development resulting in an active BRCA1 gene and an inactive pseudo-BRCA1 gene. BRCA1 transcription occurs through two alternative promoters (α and β), producing transcripts differing in their first exons (1A and 1B). The α promoter appears to be used much more frequently in breast tissue. The arrows indicate transcription start sites and the numbers refer to gene exons.

and β) regulate human BRCA1 gene expression, producing two distinct BRCA1 transcripts (1a and 1b), which differ in the use of the first exon of the gene 108. The 218bp

α promoter is shared with the NBR2 gene, driving the transcription of the two genes in opposite directions. It is this promoter that appears to be predominantly used in breast tissue. Analysis of the Brca1/Nbr1 and BRCA1/NBR2 intergenic regions has shown that the mouse and human promoters are highly conserved. This extends to the conservation of consensus binding sites for the transcription factors Ik1, E2F, RFX2, CAAT, CREB,

NRF2, and GABP 109.

Reports differ regarding the activity of the shared promoter in the direction of

BRCA1 vs. the direction of its neighbouring gene. In mouse testicular cells it was found that Brca1 and Nbr1 are expressed differentially during embryonic development 109.

Similarly, BRCA1 and NBR2 expression differed in the muscle cell line C2C12 110.

However, we have observed that the two genes are regulated similarly by transcription factors known to bind the promoter (unpublished data). A model of expression has been proposed in which the minimal promoter drives transcription for both BRCA1 and NBR2 simultaneously, while regulatory sequences located within the first intron of each gene determine the gene-specific level of expression 111.

1.4.3 Regulation of BRCA1 gene expression

1.4.3.1 Hormonal regulation of BRCA1 gene expression

A variety of hormonal signals have been shown to regulate BRCA1 gene expression. Hormonal regulators of the BRCA1 gene include estrogen, progesterone, prolactin, and growth hormone, all of which are involved in the systemic signaling

required for mammary gland morphogenesis and differentiation (described in section 1.2).

Since BRCA1 plays a role in the prevention of genomic instability during periods of cell growth and differentiation, the responsiveness of the BRCA1 gene to the above hormones is most likely correlated to their role as regulators of mammary cell proliferation.

Estrogen was shown to upregulate both BRCA1 mRNA expression (2.5 to 5 – fold), and BRCA1 protein levels (3 to 10 – fold) in estrogen receptor – positive breast

MCF-7 and C7-MCF-7 cells, and ovarian BG-1 cells 112. This coincided with an increase in cell proliferation for all cell lines. Similarly, estrogen was found to stimulate BRCA1 expression in primary cultures of bovine mammary epithelial cells 113, in primary cultures of ewe mammary epithelial cells 114, in human breast cancer cells 115,116, and in ovariectomized animals 117,118. The molecular mechanism of estrogen signaling to the

BRCA1 promoter was demonstrated to involve recruitment of an estrogen receptor – α/ coactivator p300 complex to a specific region of the promoter capable of binding Jun/Fos transcription factors 119. Further study found that the positive effect of estrogen on

BRCA1 expression also required Jun/Fos binding, and occupancy of the promoter by the unliganded aromatic hydrocarbon receptor 120.

The hormone progesterone is produced in the ovaries and plays a role in the proliferation and differentiation of the mammary gland during puberty and pregnancy 36.

Progesterone was demonstrated to have only a slight effect on BRCA1 expression, whose direction varies between studies. Treatment of human malignant MCF – 7 cells with high levels of the hormone (10-4M) caused loss of cell proliferation and cell cycle progression, and stimulated apoptosis 121. The decrease in growth resulted in lower BRCA1 mRNA levels in treated cells. Low levels of progesterone (10-10M) had no effect on BRCA1

expression. Conversely, treatment of ewe mammary epithelial cells with progesterone resulted in a small increase in BRCA1 gene expression 114.

Prolactin treatment of mammary epithelial cells is correlated with a strong upregulation of BRCA1 expression. In bovine mammary cells, prolactin was demonstrated to induce higher BRCA1 mRNA levels individually, and in conjunction with estrogen 113. However, the effect was smaller than the effect of estrogen alone. In the human breast cancer cell lines MCF7 and T47D, prolactin induced both mRNA expression (12-fold, and 2-fold increase, respectively) and protein expression (4-fold, and

6-fold increase, respectively) 122. No effect of prolactin was seen on the non-malignant mammary cell line MCF-10a.

The effect of growth hormone on BRCA1 gene expression has not been extensively investigated. However, in primary ewe mammary cells this hormone was shown to have the strongest positive effect on BRCA1 gene expression among the other hormones discussed 114.

1.4.3.2 Transcriptional regulation of BRCA1 gene expression

Since the identification of BRCA1 in 1994 85,123, the gene has been extensively analyzed for the presence of regulatory elements and transcription factor binding. A number of regulatory sequences have been identified both within the ~200bp proximal promoter and within the gene itself (Fig. 6).

Regulatory elements found outside of the promoter include an 83 base pair – long repressor element located 500 base pairs into the first intron of the BRCA1 gene 124, and two evolutionarily conserved noncoding sequences (CNS-1 and CNS-2) located within intron 2, 5 kilobases downstream of the BRCA1 promoter 125. CNS-1 and CNS-2 have

E2F4 E2F1 E2F4

-203 -178 -176-169 -47 -25

NBR2 E2FA E2FB BRCA1 ets ets ets RIBS CREB UP

GABPα/β CREB GABPα/β Ets-2 c-Jun/FRA2 USF2 HMGA1 p53BP

Figure 6. Structure and transcriptional regulators of the BRCA1 promoter. Promoter sites known to be involved in regulation of the BRCA1 gene are represented as rectangles. Their location is indicated with respect to the transcriptional start site of the BRCA1 gene. The three consensus binding sites for ets-family proteins are indicated within the RIBS element. The E2FA and E2FB consensus binding sites overlap to a certain extent with the UP element. Transcription factors which have a positive effect on BRCA1 expression are indicated for each promoter element in red. Negative promoter regulators are listed in blue. The numbers indicate nucleotide position upstream of the BRCA1 transcription start site. Arrows indicate transcription start sites.

been found to differ in their regulatory activity, with CNS-1 having a positive effect on transcription, and CNS-2 having a strong negative effect. Transcription factors binding to either the intron 1 or intron 2 regulatory elements have not been identified.

The physical distance between the BRCA1 and NBR2 genes is 218bp 107.

However, the region important for BRCA1 expression, characterized as the BRCA1 minimal promoter, was shown to consist of a 222 base pair region, spanning -202 to +20

126. Deletion of this region was shown to result in a 100% loss in BRCA1 expression.

Footprinting assays performed in the Mueller lab have identified a number of promoter elements capable of protein binding (unpublished data). Several of those have been shown to be active in the regulation of BRCA1 expression. Those include a consensus

CRE (cAMP response element), which acts as a strong positive transcriptional element ( at -176) 126-128; a 22bp RIBS element containing three ets-factor binding sites (at -203) 129; a UP element containing two consensus binding sites for the ets-factor GA Binding

Protein (GABP) which overlap with two consensus binding sites for the activator protein

Upstream Stimulatory Factor 2 (USF2); and two E2F sites, E2FB at -27, which acts as a repressor, and E2FA at -48 130.

The BRCA1 promoter has been shown to be targeted by transcriptional effectors of several well known signaling pathways, suggesting an involvement of the BRCA1 protein product in those pathways. The consensus CRE element was found to bind cAMP response element binding protein (CREB) in MCF7 cells 131. In addition, our lab has identified binding of the AP-1 heterodimer c-Jun/FRA2 (unpublished data). Both factors activate BRCA1 expression. Conversely, binding of the non-histone chromatin protein High Mobility Group Protein 1 (HMGA1) results in loss of BRCA1 promoter activity 132. HMGA1 is a structural protein, known to bind DNA in AT-rich regions and

to interact with transcription factors, thus, determining the level of expression through promoter accessibility. The mechanism of promoter binding and regulation by HMGA1 vs. that by CREB and c-Jun/FRA2 has not been investigated.

The RIBS promoter element binds MAPK-regulated transcription factors, although its activity defers between breast cancer cell lines 129. The ets-family protein

GABP, which acts down-stream of ErbB receptor signaling, activates the BRCA1 promoter by binding two of the three RIBS ets-factor binding sites 129. In opposition, the

Ets-2 transcription factor, part of the same protein family, represses BRCA1 expression by recruiting the SWI/SNF chromatin remodeling complex to the promoter 133. Ets-2 has been shown to function down-stream of two ras-effector pathways, the Raf/MAPK pathway, and the phatidylinositol 3-kinase/Akt pathway, implicating those pathways in

BRCA1 regulation.

The E2F consensus elements have been shown to be targeted by both activating and repressing members of the E2F family of transcription factors. E2F1, a transcriptional activator, up-regulates BRCA1 expression by binding to the E2FB site.

The retinoblastoma (Rb) tumour suppressor acts to down-regulate BRCA1 expression by complexing with, and inactivating, promoter-bound E2F1 130. The transcriptional repressor E2F6 regulates BRCA1 expression in a similar way, by affecting E2F1 activity at the promoter 134. Depletion of E2F6 results in recruitment of E2F1 to the BRCA1 regulatory region. Finally, the repressor E2F4 was found to be capable of binding both the E2FA and E2FB promoter elements alone or simultaneously with E2F1 135.

Therefore, the relative promoter occupancy by activating vs. repressing E2F factors is thought to determined the levels of BRCA1 promoter activity 135. Signaling from the Rb-

E2F pathway may be one of the mechanisms through which the involvement of BRCA1

in cell cycle progression and apoptosis is determined. Rb and E2F1 have been shown to be involved in the regulation of both 136.

The BRCA1 gene is also known to be targeted by signaling from the tumour suppressor p53. p53 induction in human mammary cells results in transcriptional repression of BRCA1 expression, although the mechanism of how this occurs has not been determined 137. Later, the p53 – binding protein, 53BP1, was found to be present in a complex bound to the UP element of the BRCA1 promoter, causing promoter activation

138. It is possible that p53 inhibits the 53BP1-containing complex, thus, causing BRCA1 down-regulation.

Finally, the GABP protein was found to bind one of two consensus binding sites within the UP element of the BRCA1 promoter 139. This results in BRCA1 up-regulation.

This effect may be achieved in cooperation with the transcription factor USF2, which also binds to the UP site (unpublished data) but whose function at that site is not yet known.

1.5 Hypothesis

We hypothesize that the BRCA1 gene is a target gene for hydrocortisone and glucocorticoid receptor regulation. Furthermore, we hypothesize that polymorphic variations in the glucocorticoid receptor gene, which alter hydrocortisone sensitivity, have an effect on breast cancer risk.

CHAPTER 2

HYDROCORTISONE DOWN-REGULATES THE TUMOUR SUPRESSOR GENE

BRCA1 IN MAMMARY CELLS:

A POSSIBLE LINK BETWEEN STRESS AND BREAST CANCER

Statement of Co-Authorship

This manuscript has been provisionally accepted for publication in Genes,

Chromosomes and Cancer, and is currently undergoing minor revisions. The authors are

Lilia Antonova and Dr. Christopher R. Mueller. The experiment shown in Figure 7a was done by Jim Gore. I would like to acknowledge Dr. Gwen MacDonald for her help with the experiment shown in Figure 15b. All figures were prepared by me. All writing was done by me. Both Dr. Mueller and myself were involved in the editing of the manuscript.

2.1 Abstract

Background: Psychological stress has been correlated with breast cancer development in numerous epidemiological studies. However, physiological and molecular models which may account for this association are not readily available. We have found that the stress hormone hydrocortisone (cortisol) down-regulates the expression of the breast cancer susceptibility gene 1 in the non-malignant mouse mammary cell line EPH4. Since low levels of BRCA1 have been implicated in the development of sporadic breast cancer, this effect may represent a mechanism through which stress signaling disrupts tumorigenesis-prevention mechanisms within the cell.

Results: Hydrocortisone was found to repress BRCA1 promoter activity and mRNA

levels in EPH4 cells. This effect is concentration-dependent, is reliant on the continuous presence of hydrocortisone, and is not affected by the addition of lactogenic hormones, or growth conditions. Hydrocortisone was also found to negate a known positive effect of estrogen on BRCA1 expression and therefore, may interfere with estrogen-related signaling in mammary epithelial cells. The repressive effect of hydrocortisone is lost in malignant mouse mammary cells HC-11 and SP1, suggesting alteration of signaling to the

BRCA1 promoter in the course of cell transformation. We have uncovered two promoter regulatory sites, which are involved in BRCA1 regulation by hydrocortisone, namely the

BRIBS and UP regulatory elements. Binding of the transcription factor GABPα/β to both sites and binding of the transcription factor USF2 to the UP site are lost upon hydrocortisone addition, suggesting the involvement of both factors in hydrocortisone- induced repression. Conclusions: The breast cancer susceptibility gene BRCA1 is down- regulated by the stress hormone hydrocortisone. Since BRCA1 activity is important for a number of intracellular pathways involved in prevention of tumorigenesis, its observed down-regulation may represent a novel molecular mechanism for cortisol’s involvement in breast cancer development.

2.2 Introduction

The development of preventative and therapeutic strategies for breast cancer is dependent on understanding of the mechanisms through which genetic and environmental factors contribute to its occurrence and progression. Genetic studies estimate that up to

10% of breast cancer cases can be attributed to mutations in recognized genes, such as

BRCA1, BRCA2, TP53, PTEN and ATM 140. It has been proposed that the remaining breast cancers are linked to life-style and physiological factors, such as age, family

history of breast cancer, parity, early menarche, late menopause, use of oral contraceptives 141, and psychosocial factors, such as psychological stress 142.

Epidemiological studies indicate that psychological stress produces a significant increase in breast cancer risk. A meta-analysis by Duijts S. 3 found that approximate measures of stress, such as number of stressful life events, death of a significant other, and death of a loved one are correlated to breast cancer risk by odds ratios of 1.77 (95% confidence interval : 1.31-2.40), 1.37 (95% CI: 1.10-1.71), and 1.35 (95% CI: 1.09-

1.68), respectively. Similarly, recent prospective cohort studies 2,143-145 show a significant association between approximate measures of psychological stress and breast cancer risk.

The field of breast cancer research in relation to stress, specifically in terms of finding physiological models to explain the association observed in epidemiological studies, is limited to a few studies and at this point is largely hypothetical in nature. Most research to date has focused on the effect of stress on immune system function due to the important role of the immune system in tumour surveillance. Holden et al.146 suggest a causal model in which a stress-related increase in TNFα results in decreased activity of tyrosine phosphatase and consequently diminished expression of the class-I MHC antigen on the surface of malignant cells. In addition, stress may cause a reduction in natural killer cell activity 147. Transformed cells are thus thought to escape detection by the immune system. Although increased production of TNFα has been observed in response to stress as well as in the presence of most organ-related carcinomas 146, studies testing the validity of this immunological model are not available.

An alternative hypothesis is that stress affects breast cancer risk by altering the ability of cells to repair DNA damage or to undergo apoptosis. Several mouse and human studies suggest that during periods of stress DNA repair capacity in peripheral blood

lymphocytes and the ability of cells to undergo apoptosis differ from those in the unstressed subject 8,148-150. In particular, stress was found to promote cell survival in the mammary gland 7. A physiological or molecular model explaining these observations has thus far not been proposed. It is conceivable, however, that such a model may involve alteration in the expression of proteins which play a functional role in DNA repair and/or apoptosis.

Mutation-induced loss of activity of the tumour suppressor gene BRCA1 is an important factor in the development of the majority of familial breast cancers 85,151. In addition, although mutations in the gene do not seem to play a role in the sporadic form of breast cancer, low levels of BRCA1 expression have been associated with most cancers in this group 9. The importance of BRCA1 in breast cancer development is likely attributable to the involvement of its protein product in various key regulatory processes, which include DNA repair and apoptosis 93,152,153.

In the study reported here we show that BRCA1 gene expression in the non- malignant mouse mammary cell line EPH4 is down-regulated by hydrocortisone (a synthetic form of cortisol), the principal hormone released in response to psychological stress. The observed correlation may provide a molecular pathway for experimentally observed changes in DNA repair capacity and apoptotic ability during periods of psychological stress. By disrupting the tumour-suppressor role of the BRCA1 gene, stress-induced release of hydrocortisone may affect the ability of cells to maintain genomic integrity and to suppress transformation to a malignant phenotype.

2.3 Materials and Methods

2.3.1 Cell culture and treatments

Murine mammary non-tumorigenic Ras-transformed EPH4 154 cells were obtained from Dr. Calvin Roskelley (UBC, Canada). Non-tumorigenic mutant-p53 HC-11, and mammary carcinoma SP1 cells were both a kind gift from Dr. Bruce Elliott (Queen’s

University, Canada). All cells were cultured at 37°C and 5% CO2. EPH4 cells were maintained in DMEM/F-12 medium (HyClone) supplemented with 5% fetal bovine serum (HyClone), 5ug/mL insulin (Sigma) and penicillin/streptomycin (Sigma). HC-11 cells were maintained in DMEM high glucose media (Sigma) supplemented with 10% fetal bovine serum, 5ug/mL insulin and penicillin/streptomycin. Treatments were done in fully supplemented media containing 1ug/mL hydrocortisone for 48 hours. SP1 cells were cultured in RPMI-1640 (Sigma) supplemented with 10% fetal bovine serum and penicillin/streptomycin and were treated for 48 hours in fully supplemented media with

1ug/mL hydrocortisone. EPH4 and EPH4-L6 treatments were done for 48 hours in

DMEM-F12 media supplemented only with penicillin/streptomycin unless otherwise stated. Hydrocortisone treatments were carried out using a stock of 1mg/mL hydrocortisone (Sigma) in 100% ethanol. Dexamethasone stock used was at 100mM in ddH2O (Sigma). Prolactin was at 3ug/mL final concentration (stock at 3mg/mL in 10mM

NaOH) (Sigma-Aldrich) and β-estradiol was used at 10nM final concentration (stock at

10uM in 100% ethanol).

In vitro differentiation experiments using EPH4-L6 cells were plated on Matrigel

(BD Biosciences) in DMEM/F-12 medium supplemented with 5ug/mL insulin, 3ug/mL prolactin and 1ug/mL hydrocortisone, as described in 155.

2.3.2 Transient Transfections and Luciferase Assays

Cells for transient transfections were seeded out at 5x104 cells/mL for EPH4 cells, and 1x105 cells/mL for HC-11 and SP1 on 12-well culture plates, 24 hours prior to transfections. EPH4 cells were transfected with 1uL per well FuGene6 transfection reagent (Roche Applied Science) in serum-containing media according to the manufacturer’s instructions, using a total of 250 ng of DNA per well. Each transfection condition was performed in triplicate. Control CMV-Luc vector (Promega) was used at

25 ng per well, as were expression vectors and empty vector controls. The remainder of the 250 ng per well was allotted to the appropriate renilla luciferase reporter vector. HC-

11 and SP1 cells were transfected using Lipofectamine/PLUS Reagent (Invitrogen) as recommended by the manufacturer. A total of 900 ng of L6 renilla luciferase reporter vector and 100 ng CMV-luc internal control vector were used per well. Each condition was performed in triplicate. For all cell lines, cells were treated with hydrocortisone on the day following transfections, after which they were lysed using Passive Lysis Buffer, and assayed using the Dual-Luciferase Assay System (Promega) as per manufacturer’s instructions. Details of DNA constructs used are shown in Fig. 13a and in Appendix B.

2.3.3 Reverse Transcription and Real-Time PCR

For real-time quantitative polymerase chain reaction (PCR) assays cells were seeded on 100mm culture plates and treated 24 hours after plating with 1ug/mL hydrocortisone in serum-free media for 48 hours. Cells were harvested using the

GenElute Mammalian Total RNA Kit (Sigma) as described by the manufacturer. Isolated

RNA was used in a reverse transcription reaction as follows: for each sample 2.5ug RNA

were incubated with 1ug pd(N)6 random hexamer (GE Healthcare) and DEPC-treated

H2O up to 25uL at 70°C for 5 minutes in a Brinkmann thermocycler. Samples were placed on ice and 25uL of reaction mix was added. Reaction mix contains 10X Mu-MLV

Buffer (New England Biolabs), 200 units Mu-MLV RTase (New England Biolabs), 40 units RNase OUT (Invitrogen), 5mM dNTPs in DEPC-treated H2O (New England

Biolabs), and DEPC-treated H2O. Samples were incubated for 1 hour at 42°C.

Real-time PCR was performed using the SmartCycler II (Cepheid) and the SYBR

Green PCR Kit-QuantiTect (Qiagen) as per manufacturer’s instructions. For each cDNA sample, both a BRCA1 PCR and a control gene (TBP) PCR reactions were prepared. In each, 2.5uL of cDNA sample were used, with each of the forward and reverse primers at a final concentration of 0.5uM in a 25uL reaction. PCR conditions used for both BRCA1 and TBP reactions were: 95°C for 15min followed by 45 cycles of 95°C for 15 seconds,

60°C for 30 seconds, and 72°C for 30 seconds. Primers used were: mBRCA1 forward (5’

– GCAGCTGTGTGGGGCTTCCGTG – 3’), mBRCA1 reverse (5’ –

GTTGCTGTCTTCTGTCCAGGCGC – 3’), mTBP forward (5’ -

GGCCTCTCAGAAGCATCACTA – 3’), and mTBP reverse (5’ –

GCCAAGCCCTGAGCATAA – 3’).

2.3.4 Antibodies

Antibodies used for EMSA supershifts were: USF2 (Santa Cruz, N-18); GABPα

(Santa Cruz, H-180); GABPα (Santa Cruz, H-2); CREB-1 (Santa Cruz, 240); Ets-2

(Santa Cruz, C-20). Antibodies used for Western Blots were: USF2 (Santa Cruz, N-18

X); SP1 (Santa Cruz, sc59); GABPα and GABPβ rabbit antibodies were raised by

Chemicon against peptides ASQEQQMNEIC and MQNQINTNPEC, respectively.

2.3.5 Nuclear Extract Preparation and Electromobility Shift (EMSA) Assays

Nuclear extract preparation protocol and EMSA conditions have been previously described by Atlas et al. [129]. Loading controls were done using a labeled oligonucleotide corresponding to the nuclear factor Y binding site within the albumin gene promoter (+ strand: 5’ – GTAGGAACCAATGAAATGCGAGGTAAGTAT – 3’; - strand: 5’ – CCTACATACTTACCTCGCATTTCATTGGTT – 3’). For the USF2 supershift assay, nuclear extracts were incubated with 2uL of anti-USF2 antibody for

15min. on ice prior to preparation of bandshift reactions. GABPα nuclear extract preparation and supershift assay for the RIBS site were carried out as described in Lin et al. 156. The GABPα supershift assay consisted of incubation of 2uL of pre-bleed serum or anti-GABPα antibody with EPH4 nuclear extracts for 30 min. prior to preparation of bandshift reactions. GABPα supershift assay for the UP-FR6 site was carried out as described in Rosmarin et al. 157 with nuclear extracts prepared as described in Atlas et al

[23]. The GABPα supershift assay consisted of incubation of 2uL of anti-Ets2 non- specific or anti-GABPα antibody with EPH4 nuclear extracts for 10 min. prior to preparation of bandshift reactions. Cold probe competition reactions were done as in [23] by adding unlabeled UP or BRIBS oligonucleotide at a weight ratio to radioactively labeled oligonucleotide of 5:1, 10:1, or 50:1.

Specific oligonucleotides used are as described in Figure 13a.

2.3.6 Western Blots

For all Western Blots, nuclear extracts from EPH4 cells were resolved on a 10% acrylamide gel by SDS-PAGE, blotted onto a nitrocellulose membrane and probed with

the appropriate antibody overnight at a ratio of 1:1000. Secondary antibody detection was performed by chemiluminescence (Pierce). An anti-Sp1 antibody [Santa Cruz

(sc59)] was used to confirm equal loading.

2.3.7 Statistical Analysis

Error and statistical significance calculations for luciferase assay results were performed with Microsoft Office Excel 2003, using the two-sample t-test function assuming equal variances (Appendix A). Real-time PCR error calculations were performed as suggested for the SmartCycler II system by manufacturer (Appendix A).

2.4 Results

2.4.1 Characterization of EPH4 cells stably transfected with the BRCA1 proximal promoter.

Stress-related changes in immune system function, DNA repair capacity and apoptotic ability have been suggested to contribute to cancer development 158. The protein product of the tumour suppressor gene BRCA1 plays a key regulatory role in both

DNA repair and apoptosis 153 and has been shown to be misregulated in the majority of sporadic breast cancer cases 9. Therefore, we hypothesized that the BRCA1 gene may be a likely target for regulation by the primary stress hormone, cortisol. In order to address this hypothesis and examine the effect of hormonal stimuli on BRCA1 expression, we constructed stable transfectants in which a luciferase reporter gene was driven by the human BRCA1 proximal promoter (a 226bp region immediately upstream of the 1A transcript of BRCA1, -204 to +26) in the non-malignant mouse mammary cell line EPH4.

Cells were co-transfected with a renilla luciferase reporter vector under the control of the

BRCA1 proximal promoter (L6) and a puromycin selectable vector. After 3 days of drug selection, cells were trypsinized and passaged as a pooled population in order to minimize positional effects of reporter integration. Values for these transfectants averaged 6312 relative light units (Fig.7a). In order to obtain higher relative light unit values and therefore increase assay sensitivity, individual clones were isolated from the pooled culture and were tested for luciferase expression. As expected, a wide range of expression was observed likely related to the site of integration (Fig. 7a). A number of assays indicated that the individual clones behaved in a similar manner to the pooled population (results not shown). Clone # 15 was identified as a high-expression clone showing 259693 relative light units of BRCA1 expression and both the pooled cells and clone #15 were used in subsequent experiments.

2.4.2 Glucocorticoids down-regulate exogenous BRCA1 promoter activity in

EPH4-L6 non-malignant mouse mammary cells.

The effect of hydrocortisone on BRCA1 expression was evaluated in the pooled

EPH4-L6 stable transfectants described above. A concentration-dependent decrease in exogenous BRCA1 promoter activity was observed in these cells upon 48-hour treatment with hydrocortisone (Fig.7b). Hydrocortisone concentrations ranged up to 2.0 ug/mL. At the maximum hormone concentration, BRCA1 promoter activity was down-regulated by

77%. The effect of hydrocortisone on BRCA1 was observed at both 24 and 48 hours of treatment (results not shown). Treatment of cells with the synthetic glucocorticoid

300000 a)

200000

RLU 100000

0 L6-4 #6 #7 #10 #15 #20 b)

15000

10000 77% RLU 5000

0 0 0.01 0.02 0.05 0.1 0.5 1 2

[HC] ug/mL c)

10000

7500 76% 5000

RLU

2500

0 0 0.05 0.10 1.00 2.00

[Dex] µµµ M

Figure 7 Glucocorticoids represses BRCA1 promoter activity in a concentration- dependent manner. a) EPH4 cells were stably transfected with a renilla luciferase reporter vector driven by the BRCA1 proximal promoter (L6). Renilla expression values, as measured by relative light units (RLU), were obtained for cells from pooled clones (L6-4) and for cells from individual clones derived from the pool (numbered as indicated). b) EPH4 L6 clone #15 cells stably transfected with an expression construct for the BRCA1 proximal promoter were treated with the indicated range of hydrocortisone concentrations or (c) the synthetic glucocorticoid dexamethasone for 48 hours. Results are shown as relative light units (RLU) at 48 hours of treatment for triplicate samples for each condition. Error bars indicate standard deviation. Representative experiments are shown out of N=3.

dexamethasone had a similar repressive effect on BRCA1 promoter activity. EPH4-L6 cells exhibited a decrease of 76% in exogenous promoter activity at 48 hours of treatment with 2uM dexamethasone (Fig.7c).

The human BRCA1 proximal promoter is bi-directional, regulating both the

BRCA1 gene and the neighbouring NBR2 gene. Although it has been found that BRCA1 expression is opposite to that of NBR2 in certain tumour breast cell lines 159, results from our laboratory suggest that NBR2 expression is regulated in concordance with BRCA1

(unpublished results). Also, core transcriptional elements have been shown to regulate both promoters 111. To determine the effect of hydrocortisone on NBR2 expression, we transiently transfected EPH4 cells with a renilla luciferase expression vector, containing both the BRCA1 and NBR2 transcriptional start sites (nucleotides -286 to +26) with the

NBR2 sequences driving the reporter gene. NBR2 promoter activity was negatively regulated by hydrocortisone to a similar degree as BRCA1 (Fig.8).

Previous studies have demonstrated that both the human and mouse BRCA1 genes are responsive to hormonal regulation by lactogenic hormones 122,160,161. Therefore, we wanted to examine whether the effect of hydrocortisone observed in undifferentiated cells grown on plastic is modified by the presence of such hormones. Insulin and prolactin, in combination with hydrocortisone, are routinely used to promote epithelial cell differentiation and milk protein expression in EPH4 cells 155. Therefore, we treated

EPH4-L6 #15 cells with 1ug/mL of hydrocortisone in the presence or absence of 5ug/mL of insulin and/or 3ug/mL of prolactin. For all treatments, cell counts were performed and were used to control for cell growth differences. The only single agent which had an effect on BRCA1 expression was hydrocortisone (Fig.9a). Hydrocortisone-induced repression was not significantly altered by insulin or prolactin alone, and was only

BRCA1 NBR2

Bidirectional Promoter Renilla Luciferase Gene NBR2 construct +27 -286

1.25 No HC

HC 1.00

0.75

0.50

0.25 NBR2 Promoter Activity NBR2 Promoter Activity NBR2 Promoter 0.00

Figure 8 The NBR2 promoter is regulated coordinately with BRCA1 in the presence of hydrocortisone. EPH4 cells were transiently transfected with an expression construct containing the BRCA1 promoter in reverse orientation starting from 286 basepairs upstream of the BRCA1 transcription initiation site (as shown in schematic). NBR2 promoter activity was measured at 48 hours of hydrocortisone treatment and is expressed as relative light units. Values are normalized to a CMV firefly luciferase expression vector. Triplicate samples were done for all conditions. Two stars signify statistically significant repression of p≤0.01. Error bars indicate standard deviation. Representative experiment is shown out of N=3.

relieved when insulin and prolactin were added in combination. Differentiation of EPH4 cells, as measured by formation of spherical mammosphere structures capable of milk protein production, can be achieved by growing the cells on a basement membrane – like substrate (Matrigel) in the presence of hydrocortisone, insulin and prolactin 155. The effect of hydrocortisone on fully differentiated cells was tested by stimulating mammosphere formation of EPH4-L6 #15 cells, withdrawing only hydrocortisone from the media and monitoring changes in renilla luciferase expression. At 72 hours after hydrocortisone withdrawal, BRCA1 promoter activity increased by 45% (Fig.9b) with no change in cellular morphology, suggesting recovery of expression in the absence of the hormone.

BRCA1 expression in mammary cells has been shown to be up-regulated in growing cells 162. We were interested in assessing whether cell growth negates the repressive effect of hydrocortisone on BRCA1 promoter activity. To this purpose, EPH4-

L6 #15 cells grown in 5% serum-containing medium (in contrast to previous experiments) were treated with 1ug/mL hydrocortisone. As expected, BRCA1 promoter activity increased in untreated cells grown in serum. Promoter activity in treated cells was repressed fully regardless of serum conditions (Fig.10a). Therefore, the cell growth - induced stimulation of BRCA1 expression appears to be less significant than the repressive effect of hydrocortisone on promoter function.

The ovarian hormone estrogen has also been shown to promote proliferation of mammary epithelial cells 112. In addition, estrogen causes a slight upregulation in BRCA1 expression in growing cells [33]. To determine if estrogen-induced activation of BRCA1 thwarts the repressive effect of hydrocortisone, we grew EPH4-L6 #15 cells in media containing estrogen at concentration of 10nM and hydrocortisone at 1ug/mL. As

1.5

1.0

0.5

0.0 l L S L S tro R n HC P IN PR +IN C Co C+ H H PRL+INS HC+PRL+INS

1.25 No HC HC 1.00 0.75

0.50 0.25

BRCA1 Promoter Promoter Activity BRCA1 0.00

Figure 9 Hydrocortisone repression of BRCA1 promoter activity in the presence of lactogenic hormones and in differentiated cells. a) EPH4 L6 clone #15 cells stably transfected with the BRCA1 proximal promoter were treated for 48 hours with hydrocortisone (HC), prolactin (PRL), insulin (INS) and the indicated combinations of lactogenic hormones. Results are expressed as relative expression level, normalized to cell number and expressed in relation to the untreated control. All conditions were sampled in triplicate. b) EPH4 L6 clone #15 cells were grown on the basement membrane-like substrate Matrigel in the presence of lactogenic hormones. Hydrocortisone was withdrawn from the media upon development of mammosphere structures. Luciferase activity was measured 72 hours later for five samples for each condition. Results are expressed as relative expression level, normalized to cell number and expressed in relation to cells without hydrocortisone. Three stars signify a statistically significance of p≤0.001, two stars for p≤0.01, and one star for p≤0.05. Error bars indicate standard deviation. Representative experiments are shown out of N=3.

expected, estrogen upregulated BRCA1 in the absence of hydrocortisone (Fig.10b).

Hydrocortisone addition, however, represses BRCA1 to the same level in estrogen treated and untreated cells. Thus, hydrocortisone signaling can abolish estrogen upregulation of

BRCA1.

2.4.3 Continuous hydrocortisone presence is needed for long-term down- regulation in BRCA1 exogenous promoter activity.

We wanted to examine whether transient exposure to hydrocortisone is sufficient to induce a long-term down-regulation in BRCA1 expression. Therefore, EPH4-L6 pooled cells were treated either for 48 hours after which the hydrocortisone was removed, or continuously (hydrocortisone renewed every 24 hours), and were harvested at different points in time following the 48-hour treatment. Untreated cells grown under the same conditions and harvested at corresponding time points were used as control. BRCA1 expression was repressed in the presence of hydrocortisone but recovered within 24 hours after hydrocortisone removal from the medium (Fig.11). Continuously treated cells exhibited reduced BRCA1 expression levels for the entirety of the experiment.

Interestingly, the BRCA1 promoter showed a reproducible spike of activity following recovery from repression (at Day 2). This may represent a cell mechanism for protecting genomic integrity in which BRCA1 protein amounts are brought up to their original level by short-term overexpression of the gene.

Therefore, continuous hydrocortisone presence is required for long-term repression of BRCA1 promoter activity.

175000

150000 No HC 125000 HC

100000

RLU 75000 50000 25000

0 - Serum + Serum

200000 No HC HC 150000

100000 RLU

50000

0 - Estrogen + Estrogen

Figure 10 Hydrocortisone represses BRCA1 promoter activity regardless of growth conditions. a) EPH4 L6 clone #15 cells stably transfected with the BRCA1 proximal promoter were treated for 48 hours with hydrocortisone in the presence or absence of 5% fetal bovine serum or (b) in the presence or absence of estrogen. Results are shown as relative light units (RLU) for triplicate samples for each condition, and are normalized to cell number. Three stars signify a statistically significant repression of p≤0.001, two stars for p≤0.01, and one star for p≤0.05. Error bars indicate standard deviation. Representative experiments are shown out of N=3.

2.4.4 Hydrocortisone has only a minimal effect on BRCA1 exogenous promoter activity in malignant mouse mammary cell lines.

Changes in BRCA1 expression are an early event in the process of cell transformation to a malignant phenotype 9. The majority of breast cancer cells show significantly reduced levels of BRCA1 expression. Therefore, it was of interest to determine whether the BRCA1 promoter remains responsive to hydrocortisone in malignant cells. Mouse mammary cell lines EPH4, HC-11 and SP1 were transiently transfected with a renilla luciferase reporter vector containing the BRCA1 promoter (L6- pRL) and treated with hydrocortisone for 48 hours. HC-11 cells have a mostly non- malignant morphology but are negative for p53 expression 163,164. Exogenous promoter activity in these cells was down-regulated to a lesser extent by hydrocortisone than in the non-tumorigenic EPH4 cell line (22 % decrease in promoter activity vs 74%, respectively) (Fig.12a). SP1 cells are fully malignant, with multiple chromosomal rearrangements 165. They showed no significant change in exogenous promoter activity upon hydrocortisone treatment. Thus, our results demonstrate that the effect of hydrocortisone on BRCA1 expression may dependent on the degree of cell malignancy.

2.4.5 Endogenous BRCA1 response to hydrocortisone parallels that of exogenous BRCA1, and differs in non-malignant and malignant cells.

To examine the regulation of the endogenous BRCA1 promoter in non-malignant and malignant cells in response to hydrocortisone, total RNA was isolated from EPH4,

BRCA1 Promoter Activity

0 1 2 3

Day0

Day1

DayAfter48h. Treatment Day2

Day3

Day4

Day5

HC HC48h. NoHC

Figure 11 Continuous hydrocortisone presence is required for long-term down- regulation of the BRCA1 promoter. Pooled EPH4 cells stably transfected with the BRCA1 proximal promoter were either untreated (pink bars) or treated with hydrocortisone for 48 hours after which the hormone was withdrawn from the media (blue bars), or hydrocortisone was maintained in the media (green bars) . Luciferase activity was assayed for triplicate samples every day after hydrocortisone withdrawal, for up to 5 days. Results are expressed as relative expression level, normalized to cell number and expressed in relation to the untreated control on Day 0. Statistical significance is defined as: two stars for p≤0.01, and one star for p≤0.05. Error bars indicate standard deviation. Representative experiment is shown out of N=3.

HC-11, and SP1 cells treated with hydrocortisone for 48 hours. Real-time quantitative

PCR assays were done for the mouse BRCA1 gene, using the mouse TBP gene as an internal control. EPH4 cells treated with hydrocortisone showed a 11.4-fold decrease in

BRCA1 mRNA product, while HC-11 cells exhibited a less pronounced response of 2.4- fold decrease and BRCA1 mRNA levels in SP1 showed almost no change (1.1-fold increase) (Fig. 12b). Thus, the effect of hydrocortisone on BRCA1 mRNA levels differs between non-malignant and malignant cells. This parallels the trend observed for transient BRCA1 promoter reporter activity in the presence of hydrocortisone.

2.4.6 Hydrocortisone responsive sites within the BRCA1 promoter.

In an attempt to identify the sites within the BRCA1 promoter which contribute to hydrocortisone signaling, we performed a computer analysis of the promoter sequence in search of potential glucocorticoid recognition elements. Those include glucocorticoid receptor binding sites (GREs), which are traditionally associated with GR transactivation, and negative glucocorticoid receptor binding sites (NGREs), associated with transrepression 46. Neither of these types of recognition elements was identified within the promoter. Therefore, we further aimed to isolate promoter regions relevant to hydrocortisone signaling by scanning the promoter for changes in protein binding. We performed an EMSA assay using radioactively labeled oligonucleotide probes corresponding to various previously identified protein-binding sites within the promoter

(unpublished data) (Fig.13a) and nuclear extracts from untreated EPH4 cells and cells treated with hydrocortisone for 48 hours. Two promoter elements showed a clear difference in protein binding between untreated and treated cells. At both the RIBS and

¦ ©

¢ ¤

¦ © ¨ ¨ ¦

¨ © ¨

¨ © ¨ ¨

¨ © ¨

¨ © ¨ ¨

¡ ¢ £ ¢ ¤ ¥ ¦ ¦ § ¡ ¦

" ! !

¦ ©

¢ ¤

¦ © ¨

¨ ©

¨ © ¨

¡ ¢ £ ¢ ¤ ¥ ¦ ¦ § ¡ ¦

Figure 12 Exogenous and endogenous BRCA1 promoter activity is regulated differently in non- malignant and malignant mouse mammary cells. a) EPH4, HC-11, and SP1 cells were transiently transfected with the BRCA1 proximal promoter and treated with hydrocortisone for 48 hours. Luciferase values were normalized to internal control firefly luciferase values for triplicate samples and are expressed as relative expression in relation to each untreated cell line. Statistically significant repression is defined as: two stars for p≤0.01. b) EPH4, HC-11, and SP1 cells were treated with hydrocortisone for 48 hours. Following reverse transcription of isolated mRNA, real-time PCR was carried out for endogenous BRCA1. BRCA1 Ct values were normalized to TBP Ct values for triplicate samples and are expressed as the level of expression in relation to untreated cells for each line. Error bars indicate standard deviation. Representative experiments are shown out of N=3.

UP promoter sites a high molecular weight protein complex is lost upon hydrocortisone treatment (Fig.13b).

Protein binding specificity to the UP and RIBS sites was tested in EMSA assays with unlabeled competitor UP and RIBS oligonucleotides. At both sites, addition of cold probe resulted in loss of the protein complexes affected by hydrocortisone treatment, suggesting that these complexes bind specifically (Fig.13c and 13d).

The functional significance of protein binding to the UP and RIBS sites within the

BRCA1 promoter was determined by introducing a RIBS deletion construct (∆R-pRL) and a UP point mutation construct (mUP-pRL) into EPH4 cells. Following transfection, cells were treated with hydrocortisone for 48 hours. Reporter values obtained were normalized to the expression of a firefly luciferase vector under the control of the CMV promoter (CMV-luc). Fold repression of promoter activity by hydrocortisone was calculated by dividing the normalized renilla luciferase expression values in untreated cells by those in treated cells. Both deletion of the RIBS site and mutation of the UP site reduced hydrocortisone-induced repression to approximately half of that seen for the native promoter, suggesting a functional role of these sites in BRCA1 regulation by hydrocortisone (Fig.14a). To determine if the UP and RIBS sites act cooperatively in this context, we utilized a construct in which activity at both sites was eliminated through concomitant RIBS deletion and UP point mutation (∆R/mUP-pRL). Loss of the two regulatory sites was found to reduce the effect of hydrocortisone on the BRCA1 promoter to a level similar to that seen with loss of either site individually.

In order to examine whether hydrocortisone has a repressive effect on the RIBS and UP sites outside of the context of the promoter, multimers consisting of linked repeats of these sites were constructed. These were cloned into a renilla luciferase vector

promoter binding analysis corresponding to corresponding(nucleo to analysis binding promoter iue 3 Poen opee a te IS n U re UP and RIBS the at complexes Protein 13. Figure CREB (– 176 to -169), SP1 (– 110 to -105), FA (– 90 90 -105), 110 to FA (– (– SP1 -169), 176 to (– CREB a) treatment. hydrocortisone 1530 tcggggaaccaaaggcaccgttgccttttcgcgcccttaatgtc - 1440 tctcggggctctctgcgaaccgagaaagacagggagggtaggag - 1350 cgtccgtgaaataccgtttgagtccatcttaagaa - UP-FR6 51 agcc 141 agagccccgagagacgcttggctct 231 gcaggcactt UP-FR6 51 agcc 141 agagccccgagagacgcttggctct 231 gcaggcactt -221 -221

NBR2 NBR2 NBR2 NBR2 c

ctt ctt

t ttt

t ttt a a t t -204 Start of L6 L6 of -204 Start -204 Start of L6 L6 of -204 Start cc ggcaaactcaggta cc ggcaaactcaggta UP UP

gt gt

gg gg caacggaaaagcgcg caacggaaaagcgcg ceai o te RA poia pooe wt oligo with promoter proximal BRCA1 the of Schematic

t t tctgtccctcccatcctctgattgt tctgtccctcccatcctctgattgt

g g

aattctt aattctt ------

tides upstream of BRCA1 transcription start site): site): start BRCA1transcription upstream of tides

Sp1 Sp1 RIBS RIBS to -70), UP (– 47 to – 25), PR (– 17 to + 3).to + 17 (– 25), PR – 47 to to (– -70), UP g g gaattacagataaatt cc gg gaattacagataaatt cc gg

Minimal Minimal tctt agaa tctt agaa uaoy lmns f h BC1 rmtr r ls up lost are promoter BRCA1 the of elements gulatory

cc gg cc gg

gtctcttt cagagaaa gtctcttt cagagaaa PR PR

tatttaattttgacgctgacgcgccgcactcgag actaacatggaactaaagcataagactctccgacgacgaatcgcca

bi-directional promoter bi-directional promoter

FRAG1 FRAG1 CREB CREB a cc gg a cc gg a a aaactgcgactgcgcggcgt aaactgcgactgcgcggcgt ccttgatttcgtattctgagaggctgctgcttagcggt ccttgatttcgtattctgagaggctgctgcttagcggt tttta aaaat tttta aaaat BRCA1 BRCA1 cg gc cg gc FA FA tcatccgggggca agtaggcccccgtctgacccac tcatccgggggca agtaggcccccgtctgacccac

+3 End of L6 L6 of End +3 +3 End of L6 L6 of End +3

uloie ue i EMSA in used nucleotides

------RIBS (-204 to -180), -180), to (-204 RIBS

g g

agctc agctc g g actgggtggccaatc actgggtggccaatc

c c ggttagg ggttagg on c c

C C HC H HC - H C + - HC H Y Y - b) F IBS - IBS + F N NFY R R N NFY + HC UP UP + HC HC- HC- specific specific complex complex

Protein Unlabeled RIBS probe c) 0.5uL 1uL 2uL 5ng 10ng 50ng

RIBS- specific binding

d) Protein Unlabeled UP probe

0.5uL 1uL 2uL 5ng 10ng 50ng

UP- specific binding

Figure 13 continued. Protein complexes at the RIBS and UP regulatory elements of the BRCA1 promoter are lost upon hydrocortisone treatment. b) Nuclear extracts isolated from EPH4 cells untreated (-HC) or treated with hydrocortisone for 48 hours (+HC) were used in an EMSA assay with radioactively labeled oligonucleotides corresponding to a control NF-Y binding probe (NF-Y) or to the RIBS site and UP regulatory sites of the BRCA1 proximal promoter as described in (a). c) Nuclear extracts isolated from untreated EPH4 cells were used in an EMSA assay with radioactively labeled oligonucleotide corresponding to the RIBS regulatory element of the BRCA1 promoter. Increasing amounts of nuclear protein and increasing concentrations of unlabeled RIBS oligonucleotide (as indicated) were added to detect site-specific binding complexes. d) Nuclear extracts isolated from untreated EPH4 cells were used in an EMSA assay with radioactively labeled oligonucleotide corresponding to the UP regulatory element of the BRCA1 promoter. Increasing amounts of nuclear protein and increasing concentrations of unlabeled oligonucleotide were used to detect site-specific binding complexes. Representative experiments are shown out of N=3.

and transfected into EPH4 cells. The UP multimer, consisting of 16 repeats of the UP site, showed no significant change in activity upon hydrocortisone treatment (Fig.14b).

In contrast, the 4 - repeat RIBS multimer was repressed by 27% upon hydrocortisone treatment. These results taken together with those obtained with RIBS and UP site mutations suggest that the RIBS site is hydrocortisone - responsive when taken outside of the context of the native promoter, whereas the UP site is only sensitive to hydrocortisone in the presence of other promoter sites. Therefore, the RIBS and UP sites respond differently to hydrocortisone outside of the context of the BRCA1 promoter, but may act cooperatively when found together in the native promoter.

We had previously created a luciferase expression vector containing a fragment

(FRAG1) of the promoter (nucleotides -204 to -155) which consists of a single copy of the RIBS element as well as the down-stream CREB site driving a heterologous promoter.

The CREB site has been previously shown to be important for overall regulation of

BRCA1 expression 127,128,131. Therefore, we tested whether the presence of this element has an effect on hydrocortisone repression of RIBS activity. When EPH4 cells transfected with the FRAG1 reporter vector were treated with hydrocortisone, there was a 28% decrease in FRAG1 activity, comparable to that observed for the RIBS site alone (Fig.

14b).

2.4.7 Transcription Factors Involved in Hydrocortisone Signaling at the

BRCA1 Promoter

In previous studies we had found that both the RIBS and UP sites play a key role in regulating overall BRCA1 expression ([129]; unpublished data). The RIBS

2.1x a) 2.5 No HC 2.0 HC 4.1x 1.5 2.0x 2.4x

1.0

0.5

0.0 L6 DR mUP DR/mUP

No HC 4 HC

Activity Multimer 0 UP16n RIBSn FRAG1

Figure 14 The RIBS and UP regulatory elements of the BRCA1 promoter are functionally involved in hydrocortisone regulation of BRCA1 promoter activity. a) The L6 BRCA1 promoter, as well as constructs containing a RIBS site deletion (DR), a UP point mutation (mUP) and both (DR/mUP) were transiently transfected into EPH4 cells. Renilla luciferase activity was normalized to firefly luciferase values for triplicate samples and is expressed as relative expression in relation to the untreated L6 construct. Statistically significant repression is defined as: three stars for p≤0.001, two stars for p≤0.01, and one star for p≤0.05. Fold repression was calculated by dividing values for untreated samples by values for corresponding treated samples. b) Reporter constructs containing multimerized oligonucleotides corresponding to the UP (UP16n) and RIBS (RIBSn) regulatory elements of the BRCA1 promoter, and a single element containing both the RIBS site and the nearby CREB site (FRAG1) were transiently transfected into EPH4 cells. Following 48 hour hydrocortisone treatment cells were assayed for renilla luciferase activity and normalized to firefly luciferase activity for triplicate samples and is expressed as relative expression in relation to the untreated UP16n construct. Statistically significant repression is defined as: three stars for p≤0.001, and one star for p≤0.05. Error bars indicate standard deviation. Representative experiments are shown out of N=3.

binding protein complex was found to contain the tetrameric transcription factor

GABPα/β, while the protein complex binding to the UP site contains both GABPα/β and the transcription factor USF2. We tested the involvement of these regulatory factors in the BRCA1 hydrocortisone response. EMSA assays were performed in which antibodies specific to the USF2 and GABPα/β transcription factors were mixed with nuclear extracts from EPH4 cells grown for 48 hours in the presence or absence of hydrocortisone. USF2 antibody addition caused a shift in the hydrocortisone-specific UP site protein complex demonstrating that USF2 is present in that complex (Fig.15a). An antibody against the

DNA binding component of GABPα/β (GABPα) was able to supershift the hydrocortisone-specific protein complexes at both the UP and RIBS promoter sites (Fig.

15b, 15c). To examine the individual roles of GABPα/β and USF2 in hydrocortisone signaling, a renilla luciferase construct of the BRCA1 proximal promoter was co- transfected with expression vectors for GABPα and GABPβ and/or USF2. GABPα/β and

USF2 addition did not have a significant effect on repression of BRCA1 expression by hydrocortisone (Fig.16a). In addition, Western blot assays using protein isolated from hydrocortisone-treated and untreated cells did not demonstrate differences in endogenous protein levels of USF2, GABPα or GABPβ in response to treatment (Fig.16b). Thus, mechanisms other than changes in available protein levels for these transcription factors are likely to be responsible for hydrocortisone-induced differences in BRCA1 promoter signaling.

a) NFY UP + UP + anti-CREB anti-USF2 - + - + - + HC HC HC HC HC HC

supershift shift

NFY UP-FR6 + UP-FR6 + b) Anti-Ets2 anti-GABPα - + - + - + HC HC HC HC HC HC supershift shift

NFY RIBS - HC RIBS + HC - m + ru α α se BP HC HC A PB G PB serum GABP c)

supershift shift

Figure 15 The transcription factors USF2 and GABPα/β bind to the hydrocortisone-responsive elements. a, b) Untreated (-HC) or hydrocortisone-treated (+HC) EPH4 cell nuclear extracts were used in an EMSA assay with the radioactively labeled NF-Y or UP-FR6 oligonucleotides. Supershift reactions were carried out using control CREB (a) or Ets-2 (b) antibodies (UPFR6+ anti-CREB/anti-Ets2) or with a USF2 antibody (UPFR6+ anti-USF2). The positions of the normal or supershift complexes are indicated by the labeled arrows. c) Untreated (-HC) or hydrocortisone-treated (+HC) EPH4 cell nuclear extracts were used in an EMSA assay with the radioactively labeled NF-Y or RIBS oligonucleotides. Supershift experiments were carried out by the addition of pre-bleed (PB) serum or a GABP α antibody. The positions of the normal or supershift complexes are indicated by the labeled arrows.

2.5 Discussion

The stress hormone hydrocortisone has a physiological role in mammary tissues at certain periods of breast development, such as puberty and pregnancy. It has been linked with mammary cell differentiation 166,167, as well as with induction of milk protein expression 37,168, and suppression of involution during lactation 169. We have found that hydrocortisone negatively regulates the expression of the breast cancer susceptibility gene

BRCA1 in mouse mammary cells. Since BRCA1 is a pro-apoptotic protein, whose high- levels have been linked to promotion of mammary gland involution 118,170,171, BRCA1 down-regulation by hydrocortisone may be correlated with the natural anti-apoptotic/pro- lactatory role of hydrocortisone in the breast. However, the continuous presence of high levels of hydrocortisone in the body, such as occurs during periods of stress, may result in long-term repression of BRCA1 expression and have unwanted effects on breast cell biology and cancer risk. Decreased levels of BRCA1 have been demonstrated, in both in vitro and in vivo studies, to promote accelerated cell growth, genetic instability, and tumour development 9,13,172.

The BRCA1 gene was previously shown to be hormonally responsive. Estrogen, progesterone and prolactin are all capable of altering BRCA1 mRNA expression in human breast cells 112,114,121,122. BRCA1, in turn, appears to block estrogen signaling pathways and estrogen-induced cell proliferation 173. It is suggested that the positive effect of estrogen and progesterone on BRCA1 expression represents a feedback mechanism by which rapidly proliferating cells control their growth 112. Factors which obstruct this mechanism are likely to produce unchecked cell proliferation. Therefore, through its negative effect on BRCA1 expression, hydrocortisone may interfere with normal ovarian hormone signaling in the breast, thus promoting tumour development. Indeed, our results

a) 4.8x

1.5 5.1x 5.4x -HC +HC 6.1x 1.0

0.5

BRCA1 Promoter Activity 0.0 β Pβ (x2) S G ABP G +GAB α Pα+ P

-Gal+pCAG +GAB -Gal+GAB L6+USF2+pCAGGS(x2) L6+USF2 L6+PSCT L6+PSCT

-HC + HC USF2

GABPβ

GABPα

SP1

Figure 16 GABPα/β and USF2 overexpression does not alter hydrocortisone-induced repression of BRCA1 promoter activity and the subunit protein levels are not altered by hydrocortisone. a) EPH4 cells were transiently co-transfected with a reporter vector containing the BRCA1 proximal promoter and expression vectors for GABPα and GABPβ and/or USF2. Following 48-hour treatment with hydrocortisone, cells were assayed for renilla luciferase activity and values were normalized to firefly luciferase expression for triplicate samples and are expressed as relative expression in relation to the untreated L6 construct co-transfected with the empty vector. Statistically significant repression is defined as: two stars for p≤0.01. Fold repression was calculated by dividing values for the untreated samples by values for the corresponding treated samples. Error bars indicate standard deviation. Representative experiment is shown out of N=3. b) Nuclear protein was extracted from EPH4 cells treated with hydrocortisone for 48 hours and used in a Western Blot assay with antibodies directed against USF2, GABPα, GABPβ or Sp1.

demonstrate that in mouse mammary cells the up-regulation in BRCA1 expression observed in the presence of estrogen is negated by the repressive effect of hydrocortisone.

We have found that the observed regulatory effect of hydrocortisone in non- transformed mammary cells is diminished in more malignant cells. This may be related to the decrease in BRCA1 levels found in most mammary tumours 9. Conceivably, in tumour cells the BRCA1 promoter is fully repressed, and is thus unresponsive to negative signals. In another example of malignancy-dependent BRCA1 regulation, stimulation of

BRCA1 expression by the hormone prolactin is observed only in tumour human mammary cells and not in non-transformed cells presumably due to the already high levels of

BRCA1 expression in non-transformed cells 122. Alternatively, factors mediating the hydrocortisone effect on BRCA1 in non-malignant cells may be inactivated in the course of cell transformation. We have identified two transcription factors whose binding to the

BRCA1 promoter is affected by the presence of hydrocortisone, USF2 and GABPα/β.

Both of those are known to be important for BRCA1 regulation in general (129; unpublished data) and show altered binding to the promoter upon hydrocortisone treatment. The GABPα/β heterodimer acts down-stream of ERK and JNK signaling in certain cells 174 and appears to be an activator of BRCA1 transcription 129. Its loss from the BRCA1 promoter, therefore, may explain the hydrocortisone-induced repression observed and may implicate interference with MAPK signaling as the means for hydrocortisone action. In keeping with this, the glucocorticoid receptor has been shown to hinder ERK and JNK activation and down-stream signaling in breast epithelial cells 42.

Furthermore, loss of MAPK signaling results in cell survival in the presence of apoptosis- inducing paclitaxel 42. It is tempting to speculate that decreased BRCA1 pro-apoptotic activity can at least partially account for these results.

An alternate pathway for hydrocortisone signaling to BRCA1 is suggested by the involvement of both USF2 and GABPα/β in Transforming Growth Factor β

(TGFβ)/Smad3 -induced transactivation 175,176. Numerous reports have, in turn, shown overlap between TGFβ and glucocorticoid receptor signaling 177-179. Previous evidence also exists for direct regulation of USF2 expression by the glucocorticoid receptor. In a microarray study using endometrial cancer cells the glucocorticoid receptor significantly up-regulated USF2 mRNA levels 180.

Our results suggest that the hydrocortisone-repressed BRCA1 promoter returns to normal expression levels within 24 hours of removal of the hormone. This points to the continued presence of hydrocortisone as being necessary for long-term BRCA1 down- regulation. The occurrence of such a prolonged hormone stimulus is expected during periods of stress. There is also evidence suggesting that in the case of chronic stress, the hypothalamic-pituitary-adrenal (HPA) axis of stress signaling can be primed to actively signal even after removal of the stressor 181,182. This is achieved by loss of glucocorticoid receptor molecules in the brain, resulting in unresponsiveness to negative feedback regulation by glucocorticoids. Long-term presence of hydrocortisone may, in addition, cause lasting inactivating changes in the BRCA1 promoter itself. Experimental evidence indicates that prolonged decrease in gene transcription triggers promoter hypermethylation, and permanent gene repression 183. Approximately 15-20% of sporadic breast cancer cases are reported to exhibit aberrant BRCA1 promoter methylation

184.

2.6 Conclusions

The involvement of hydrocortisone in BRCA1 regulation suggests a novel molecular mechanism through which psychological stress may affect breast cancer risk.

Specifically, the known participation of BRCA1 in DNA repair and apoptosis may account for experimental observations pointing to disruption of these processes in stressed subjects 7,8,149,150 . This addresses a lack of availability of molecular models which can account for stress-related perturberance of intracellular processes, in particular, and stress-related increase in breast cancer risk, in general. Future studies should focus on directly correlating hydrocortisone signaling with BRCA1-regulated pathways.

Acknowledgements

This research was supported by operating grants from the Canadian Institute of

Health Research and the Canadian Breast Cancer Foundation-Ontario Chapter, and by

Fellowships from the Canadian Institute of Health Research and the Canadian Breast

Cancer Foundation-Ontario Chapter to LA.

CHAPTER 3

THE GLUCOCORTICOID RECEPTOR AS A REGULATOR OF BRCA1

EXPRESSION

Statement of Co-Authorship

This manuscript is presently being prepared for peer review. The authors are Lilia

Antonova and Christopher R. Mueller. All figures and tables were prepared by me. All sections of the manuscript were written by me and edited by Dr. Mueller.

3.1 Abstract

Psychological stress has been demonstrated in epidemiological studies to be associated with breast cancer risk. The molecular pathways through which this occurs, however, have yet to be identified. In previous work we have found that the stress hormone hydrocortisone acts as a negative regulator of the expression of the BRCA1 gene in non-malignant mouse mammary cells. Since low levels of BRCA1 expression have been linked to breast cancer development, this finding may demonstrate a molecular pathway through which prolonged exposure to hydrocortisone affects breast cancer risk.

To determine if our observations in murine cells apply to human tissues, we tested the effect of hydrocortisone on BRCA1 expression in non-malignant and malignant breast and ovarian human cells. We determined that, analogously to mouse cells, hydrocortisone has a negative effect on BRCA1 expression in non-malignant human breast cells, which is lost in malignant cells. Interestingly, this did not apply to human ovarian cells, suggesting different patterns of hydrocortisone signaling between breast and ovarian tissues.

We also aimed to determine the role of the intracellular hydrocortisone receptor,

GR, in the regulation of BRCA1 transcription by hydrocortisone. We show that GR upregulates BRCA1 expression levels in the absence of its ligand. This effect is mediated through the RIBS and UP sites of the BRCA1 promoter, which we have previously shown to be involved in hydrocortisone-induced BRCA1 down-regulation. In addition, a CREB site located down-stream of the RIBS promoter element appears to cooperate with RIBS in the BRCA1 trans-activation by GR. Finally, we demonstrate direct presence of the GR at the BRCA1 promoter. These findings contribute to the understanding of stress signaling in breast and ovarian cells and reveal a novel role of the GR as a ligand- independent transcriptional regulator.

3.2 Introduction

Breast cancer is the most commonly diagnosed malignancy in Canadian women and is second only to lung cancer as a cause of cancer-related mortality 185. Hereditary breast cancer accounts for less than 10% of cases, approximately half of which exhibit mutations in the Breast Cancer Susceptibility Gene 1 153. Such genetic alterations have been found to be associated with a highly malignant and invasive tumour phenotypes.

Although BRCA1 mutations are rarely seen in sporadic breast cancers 123,186, 30-40% of those exhibit decreased levels in the expression of the BRCA1 gene 153. In vitro studies demonstrate that low levels of BRCA1 in turn lead to accelerated cell proliferation and are associated with transition from carcinoma in situ to invasive breast cancer 9. In addition, loss of BRCA1 expression has been correlated with higher grade sporadic tumours 12, higher metastatic rates for such tumours 187, and an adverse effect on disease- free survival 188. This is consistent with the known involvement of the BRCA1 protein in

several processes important for maintenance of genetic stability including DNA repair, cell-cycle checkpoint regulation, and apoptosis 86.

Epigenetic processes, such as hypermethylation of the BRCA1 promoter, appear to play a role in only a small portion of breast cancer cases exhibiting aberrant BRCA1 expression 189. Therefore, changes in BRCA1 transcriptional regulation are thought to make an important contribution to sporadic breast cancer development.

The BRCA1 proximal promoter is bi-directional, controlling the expression of both the BRCA1 and NBR2 genes, and is approximately 200bp in length 110. Regulation of BRCA1 expression is not fully understood and appears to involve a number of regulatory elements and signaling pathways 190. In particular, the promoter has been shown to be responsive to hormonal signals. Estrogen and prolactin have both been identified as regulators of BRCA1 expression 112,113,116,122. The estrogen receptor has been shown to bind directly to the larger BRCA1 promoter through an AP-1 binding site and to thus upregulate gene expression 119. Recently we have identified the stress hormone hydrocortisone as another regulator of BRCA1 transcription. In non-malignant mouse mammary cells, but not in malignant cells, hydrocortisone treatment was demonstrated to cause a significant decrease in BRCA1 promoter activity and mRNA levels. This effect was dependent on changes in protein binding to the promoter and involved the transcription factors GABPα/β and USF2. Hydrocortisone has a functional role in the breast during lactation 191,192, and has been shown to suppress mammary gland involution following lactation 193. Since the BRCA1 protein is known to be involved in breast involution 117,171, repression of its activity by hydrocortisone may be important for delaying the onset of involution. However, the prolonged elevation of hydrocortisone in

the organism, such as during periods of stress, would result in long-term down-regulation of BRCA1, which has in turn been shown to contribute to tumour development 9.

Hydrocortisone signaling has been demonstrated to be dependent on binding of the hormone to its intracellular receptor, GR, in the cytoplasm of cells and the subsequent translocation of this complex to the nucleus 53. Liganded GR in turn regulates the transcription of target genes through direct DNA binding to conserved sequences or through protein-protein interactions 46. Ligand-independent transcriptional activity of

GR has not thus far been observed for the native receptor. A study by Schmitt et al., however, reported a ligand-independent positive effect of recombinant GR on the expression of the Mouse Mammary Tumour Virus Promoter 194. In addition, improvement of experimental conditions has demonstrated that the majority of GR in certain cell types dwells in the cell nucleus in the absence of hydrocortisone, and not in the cytoplasm as earlier believed 55. In this study we focused on testing for direct involvement of the glucocorticoid receptor in signaling to the BRCA1 promoter.

The mouse and human BRCA1 promoters share highly conserved homology and have been shown to be similarly regulated in mouse and human breast cells 109,159. In addition, BRCA1 has been shown to play an important role in the development of familial ovarian breast cancer, and to be down-regulated in a large proportion of sporadic ovarian breast cancer cases. Certain BRCA1 promoter elements crucial for BRCA1 gene expression in breast cells are also important for the regulation of the gene in ovarian cells.

Since the effect of hydrocortisone on the expression of BRCA1 in human epithelial breast and ovarian cells has not previously been examined, we were interested in investigating whether our observations from mouse mammary cells extend to those cell types.

This study demonstrates that hydrocortisone acts as a regulator of BRCA1 expression in human breast cells, and that its effect differs between non-malignant and malignant cells. In addition, we report a novel hormone-independent role for the glucocorticoid receptor in regulating the expression of the BRCA1 gene. GR overexpression was found to cause upregulation of BRCA1 promoter activity. This effect was dependent on specific regulatory sites within the promoter, some of which had previously been correlated with regulation of BRCA1 expression by hydrocortisone. Preliminary results indicate the direct presence of the receptor at the BRCA1 promoter. .

3.3 Materials and Methods

3.3.1 Cell Culture and Treatments

The conditions in which cell lines used in this study were maintained are listed in

Table 1. Mouse mammary EPH4 cells, and human mammary 184-hTERT cells were obtained from Dr. Calvin Roskelley (UBC, Canada). All other cell lines were obtained from ATCC. Cells were maintained at 37°C with 5% CO2.

Cell treatments for EPH4 cells were performed for 48 hours in DMEM/F-12 medium (HyClone) supplemented with penicillin/streptomycin, and 1ug/mL hydrocortisone (Sigma). Treatments for 184-hTERT cells grown on plastic were done in

MEBM media (Clonetics), supplemented with 400ug/mL G418. Hydrocortisone withdrawal experiments for 184-hTERT cells grown on Matrigel in the absence of serum

(branches) were performed in MEBM media supplemented with SingleQuot (Clonetics),

400ug/mL G418, 1ug/mL transferrin, 1.25ug/mL isoproterenol, and 1ug/mL hydrocortisone for 96 hours. 184-hTERT Matrigel treatments for cells grown in serum

Cell Line Maintenance Medium

DMEM/F-12, 5% FBS, 5ug/mL insulin, 1x Pen/Strep EPH4 (100units/mL penicillin, 100ug/mL streptomycin) MEBM + SingleQuot, 400ug/mL G418, 1ug/M transferrin, 184-hTERT 1.25ug/mL isoproterenol MEBM + SingleQuot, 400ug/mL G418, 1ug/M transferrin, 184-hTERT branches 1.25ug/mL isoproterenol

184-hTERT mammospheres DMEM + 10% FBS, 1x Pen/Strep

HeLa DMEM + 10% FBS, 1x Pen/Strep

MCF7 RPMI-1640, 10% FBS, 1x Pen/Strep

SKBR3 DMEM + 10% FBS, 1x Pen/Strep

IOSE-80PC DMEM, 5% FBS, 1x Pen/Strep

SKOV3 DMEM, 5% FBS, 1x Pen/Strep

OVCAR3 RPMI-1640, 10% FBS, 10ug/mL insulin, 1x Pen/Strep

Table 1. Culture conditions for cell lines used in this chapter.

(mammospheres) were done in DMEM + 10% FBS, penicillin/streptomycin, and 1ug/mL hydrocortisone. Cells for both Matrigel conditions were grown until differentiation end- point (branch formation in absence of serum or mammosphere formation in presence of serum), at which time they were treated with hydrocortisone for 96 hours. Cell treatments for ovarian and malignant mammary cells were performed in 1ug/mL hydrocortisone in fully supplemented media for 48 hours (Table 1).

3.3.2 Transient Transfections and Luciferase Assays

For all transfections, cells were seeded out in 12-well plates at a density of 5x104 cells/mL for EPH4 cells, and 1x105 cells/mL for all other cell lines 24 hours prior to transfections. Transfections were performed using 1uL per well FuGene6 transfection reagent (Roche Applied Science) in serum-containing media according to the manufacturer’s instructions. Transfection conditions and assays for the BRCA1 proximal promoter wild-type, proximal promoter mutations and promoter site multimers were performed as described previously (Chapter 2). BRCA1 promoter constructs are shown in Appendix B. GRwt and GR501P vectors were transfected at 50ng per well. Both vectors were constructed by Pearce et al. 195 and consist of the full rat glucocorticoid receptor cloned in pSP65 (Promega). The GR501P construct contains a leucine to proline mutation at amino acid 501 of the GR protein.

In order to test the effectiveness of the GR siRNA construct, HeLa cells were plated on 12-well plates at a density of 4x104 cells/mL and transfected with the siRNA construct. Transfections were performed using 3uL of FuGene transfection reagent

(Roche Applied Science) and 2ug siRNA plasmid, as per manufacturer’s instructions.

Seventy-two hours post-transfection, cells were harvested using 50uL of modified

radioimmunoprecipitation (RIPA) buffer (50mM Tris-HCl pH 7.4, 1% Igepal C630,

0.25% Na-deocycholate, 150mM NaCl, 1mM EDTA, 1mM PMSF, 1ug/mL each of aprotinin, leupeptin, and pepstatin, 1mM Na3VO4, 1mM NaF) for 15 minutes at 4°C. An equal amount of 2x SDA-PAGE loading buffer was added to each lysate, and lysates were resolved on an acrylamide gel. Densitometry calculations were performed as in

Appendix A. .

3.3.3. siRNA Western Blot

In order to detect GRα, proteins were resolved by SDS-PAGE, blotted onto a nitrocellulose membrane and probed with a GRα-directed antibody (Santa Cruz, P-20).

Secondary antibody (GAR HRP) detection was performed by chemiluminescence

(Pierce). To confirm equal loading, the blots were washed with phosphate buffered saline

(PBS) and re-probed with a Sp1-directed antibody (Santa Cruz, sc59).

3.3.4 Reverse Transcription and Real-time PCR

Real-time PCR analysis was performed as described in Chapter 2 for the human

BRCA1 gene. The human TBP gene was amplified as a control. PCR conditions used for both BRCA1 and TBP reactions were: 95°C for 15min followed by 45 cycles of 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 30 seconds. Primers used were: hBRCA1 forward (5’ – TACCACTACAATGGATG – 3’), hBRCA1 reverse (5’ –

GGGGTACCTGCATTGCCATTTCC – 3’), hTBP forward (5’ -

CACGAACCACGGCACTGATT – 3’), and hTBP reverse (5’ –

TTTTCTTGCTGCCAGTCTGGAC – 3’).

3.3.5 Immunofluorescence Assay

To perform an immunofluorescence analysis, EPH4 cells were plated on coverslips in 12-well plates at a density of 5x104, and treated with hydrocortisone for 48 hours. At that time, the media was aspirated, and the wells were washed with PBS. This was followed by fixation at room temperature using 4% paraformaldehyde in PBS, aspiration of media, washing with PBS, and permeabilization at room temperature suing

0.5% TritonX-100 in PBS. Cells were then incubated in blocking buffer [3% bovine serum albumin (BSA), 10% Normal Goat Serum, 0.1% Triton X-100, 0.1% Tween 20 in

PBS] at room temperature for 1 hour, followed by primary antibody solution [1:200 dilution of GR antibody (Santa Cruz, P-20) in PBS, 3% BSA] at room temperature for one hour in a humidified chamber, and then washed with PBS. The coverslips were then incubated in darkness in secondary antibody solution [1:100 dilution of AlexaFluor 488 goat anti-mouse (Molecular Probes, A11017), 3% BSA] for one hour in the humidified chamber, washed with PBS, and stained for 10 minutes with Hoechst in PBS. Finally, the coverslips were washed in PBS and mounted onto slides using Permount Anti-fade mounting medium. Images were visualized using confocal microscopy.

3.3.6 Chromatin Immunoprecipitation (ChIP) Assay

ChIP assay was performed using the ChIP-IT Express Enzymatic kit (Active

Motif) as per manufacturer’s instructions, using antibodies directed against GR (Santa

Cruz, P-20), acetylated histone 3 (AcH3, Upstate Biotechnology), and hemoglutinin (HA,

Santa Cruz Y-11). PCR conditions were as described in Figure 25. PCR primers used are: mBRCA1 ChIP forward (5’ – TGCCCCTTCACCTTCCAG – 3’), and mBRCA1

ChIP reverse (5’ – AGTGGATTCGCGGGCACAGA – 3’).

3.4 Results

3.4.1. Hydrocortisone represses BRCA1 gene expression in non-malignant human breast cells.

In previous work we have identified the stress hormone hydrocortisone as a regulator of BRCA1 gene expression in mouse mammary cells. Since the human BRCA1 gene is regulated in a manner similar to the mouse gene 109,159, we hypothesized that hydrocortisone would have the same effect on BRCA1 expression as that seen in mouse cells. To test this we transiently transfected non-malignant TERT-immortalized human mammary cells 184-hTERT with a renilla luciferase reporter construct (pRL) under the control of the proximal BRCA1 promoter (L6: n -204 to +26 of the human 1A BRCA1 promoter) and treated these cells with 1ug/mL hydrocortisone. Firefly luciferase expression was used to normalize transfection results. At 48 hours of hydrocortisone treatment BRCA1 expression showed a significant decrease of 33% as compared to untreated cells (Fig. 17a). This is not as great as that observed in mouse non-malignant mammary cells (77%). Therefore, we proceeded to test whether this change in promoter activity is sufficient to significantly alter BRCA1 mRNA levels. Total RNA was isolated from 184h-TERT cells treated with hydrocortisone for 48 hours after which real-time quantitative PCR assays were done for the human BRCA1 gene and the human TBP gene as an internal control. Hydrocortisone significantly repressed the expression of BRCA1 mRNA (by 49%) (Fig. 17b).

a) 1.25

no HC 1.00 HC

0.75

0.50

0.25

Activity Promoter BRCA1 0.00

b) 1.2 no HC 1 HC 0.8

0.6

0.4

0.2 BRCA1 Expression Level Expression BRCA1 0

Figure 17. Hydrocortisone represses BRCA1 promoter activity and BRCA1 mRNA levels in non-malignant human mammary cells grown on monolayer. a) 184-hTERT cells were transfected with a renilla luciferase reporter vector under the control of the proximal BRCA1 promoter, and were treated with hydrocortisone for 48 hours. BRCA1 promoter activity was determined by renilla luciferase activity. b) 184-hTERT cells were grown on plastic in the presence or absence of hydrocortisone for 48 hours. Following treatment, mRNA was isolated and reverse transcribed. The expression of the BRCA1 gene was examined with the use of real-time PCR. Error bars indicate standard deviation. Representative experiments are shown out of N=3.

We had previously demonstrated that hydrocortisone down-regulates BRCA1 expression in non-malignant EPH4 mouse cells in both undifferentiated cells grown on plastic and in fully differentiated cells grown on a basement membrane-like substrate

(Matrigel). Therefore, we were interested in determining the role of cell differentiation in the regulation of BRCA1 by hydrocortisone in human non-malignant mammary cells. To approximate in vivo differentiation conditions, 184h-TERT cells were grown on Matrigel in the presence of the lactogenic hormones insulin, prolactin and hydrocortisone. Two different levels of cell differentiation were achieved by sustaining the cells in the absence or presence of serum. Cells lacking serum-containing media proliferated and formed branch-like structures mimicking ductal branching in the breast. In contrast, cells grown in the presence of serum aggregated into structures called mammospheres, consisting of a central lumen surrounded by fully differentiated epithelial cells. Upon cell differentiation, as determined by formation of the above-described structures, hydrocortisone was withdrawn from the media and the cells were tested for BRCA1 expression by real-time PCR assays. For both the intermediately-differentiated 184- hTERT branches and for the fully differentiated mammosphere cells, removal of hydrocortisone from the media produced an increase in BRCA1 levels (of 42% and 34%, respectively) (Fig. 18a and 18b). This points to a repressive effect of hydrocortisone on

BRCA1 expression levels in differentiated cells, and to recovery of BRCA1 expression upon hydrocortisone removal.

a) 1.2

1 no HC

0.8 HC

0.6

0.4

0.2 Level Expression BRCA1 0

b) 1.4 no HC 1.2 HC 1

0.8 0.6

0.4 0.2 Level Expression BRCA1 0

Figure 18. Hydrocortisone down-regulates BRCA1 expression in differentiated non- malignant human mammary cells. 184-hTERT cells were grown on Matrigel substrate in the absence (a) or presence (b) of serum and insulin, hydrocortisone, and prolactin until formation of branches (a) or mammospheres (b) was achieved. Following differentiation, hydrocortisone was withdrawn from the media for 48 hours (no HC). Cells were harvested for mRNA and BRCA1 expression was tested with the use of real- time PCR. Error bars indicate standard deviation. Representative experiments are shown out of N=3.

3.4.2 The effect of hydrocortisone on BRCA1 expression in human breast cells is dependent on cell malignancy.

The majority of human sporadic breast cancer cells show reduced levels of

BRCA1 expression 9. This change in BRCA1 levels has been shown to occur early in breast cancer development. Therefore, we tested whether the effect of hydrocortisone on

BRCA1 is altered by cell malignancy. Malignant human breast MCF7, and SKBR3 cells were transiently transfected with L6-pRL and treated with hydrocortisone for 48 hours.

Hydrocortisone was found to significantly induced BRCA1 expression in both malignant cell lines (Fig.19a). These observations are consistent with the differential effect observed for hydrocortisone treatment of mouse non-malignant and malignant mammary cells, and point to transformation-induced alterations in the hydrocortisone signaling pathway to BRCA1.

The effect of hydrocortisone on BRCA1 mRNA levels in human breast cells was evaluated by real-time PCR assays for the human BRCA1 gene. Hydrocortisone-induced changes in mRNA levels in mammary tumour cells paralleled those observed for exogenous promoter activity levels for both cell lines tested (Fig. 19b).

3.4.3 The exogenous glucocorticoid receptor has a regulatory effect on BRCA1 expression, which differs between non-malignant and malignant mammary cells, but is independent of GR DNA binding activity and ligand availability.

We have demonstrated that the stress hormone hydrocortisone regulates BRCA1 gene expression similarly in mouse and human mammary cells. Since hydrocortisone intracellular signaling has been shown to be dependent on the activity of the

a) 2.5 no HC 2.0 HC

1.5

1.0 0.5

BRCA1 Promoter BRCA1 Activity BRCA1 Promoter BRCA1 Activity 0.0 MCF7 SKBR3

Cell Line

14 no HC 12 HC 10

6 4 2 Level Expression BRCA1 0 MCF7 SKBR3 Cell Line

Figure 19. The effect of hydrocortisone on BRCA1 expression is dependent on cell malignancy. a) Malignant human mammary cells MCF7 and SKBR3 were transfected with a renilla luciferase reporter vector under the control of the BRCA1 proximal promoter. Cells were treated with hydrocortisone for 48 hours and assayed for renilla luciferase activity. Significant changes in BRCA1 promoter activity are denoted as: two asterisks, p<0.005; three asterisks, p<0.0005. b) MCF7 and SKBR3 cells were treated with hydrocortisone for 48 hours. Reverse transcription was performed on harvested mRNA, and BRCA1 expression was measured with real-time PCR. Error bars represent standard deviation. Representative experiments are shown out of N=3.

glucocorticoid receptor 23, we were interested in evaluating the role of GR in this pathway. Therefore, we co-transfected mouse mammary EPH4 cells with L6-pRL and either an expression vector for the full length GR (GRwt), or a GR expression vector containing a point mutation eliminating the GR DNA binding activity (GR501P). To establish the importance of ligand-binding to GR, renilla luciferase activity was measured in both untreated cells and cells treated with hydrocortisone. GR overexpression caused a significant increase in BRCA1 promoter activity (Fig.20a). This was observed for both

GRwt and GR501P, suggesting that this effect is independent of the ability of GR to bind to DNA. Interestingly, while BRCA1 upregulation was seen in untreated cells, no significant effect of GR addition was observed on BRCA1 promoter activity in treated cells, pointing to a previously unreported ability of GR to regulate transcription in the absence of ligand. In addition, this demonstrates that ligand binding to GR abolishes its stimulatory activity at the BRCA1 promoter.

To further investigate this association, we employed an siRNA vector targeted against GR. Loss of GR caused a corresponding loss in BRCA1 promoter activity in untreated EPH4 cells but had no effect on cells treated with hydrocortisone (Fig.20b).

This re-enforces a role for GR in upregulating BRCA1 expression in the absence of ligand which is thwarted by hydrocortisone addition.

The effect of GR overexpression on BRCA1 promoter activity was also tested in human non-malignant and malignant mammary cells. In non-malignant mammary 184h-

TERT cells, transfection with both GRwt and GR501P caused upregulation of BRCA1, demonstrating a DNA-binding independent GR effect (Fig. 21a). Conversely, GRwt had no effect or a negative effect on BRCA1 promoter activity in MCF7, and SKBR3 malignant mammary cells, respectively (Fig. 21b). This result complements the

2.36 x 1.97x

2.5 no HC HC 2.0 1.5

1.0

0.5

BRCA1 Activity Promoter 0.0 R mpty G 1P E Vector L6 + R50 L6 + G L6 +

1.66 x 1.25 no HC HC 1.00

0.75 0.50

0.25

BRCA1 Activity Promoter 0.00 R L6 + H1 L6 + siG

R iG -s 1 1 H H SP1 1.2 1 0.8 0.6 0.4 GR 0.2

¡ ¡ ¢ £ ¤ ¥ ¦

Figure 20. The glucocorticoid receptor (GR) upregulates BRCA1 promoter activity. a) Non- malignant mouse mammary cells EPH4 were co-transfected with the BRCA1 proximal promoter (L6) and wild-type GR or a DNA-binding GR mutant (GR501P) and were treated with hydrocortisone for 48 hours. Fold activation values are indicated. Significant changes in promoter activity are indicated as: one asterisk, p<0.05, two asterisks, p<0.005. b) EPH4 cells were co-transfected with L6 and an siRNA construct targeted against GR (siGR). c) HeLa cells were transfected with an empty siRNA vector (H1) or a vector directed against the GR gene. Protein lysates were collected and analyzed by western blot. A control antibody against Sp1 or an antibody against GR were used to detect these proteins. Densitometry analysis (Appendix A) for siGR efficiency is shown on the right. Error bars represent standard deviation. Representative experiments are shown out of N=3 (a and b).

differential effect observed with hydrocortisone treatment for non-malignant vs. malignant mouse and human mammary cells.

Traditionally, the glucocorticoid receptor is believed to reside in the cell cytoplasm in the absence of ligand and to only be translocated to the nucleus upon ligand binding. However, our findings imply the presence of GR in the nucleus in the absence of hydrocortisone. In previous work by Brink et al. 55, it was demonstrated that the majority of unliganded receptor is in fact localized within the nucleus when assay conditions are strictly controlled. However, the scope of that study was limited to hepatoma cells. In order to provide biological plausibility for the transfection experiments performed in the work presented here, we proceeded to investigate whether there is glucocorticoid receptor presence in the nucleus of breast cells in the absence of hydrocortisone. To this end, we performed an immunofluorescence assay with EPH4 cells treated and untreated with hydrocortisone, using an antibody targeted against the mouse glucocorticoid receptor. The assay demonstrated that, although a higher concentration of glucocorticoid receptor molecules are translocated to the nucleus upon hydrocortisone treatment, a large amount of receptor is present in the nucleus in the absence of hydrocortisone (Fig. 22).

3.4.4 The effect of hydrocortisone and glucocorticoid receptor presence on

BRCA1 expression differs between ovarian and breast cells.

BRCA1 promoter signaling and expression patterns in sporadic cancer have been shown to be similar between breast and ovarian cells 9,190,196,197. Since BRCA1 down- regulation has been implicated in a number of sporadic ovarian tumours 197, it was of interest to determine whether the BRCA1 gene is a target for hydrocortisone down-

Figure 21. The glucocorticoid receptor up-regulates BRCA1 promoter activity in the absence of ligand and independently of its DNA –binding function in human non-malignant cells. A wild-type construct of the glucocorticoid receptor (GRwt) was co-transfected with the proximal BRCA1 promoter (L6) into a) 184-hTERT non- malignant human mammary cells and b) MCF7 and SKBR malignant human mammary cells. A GR construct containing a mutation in the GR DNA-binding domain was also transfected into 184-hTERT cells to determine the importance of DNA binding in the regulation of BRCA1 by GR. Statistically significant changes in BRCA1 promoter activity are denoted as: two asterisks, p<0.005; three asterisks, p<0005. Error bars represent standard deviation. Representative experiments are shown out of N=3.

regulation in ovarian cells. Therefore, BRCA1 mRNA levels were measured through real-time PCR in non-malignant IOSE-80PC, and in malignant SKOV3 and OVCAR3 human ovarian cells treated with hydrocortisone for 48 hours. In contrast to its effect in human mammary cells, hydrocortisone caused upregulation in the non-malignant IOSE-

80PC cell line and caused down-regulation in the two malignant cell lines (Fig. 23a).

To test whether the BRCA1 promoter in ovarian cells is subject to regulation by the unliganded GR we co-transfected the L6-pRL proximal promoter construct with the

GR expression vector into all three ovarian cell lines. In keeping with the findings for hydrocortisone treatment, GR over-expression resulted in down-regulation of BRCA1 expression in IOSE-80PC cells and upregulation in SKOV3 and OVCAR3 cells (Fig.

23b). These results differ from those obtained for mouse and human mammary cells, and point to differences in the role of BRCA1 in hydrocortisone signaling between breast and ovarian tissues.

3.4.5 Promoter elements involved in regulation of BRCA1 expression by GR.

In previous work we had uncovered some of the BRCA1 promoter elements involved in regulation of the BRCA1 gene by hydrocortisone. These include the RIBS and UP promoter elements. We have demonstrated that binding of the transcription factor

GABPα/β to both sites, and that of the transcription factor USF2 to the UP site is negatively affected by hydrocortisone presence. Since these sites play a role in hydrocortisone signaling to BRCA1, we hypothesized that one or both of those sites may be involved in the upregulation of BRCA1 by GR. Therefore, EPH4 cells were co- transfected with GRwt and L6 constructs containing mutations at the RIBS and UP sites.

Mutations at each site individually and together caused a decrease in GR-induced

80 receptor molecules are seen here as green green (middle). as here are seen receptor molecules Cru antibody (Santa receptor usingglucocorticoid a absence (top row) or presence (bottom row) of hydro row)(bottom of or(top absence presence row) the hydrocortisone. absence of Figure 22. The glucocorticoid receptor is present is present receptor Figureglucocorticoid The 22. EPH4 non-malignant mouse mammary cells were grownwere o cells mouse mammary non-malignant EPH4 Overlap of the two stains is is shown far rig at the twoOverlap stains the of z). DAPI-stained nuclei are seen as blue (left), s (left), as blue are seen DAPI-stainedz). nuclei cortisone. Cells were prepared for immunofluoresen prepared were Cells cortisone. in both the cytoplasm and nucleus of EPH4nucleus cytoplasmce mammary of and the in both n plastic for 48 hours in the the in for hours 48 n plastic ht. tained glucocorticoid glucocorticoid tained ce staining staining ce lls in in lls

upregulation, demonstrating the involvement of these sites in the GR regulatory effect

(Fig.24a). However, upregulation of BRCA1 was not completely eliminated by mutating both elements, suggesting the participation of additional promoter sites. Mutation of both sites together reduced BRCA1 upregulation by a degree similar to that for each site alone, suggesting that the participation of the two promoter elements is not additive.

To confirm that the RIBS and UP sites are GR-responsive, we tested the effect of

GRwt addition on expression vectors containing multimers of each element. Only a minor positive effect was seen on either element outside of the native promoter, suggesting that these sites are less GR-responsive in the absence of other promoter elements (Fig.24b). However, a construct containing both the RIBS site and a downstream CREB site (FRAG1) showed a marked increase in activity in the presence of GR

(Fig.24b). The CREB element has previously been proven to be important for the overall function of the BRCA1 promoter 127,128 and is therefore a likely target for BRCA1 transcriptional regulators. Co-transfection of a multimerized construct containing the

CREB site (BrCREO) with GRwt caused a slight down-regulation in CREB site activity

(Fig.24b).

To further investigate the relative contributions of the RIBS and CREB elements to GR-induced activation of BRCA1 expression, we co-transfected GRwt with a previously identified positive promoter element encompassing both RIBS and CREB

(PRR, nucleotides -198 to -162) 126 , as well as PRR constructs containing mutations at each of the promoter elements (M1 and M2 refer to mutant RIBS and mutant CREB, respectively) or mutations at both (M3). Within the context of the PRR fragment, mutation of the RIBS site caused loss of GR-induced promoter activation (as previously observed), but not mutation of the CREB site (Fig. 24c). Mutation of both sites reduced

Figure 23. Different regulation of the BRCA1 gene by hydrocortisone and the glucocorticoid receptor in ovarian cells. a) Non-malignant IOSE-80PC and malignant SKOV3 and OVCAR3 human ovarian cells were transfected with a renilla luciferase reporter construct under the regulation of the BRCA1 proximal promoter (L6) and were treated with hydrocortisone for 48 hours. b) Ovarian cells were co-transfected with L6 and a glucocorticoid receptor expression vector (GRwt). BRCA1 promoter activity was determined by measuring renilla luciferase activity. Statistically significant changes in BRCA1 promoter activity are denoted as: one asterisk, p<0.05; two asterisks, p<0.005, three asterisks, p<0.0005. Error bars represent standard deviation. Representative experiments are shown out of N=3.

BRCA1 up-regulation to a level similar to that obtained with the RIBS mutation construct. This suggests that the RIBS promoter element is the main mediator of the GR effect on BRCA1 expression. This is consistent with a previously observed lack of protein binding change at the CREB promoter element upon hydrocortisone treatment

(unpublished data). However, the CREB site may be necessary to stabilize the RIBS- binding complex, since in the absence of the CREB site, the RIBS element is not responsive to GR.

3.4.6 GR binds directly to the BRCA1 promoter.

The glucocorticoid receptor is known to regulate target gene expression by either direct ability to bind DNA through GRE sites or by binding to transcription factors. Our work demonstrates that BRCA1 regulation by GR is not dependent on the DNA-binding function of the receptor. In addition, promoter sequence analysis does not identify any known GRE sequences within the BRCA1 promoter. Therefore, GR may affect BRCA1 expression by either direct binding to its promoter through protein-protein interaction, or by affecting the upstream expression of transcriptional regulators of BRCA1. We had previously shown that protein levels of the molecules identified as being involved in hydrocortisone down-regulation of BRCA1 expression (the transcription factors USF2 and GABPα/β) are unaltered by hydrocortisone addition. Thus, we considered it likely that GR exerts its effect on BRCA1 transcriptional activity by interacting with proteins present at the BRCA1 promoter. We tested this by performing a chromatin immunoprecipitation assay (ChIP) using an antibody targeted against GR and oligonucleotide primers designed to amplify the BRCA1 proximal promoter. Preliminary

Figure 24. Promoter elements involved in the GR-induced upregulation of BRCA1 promoter activity. EPH4 cells were co-transfected with the wild-type glucocorticoid receptor and: a) BRCA1 promoter mutant constructs (L6=wild-type, DR=RIBS deletion, USGAm=UP site mutant, DR/USGAm=RIBS deletion and UP site mutation); b) Multimerized RIBS, UP, and CREB (BrCREO) promoter sites, or promoter fragment containing RIBS and CREB elements (FRAG1); c) BRCA1 promoter fragment (PRR=wild-type RIBS and CREB sites, PRR-M1=mutant RIBS, PRR-M2=mutant CREB, PRR-M3=RIBS and CREB double mutant). FRAG1 fragment encompasses nucleotides -204 to -135; PRR fragment encompasses nucleotides -198 to -162. Significant changes in GR transactivation are shown as: one asterisk, p<0.05; two asterisks, p<0.005. Error bars represent standard deviation. Representative experiments are shown out of N=3.

results indicate direct presence of the glucocorticoid receptor at the BRCA1 promoter, although the role of hydrocortisone in GR binding remains to be determined (Fig. 25).

3.5 Discussion

In the work presented here, we have identified the stress hormone hydrocortisone as a regulator of BRCA1 gene expression in human breast and ovarian cells. In addition, we have established that the glucocorticoid receptor is involved in regulating BRCA1 transcription both in the absence and presence of hydrocortisone. This demonstrates a previously unrecognized ability of GR to transregulate gene expression in the absence of its hormone ligand, and contributes to the elucidation of the hydrocortisone signaling pathway involved in BRCA1 regulation.

In previous work we have found that BRCA1 expression is down-regulated by hydrocortisone in mouse mammary cells and that this effect is dependent on the state of cell malignancy 198 . The present study suggests that the BRCA1 promoter is regulated in a similar manner in human mammary cells. Several reports point to parallels in the regulation of the mouse and human BRCA1 genes. Estrogen treatment has been shown to upregulate BRCA1 in both ovariectomized mice 118,199 , and in human estrogen-positive breast cell lines 112,115,116 . The tissue-specific patterns of expression of human BRCA1 are indistinguishable from those of mouse Brca1. Namely, the highest levels of BRCA1 mRNA are found in the thymus and testis, followed by breast and ovarian tissues in both the mouse and human 85,199-201 . Similarly, BRCA1 expression is regulated according to cell cycle progression in both non-tumorigenic mouse mammary cell lines and in human mammary cell lines and primary cells 161,162 . In all of those cell types BRCA1 mRNA expression is highest during the G1/S transition and is lowest during G0 and early G1.

y d 3 R D O A 2 o H G L c H H ib p t A b n 0 A 0 1 o N

O y A D 2 3 L d H H R H o p c G ib b t A 0 0 n 1 A No

Figure 25. The glucocorticoid receptor is present at the BRCA1 promoter. A chromatin immunoprecipitation assay was performed on cells treated with hydrocortisone for 48 hours. Polymerase chain reaction (PCR) assays were performed as follows: Top gel – Tm (annealing temperature) =64°C, 38 PCR cycles; Bottom gel – Tm=64°C, 42 PCR cycles. PCR products were visualized on an agarose gel using ethidium bromide. LD, ladder. H2O, water control. HA, hemoglutinin (negative control). AcH3, acetylated histone 3 (positive control). GR, glucocorticoid receptor.

Finally, the RIBS and UP promoter regions, which we have identified as being involved in the regulation of BRCA1 expression by hydrocortisone, are highly conserved between the mouse and human BRCA1 promoters 109 . In accordance with these findings, we found that the RIBS and UP sites respond similarly to GR overexpression in mouse and human mammary cells.

For both mouse and human cell lines, we observed an effect of cell malignancy on the magnitude and direction of the BRCA1 response to hydrocortisone. We hypothesize that the inability of hydrocortisone to repress the BRCA1 promoter in malignant cells may be due to an already low level of BRCA1 expression in those cells. The BRCA1 promoter may be at a minimal state of activation, which does not allow further down- regulation. For instance, chromatin remodeling may render the promoter inaccessible to glucocorticoid receptor-stimulated transcription factors or to the receptor itself.

Alternatively, the expression of transcription factors involved in GR-induced BRCA1 down-regulation may be altered in the course of cell transformation. Interestingly, hydrocortisone has been shown to cause growth arrest in rat mammary tumour cells 202 . It is tempting to speculate that this effect may be correlated with the increase in BRCA1 levels which we have observed upon hydrocortisone treatment of malignant mammary cells.

An interesting finding of this work is that ovarian cells respond differently to hydrocortisone than breast cells, in terms of BRCA1 expression. Epidemiological evidence suggests that the contribution and involvement of BRCA1 in ovarian cancer development is comparable to its role in breast cancer development. For instance, the presence of a BRCA1 mutation confers a lifetime chance of developing breast cancer of

85%, and of 65% for developing ovarian cancer 151 . Analogously to the case of sporadic

breast cancer, few BRCA1 mutations have been discovered in sporadic ovarian cancers

203-205 , but BRCA1 expression is downregulated in a large proportion of those cases 197 .

In addition, BRCA1 promoter sites key for overall BRCA1 expression in breast cells, such as the RIBS and CREB elements, have been shown to play an equally important role in ovarian cells 196 . However, the factors which contribute to BRCA1 down-regulation in ovarian cells have not been identified. Moreover, no research has been done on the role of reproductive hormones in the regulation of BRCA1 in the ovary. Therefore, it is possible that hormonal factors which affect BRCA1 expression negatively in breast cells have a different effect on the ovarian gene. Our findings suggest that such may be the case for the regulation of BRCA1 gene expression by hydrocortisone. The physiological role of hydrocortisone in ovarian tissue has been postulated to lie in suppressing inflammation triggered by release of the ovum during ovulation 206 . Inflammation, in turn, is thought to play a chief role in the etiology of ovarian cancer 207 . Therefore, hydrocortisone may have a protective effect against ovarian cancer development, which is reflected in its positive effect on BRCA1 expression. This would be in contrast to the contributing role of the hormone in the development of breast cancer 3 and its suppressive effect on BRCA1 expression in non-malignant breast tissue 198 .

In this study we have shown that the glucocorticoid receptor can regulate BRCA1 expression in a ligand-independent manner. Although no previous reports exist regarding the ability of the native GR to participate in transregulation in the absence of hormone, the necessity of ligand binding for GR transactivating activity was examined in a study by

Schmitt et al. with the use of a recombinant GR protein 194 . The authors characterized the recombinant protein as behaving indistinguishably from the authentic GR with respect to

DNA and hormone binding, and tested its ability to transactivate a synthetic

glucocorticoid-responsive promoter, and the mouse mammary tumour virus promoter in the absence of hydrocortisone. Both promoters were up-regulated by GR. Furthermore, the authors demonstrated that both of the transactivation domains of the GR protein, the constitutive activation domain AF1, and the ligand-dependent transactivation domain

AF2, participated in hormone-independent gene regulation. These findings support our observation that GR is capable of stimulating gene expression in the absence of its ligand.

Another contentious issue in GR studies has been the localization of GR molecules in the cell in the absence of hormone. It is required that the glucocorticoid receptor is present in the nucleus in order for it to regulate gene expression. The traditional assumption is that

GR is localized to the cytoplasm in the absence of hormone and then translocates to the nucleus upon ligand binding 53 . In this work we demonstrate that although GR concentration in the nucleus increases upon hydrocortisone addition, some GR does localize to the nucleus in the absence of its ligand. This finding is supported by a study by Brink et al., which demonstrates that the majority of unliganded GR in hepatoma cells is located in the cell nucleus and not in the cell cytoplasm 55 .

We had previously shown that the RIBS and UP BRCA1 promoter elements are necessary for the regulation of BRCA1 expression by hydrocortisone 198 . Here we demonstrate that GR-induced activation of BRCA1 expression in the absence of hydrocortisone is similarly dependent on those two promoter elements. In the context of hydrocortisone addition, the UP site was previously found to be hormone responsive only in the presence of other promoter elements 198 . This was also the case for the transactivation of BRCA1 expression by GR in the present study.

The study presented here identifies the glucocorticoid receptor as a positive regulator of BRCA1 gene expression. The effect of the receptor on BRCA1 promoter

activity is mediated by the RIBS and UP BRCA1 promoter elements and is independent of GR DNA-binding ability. Therefore, we propose that GR interaction with protein complexes present at the above listed promoter sites is responsible for the effect of GR on

BRCA1 expression. In support of this hypothesis is the observation that complexes containing the transcription factor GABPα/β, and the transcription factors GABPα/β and

USF2 are lost from the RIBS and UP promoter sites, respectively, upon hydrocortisone treatment and that this leads to promoter down-regulation 198 . The GR protein may be present in those complexes in the absence of hydrocortisone, and may be recruited away from the promoter, together with its binding partners, upon ligand addition. Cooperation of GR with GABPα/β has been previously demonstrated. In the case of the MMTV

(mouse mammary tumour virus) promoter, GR upregulates gene expression through two

GABP-binding promoter sequences 191 . Importantly, similarly to what we have shown for the BRCA1 promoter, co-expression of GR and GABP causes synergistic activation of the MMTV promoter. Therefore, GABPα/β may act as the DNA-linking protein for GR interaction with the BRCA1 promoter.

Relevant to this investigation is the fact that both GABPα/β and GR are known to physically interact with AP-1 transcription factors 67,208 . Our team has earlier shown that the AP-1 heterodimer Jun/FRA2 binds the CREB BRCA1 promoter site and is involved in BRCA1 regulation (unpublished data). However, here we demonstrate that the CREB site does not have a significant function in the regulation of BRCA1 by GR. Instead, it may have a stabilizing effect on the RIBS-site binding protein complex controlled by hydrocortisone.

The mode of cooperation between the RIBS and UP sites is at this point unclear, since they are located away from each other on the promoter. However, we have

91 RIBS A 1) A 2) GR ? GR GR GABPGABP GABPGABP GABPGR GR USF2GABP GR RIBS UP GABP USF2GABP UP

A 3) A 4) HAT SWI/SNF HAT GR GR GR GR GABPGABP GABPGABP

RIBS UP RIBS UP

B 1) GR HC B 2) GR HC GABP GABP USF2 GR HC GABP HDAC2 GR HC ? RIBS UP RIBS UP

Figure 26. Possible mechanisms of stress signaling at the BRCA1 promoter. In the absence of hydrocortisone (A), the glucocorticoid receptor (GR), which is known to act as a dimer, may be bound to the BRCA1 promoter through its interaction with GABPα/β at either or both the RIBS and UP promoter sites. This leads to activation of the promoter. Binding of GABPα/β to either site has been previously shown to have a positive effect on BRCA1 expression. The complex at the UP site also contains the transcription factor USF2. The GR complexes at the two promoter sites may be linked through yet unidentified proteins with the DNA being in a linear conformation (A1) or through DNA folding (A2). Alternatively in the model shown in (A2), the complexes may interact through binding of two GR molecules. Promoter transactivation by GR may occur through the recruitment of the SWI/SNF chromatin remodeling complex known to bind both the RIBS site and the glucocorticoid receptor (A3), and/or through the recruitment of GR coactivators containing HAT activity (such as CBP, p300, and/or SRC-1) to either or both promoter elements (A4). In the presence of hydrocortisone (B) the RIBS and UP binding complexes are dissociated leading to either recruitment of GR away from the promoter (B1), or a change in GR binding partners at the promoter (B2).

determined that UP protein binding is altered simultaneously with RIBS protein binding upon hydrocortisone treatment 198 . A possible scenario is that DNA folding at the

BRCA1 promoter allows for interaction between the RIBS and UP-binding complexes, linking the two sites. Alternatively, GR may interact separately with each site by binding to DNA-linked GABPα/β. A summary model for GR and hydrocortisone activity at the

BRCA1 promoter is presented in Fig. 26.

The findings presented here provide additional evidence for a role of hydrocortisone signaling in the regulation of BRCA1 gene expression in breast cells.

Stress-induced release of hydrocortisone has been previously shown to contribute to breast cancer development 3, although the manner in which this occurs remains unclear.

In addition, low levels of BRCA1 have been demonstrated in the majority of sporadic breast cancers 9,12 , and suppression of BRCA1 expression in vitro has been shown to lead to cell malignancy 9. Therefore, the negative effect of hydrocortisone on BRCA1 expression may be one of the ways through which stress disrupts regulatory pathways in the breast and promotes cell transformation. Future studies should focus on further elucidating the mechanism of GR signaling to the BRCA1 promoter, and on understanding the dynamics of GR binding to the promoter in the absence and presence of hydrocortisone.

Acknowledgments

This research was supported by an operating grant form the Canadian Breast

Cancer Foundation-Ontario Chapter and by a Fellowship from the Canadian Institute of

Health Research to LA.

CHAPTER 4

DESIGN OF AN EPIDEMIOLOGICAL STUDY LOOKING AT THE EFFECT OF

POLYMORPHISMS IN THE GLUCOCORTIOCOID RECEPTOR GENE ON

BREAST CANCER RISK

Statement of Co-Authorship

This study design was prepared in a CIHR grant format and will be used in a future epidemiological study. The authors are Lilia Antonova, Dr. Kristan Aronson, and

Dr. Christopher R. Mueller. All figures and tables were prepared by me. All sections of the study design were written by me and edited by Dr. Kristan Aronson and Dr.

Christopher R. Mueller.

4.1 Introduction

4.1.1 Research Question

Is there an association between hydrocortisone sensitivity-altering polymorphisms in the glucocorticoid receptor gene and breast cancer risk?

4.1.2 General Background

Breast cancer is the most commonly diagnosed cancer in Canadian women 1. One in nine is expected to develop breast cancer in her lifetime. Despite extensive efforts that have been invested into understanding the risk factors associated with breast cancer development, the etiology of this disease remains largely unknown. Studies have estimated that approximately 50% of breast cancer incidence can be attributed to known

genetic, physiologic or behavioral risk factors 141 . Genetic risk factors account for 5-10% of breast cancer cases and correspond to mutations in genes involved in maintenance of genomic integrity, such as BRCA1, BRCA2, TP53, PTEN and ATM 140 . Established physiological and behavioral risk factors for breast cancer include having a first degree relative with breast cancer, early menarche, late menopause, nulliparity or bearing of first child at a later age, overweight after menopause, certain types of benign breast diseases, alcohol consumption and long term use of menopausal estrogen replacement therapy 142 .

In addition to these well-characterized contributors, other factors, whose level of exposure is more difficult to evaluate, are suspected to confer breast cancer risk. These include smoking, certain aspects of nutrition (meat and fat consumption), physical activity, and psychological stress 209 .

Stress is defined as “an alteration in the body’s hormonal and neuronal secretions caused by the central nervous system in response to a perceived threat” 210 . The response to psychosocial stressors in humans consists of activation of the hypothalamic-pituitary- adrenal axis of hormonal signaling 211 . Corticotropin-releasing hormone produced in the hypothalamus stimulates the release of adrenocorticotropin hormone (ACTH) from the anterior pituitary. ACTH, in turn, signals to the adrenal cortex to produce the hormone hydrocortisone (cortisol). Hydrocortisone generates a physical response to the stress signal by binding to its cytoplasmic receptor, GR, and promoting protein, lipid, and carbohydrate catabolism 212,213 . In its ordinary physiological role, hydrocortisone has protective effects on the organism by regulating immune function, promoting memory of dangerous events, increasing blood pressure and heart rate to meet the physical demands of a fight or flight response, and making fuel available for sustaining increased physical activity 214 . Prolonged stress-response conditions, however, similar to those stimulated by

stressful life events, have been shown to predispose for illnesses such as hypertension, atherosclerosis, osteoporosis, immune dysfunction and cancer in a number of studies

214,146,210 .

Epidemiological research (as summarized in section 4.1.3.1 below) points to a role of stress in the development of breast cancer. However, the epidemiological studies performed to date have been limited to measuring and linking external stress exposure to breast cancer diagnosis. The research proposed here will aim to examine the association between stress and breast cancer risk at the level of intracellular stress signaling with the use of molecular epidemiological techniques. Specifically, a research design will be developed for a study investigating the impact of naturally occurring polymorphisms in the receptor for the stress hormone hydrocortisone, the glucocorticoid receptor, on breast cancer risk. In the following sections, the current epidemiological and molecular knowledge of the association between stress and breast cancer will be presented, and the biological rationale and conceptual model for the proposed study will be outlined. The specific research techniques, study population, and genetic variants to be included in the study will also be described. Finally, the study will be analyzed for its strengths, limitations and possible contributions to research.

4.1.3 Current knowledge on the association between stress and breast cancer

development

4.1.3.1 Epidemiological evidence for a stress - breast cancer association.

A number of epidemiological studies have indicated that the occurrence of stress is correlated with breast cancer. These have been most recently grouped into a meta- analysis by Duijts et al. 3. The authors analyzed studies examining the relationship

between stressful life events and breast cancer risk published between 1966 and

December 2002. They concluded that stressful life event variables significantly associated with breast cancer risk are an increased number of stressful life events [OR

1.77 (95%CI 1.31-2.40)], death of a significant other [OR 1.37 (95%CI 1.10-1.71)], and death of a relative or friend [OR 1.35 (95%CI = 1.09-1.68)]. Prospective design studies included in the analysis showed a higher summary odds ratio than retrospective design studies [ex. OR 2.46 (95%CI=0.98-6.18) and OR 1.93 (95%CI=1.13-3.31) for stressful life events, respectively], which was attributed to the possible presence of recall bias in retrospective studies. In addition, studies which took into account well-established breast cancer risk factors as possible confounders, showed a statistically significant association, as opposed to studies which did not control for such factors [ex. OR=2.22

(95% CI 1.39-3.56) and OR=1.04 (95% CI 0.90-1.20) for stressful life events, respectively]. Therefore, the strongest association was observed in studies that attempted to minimize the effect of measurement bias and confounding.

Since the publishing of the meta-analysis described above, the results of two more prospective cohort studies, whose findings support a correlation between stress and breast cancer risk, have become available. In a study by Helgesson et al., a cohort of 1,462

Swedish women, aged 38-60 years were followed for 24 years 144 . Stress experience for the five years preceding baseline examination, was measured by a questionnaire on a scale of 1 (never experienced mental stress) to 6 (experienced mental stress constantly).

It was subsequently analyzed as a dichotomous variable [stressed (categories 3-6 on the stress scale) vs. not stressed (categories 1-2)] in relation to breast cancer incidence. The age-adjusted relative risk of breast cancer diagnosis for women reporting stress was calculated to be 2.1 (95% CI 1.2-3.7).

The results from this study were strengthened by several factors: selection bias was minimized by a high rate of participation in the study (90.1%) and a very low loss to follow-up (less than 1%); the prospective design ensured a lack of recall bias; possible confounders were taken into account at the time of data analysis and were shown not to affect the stress-breast cancer association significantly. The exposure measurement method required from the study participants to judge their level of stress retrospectively over the five years preceding the study baseline. However, since the outcome status for each participant was not known at that time, any misclassification of exposure status that may have occurred would have been non-differential. Finally, the time of outcome determination following exposure to stress is appropriate considering the time period attributed to breast cancer development (longer than 10 years 215,216 ). Due to these factors, the results of this study are superior to many retrospective designs employed previously. An important limitation of the study is the relatively small sample size, which may have decreased the statistical power of the study, and does not allow for a dose- response measurement of the contribution of stress.

A study by Lillberg et al. examined the association between stressful life events and breast cancer risk in a group of 10,808 Finnish women 2. Data on the number and type of stressful life events to which the participants were exposed in the time prior to baseline was collected through a life event questionnaire in 1981. The time of exposure

(in the five years preceding baseline vs. earlier) was taken into account in the analysis in order to establish a relevant time-frame. Outcome status was determined by identifying incident breast cancer cases for the years 1982-1996. The number of stressful life events was included in the analysis as a continuous variable, whereas the impact of individual stressful life events was calculated as a dichotomous variable in relation to the time of

exposure (in the five years prior to baseline vs. never/earlier). The results of the cohort analysis demonstrated a clear association between the number of stressful life events and breast cancer risk, with the hazard ratio (HR) for breast cancer per one-event increase in the total number of stressful life events being (HR) = 1.07 (95% CI 1.00-1.15). When only major life events were included, the risk estimate increased to 1.35 (95% CI 1.09-

1.67). Independently of the number of life events, the exposure categories divorce/separation, death of a husband, and death of a relative or friend were all associated with breast cancer risk [HR=2.26 (95% CI 1.25-4.07), HR=2.00 (95% CI 1.03-

3.88), and HR=1.36 (95% CI 1.00-1.86), respectively). Interestingly, events that occurred in the 5 years prior to the study baseline, and events that occurred earlier than that were all correlated with breast cancer risk. However, exposure in the 5 years prior to baseline conferred the highest risk. This narrows down the most relevant time of exposure to stress to less than 20 years prior to breast cancer diagnosis. This study shares most of the strengths and limitations attributed to the study by Helgesson et al. due to their similar design. However, an important advantage of the study by Lillberg et al. is the much larger sample size, which minimizes the possibility of random variation in the results. In addition, this study makes important contributions to the general knowledge of the stress- breast cancer relationship. It manages to evaluate the risk associated with particular types of stress and with each additional stressful event. Also, it contributes to the understanding of the timing of stress exposure relevant to breast cancer risk.

A possible disadvantage may be presented by the fact that both of the described studies are limited to populations characteristic of Northern Europe. Therefore, their findings may not apply to North American populations, which exhibit different patterns of behavior and diet. In addition, lifestyle factors were not controlled for in either study.

For example, exercise has stress-reducing effects and is thought to be protective against breast cancer. If it is correlated with both the exposure and outcome of interest, it may be a confounder for the stress-breast cancer association.

Despite some limitations, the prospective cohort studies described here offer convincing evidence for a stress-breast cancer relationship. A number of factors, including their prospective design, the inclusion of possible confounders in the analysis, and their large sample sizes as compared to most case-control designs, lend credibility to the presented results and make the studies superior to previous work. The evidence of an association between stress and breast cancer is further strengthened by the statistical analysis of research to date performed by Duijts et al. This meta-analysis takes under consideration individual study variations, thus accounting for individual study weaknesses, and presents a statistically significant association between the occurrence of specific major stressful life events and breast cancer risk.

4.1.3.2 Molecular models for the effect of stress on breast cancer risk

The molecular or physiological pathways linking prolonged and increased hydrocortisone presence to cancer development are poorly understood. Currently, two theoretical models exist linking stress to intracellular changes impacting cancer risk.

Apoptosis modulation has been suggested as a mechanism to explain the correlation between hydrocortisone and cancer risk 149 . Hydrocortisone is known to induce apoptotic death in cells of the immune system, such as thymocytes, myeloma cells, and peripheral blood lymphocytes 149 . This ability reflects its central anti-inflammatory function. Studies have suggested, however, that in certain nonhematologic tissues, including the mammary gland, ovary, liver and fibroblasts, hydrocortisone has an

100

opposing effect and promotes cell survival by suppressing apoptosis 7. These findings indicate the possibility that, in tissues such as the mammary gland, prolonged exposure to stress may facilitate tumour progression by suppressing the removal of genetically altered cells.

Alternatively, psychological stress has been demonstrated to impair DNA repair capacity in peripheral blood lymphocytes. Levels of an important DNA repair enzyme,

O6-methyl guanine methyltransferase, have been found to be significantly lower in lymphocytes from stressed rats, as compared to those obtained from control rats 148 .

Similarly, a higher rate of DNA mutation occurrence has been found in stressed subjects in both human and animal studies 8,150 . Faulty DNA repair has been previously demonstrated to lead to an increased incidence of cancer 217 , and thus provides a possible causal model for the association of stress with breast cancer.

4.1.4 Biological Background and Biological Mechanism for the Proposed

Research

The effect of hydrocortisone on target genes and, therefore, on the above- described pathways is dependent on the binding of the hormone to its intracellular receptor, glucocorticoid receptor 23 . Intracellular stress signaling begins with the association of hydrocortisone to GR within the cytoplasm of cells, upon which a conformational change in the receptor causes it to dissociate from a multi-protein cytoplasmic complex containing the heat shock proteins hsp-90, hsp-70 and hsp-56 46 .

The liganded GR is then transported into the nucleus where it brings about the definitive effects of the stress signal by regulating the expression of hydrocortisone responsive genes. This is done by either direct binding of GR to consensus recognition elements

101

(GREs) or by binding to transcription factors which regulate the gene of interest, such as

AP-1 and NFkB. Therefore, the strength of the stress response, the intracellular effects of stress signaling, and the effect of stress on risk of disease development (including in the case of breast cancer) are a function of the ability of the receptor to bind its ligand and to affect down-stream gene expression. In cases where GR activity is altered due to mutational changes in its expression or function, anomalous stress signaling is observed resulting in systemic physiological morbidities. This has been demonstrated in both animal and human studies 19-20 . Diminished GR ligand or DNA binding activity causes overcompensation of adrenal signaling resulting in symptoms such as strong obesity, changes in gluconeogenic enzyme regulation, alterations in peripheral T-cell numbers, behaviour, neural responsiveness and spatial memory. Due to the lack of recognized GR activating mutations to date, the impact of such mutations on the organism in periods of stress have not been described. However, glucocorticoid hypersensitivity has been linked to diseases previously associated with increased cortisol production, such as Cushing’s syndrome 218 (characterized by obesity and insulin resistance) and post-traumatic stress disorder 219 .

GR mutation-associated physiological changes are demonstrative of the dependency of HPA-axis signaling on proper function of the glucocorticoid receptor.

They are also of interest since they may represent a biological cause for interindividual differences in stress susceptibility (in terms of disease outcome) which have been observed in epidemiological studies 220-21 . The limited frequency of gene mutations within the population, however, makes it unlikely that they would play an important overall role in deciding which individuals are more susceptible to stress and, as a result, more likely to develop diseases such as cancer.

102

Recently, a number of naturally occurring high frequency glucocorticoid receptor variants have been identified and characterized 19 . As opposed to genetic mutations, these single nucleotide or nucleotide repeat polymorphisms occur, by definition, at a rate higher than 1% within the population and are therefore liable, if affecting GR function, to account for a higher proportion of the stress susceptibility differences observed.

Therefore, some epidemiological studies have focused on measuring the impact of such nucleotide changes on GR activity and expression and on subsequent vulnerability to disease development. Although the role of GR polymorphisms in the etiology of diseases such as coronary heart disease, rheumatoid arthritis, mental disorders, and multiple sclerosis 221,219,222-223 has been examined, research on the importance of such polymorphisms in cancer development is very limited. The effect of GR polymorphisms on breast cancer risk, in particular, is not known.

The proposed biological mechanism for this study is outlined in Figure 27. We predict that naturally occurring genetic variants within the GR gene which increase susceptibility to stress signaling (by enhancing the affinity of the receptor for hydrocortisone or its ability to affect downstream gene expression) would produce an increased risk for breast cancer development. This may be through a decrease in apoptotic ability and/or through loss of DNA repair capacity in breast cells, both of which have been found to occur in periods of stress. Conversely, polymorphisms which reduce stress sensitivity (by making the glucocorticoid receptor incapable of ligand binding or of

103

Study Population Controls Cases Stress-sensitivity increasing GR polymorphisms +

Stress Other Breast Cancer Risk Factors Study Population _ Stress-sensitivity decreasing GR polymorphisms

DNA Repair Genes Pro-Apoptotic Genes

Genomic Instability and Cell Proliferation

Breast Cancer

Figure 27. Biological model for the effect of GR polymorphisms on breast cancer risk. Stress-sensitivity altering polymorphisms strengthen or weaken the physiological response produced during exposure to stress. This, in turn, alters the effect of stress on DNA repair and pro-apoptotic genes, alters the ability of breast cells to maintain genomic stability, and affects the risk of developing breast cancer in response to stress. In this study the proposed biological effect would be reflected by a higher proportion of carriers of stress sensitivity-increasing polymorphisms in the case population as compared to controls, and a higher proportion of carriers of stress-sensitivity-decreasing polymorphisms in the control population as compared to cases.

104

downstream signaling) are expected to have a protective effect against breast cancer.

Therefore, they are predicted to be found at a higher frequency within unaffected individuals.

4.1.5 Conceptual Model for the Effect of GR Polymorphism Presence on Breast

Cancer Development

A conceptual model for the effect of GR polymorphisms on breast cancer development is presented in Figure 28. This model, proposed by Love et al. 224 to describe the phases of breast cancer development, encompasses the various factors contributing to breast cancer progression, and has been modified to include the effect of GR polymorphism presence. It consists of five phases of disease progression, which include: the effect of congenital mutations in genes involved in DNA repair or carcinogen metabolism on breast cancer development; preinitiation set-up (the impact of reproductive events on the level of differentiation of breast cells and consequently on gene expression in those cells), initiation (acquisition of a DNA change in a sentinel gene, leading to cell transformation), promotion (the effect of estrogenic hormones on the proliferation of transformed cells), and progression (acquisition of DNA changes which turn transformed breast cells from quiescent to nonquiescent behavior including unrestrained growth, invasiveness, and metastagenicity). In the scope of this model, stress-response enhancing

GR polymorphisms may contribute to breast cancer development at two different stages: initiation, and progression.

At the stage of initiation DNA changes occur in sentinel genes. Since stress exposure has been suggested to impact the process of DNA repair, stress may affect the expression of DNA repair genes. This, in turn, may allow for random DNA changes in

105

other genes to remain uncorrected and to be propagated through mitosis, leading to cell transformation. In this way, stress may also contribute to the process of tumour progression, where unrestricted proliferation of genetic mutations allows for the acquisition of malignant characteristics. In our own research, we have observed that the stress hormone hydrocortisone down-regulates the expression of the tumour suppressor gene BRCA1. Low levels of BRCA1 expression have, in turn, been correlated with loss of DNA repair 225,226 , and with breast cell malignancy 9. Therefore, genetic variations in the glucocorticoid receptor gene, which increase the impact of intracellular stress signaling, may cause a more efficient silencing of DNA repair pathways, thus promoting tumorigenesis.

An epidemiological study by Lillberg et al. 2 determined that breast cancer risk is most strongly correlated with stress exposure which has occurred in the 20 years prior to breast cancer diagnosis. This may be a factor of the process of breast cancer development, estimated to occur over 10-20 years 215,216 . Therefore, the period of time between the impact of glucocorticoid receptor polymorphism presence on breast cancer initiation and the diagnosis of clinically detectable disease is indicated in the conceptual model figure as less than 20 years.

4.1.6 Rationale for the Proposed Research

Glucocorticoid receptor polymorphisms represent an unexplored aspect of the stress – breast cancer association. It is conceivable that the efficiency of GR signaling, as determined by the polymorphism signature of its gene, would have an important impact on breast cancer risk due to the key role of GR in the stress response and the demonstrated effect of stress on breast cancer risk. Research in this area may allow the

106

physiologic changes defining Phase Major

al. et fromLove GRp of the effect model Figurefor Conceptual 28. Congenital mutations in metabolism DNA repairDNA carcinogen (germ cell)(germ involved ininvolved

Inherited genetic genes and and

30 ).

Pre-initiation of breastcells of events on events the differentiation expression in consequently reproductive those cells those Impact Impact of Set-up on geneon level of and and

Initiation acquired or change(s) cells that cellsthat epithelial in in breast inherited Sentinel canbe olymorphisms on breast cancer development (as modified (as olymorphismsdevelopment breast cancer on DNA

GR polymorphismsGR

Promotion to estrogenic to proliferation in response in < < 20years breast cell breast hormones Increased rates of

Progression and and metastatic of malignancy:of characteristics pre-malignant Defining DNA invasiveness unrestrained change(s) in breastcells, leading to potential growth,

Detectable Clinically Disease

107

identification of a subset of the population which is more sensitive to stress signaling and therefore more prone to developing breast cancer in response to stress. This, in turn, would facilitate future studies in the area of stress and breast cancer by allowing them to be targeted at only the susceptible population, and would provide evidence towards the direct involvement of GR in breast cancer development.

4.1.7 Objective

To determine if naturally occurring glucocorticoid receptor variants that alter hydrocortisone sensitivity have an effect on breast cancer risk.

4.2 Study Design

4.2.1 Overview

A case-control study design is being proposed to address this objective. Breast cancer risk associated with specific variations in the glucocorticoid receptor gene will be estimated within a nested case-control study among women in the Ontario Familial Breast

Cancer Registry (OFBCR) 227-229. Frequency of occurrence of all polymorphisms of interest will be estimated in the case and control populations selected for this study.

The OFBCR is a part of a collaboration of six academic and research institutions and their affiliates in Canada, the USA, and Australia, which was established in 1995 228 .

The purpose of the collaboration is to develop a comprehensive family-based registry of families at high risk for breast cancer in order to research the epidemiological, clinical, and genetic aspects of breast cancer. The Ontario Registry, in particular, aims to provide a representative sample of breast cancer cases and controls from the general population.

108

Incident invasive breast cancer cases for OFBCR are derived from the Ontario Cancer

Registry 228 which has been well-characterized and boasts over 97% case representation

230 , and controls are derived from family members, and from the general population. The

Registry is referred to as familial, since in addition to population controls data, it also contains epidemiological and biological data for the relatives of the incident breast cancer cases included in the registry. For the purpose of this study, it is important to note that both cases with or without familial breast cancer history were included in the database, and that participation in the registry was shown not to be affected by the presence of such history 227 . Therefore, the database contains a sample of sporadic breast cancer cases representative of the general Ontario population.

The aim of the OFBCR database was to identify incident cases of breast cancer diagnosed between 1996 and 1998 in all women aged 20 to 54 years, and a random 35% sample of women aged 55-69 years. From the approached women, 67% agreed to participate in the database 228 . All of the participants were given a family history questionnaire. Cases who could be classified as coming from high risk families were all included in the database. In addition, a 25% random sample of sporadic cases was included. All selected cases were asked to fill out epidemiologic (common breast cancer risk factors) and diet questionnaires and to provide blood samples. Of those showing a family history, 66% of cases provided a biological sample. Among sporadic cases, 63% agreed to give blood. Therefore, no statistically significant difference was observed for the two groups 227 . Importantly, Epstein-Barr virus-transformed lymphoblastoid cell lines were established for all blood samples, in order to ensure an unlimited supply of genetic material. In addition, the biological samples obtained were genotyped for BRCA1 and

BRCA2 mutations.

109

Population-based controls for the registry were sampled randomly using lists of randomly selected residential telephone numbers. Eligible controls were women with no history of breast cancer, who were less than 55 years of age, and who were frequency matched on 5-year age groups to the age distribution of the entire OFBCR case population. Questionnaire data was received from 73% of contacted eligible women, and blood was obtained from 52.4% of those contacted. From women who consented to give a biological sample, a random proportion approximating 50% was asked to do so.

The level to which the OFBCR represents the general population of Ontario was investigated in two separate studies 227,231 . It was found that even though the level of response of registry participants was lower than expected at certain stages of recruitment, there is no evidence of systematic differences in accordance to age, genetic, or family history factors, in terms of study participation. The only difference observed was for ethnicity, with Caucasian women being more likely to respond. Therefore, the Registry was judged to be representative of the Caucasian population of Ontario. This finding suggests a lack of major selection bias associated with the recruitment process.

OFBCR represents an ideal source of cases and controls for this research study, since it includes blood samples for all cases and controls. Therefore, exposure measurement (genetic testing for polymorphisms of interest) will be done on previously obtained biological material, minimizing the cost and time requirements. In addition, the registry includes family history information, clinical data, and information on most major breast cancer risk factors which can be used for participant selection, for age-matching of controls to cases and for control of potential confounding factors.

Inherent to the design of this study is the necessity to have a sufficient number of participants to detect expected odds ratios for a number of different polymorphisms with

110

a pre-set statistical power. To assure that enough individuals are included to achieve that goal, the number of cases and controls should be selected based on a statistical power calculation for the polymorphism with the lowest frequency occurrence in the general population and odds ratios available in the literature for this polymorphism with respect to breast cancer risk. However, the polymorphisms examined in this study have not been previously looked at in relation to breast cancer risk (with the exception of the D5S207 polymorphism). Therefore, odds ratios from previous studies are not available. A decision on sample size will be based on a table containing several possible odds ratios in a range considered appropriate, and the frequency for the least common polymorphism

(N363S).

Odds ratios for the presence of each polymorphism and corresponding breast cancer risk will be calculated after exposure and outcome determination. Individual information on strong risk factors for breast cancer will be obtained from OFBCR records and will be included in a multivariate logistic regression analysis to control for possible confounding.

4.2.2 Sampling

4.2.2.1 Source population

The source population for this research study is women from the general population of Ontario recruited in the OFBCR, who are Caucasian (polymorphism frequencies often differ between races and most GR polymorphism studies to date have been done on Caucasian populations), are less than 55 years old (since population-based controls are available only for this age group), have no identified genetic mutations in

111

breast cancer associated genes (mutations BRCA1 and BRCA2 have been shown to be very strongly associated with breast cancer risk and are likely to overshadow the more subtle effect of polymorphisms on breast cancer risk), and have no history of previous malignancy, except for in situ cervical carcinoma or non-melanoma skin cancer (both of these have been shown to be unrelated to breast cancer risk 232 ).

4.2.2.2 Cases

Cases classified as sporadic in the OFBCR (no family history of breast cancer), less than 55 years of age at the time of diagnoses, and meeting the above-described criteria will be asked permission for inclusion in this study. Due to the number of available participants in the database for that time period, it is likely that all eligible cases who agree will be included in the study.

4.2.2.3 Controls

For the purpose of this study, the same number of controls will be selected as number of cases. The selection will be based on the criteria described for the source population above. Controls will be frequency matched to cases on the basis of age.

Controls who refuse participation will be replaced with another eligible control chosen randomly from all appropriate controls.

4.2.3 Exposure measurement

Genotyping will be done on Epstein-Barr virus-transformed lymphoblastoid cell lines previously established by the OFBCR for all cases and controls. Due to the necessity of assaying a large number of samples for a number of polymorphisms, a high

112

though-put genotyping assay will be used, such as the molecular-inversion probe (MIP)

PCR-based assay 233 . This assay uses circularized probes which anneal both upstream and downstream of the desired polymorphisms, thus conferring high specificity. A large number of genotyping reactions can be carried out in the same process, which dramatically reduces assay time.

To ensure that no measurement error is present, following data collection, genotypic frequencies for each tested polymorphism will be assessed for conformance to the Hardy-Weinberg equilibrium.

4.2.3.1 Selection of Polymorphisms to be Tested

The GR gene is located on chromosome 5 (locus 5q31), is approximately 80kb long and contains 9 exons (Figure 29). Exon 2 codes for the N-terminal transactivation domain of the protein, exons 3 and 4 for the DNA binding domain, and exons 5-9 for the

C-terminal ligand binding domain 24 . The majority of identified polymorphisms are located within the transactivation domain-coding part of the GR gene. A total of 18 single nucleotide polymorphisms (SNPs) have been identified 19,20 . Also, a dinucleotide repeat located within 200kb of the GR locus is suspected to be linked to a polymorphism within the GR locus and has been implicated in the development of breast cancer 234 .

Four GR haplotypes have been identified and determined to account for 95% of the population 21 . One of these was found to confer enhanced sensitivity to hydrocortisone.

The genetic variants chosen to be included in the current study are those considered likely to cause phenotypic changes in the organism. Such polymorphisms or haplotypes have been previously associated with altered GR signaling, or have been linked to disease susceptibility. Of specific interest are genetic variants associated with

113

5’ 3’

1 2 3 4 5 6 7 8 9α

Tth111L BclI - 22 C/A E22E N363S R23K

Figure 29. Structure of the glucocorticoid receptor (GR) gene and GR function- altering polymorphisms. Numbers indicate gene exons. Exon 9 can be alternatively spliced producing an active alpha and a beta isoform which is incapable of binding ligand. Polymorphisms which may affect GR function are shown below the gene. The beta splice variant contains one additional genetic variant (9β ATTTA) in its 3’ untranslated region (not shown).

114

an increase in GR sensitivity to glucocorticoids, since such polymorphisms are expected to promote the effects of stress on target cells, such as those in the breast. On the basis of this criterion the following six polymorphic variants were selected for investigation

(summarized in Table 2):

a) Genetic variants associated with increased hydrocortisone sensitivity:

• Asp363Ser SNP This single nucleotide polymorphism (SNP) was originally

identified by Koper et al. (1997) 235 in a population of 216 participants at a rate

of 6% for the heterozygous genotype. It consists of an ATT to GTT point

mutation at nucleotide position 1220 (3’ region of Exon 2), resulting in an

aspartic acid to serine change at codon 363 of the glucocorticoid receptor.

Asp363Ser was found to be correlated with increased GR sensitivity to

glucocorticoid signaling in the original study population 218 . Later, this effect

was linked to an increased transactivation capacity of the GR protein 236 . The

change in sensitivity conferred by the polymorphism was associated with a

number of metabolic changes, including an increased body mass index

218,220,237 , lowered bone mineral density 218 , high cholesterol levels 220,238 ,

coronary artery disease 238 , and obesity 239 . Although, this polymorphism has

been identified at a frequency ranging between 3 and 7% in different Caucasian

study populations, it has not been found to occur in Japanese or Chinese study

populations 240,241 .

• Bcl I RFLP This is the only polymorphism other than Asp363Ser that has

been clearly correlated with increased hydrocortisone sensitivity 242 . It was

originally identified by Murray et al. 243 as a restriction fragment length

115

polymorphism (RFLP) with the use of the Bcl I restriction enzyme. Later, this

variant was determined to consist of a C to G mutation located 646 nucleotides

downstream from Exon 2 (within Intron B) 242 and to be present at a very high

frequency (35%-45%) within Caucasian populations 20 . Bcl I has been linked

with physiological changes such as: hyperinsulimia 244 , hypertension 245 ,

increased abdominal visceral fat 246-248 , and higher cortisol levels 247 .

• GAT Haplotype Haplotypes are combinations of polymorphisms occurring

together in linkage disequilibrium 249 . Such are commonly found in

chromosomal regions of low recombination frequency. The use of haplotypes

in association studies, as opposed to use of individual polymorphisms, is

thought to increase the power of a study by demonstrating the combined effects

of all polymorphisms present within the haplotype 21 . A comprehensive

haplotype pattern mining analysis of the GR gene was carried out by Stevens et

al. 21 The authors were able to identify four haplotypes that accounted for 95%

of the 216-person Caucasian study population. One of these haplotypes, GAT,

was found to be significantly correlated with increased glucocorticoid

sensitivity. It consists of three polymorphisms within the Intron B region: the

G allele of Bcl I, the A allele of intron B 33389, and the T allele of intron B

33388. This haplotype was found in 41% of individuals in the highest quartile

of hydrocortisone sensitivity, compared to 23% in all other quartiles combined

(OR 2.4, 95% CI 0.9-6.3). Relevant to this study is the determination of the

intron B 33389 A allele as a haplotype tagging SNP. Thus, testing for this

variant alone during exposure measurements should be sufficient to identify the

entire GAT haplotype in study subjects.

116

• D5S207 Dinucleotide Repeat D5S207 is a highly polymorphic dinucleotide

CA repeat situated at chromosome location 5q31.3-33.3, within 200kb of the

glucocorticoid receptor locus. Curran et al. 234 identified 6 possible alleles

ranging in size from 127 to 137 base pairs in 100 breast cancer cases and 100

controls. The authors found a significant correlation between alleles with high

number of dinucleotide repeats (designated alleles 5 and 6) and increased

breast cancer risk (χ 2 = 17.66, p = 3x10 -5). Although this polymorphic site has

not been associated with altered hydrocortisone sensitivity, it is of interest due

to its proximity to the GR locus and to its correlation with breast cancer risk.

Curran et al. hypothesize that the D5S207 may occur in linkage disequilibrium

with a polymorphism located within the GR locus and thus may actually be a

marker for the effect of a GR polymorphism on breast cancer risk. b) Genetic variants associated with decreased hydrocortisone sensitivity:

• ER22/23EK A polymorphism located in exon 2 of the GR gene was described

by Koper et al. 235 . This variant was found to consist of two linked single

nucleotide mutations located in codons 22 and 23 within the transactivation

domain of the GR protein. The codon 22 mutation does not produce an amino

acid change (GAG to GAA, both coding for glutamic acid). The mutation in

codon 23, however, is non-synonymous, resulting in an arginine to lysine

change (AGG to AAG). ER22/23EK has been associated with glucocorticoid

resistance 250 , and positive physiological parameters such as: lower fasting

insulin levels 250 , increased insulin sensitivity 250 , lower total and low-density

lipoprotein cholesterol levels 250 , lower C-reactive protein levels 251 , lower

117

waist circumference in females 252 , and better survival in elderly men 251 . It was recently determined that these metabolic characteristics may be a product of a significant reduction in the transactivating capacity of the GR protein 236 .

Interestingly, in addition to its individual effects on stress signaling,

ER22/23EK was found to occur in conjunction with two other polymorphisms which have been separately tested for hydrocortisone responsiveness. Those are Tth111L, and Exon 9β ATTTA.

The Tth111L variant is a restriction fragment length polymorphism characterized as a C to T mutation located 3807 base pairs upstream from the

GR mRNA start site, within the promoter of the GR gene 23 . In a study of 209

Caucasians, it was found that although Tth111L can occur on its own, all

ER22/23EK carriers exhibited the Tth111L polymorphism as well 23 . In addition, carriers of both variants had the metabolic profile and lack of hydrocortisone sensitivity characteristic of ER22/23EK, whereas Tth111L was not correlated with phenotypic changes.

The second polymorphism linked to ER22/23EK is Exon 9β ATTTA.

This is an A to G mutation located in the 3’UTR (untranslated region) of the β mRNA splice variant of the GR gene. The protein product of this variant

(GRβ) is incapable of binding hydrocortisone and is transcriptionally inactive.

Thus, it has been shown to act as a dominant negative inhibitor of GRα transactivation activity. The 9β ATTTA polymorphism is located within an

ATTTA motif known to destabilize mRNA, and has been shown to cause increased mRNA stability and protein expression of the GRβ isoform.

Therefore, it reduces GRα activity by increasing GRβ expression. More

118

specifically, it has been found to produce a decrease in transrepressing activity

of the GRα receptor 253 . Similarly to the Tth111L polymorphism, however,

this intracellular effect does not produce any physiological changes unless the

9β ATTTA polymorphism occurs together with the ER22/23EK variant 253 . 9β

ATTTA and ER22/23EK were determined to occur in linkage disequilibrium

and to result in metabolic alterations associated with the ER22/23EK

polymorphism.

Therefore, the three GR gene variants ER22/23EK, Tth111L, and 9β

ATTTA, appear to form a haplotype responsible for loss of GR responsiveness

to hydrocortisone. Since ER22/23EK has been shown to be the polymorphism

with active physiological effects, it will be the genetic variant tested for in this

part of the study.

• -22C/A SNP This genetic variant is located within the promoter region of the

GR gene. Since it was recently identified 240, it has not yet been tested for

physiological effects on the organism. However, in vitro it has been correlated

with decreased GR promoter activity 240 . Therefore, it is likely to result in

decreased hydrocortisone sensitivity.

119

Polymorphism Location Frequency Effect on GR Systemic Phenotypic Of Allele Function or Effects Expression increased linked to increased insulin hydrocortisone response, increased waist- sensitivity; to-hip ratio, coronary artery Asp363Ser codon 363 3-7% increase in disease and several other transactivating cardiovascular risk factors capacity of the 24 236 ; receptor ; increased linked to abdominal obesity, Bcl I intron B 35-45% hydrocortisone increased insulin levels, sensitivity 23 ; lower lean body mass 23 ; increased GAT Haplotype Intron B 14.6% hydrocortisone unknown sensitivity 21 ; dinucleotide repeat 31.5% for alleles with higher number of approximately allele 5; dinucleotide repeats linked D5S207 unknown 200kb 9.5% for to breast cancer upstream of GR allele 6 susceptibility 234 ; locus; decreased resistance to hydrocortisone hydrocortisone, better sensitivity; insulin sensitivity, lower total SNP in codons ER22/23EK 4% reduction in and low-density lipoprotein 22 and 23 transactivating cholesterol levels, lower C- capacity of the reactive protein levels, receptor 236 ; longevity 236 ; associated with upstream significantly -22C/A region of GR ~ 4% unknown lower GR gene promoter activity 240 ;

Table 2. Glucocorticoid receptor locus polymorphisms to be included in the study. Variants associated with increased glucocorticoid sensitivity are shown in red, and those associated with decreased sensitivity are shown in blue.

120

4.2.4 Power Calculation

The polymorphisms selected to be included in this study have not been looked at with respect to breast cancer risk previously (with the exception of the D5S207 microsatellite polymorphism located outside of the GR locus). Therefore, several odds ratios will be used to construct a table for possible numbers of necessary subjects (Table

3). These range from OR = 1.3 to OR = 1.7. This range of odds ratios was selected based on:

1. The hypothesis for this study predicts that polymorphisms that affect

GR function would affect breast cancer risk because of the key role of

GR in stress signaling. GR polymorphisms are expected to be a

measure for susceptibility to stress, and the existence of such a

susceptible population may account for inter-study variation in results

among stress-breast cancer association studies. Therefore, the

measures of association found for exposure to stress and breast cancer

risk may be comparable to those to be found for GR polymorphisms

and breast cancer risk. As described previously, odds ratios for

stressful life events and breast cancer range between 1.35 and 1.77 3.

2. Odds ratios for associations of GR polymorphisms with conditions

other than cancer, such as multiple sclerosis and chronic fatigue

syndrome range between 1.21 and 3.0 254,255 .

3. At certain periods of mammary gland differentiation, the prolactin

receptor has a similar effect to the glucocorticoid receptor on

mammary gland cells 5,256,257 . We hypothesized that the prolactin

121

Predicted Odds Ratio Number of Cases to be Included in Study

1.3 5255

1.4 3117

1.5 2083

1.6 1506

1.7 1152

Table 3. Number of cases to be included in the study for various predicted odds ratios. Calculations are based on same number of cases as controls, 80% power, and 0.05 statistical significance.

122

receptor may be a good model for a hormone receptor in the breast that

is not directly related to ovarian hormone function (similarly to

hydrocortisone) and that risk found for polymorphisms in the prolactin

receptor gene may provide an example of the magnitude of risk that

can be produced by polymorphisms in such a receptor. Only one study

has been done to date on prolactin receptor polymorphisms 33 . The

odds ratios calculated for different genetic variants associated with an

increased breast cancer risk ranged between 1.42 and 2.09.

A sample calculation for the number of cases and controls to be included in the study in order to achieve sufficient statistical power is shown on the following page:

123

2 2 r (٭ n cases = (Z α/2 + Z β) pَ (1 - p)َ (r + 1) / (d

Parameter Description Value Odds Ratio Sample odds ratio 1.5 (OR)

Z β Value of the standard normal distribution For 80% power, corresponding to a selected power for the study Z β = 0.84

Z α/2 Value of the standard normal deviate For α = 0.05, Z α/2 = 1.96 corresponding to a specified significance level r Ratio of number of controls to cases 1

p0 Exposure proportion among controls 0.04 for N363S polymorphism

p1 Exposure proportion among cases p1 = p0 OR / [1 + p 0 (OR – 1)] p1 = 0.04 (1.5) / 1 + 0.04 (1.5 – 1) p1 = 0.0588

(pَ Weighted average of p 1 and p 0 pَ = (p 1 + r p 0) / (1 + r pَ = [0.0588 + (1) (0.04)] / 1 + 1 pَ = 0.0494

p 1 - p 0 = ٭Difference in proportions d ٭d 0.04 – 0.0588 = ٭d 0.0188 = ٭d

2 2 n cases = (1.96 + 0.84) (0.0525) (1 – 0.0525) (1 + 1)/ (0.0188) (1)

= 2083.

Therefore, for an expected odds ratio of 1.5 with 80% power, 0.05 statistical significance, and a frequency of polymorphism distribution of 4%, 2083 cases and 2083 controls need to be included in the study.

124

4.2.5 Analysis

Data obtained in this study will be classified into two exposure categories for the purpose of statistical analysis. These are: non-carriers (homozygous wildtype), and polymorphism carriers (combines heterozygous individuals, and homozygous polymorphic individuals). The latter category encompasses heterozygous and homozygous polymorphic individuals in order to ensure sufficient statistical power for all polymorphisms tested (including less frequent ones). For more frequent polymorphisms, heterozygous carriers and homozygous polymorphic study participants will be compared to non-carriers separately. Unconditional logistic regression analysis with a program such as the Statistical Analysis System will be used to calculate age-adjusted odds ratios and

95% confidence intervals to significance of p < 0.05. Since the outcome of interest is relatively rare within the base population, the odds ratio will be an estimate of relative risk. Adjusted odds ratios will be calculated by taking into account possible confounders using a stepwise backward elimination procedure based on a 10% change in the odds ratio for the exposure of interest and breast cancer risk 258 . Potential confounders to be included in the multivariate analysis are known strong risk factors for breast cancer: history of benign breast disease, early menarche, age at menopause, use of oral contraceptives, and obesity. Menopausal status will not be included in the analysis since only women aged under 55 years old will be included in the study.

4.3 Study Strengths and Limitations

The strength of a study design can be judged based on the amount of potential systematic error (bias) present. Bias affecting the validity of studies involving genetic

125

polymorphisms can be classified in the same way as that found in traditional epidemiological studies, and can be grouped into three classes: selection bias, information bias, and confounding 259 .

4.3.1 Selection Bias

Selection bias occurs when the characteristics of the subjects selected for the study differ systematically from those in the underlying population, or when the case and control groups are selected from different populations. Selection bias is minimized when controls are selected randomly from the underlying population and show a high participation rate. OFBCR controls were chosen from the general population of Ontario, the base population for cases included in the Registry, and were selected by random calling. Participation rate was likely affected to a certain extent by the necessity of biological sample collection, resulting in 52.4% of contacted potential controls submitting both blood and a lifestyle questionnaire. However, response rates were considered to meet the expected criteria for the Registry 228 , and were shown not to be affected by age, sex, genetic, or family history factors 227,231 . Therefore, the controls included in the

Registry are considered to be representative of the Caucasian population of Ontario from which cases arose. In addition, a number of polymorphism studies have already been performed successfully with the use of these population controls 260-263 .

The exposure of interest, namely presence of GR polymorphisms, is a genetic marker, and is unlikely to affect participation in the study. Therefore, it is not expected to contribute to selection bias.

126

4.3.2 Information Bias

Information bias is defined as misclassification of the study participants with respect to disease or exposure status 259 . In the present study possible sources of information bias are errors in genotyping (determination of exposure) and errors in disease status determination at the time of data collection. The MIT genotyping technique described above has been shown to have 99% accuracy 264 . To confirm assay accuracy, however, a random selection of DNA samples from proposed polymorphism carriers and a corresponding number of samples from non-carriers will be sequenced. In previous polymorphism studies based on the OFBCR database, regenotyping by sequencing or other methods was performed on 10% of DNA samples 260,261 . Therefore, the chance of genotyping error is less than 1%, will be non-differential between cases and controls, and is not likely to contribute to information bias.

Disease status for cases has been previously validated from pathology reports for

OCR 265 , and is therefore unlikely to contribute to misclassification. Disease status for population-based controls was determined by an initial phone-interview to determine eligibility for the study, and by the subsequent completion of a questionnaire asking about personal and family history of breast and other cancers. Validation for this questionnaire is not available. However, previous evidence demonstrates that personal history of breast cancer is unlikely to be misreported 266 . Factors on personal and family history are being followed up for both cases and controls on an annual basis through the re-mailing of the family history questionnaire. Data from these questionnaires will be used to confirm that controls continue to be free of breast cancer at the time of the study. Controls who have been diagnosed with breast cancer will be excluded from the study, since they may have

127

been in the stages of early disease development at the time of data collection by the registry. Such controls will be replaced with other suitable controls according to the criteria described in section 4.2.2.

4.3.3 Confounding

Confounding is defined as a non-comparability between exposed and non-exposed groups due to inherent differences in background disease risk 259 . A factor is considered a confounder if it is predictive of the disease of interest in the absence of the exposure of interest, is associated with the exposure and is not in the causal pathway between exposure and outcome. Although confounding may play a role in polymorphism studies looking at genotype-produced phenotypic differences, it is not likely to play a role in studies in which the polymorphic genotype itself is of interest. This is because common disease risks are not likely to affect inherited genotypic variation. Confounding, therefore, is not expected to affect the validity of this study. However, since information about risk exposure is readily available from OFBCR for all study participants, exposure to common breast cancer risk factors will be taken into account at the analysis stage of the study. Glucocorticoid receptor signaling has not been correlated with age at menarche and has not been shown to be affected by oral contraceptive use. Similarly, stress has not been correlated with benign breast disease. Therefore, these factors are unlikely to affect the association under study and will not be examined as potential confounders.

An important risk factor for breast cancer is obesity. Since hydrocortisone signaling affects certain metabolic functions, it is possible that aberrant GR activity may result in obesity and thus affect breast cancer development. This factor, then, would be a

128

part of the causal pathway, would not produce confounding bias, and will not be included as a confounder in the analysis.

4.3.4 The effect of stress exposure on the possible association between GR polymorphisms and breast cancer risk

An important factor to discuss in the design of this study is the involvement of stress in the possible association between GR polymorphism presence and breast cancer risk. In future studies, stress can be included as an exposure variable and the presence of a gene-environment interaction between stress and GR polymorphisms in relation to breast cancer risk can be examined. Such a study can be performed as a case-only study.

However, the current study focuses on the effect of GR polymorphisms only. This decision was made for several reasons:

- Most importantly, we were interested in the effect of GR polymorphisms alone,

since that would establish a never-before tested association between intracellular

stress signaling and breast cancer risk.

- Information about stress exposure was not included in the OFBCR

questionnaires. Obtainment of such information would require the construction

and validation of a separate questionnaire, and the obtainment of data from both

cases and controls with regard to that exposure. Therefore, such a process is

associated with large time and cost requirements. In addition, such data would be

very prone to recall bias due to possible awareness of the association between

stress and disease development.

- In a number of GR polymorphism studies, polymorphism presence was shown

to be correlated with disease development without taking into account stress

129

exposure. Notably, the disease outcomes in question had been previously

associated with stress. This indicates that the effect of GR polymorphisms alone

produces a detectable effect on stress-related disease risks, which is independent

of stress exposure.

In summary, an effect is expected to be observed of GR polymorphism presence on breast cancer risk which is separate from the effect of exposure to stress. In the case of gene-environment interactions, different odds ratios are obtained for the exposure- outcome of interest across strata of the additional factor. Therefore, in the study presented here, if such an interaction is present, two different odds ratios would be obtained for GR polymorphism presence and breast cancer risk when stressed and not- stressed individuals are considered separately. In such a case, the inclusion of both stress and stress susceptibility-inducing GR polymorphisms in the analysis would be expected to generate an additive effect and to result in the obtainment of a higher odds ratio result.

Not including stress in this design, therefore, may bias the result estimate towards the null rather than leading to overestimation. On the basis of previous research studies involving

GR polymorphisms, the effect of such polymorphisms alone is, nevertheless, expected to produce detectable results.

4.3.5 Summary of strengths and limitations

The strengths of the proposed study include:

• The use of a breast cancer registry containing a high quality of

information and in which the effect of biases has been estimated.

130

• Minimal information and confounding bias due to validation of

exposure measurement through sequencing, validation of disease

status during construction of the Registry, use of definitive

exposure variants (genetic markers), and control for potential

confounders in the statistical analysis.

• Cost- and time- efficiency due to the availability of previously

collected biological samples and risk exposure information,

including information on genes correlated with breast cancer

susceptibility.

• Novelty of proposed research. Despite a number of studies

addressing the link between stress and breast cancer, there is a lack

of studies looking at genetic predisposition in stress signaling and

breast cancer. The results of the study may also address inter-

study variation for the association between breast cancer and

stress, since previous studies would not have included

classification of study participants into stress-susceptible and non-

susceptible.

Limitations of the study include:

• Possible selection bias due to low response rate among controls.

• Possible inability to compare the effect of polymorphism

homozygosity and heterozygosity for all polymorphisms due to

insufficient number of participants.

131

• Lack of previous studies which can be used for determination of

the magnitude of the expected association.

• Possible obscurement of results by stress acting as an effect

modifier.

• Limitation of study results to Caucasian population in Ontario only.

4.4 Summary and Contributions of Research

The study proposed here examines a possible link between naturally occurring variants in the receptor for the stress hormone hydrocortisone and breast cancer risk.

Epidemiological studies have previously demonstrated a link between exposure to stressful life events and breast cancer development. However, a need exists for understanding the molecular mechanisms involved, and for minimizing the inter-study variation found in most previous research. We believe that the current study will address both of these issues by proposing a molecular mechanism for genetic susceptibility to stress and subsequent breast cancer development, and by allowing the isolation of a highly susceptible sub-population of individuals in future epidemiological studies.

Polymorphisms in the glucocorticoid receptor gene have been previously shown to affect sensitivity to stress signaling and have been correlated with disease development, while their role in cancer in general, and breast cancer in particular, is largely unknown.

Only one study exists to date that has looked at the GR locus specifically in this context.

Curran et al. 234 demonstrate a link between a polymorphic site (D5S207) and breast cancer risk. Although not located within the GR gene, D5S207 has been shown to be closely linked to it, and thus demonstrates the plausibility of a link between GR locus

132

genotype and breast cancer. In a more recent study by Hunter et al. 267 , 528,173 genome- wide polymorphisms were examined for an association with breast cancer risk. Among those were 11 GR polymorphisms, most found within Intron 2 of the GR gene. While only small associations were found for those polymorphisms (estimated ORs ranging between 0.86 and 1.17), it is important to note that none of the polymorphisms known to affect stress susceptibility and included in the study described here were looked at in the work by Hunter et al. Therefore, the current study will elaborate on the existing knowledge regarding the importance of GR signaling and GR genetic variation in breast cancer development and will examine for the first time if stress-response altering polymorphisms located within the GR locus are involved in breast cancer etiology.

133

CHAPTER 5

GENERAL DISCUSSION

Exposure to psychological stress and stress-related hydrocortisone release have been proposed to be associated with an increase in breast cancer risk 3. Much research has been devoted to providing proof for such an association through the use of epidemiological techniques. The establishment of large population-based cohorts has recently allowed for an improvement in study methods and has generated more definitive evidence for a link between stress and breast cancer. However, molecular work in this area has only just begun. Little is known about the activities of hydrocortisone which may contribute to breast cancer development in breast cells. Some initial work has been done towards identifying the intracellular pathways affected by hydrocortisone.

Experimental studies looking at the apoptotic ability of breast cells demonstrated that hydrocortisone inhibits some well defined apoptotic pathways in these cells and, thus, represses programmed cell death 84,193 . The finding that hydrocortisone represses the

DNA repair capacity of some cells of the immune system 8,150 may also be relevant. This may present an alternative way through which the hormone may contribute to breast cell malignancy. However, additional research is needed in order to determine the relative contribution of DNA repair and apoptosis to the process of stress-induced breast tumorigenesis, to identify the particular DNA repair and apoptosis genes affected by hydrocortisone, and to isolate additional pathways and genes involved in the stress-breast cancer association.

In the current study we have addressed the lack of knowledge in the area of intracellular stress signaling in the breast with the use of both molecular and

134

epidemiological techniques. We present evidence that the expression of the tumour suppressor gene BRCA1 is under the regulation of components of the stress response pathway including hydrocortisone and its intracellular receptor glucocorticoid receptor.

Since BRCA1 has been previously demonstrated to play an important role in both DNA repair and apoptosis, and has been shown to be crucial for the prevention of genomic instability and malignant transformation in breast cells 90 , we propose that BRCA1 is one of the genes linking the physiological response to stress and breast cancer development.

In this work, we have further aimed to contribute towards the understanding of molecular stress signaling in the breast by designing an epidemiological study which would examine the effect of inter-individual differences in glucocorticoid receptor responsivity on the risk of developing breast cancer.

We believe that the interdisciplinary research approach introduced here, addressing the intracellular stress signaling pathway in the breast at two distinct levels, represents a more rapid and effective route towards understanding the etiology of breast cancer development.

5.1 Regulation of the BRCA1 promoter by the stress signaling pathway

In the course of our research we have discovered that both hydrocortisone and the glucocorticoid receptor alone are capable of altering the expression of the mouse and human BRCA1 genes. BRCA1 appears to be transactivated by GR in the absence of hydrocortisone. This effect is lost upon hydrocortisone addition, resulting in BRCA1 down-regulation. In addition, we have found that these effects are reliant on the RIBS and UP sites of the BRCA1 promoter and involve the transcription factors GABPα/β and

USF2.

135

Recognition of the participation of RIBS and UP in BRCA1 regulation by hydrocortisone adds a new layer of complexity to what is currently known about BRCA1 transcriptional regulation. The RIBS site has been previously shown to act as a positive transcriptional promoter element 129 and the binding of GABPα/β to this site results in enhancement of BRCA1 promoter activity. In contrast, the UP site acts as a transcriptional repressor 139 . However, studies by our team have found that GABPα/β binding to this site causes BRCA1 upregulation 139 . Therefore, the crosstalk between these two promoter elements appears to be multifaceted and merits additional investigation. The work presented here contributes to the understanding of overall

BRCA1 transcriptional control by further defining the roles of the RIBS and UP elements.

We demonstrate that despite differing individual functions, the RIBS and UP sites act in concert in both the upregulation of BRCA1 expression by GR, and in the down-regulation of BRCA1 by hydrocortisone. This cooperation may be achieved through the activating effect that GABPα/β binding to both RIBS and UP has on BRCA1 expression. Therefore, binding of GABPα/β in the absence of hydrocortisone may result in positive signaling through both promoter elements and cause an increase in BRCA1 mRNA expression.

Conversely, the loss of GABPα/β from both elements in the presence of hydrocortisone, which we have demonstrated to occur, may be partially responsible for a down-regulation in BRCA1 expression.

The displacement of GABPα/β and USF2 from the BRCA1 promoter upon hydrocortisone treatment also suggests that in regulating BRCA1 expression stress signaling may compete with intracellular pathways in which these two transcription factors participate. For example, GABPα/β is known to be phosphorylated and, thus, activated by the MAP kinases ERK and JNK. This, in turn, leads to the transactivation of

136

GABPα/β target genes. Therefore, it is possible that hydrocortisone competes with

MAPK signaling to BRCA1, thus inactivating GABPα/β, and down-regulating BRCA1.

Consistent with this theory is the observation that hydrocortisone-bound GR stimulates

MAP kinase phosphatase-1 activity and, thus, down-regulates MAPK signaling 62 .

Interestingly, phosphorylation of liganded GR by ERK and JNK, in turn, leads to loss of

GR-induced transactivation 60,61 . Therefore, it is conceivable that hydrocortisone modulates BRCA1 expression through continuous cross-talk with MAPK signaling pathways.

It is important to note that our preliminary findings indicate that GR can be seen physically bound to the promoter even in the presence of hydrocortisone (Fig. 25). The binding of GR to its ligand and to target promoters has been previously shown to be in a state of dynamic flux, where GR complexes are continuously disassembled from target promoters, and the receptor dissociates from hydrocortisone every few minutes 268 .

Therefore, instead of BRCA1 down-regulation being caused by complete recruitment of

GR away from the BRCA1 promoter in the presence of hydrocortisone, it may be the ratio of promoter-bound vs. hormone-bound GR molecules which determines the level of expression of the BRCA1 gene.

Another observation which may be relevant to our results is the fact that the transcriptional activity of the transactivator USF2 is lost in several breast cancer cell lines

269 . For example, malignant MCF7 cells exhibited a marked decrease in USF2 activity as compared to non-malignant cells. Here we have shown that USF2 forms a part of the protein complexes lost from the BRCA1 promoter upon hydrocortisone addition, and therefore, may be important for the hydrocortisone effect on BRCA1 expression. Also, hydrocortisone-induced BRCA1 repression in breast cancer cells was found to differ

137

between non-malignant and malignant breast cell lines for both mouse and human cells.

Therefore, we speculate that the malignancy-associated differences in BRCA1 regulation may be in part due to USF2 inactivation in the course of cell transformation.

5.2 Integrating the results of this work into the current knowledge of molecular stress signaling in breast cells.

A model of the current knowledge on tumorigenic hydrocortisone activity in breast cells, which incorporates our work, is presented in Figure 30a. In the absence of hydrocortisone the glucocorticoid receptor is distributed between the cytoplasm and nucleus of the cell with an emphasis on the cytoplasm. Upon entrance of hydrocortisone in the cell, the hormone binds GR and the complex translocates to the cell nucleus. The efficiency of receptor-ligand association would be dependent on the structure of the glucocorticoid receptor, as determined by the polymorphic composition of the GR gene.

Once in the nucleus, GR affects pathways involved in apoptosis and possibly DNA repair, thus compromising genomic integrity. This includes pathways regulated by the BRCA1 protein. Since BRCA1 is involved in checkpoint establishment and cell cycle regulation, its down-regulation by hydrocortisone suggests that these pathways may also be compromised. Liganded GR also activates the transcription factor AP-1 39 , thus inhibiting AP-1 target genes, and suppressing apoptosis. In addition, activation of SGK-1 by GR leads to loss of the pro-apoptotic activity of the FOXO3a transcription factor 84 .

Hydrocortisone may affect BRCA1 transcription by several means, including: recruiting unliganded GR away from the BRCA1 promoter and, thus, abolishing its stimulatory action; interfering with MAPK-induced activation of RIBS and UP-bound

GABPα/β; stimulating AP-1 inhibitory activity at the CREB promoter element (although

138 a) HC

? GR HC GR Polymorphisms Cytoplasm GR HC GR GR

GR HC

GR Nucleus SGK-1

AP1 GR GR BRCA1

FOXO3a

Apoptosis DNA Repair Cell Cycle Control

b) + GR Mammary Gland Proliferation

+ regulates

BRCA1 Involution - - Stress HC

Figure 30. a) Possible mechanisms of stress signaling in breast cells. Binding efficiency of the glucocorticoid receptor (GR) to hydrocortisone (HC) in the cytoplasm of breast cells is dependent on the polymorphic composition of the GR gene. Hydrocortisone binding to GR results in repression of apoptosis and possibly other regulatory cell mechanisms by causing loss of GR transactivation at the BRCA1 promoter (and maybe other regulatory genes), stimulation of AP1 transrepressing activities and/or activation of SGK-1. b) A model of stress-induced breast cancer development. The glucocorticoid receptor stimulates mammary gland proliferation during development. This requires activation of BRCA1 for the maintenance of genomic integrity functions. Hydrocortisone represses GR transactivation of the BRCA1 gene during lactation, thus suppressing BRCA1-induced apoptosis and involution. This also results in loss of the regulatory functions of BRCA1. Prolonged presence of hydrocortisone such as in periods of stress leads to long-term repression of BRCA1 and breast cancer development.

139

our findings suggest that this mechanism is unlikely to be involved); and/or inhibiting transcription through interaction of liganded GR with RNA-polymerase II, HDAC-2, or p65 72,73 .

5.3 A model of disease development

Our results demonstrate that the unliganded GR regulates BRCA1 gene expression both in the presence and absence of hydrocortisone. This suggests that both the unliganded and liganded receptor have a physiological purpose in the breast which involves BRCA1 regulation, and whose disruption may contribute to disease development. Studies in mice with defective GR have demonstrated that in addition to being necessary for lactation, GR activity is involved in the ductal development of the virgin mammary gland, most likely through the induction of proliferation 38 . Also, GR was found to be required for lobuloalveolar development during pregnancy through proliferation 166 . Interestingly, BRCA1 levels have been shown to be highest in proliferating tissues 270 . This is in accordance with the important role of BRCA1 in the maintenance of genomic integrity in proliferating cells. Therefore, the upregulation of

BRCA1 by unliganded GR which we have observed may be correlated with a proliferation-inducing role of GR in ductal morphogenesis. Based on the opposing effects which we have observed for GR and hydrocortisone in the regulation of BRCA1, it is possible that hydrocortisone affects breast cells by abolishing the activities of its unliganded receptor. During lactation this would allow for a repression of GR-induced upregulation by hydrocortisone and would prevent induction of apoptosis and involution by BRCA1. In accordance with this model (Fig. 30b), disease development may be a function of prolonged presence of hydrocortisone in the breast in periods of stress,

140

resultant long-term loss of GR positive regulation of BRCA1 expression, loss of BRCA1 tumour suppressor functions in the cell, and genomic instability.

5.4 Future directions and contributions of research

Future research should include efforts to further define the mechanisms of regulation of the BRCA1 gene by hydrocortisone. In the work presented here we have identified a number of possible pathways (described above) which may have an involvement and merit additional investigation. It would also be of interest to directly link stress-induced down-regulation of BRCA1 to loss of BRCA1-related intracellular pathways and tumorigenesis. This can be done through both in vitro studies of BRCA1 activity and through in vivo work. In addition, the role of the unliganded GR should be examined in the context of both involvement in intracellular regulatory pathways, and involvement in different stages of breast cancer development. Our results suggest that the receptor may have important functions in the breast in the absence of its ligand. Because of this changes induced by hydrocortisone in unliganded GR signaling should be determined.

Should the epidemiological study design presented here produce the hypothesized results, the effect of GR polymorphisms found to contribute to breast cancer risk should be examined on stress-regulated intracellular pathways. A future epidemiological study may also benefit from including stress as an exposure variable when looking at GR variants and breast cancer risk. This may allow for the identification of a gene environment interaction in the association between stress and breast cancer.

This research contributes to breast cancer research in a number of ways. Firstly, it broadens the understanding of the transcriptional and hormonal regulation of the BRCA1

141

gene. The importance of BRCA1 in breast cancer development makes the identification of promoter sites, transcription factors, and regulatory pathways relevant to its regulation crucial for understanding breast cancer etiology and counteracting the transformation- related transcriptional suppression of that gene.

Another important contribution is in the area of molecular stress signaling. The effect of stress on breast cancer risk will never be truly understood until the intracellular pathways triggered by the stress signaling response are defined. The identification of such mechanisms would add to the knowledge of breast cancer etiology in general, and of the physiological stress response. Here we present one such stress-induced intracellular pathway which may play a role in breast cancer development. We also identify a ligand- independent regulatory role of the glucocorticoid receptor, which introduces a novel dimension to what is currently known about the function of the receptor in intracellular stress signaling. Through the design of a future molecular epidemiology study we aim to expand the comprehension of the role of the glucocorticoid receptor in breast cancer etiology and to identify the individuals most susceptible to stress-induced breast cancer development. We believe that this would allow for an improvement in future stress study designs through the isolation of the most relevant study population.

142

Reference List

1. Canadian Cancer Society/National Cancer Institute of Canada: Canadian Cancer Statistics 2007. 2007. Toronto, Canada.

2. Lillberg K. et al. Stressful life events and risk of breast cancer in 10,808 women: a cohort study. American Journal of Epidemiology 157 , 415-423 (2002).

3. Duijts S., Zeegers M. & Vd Borne B. The association between stressful life events and breast cancer risk: a meta-analysis. International Journal of Cancer 107 , 1023-1029 (2003).

4. Statistics Canada. Personal resources: Life stress 2000/01. Health Indicators, vol. 2002, no. 2. www.statcan.ca/english/freepub/82-221- XIE/01002/nonmed/personal3.htm .

5. Neville M., McFadden T. & Forsyth I. Hormonal regulation of mammary differentiation and milk secretion. Journal of Mammary Gland Biology and Neoplasia. 7, 49-66. (2002).

6. Moberg G. Biological response to stress: implications for animal welfare. In: Moberg G., Mench J, editors. The biology of animal stress. 123-146. 2000. CABI Publishing.

7. Amsterdam A., Tajima K. & Sasson R. Cell-specific regulation of apoptosis by glucocorticoids. Biochemical Pharmacology 64 , 843-850. (2002).

8. Fischman HK., Pero RW. & Kelly DD. Psychogenic stress induces chromosomal and DNA damage. Int J Neurosci. 84 , 219-227. (1996).

9. Thompson ME., Jensen RA., Obermiller PS., Page DL. & Holt JT. Decreased expression of BRCA1 accelerates growth and is often present during sporadic breast cancer progression. Nat Genet. 9, 444-450. (1995).

10. Lee W., Jin Y., Chang T., Lin P. & Su I. Immunolocalization of BRCA1 protein in normal breast tissue and sporadic invasive ductal carcinomas: a correlation with other biological parameters. Histopathology. 34 , 106-112. 1999.

11. Yoshikawa K. & et al. Reduction of BRCA1 protein expression in Japanese sporadic breast carcinomas and its frequent loss in BRCA1-associated cases. Clin.Cancer Res. 5 , 1249-1261. 1999.

12. Wilson C. et al. Localization of human BRCA1 and its loss in high-grade non- inherited breast carcinomas. Nature Genetics. 21 , 236-240 (1999).

143

13. Xu X. et al. Conditional mutation of Brca1 in mammary epithelial cells results in blunted ductal morphogenesis and tumour formation. Nature Genetics 22 , 37-43 (1999).

14. Zhang H. et al. BRCA1 physically associates with p53 and stimulates its transcriptional activity. Oncogene. 16 , 1713-1721 (1998).

15. Harkin P. et al. Induction of GADD45 and JNK/SAPK-dependent apoptosis following inducible expression of BRCA1. Cell 97 , 575-586 (1999).

16. Gowen L. et al. BRCA1 is required for transcription-coupled repair of oxidative DNA damage. Science. 281 , 1009-1012. 1998.

17. Shen S. et al. A targeted disruption of the murine BRCA1 gene causes gamma- irradiation hypersensitivity and genetic instability. Oncogene. 17 , 3115-3124. 1998.

18. Bamberger, C. M., Schulte, H. M. & Chrousos, G. P. Molecular determinants of glucocorticoid receptor function and tissue sensitivity to glucocorticoids. Endocr Rev 17 , 245-261 (1996).

19. de Rijk R.., Schaaf M. & de Kloet E. Glucocorticoid receptor variants: clinical implications. Journal of Steroid Biochemistry and Molecular Biology 81 , 103-122. (2002).

20. Bray PJ. & Cotton RG. Variations of the human glucocorticoid receptor gene (NR3C1): pathological and in vitro mutations and polymorphisms. Hum. Mutat. 21 , 557-568. (2003).

21. Stevens A. et al. Glucocorticoid sensitivity is determined by a specific glucocorticoid receptor haplotype. The Journal of Clinical Endocrinology and Metabolism 89 , 892-897. (2004).

22. Wust S. et al. Common polymorphisms in the glucocorticoid receptor gene are associated with adrenocortical responses to psychosocial stress. The Journal of Clinical Endocrinology and Metabolism. 89 , 565-573 (2004).

23. van Rossum E. et al. Characterization of a promoter polymorphism in the glucocorticoid receptor gene and its relationship to three other polymorphisms. Clinical Endocrinology. 61 , 573-581. (2004).

24. van Rossum E. & Lamberts S. Polymorphisms in the glucocorticoid receptor gene and their associations with metabolic parameters and body composition. Recent Prog. Horm. Res. 59 , 333-357. (2004).

25. de Rijk R. et al. A human glucocorticoid receptor gene variant that increases the stability of the glucocorticoid receptor beta-isoform mRNA is associated with rheumatoid arthritis. J Rheumatol. 28 , 2383-2388 (2001).

144

26. Hsu S. & DeFranco D. Selectivity of cell cycle regulation of glucocorticoid receptor function. JBC. 270 , 3359-3364. 1995.

27. Lim-Tio S., Keightley M. & Fuller P. Determinants of specificity of transactivation by the mineralocorticoid or glucocorticoid receptor. Endocrinology. 138 , 2537-2543. 1997.

28. Yan H. & Zhou W. Allelic variations in gene expression. Curr.Opin.Oncol. 16 (1), 39-43. 2004.

29. Han W. et al. Full sequencing analysis of estrogen receptor-alpha gene polymorphism and its association with breast cancer risk. Anticancer Res. 23 (6C), 4703-4707. 2003.

30. Hsiao W., Young K., Lin S. & Lin P. Estrogen receptor-alpha polymorphism in a Taiwanese clinical breast cancer population: a case-control study. Breast Cancer Res. 6(3), R180-R186. 2004.

31. Cai, Q. et al. Genetic Polymorphisms in the Estrogen Receptor {alpha} Gene and Risk of Breast Cancer: Results from the Shanghai Breast Cancer Study. Cancer Epidemiol Biomarkers Prev 12 , 853-859 (2003).

32. Gold, B. et al. Estrogen Receptor Genotypes and Haplotypes Associated with Breast Cancer Risk. Cancer Res 64 , 8891-8900 (2004).

33. Vaclavicek A. et al. Association of Prolactin and Its Receptor Gene Regions with Familial Breast Cancer. The Journal of Clinical Endocrinology & Metabolism 91 , 1513-1519. (2006).

34. Hennighausen L. & Robinson G. Signaling pathways in mammary gland development. Developmental Cell. 1, 467-475 (2001).

35. Robinson G. et al. Understanding mammary gland development through the imbalanced expression of growth regulators. Developmental Dynamics. 206 , 159- 168 (1996).

36. Gilbert S. Developmental Biology, Eight Edition. 2006. Sunderland, Mass., Sinauer Associates.

37. Majumder, P. K., Joshi, J. B. & Banerjee, M. R. Correlation between nuclear glucocorticoid receptor levels and casein gene expression in murine mammary gland in vitro. J. Biol. Chem. 258 , 6793-6798 (1983).

38. Reichardt H. et al. Mammary gland development and lactation are controlled by different glucocorticoid receptor activities. Eur.J.Endocrinol. 145 , 519-527. 2001.

145

39. Feng, Z. et al. Glucocorticoid and progesterone inhibit involution and programmed cell death in the mouse mammary gland. J. Cell Biol. 131 , 1095- 1103 (1995).

40. Moran, T. J., Gray, S., Mikosz, C. A. & Conzen, S. D. The Glucocorticoid Receptor Mediates a Survival Signal in Human Mammary Epithelial Cells. Cancer Res 60 , 867-872 (2000).

41. Tangir J., Bonafe N., Gilmore-Hebert M. & Henegariu O. SGK1, a potential regulator of c-fms related breast cancer aggressiveness. Clin.Exp.Metastasis. 21 , 477-483. 2004.

42. Wu W., Pew T., Zou M., Pang D. & Conzen S. Glucocorticoid receptor-induced MAPK Phosphatase-1 (MPK-1) expression inhibits paclitaxel-associated MAPK activation and contributes to breast cancer cell survival. JBC. 280 , 4117-4124. (2005).

43. Lien HC. Differential expression of glucocorticoid receptor in human breast tissues and related neoplasms. J Pathol. 209 , 317-327 (2006).

44. Robinson-Rechavi M., Carpentier A., Duffraisse M. & Laudet V. How many nuclear hormone receptors are there in the human genome? Trends Genet. 17 (10), 554-556. 2001.

45. Kumar R. & Thompson E. The structure of the nuclear hormone receptors. Steroids, 64 (5), 310-319. 1999.

46. Schoneveld O., Gaemers I. & Lamers W. Mechanisms of glucocorticoid signalling. Biochimica et Biophysica Acta 1680 , 114-128 (2004).

47. Yudt M., Jewell C., Bienstock R. & Cidlowski J. Molecular origins for the dominant negative function of human glucocorticoid receptor beta. Molecular and Cellular Biology 23 , 4319. 2003.

48. Kalinyak J., Dorin R., Hoffman A. & Perlman A. Tissue-specific regulation of glucocorticoid receptor mRNA by dexamethasone. JBC. 262 , 10441. 1987.

49. Cole T. et al. Targeted disruption of the glucocorticoid receptor gene blocks adrenergic chromaffin cell development and severely retards lung maturation. Genes Dev. 9 (13), 1608-1621. 1995.

50. Reichardt HM et al. DNA binding of the glucocorticoid receptor is not essential for survival. Cell. 93 , 531-541. 1998.

51. Reichardt HM et al. Analysis of glucocorticoid signaling by gene targeting. Journal of Steroid Biochemistry and Molecular Biology. 65 , 111-115. 1998.

146

52. Heck S. et al. A distinct modulating domain in glucocorticoid receptor monomers in the repression of activity of the Transcrption factor AP-1. EMBO Journal. 13 , 4087-4095. 1994.

53. Refojo D, Liberman A., Holsboer F & Arzt E. Transcription factor-mediated molecular mechanisms involved in the functional cross-talk between cytokines and glucocorticoids. Immunology and Cell Biology. 79 , 385-394 (2001).

54. Nishi M. et al. Real-time imaging of glucocorticoid receptor dynamics in living neurons and glial cells in comparison with non-neural cells. Eur.J.Neurosci. 11 , 1927.-1936. 1999.

55. Brink M., Humbel B., de Kloet E. & Van Driel R. The unliganded glucocorticoid receptor is localized in the nucleus, not in the cytoplasm. Endocrinology. 130 , 3575-3581. (1992).

56. Kalinyak J. et al. Developmental and hormonal regulation of glucocorticoid receptor messenger RNA in the rat. J Clin Invest. 84 , 1843-1848 (1989).

57. Oakley RH. & Cidlowski J. Homologous down regulation of the glucocorticoid receptor: the molecular machinery. Crit Rev Eukaryot Gene Expr. 3, 63-88. (1993).

58. Hoeck W. & Groner B. Hormone-dependent phosphorylation of the glucocorticoid receptor occurs mainly in the amino-terminal transactivation domain. JBC 265 , 5403-5408. 1990.

59. Hock W., Rusconi S. & Groner B. Downregulation and phosphorylation of glucocorticoid receptors in cultured cells: investigations with a monospecific antiserum against a bacterially expressed receptor fragment. JBC. 14396-14402. 1989.

60. Krstic M., Rogatsky I., Yamamoto K. & Garabedian M.. Mitogen-activated and cyclin-dependent protein kinases selectively and differentially modulate transcriptional enhancement by the glucocorticoid receptor. Molecular and Cellular Biology 17 , 3947-3954. 1997.

61. Rogatsky I., Logan S. & Garabedian M. Antagonism of glucocorticoid receptor transcriptional activation by the c-Jun N-terminal kinase. PNAS USA 95 , 2050- 2055. 1998.

62. Kassel O. et al. Glucocorticoids inhibit MAP kinase via increased expression and decreased degradation of MPK-1. EMBO Journal. 20 (24), 7108-7116. 2001.

63. Almawi W. & Melemedjian O. Molecular mechanisms of glucocorticoid antiproliferative effects: antagonism of transcription factor activity by glucocorticoid receptor. Journal of Leukocyte Biology 71 , 9-15 (2002).

147

64. Karin M. New twists in gene regulation by glucocorticoid receptor: is DNA binding dispensable? Cell. 93 , 487-490 1998.

65. Dvorak Z., Modriansky M., Ulrichova J. & Maurel P. Speculations on the role of the microtubule network in glucocorticoid receptor signaling. Cell Biology and Toxicology 20 , 333-343 (2004).

66. Adcock I. & Caramori G. Cross-talk between pro-inflammatory transcription factors and glucocorticoids. Immunology and Cell Biology. 79 , 376-384 2001.

67. De Bosscher K., Berghe W. & Haegeman G. Mechanisms of anti-inflammatory action and of immunosuppression by glucocorticoids: negative interference of activated glucocorticoid receptor with transcription factors. J.Neuroimmunology. 109 , 16-22. 2000.

68. Auphan N., DiDonato J., Rosette C., Helmbertg A. & Karin M. Molecular basis for immunosuppression by glucocorticoids: inhibition of NF-kB activity through induction of IkB synthesis. Science. 270 , 286-290. 1995.

69. Smoak K. & Cidlowski J. Mechanisms of glucocorticoid receptor signaling during inflammation. Mechanisms of Ageing and Development. 125 , 697-706 (2004).

70. Kamei Y., Xu L., Heinzel T. & et al. A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell. 85 , 403- 414. 1996.

71. De Bosscher K., Vanden Berghe W. & Haegeman G. The interplay between the glucocorticoid receptor and nuclear factor-kappa B or activator protein-1: molecular mechanisms for gene repression. Endocrine Reviews. 24 (4), 488-522. 2003.

72. Li J. et al. Involvement of histone methylation and phosphorylation in regulation of transcription by thyroid hormone receptor. Molecular and Cellular Biology 22 (16), 5688-5697. 2002.

73. Nissen R. & Yamamoto K. The glucocorticoid receptor inhibits NFkappaB by interfering with serine-2 phosphorylation of the RNA polymerase II carboxy- terminal domain. Genes Dev. 14 (18), 2314-2329. 2000.

74. Sasson R., Tajima K. & Amsterdam A. Glucocorticoids protect against apoptosis induced by serum deprivation, cyclic adenosine 3'-,5'-monophosphate and p53 activation in immortalized human granulosa cells: involvement of Bcl-2. Endocrinology. 142 , 802-811. 2001.

75. Huang S. & Sidlowski J. Glucocorticoids inhibit serum depletion-induced apoptosis in T lymphocytes expressing Bcl-2. FASEB Journal. 13 , 467-476. 1999.

148

76. Yang E. & Korsmeyer S. Molecular thanatopsis: a discourse on the Bcl-2 family and cell death. Blood. 88 , 386-401 1996.

77. Chang T. et al. Dexamethasone suppresses apoptosis in human gastric cancer cell line through modulation of bcl-x gene expression. FEBS Letters. 415 , 11-15. 1997.

78. Hulkko S., Wakui H. & Zilliacus J. The pro-apoptotic protein death-associated protein 3 (DAP3) interacts with the glucocorticoid receptor and affects the receptor function. Biochem.J. 349 , 885-893. 2000.

79. Evans-Storms R. & Cidlowski J. Delineation of an antiapoptotic action of glucocorticoids in hepatoma cells: the role of nuclear factor-kB. Endocrinology. 141 , 1854-1862. 2000.

80. Natoli G. et al. Nuclear factor kB-independent cytoprotective pathways originating at tumor necrosis factor receptor-associated factor 2. Journal of Biological Chemistry 273 , 31262-31272. 1998.

81. Wang C., Mayo M., Korneluk R., Goeddel D. & Baldwin Jr A. NFkB antiapoptosis: induction of TRAF1 and TRAF2 and c-IAP1 and C-IAP2 to suppress caspase-8 activation. Science. 281 , 1680-1683. 1998.

82. Angel P. & Karin M. The role of Jun, Fos and the AP-1 complex in cell- proliferation and transformation. Biochimica et Biophysica Acta 1072 , 129-157. 1991.

83. Miner J. & Yamamoto K. Regulatory crosstalk at composite response elements. Trends Biochem.Sci. 16 , 23-26. 1991.

84. Wu, W., Zou, M., Brickley, D. R., Pew, T. & Conzen, S. D. Glucocorticoid Receptor Activation Signals through Forkhead Transcription Factor 3a in Breast Cancer Cells. Mol Endocrinol 20 , 2304-2314 (2006).

85. Miki Y. et al. A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science. 266 , 66-71. (1994).

86. Deng C. BRCA1: cell cycle checkpoint, genetic instability, DNA damage response and cancer evolution. Nucleic Acids Research. 34 , 1416-1426 (2006).

87. Weaver Z. et al. Mammary tumors in mice conditionally mutant for Brca1 exhibit gross genomic instability and centrosome amplification yet display a recurring distribution of genomic imbalances that is similar to human breast cancer. Oncogene. 21 , 5097-5107. 2002.

88. Brodie S. et al. Multiple genetic changes are associated with mammary tumorigenesis in Brca1 conditional knockout mice. Oncogene. 20 , 7514-7523. 2001.

149

89. Paterson J. BRCA1: a review of structure and putative functions. Dis.Markers. 13 , 261-274. 1998.

90. Narod S. & Foulkes W. BRCA1 and BRCA2: 1994 and beyond. Nature Reviews Cancer. 4, 665-676 (2004).

91. Hashizume R. et al. The ring heterodimer brca1-bard1 is a ubiquitin ligase inactivated by a breast cancer-derived mutation. JBC. 276 , 14537-14540 2001.

92. Dong Y. et al. Regulation of BRCC, a holoenzyme complex containing BRCA1 and BRCA2, by a signalosome-like subunit and its role in DNA repair. Mol.Cell. 12 , 1087-1099 2003.

93. Starita, L. M. & Parvin J. The multiple nuclear functions of BRCA1: transcription, ubiquitination and DNA repair. Current Opinion in Cell Biology. 15 , 345-350 (2003).

94. Mallery, D. L., Vandenberg, C. J. & Hiom, K. Activation of the E3 ligase function of the BRCA1/BARD1 complex by polyubiquitin chains. EMBO J. 21 , 6755-6762 (2002).

95. Rosen E., Fan S. & Ma Y. BRCA1 regulation of transcription. Cancer Letters 236 , 175-185 (2006).

96. Scully R.. et al. BRCA1 is a component of the RNA polymerase II holoenzyme. Proc Natl Acad Sci U S A. 94 , 5605-5610 (1997).

97. Anderson S., Schlegel B., Nakajima T., Wolpin E. & Parvin J. BRCA1 protein is linked to the RNA polymerase II holoenzyme complex via RNA helicase A. Nat Genet. 19 , 254-256. 1998.

98. Wang Y. et al. BASC, a super complex of BRCA1-associated proteins involved in the recognition and repair of aberrant DNA structures. Genes Dev. 14 , 927-939. 2000.

99. Zhong Q. et al. Association of BRCA1 with the hRad50-hMre11-p95 complex and the DNA damage response. Science. 285 , 747-750. 1999.

100. Scully R. et al. Dynamic changes of BRCA1 subnuclear location and phosphorylation state are initiated by DNA damage. Cell. 90 , 425-435 (1997).

101. Yoshida K. & Miki Y. Role of BRCA1 and BRCA2 as regulators of DNA repair, transcription, and cell cycle in response to DNA damage. Cancer Sci. 95 , 866-871. 2004.

102. Yan Y., Haas J., Kim M., Sgagias M. & Cowan K. BRCA1-induced apoptosis involves inactivation of ERK1/2 activities. JBC 277 , 33422-33430 (2002).

150

103. Zhan Q. et al. Caspase-3 mediated cleavage of BRCA1 during UV-induced apoptosis. Oncogene 21 , 5335-5345 (2002).

104. Thangaraju M., Kaufmann S. & Couch F. BRCA1 facilitates stress-induced apoptosis in breast and ovarian cancer cell lines. JBC 275 , 33487-33496 (2000).

105. Smith T. & et al. Complete genomic sequence and analysis of 117kb of human DNA containing the gene BRCA1. Genome Research. 6, 1029-1049 1996.

106. Whitehouse, C., Chambers, J., Catteau, A. & Solomon, E. Brca1 expression is regulated by a bidirectional promoter that is shared by the Nbr1 gene in mouse. Gene 326 , 87-96 (2004).

107. Xu, C. F. et al. Isolation and characterization of the NBR2 gene which lies head to head with the human BRCA1 gene. Hum. Mol. Genet. 6, 1057-1062 (1997).

108. Xu, C. F. et al. Distinct transcription start sites generate two forms of BRCA1 mRNA. Hum.Mol.Genet. 4, 2259-2264 1995.

109. Dimitrov, S., Brennerova, M. & Forejt, J. Expression profiles and intergenic structure of head-to-head oriented Brca1 and Nbr1 genes. Gene 262 , 89-98 (2001).

110. Suen, T. C. & Goss, P. E. Transcription of BRCA1 is dependent on the formation of a specific protein-DNA complex on the minimal BRCA1 Bi-directional promoter. J. Biol. Chem. 274 , 31297-31304 (1999).

111. Suen, T. C., Tang, M. S. & Goss, P. E. Model of transcriptional regulation of the BRCA1-NBR2 bi-directional transcriptional unit. Biochim. Biophys. Acta 1728 , 126-134 (2005).

112. Romagnolo, D. et al. Estrogen upregulation of BRCA1 expression with no effect on localization. Mol. Carcinog. 22 , 102-109 (1998).

113. Chung Y. & Gorewit R. Effects of Estrogen and Prolactin on bovine BRCA1 gene expression. Pakistan Journal of Nutrition. 1, 49-52 (2002).

114. Laud K. et al. Expression of BRCA1 gene in ewe mammary epithelial cells during pregnancy: regulation by growth hormone and steroid hormones. European Journal of Endocrinology. 145 , 763-770 (2001).

115. Spillman M. & Bowcock A. BRCA1 and BRCA2 mRNA levels are coordinately elevated in human breast cancer cells in response to estrogen. Oncogene. 13, 1639-1645 1996.

116. Gudas, J. M., Nguyen, H., Li, T. & Cowan, K. H. Hormone-dependent regulation of BRCA1 in human breast cancer cells. Cancer Res. 55 , 4561-4565 (1995).

151

117. Marquis S. et al. The developmental pattern of BRCA1 expression implies a role in differentiation of the breast and other tissues. Nature Genetics. 11 , 17-26 1995.

118. Rajan, J. V., Marquis, S. T., Gardner, H. P. & Chodosh, L. A. Developmental expression of Brca2 colocalizes with Brca1 and is associated with proliferation and differentiation in multiple tissues. Dev. Biol. 184 , 385-401 (1997).

119. Jeffy BD. et al. An estrogen receptor-alpha/p300 complex activates the BRCA-1 promoter at an AP-1 site that binds Jun/Fos transcription factors: repressive effects of p53 on BRCA-1 transcription. Neoplasia. 7, 873-882 (2005).

120. Hockings, J. K. et al. The ligand status of the aromatic hydrocarbon receptor modulates transcriptional activation of BRCA-1 promoter by estrogen. Cancer Res. 66 , 2224-2232 (2006).

121. Ansquer Y. et al. Progesterone induces BRCA1 mRNA decrease, cell cycle alterations and apoptosis in the MCF7 breast cancer cell line. Anticancer Research. 25 , 243-248 (2005).

122. Favy D. et al. Prolactin-dependent up-regulation of BRCA1 expression in human breast cancer cell lines. Biochemical and Biophysical Research Communications. 258 , 284-291 (1999).

123. Futreal A. & et al. BRCA1 mutations in primary breast and ovarian carcinomas. Science 266 , 120-122. 1994.

124. Suen, T. C. & Goss, P. E. Identification of a novel transcriptional repressor element located in the first intron of the human BRCA1 gene. Oncogene 20 , 440- 450 (2001).

125. Wardrop, S. L. & Brown, M. A. Identification of two evolutionarily conserved and functional regulatory elements in intron 2 of the human BRCA1 gene. Genomics 86 , 316-328 (2005).

126. Thakur, S. & Croce, C. M. Positive regulation of the BRCA1 promoter. J. Biol. Chem. 274 , 8837-8843 (1999).

127. Mancini D. et al. CpG methylation within the 5' regulatory region of the BRCA1 gene is tumor specific and includes a putative CREB binding site. Oncogene. 16 , 1161-1169. (1998).

128. Atlas, E., Stramwasser, M. & Mueller, C. R. A CREB site in the BRCA1 proximal promoter acts as a constitutive transcriptional element. Oncogene 20 , 7110-7114 (2001).

129. Atlas E., Stramwasser M., Whiskin K. & Mueller CR. GA-binding protein alpha/beta is a critical regulator of the BRCA1 promoter. Oncogene. 19 , 1933- 1940. (2000).

152

130. Wang, A., Schneider-Broussard, R., Kumar, A. P., MacLeod, M. C. & Johnson, D. G. Regulation of BRCA1 expression by the Rb-E2F pathway. J. Biol. Chem. 275 , 4532-4536 (2000).

131. DiNardo D., Butcher D., Robinson D., Archer T. & Rodenhiser D. Functional analysis of CpG methylation in the BRCA1 promoter region. Oncogene. 20 , 5331- 5340. (2001).

132. Baldassarre, G. et al. Negative regulation of BRCA1 gene expression by HMGA1 proteins accounts for the reduced BRCA1 protein levels in sporadic breast carcinoma. Mol. Cell Biol. 23 , 2225-2238 (2003).

133. Baker K, Wei G., Schaffner A. & Ostrowski M. Ets-2 and Components of Mammalian SWI/SNF Form a Repressor Complex That Negatively Regulates the BRCA1 Promoter. The Journal of Biological Chemistry 278 , 17876-17884 (2003).

134. Oberley M., Inman D. & Farnham P. E2F6 negatively regulates BRCA1 in human cancer cells without methylation of histon H3 on lysine 9. The Journal of Biological Chemistry 278 , 42466-42476 (2003).

135. Bindra, R. S. et al. Hypoxia-induced down-regulation of BRCA1 expression by E2Fs. Cancer Res. 65 , 11597-11604 (2005).

136. DeGregori J. & Johnson DG. Distinct and overlapping roles for E2F family members in transcription, proliferation and apoptosis. Curr Mol Med. 6(7), 739- 748. 2006.

137. Arizti, P. et al. Tumor suppressor p53 is required to modulate BRCA1 expression. Mol. Cell Biol. 20 , 7450-7459 (2000).

138. Rauch, T., Zhong, X., Pfeifer, G. P. & Xu, X. 53BP1 is a positive regulator of the BRCA1 promoter. Cell Cycle 4, 1078-1083 (2005).

139. MacDonald G., Stramwasser M. & Mueller C. Characterization of a negative transcriptional element in the BRCA1 promoter. Breast Cancer Res. 9 , R49. 2007.

140. Tonin P. Genes implicated in hereditary breast cancer syndromes. Seminars in Surgical Oncology. 18 , 281-286 (2000).

141. Madigan M., Ziegler R., Benichou J., Byrne C. & Hoover R. Proportion of breast cancer cases in the United States explained by well-established risk factors. Journal of the National Cancer Institute. 87 , 1681-1685 (1995).

142. Bleiker E.. & van der Ploeg H. Psychosocial factors in the etiology of breast cancer: review of a popular link. Patient Education and Counseling. 37 , 201-214 (1999).

153

143. Lillberg K. et al. Stress of daily activities and risk of breast cancer: a prospective cohort study in Finland. International Journal of Cancer 91 , 888-893 (2001).

144. Helgesson O., Cabrera C., Lapidus L., Bengtsson C. & Lissner L. Self-reported stress levels predict subsequent breast cancer in a cohort of Swedish women. European Journal of Cancer Prevention 12 , 377-381 (2003).

145. Grossarth-Maticek R. et al. Interaction of psychosocial and physical risk factors in the causation of mammary cancer, and its prevention through psychological methods of treatment. Journal of Clinical Psychology. 56 , 33-50 (2000).

146. Holden RJ., Pakula IS. & Mooney PA. An immunological model connecting the pathogenesis of stress, depression and carcinoma. Medical Hypotheses. 51 , 309- 314 (1998).

147. Yang E. & Glaser R. Stress-induced immunomodulation: implications for tumorigenesis. Brain, Behaviour, and Immunity 17 , S37-S40 (2003).

148. Glaser R et al. Stress-related impairments in cellular immunity. Psychiatry Res. 16 , 233-239 (1985).

149. Amsterdam A. & Sasson R. The anti-inflammatory action of glucocorticoids is mediated by cell type specific regulation of apoptosis. Molecular and Cellular Endocrinology 189 , 1-9 (2002).

150. Cohen L., Marshall G., Jr., Cheng L., Sandeep A. & Wei Q. DNA repair capacity in healthy medical students during and after exam stress. Journal of Behavioral Medicine 23 , 531 (2000).

151. Easton DF, Ford D & Bishop DT Breast and ovarian cancer incidence in BRCA1- mutation carriers. Breast Cancer Linkage Consortium. Am. J. Hum. Genet. 56 , 265-271 (1995).

152. Powell S. & Kachnic L. Roles of BRCA1 and BRCA2 in homologous recombination, DNA replication fidelity and the cellular response to ionizing radiation. Oncogene. 22 , 5784-5791 (2003).

153. Rosen E., Fan S., Pestell R. & Goldberg I. BRCA1 gene in breast cancer. Journal of Cellular Physiology. 196 , 19-41 (2003).

154. Fialka, I. et al. The estrogen-dependent c-Jun ER protein causes a reversible loss of mammary epithelial cell polarity involving a destabilization of adherens junctions. J. Cell Biol. 132 , 1115-1132 (1996).

155. Roskelley C., Wu C. & Somasiri A. Analysis of mammary gland morphogenesis. Methods in Molecular Biology. 136 , 27-38 (2000).

154

156. Lin J., Bhat N., John S., Queale W. & Leonard W. Characterization of the human interleukin-2 receptor beta-chain gene promoter: regulation of promoter activity by ets gene products. Mol Cell Biol. 13 , 6201-6210 (1993).

157. Rosmarin, A. G., Caprio, D. G., Kirsch, D. G., Handa, H. & Simkevich, C. P. GABP and PU.1 Compete for Binding, yet Cooperate to Increase CD18 (beta(2) Leukocyte Integrin) Transcription. J. Biol. Chem. 270 , 23627-23633 (1995).

158. Forlenza M. & Baum A. Psychosocial influences on cancer progression: alternative cellular and molecular mechanisms. Current Opinion in Psychiatry. 13 , 639-645 (2000).

159. Dimitrov S., Matouskova E. & Forejt J. Expression of BRCA1, NBR1, and NBR2 genes in human breast cancer cells. Folia Biologica (Praha). 47 , 120-127 (2001).

160. Favy, D. A. et al. Cyclosporine A inhibition of prolactin-dependent up-regulation of BRCA1 protein expression in human breast cell lines. Anticancer Res. 20 , 1703-1704 (2000).

161. Rajan J., Wang M., Marquis S. & Chodosh L. Brca2 is coordinately regulated with Brca1 during proliferation and differentiation in mammary epithelial cells. Proc. Natl. Acad. Sci. U. S. A. 93 , 13078-13083. (1996).

162. Gudas, J. M. et al. Cell cycle regulation of BRCA1 messenger RNA in human breast epithelial cells. Cell Growth Differ. 7, 717-723 (1996).

163. Hynes N. et al. Epidermal growth factor receptor, but not c-erbB-2, activation prevents lactogenic hormone induction of the b-casein gene in mouse mammary epithelial cells. Molecular and Cellular Biology. 10 , 4027-4034. (1990).

164. Merlo G. et al. Growth suppression of normal mammary epithelial cells by wild- type p53. Oncogene. 9, 443-453 (1994).

165. Elliott B. et al. Karyotypic evolution of a murine mammary adenocarcinoma in vitro and during progression from primary to metastatic growth in vivo. Genes, Chromosomes & Cancer. 4, 281-289 (1992).

166. Wintermantel T., Bock D., Fleig V., Greiner E. & Schutz G. The epithelial glucocorticoid receptor is required for the normal timing of cell proliferation during mammary lobuloalveolar development but is dispensable for milk production. Molecular Endocrinology. 19 , 340-349 (2005).

167. Porter, J. C. Hormonal regulation of breast development and activity. J Investig Dermatol 63 , 85-92 (1974).

168. Taketani Y & Oka T Hormonal regulation of the synthesis of casein and alpha- lactalbumin in a primary mammary cell culture system. Horm Metab Res. 18 , 119- 125 (1986).

155

169. Lund, L. R. et al. Two distinct phases of apoptosis in mammary gland involution: proteinase-independent and -dependent pathways. Development 122 , 181-193 (1996).

170. Blackshear P. et al. Brca1 and Brca2 expression patterns in mitotic and meiotic cells of mice. Oncogene. 16 , 61-68 (1998).

171. Mixon M., Kittrell F. & Medina D. Expression of Brca1 and splice variant Brca1D11 RNA levels in mouse mammary gland during normal development and tumorigenesis. Oncogene. 19 , 5237-5243 (2000).

172. Xu, X. et al. Centrosome amplification and a defective G2-M cell cycle checkpoint induce genetic instability in BRCA1 exon 11 isoform-deficient cells. Mol. Cell 3, 389-395 (1999).

173. Razandi M., Pedram A., Rosen E. & Levin E. BRCA1 inhibits membrane estrogen and growth factor receptor signaling to cell proliferation in breast cancer. Mol. Cell Biol. 24 , 5900-5913 (2004).

174. Rosmarin A., Resendes K., Yang Z., McMillan J. & Fleming S. GA-binding protein transcription factor: a review of GABP as an integrator of intracellular signaling and protein-protein interactions. Blood Cells, Molecules, and Diseases. 32 , 143-154 (2004).

175. Riccio A. et al. Transforming growth factor beta 1-responsive element: closely associated binding sites for USF and CCAAT-binding transcription factor-nuclear factor I in the type 1 plasminogen activator inhibitor gene. Molecular and Cellular Biology. 12 , 1846-1855 (1992).

176. Aurrekoetxea-Hernandez K. & Buetti E. Transforming growth factor beta enhances the glucocorticoid response of the mouse mammary tumor virus promoter through Smad and GA-binding proteins. Journal of Virology. 78 , 2201- 2211 (2004).

177. Li, G., Wang, S. & Gelehrter, T. D. Identification of Glucocorticoid Receptor Domains Involved in Transrepression of Transforming Growth Factor-{beta} Action. J. Biol. Chem. 278 , 41779-41788 (2003).

178. Peltier, J. et al. Transforming growth factor-[bgr]1 increases glucocorticoid binding and signaling in macrophages through a Smad- and activated protein-1- mediated process1. 63 , 2028-2036 (2003).

179. Periyasamy, S. & Sanchez, E. R. Antagonism of glucocorticoid receptor transactivity and cell growth inhibition by transforming growth factor-[beta] through AP-1-mediated transcriptional repression. The International Journal of Biochemistry & Cell Biology 34 , 1571-1585 (2002).

156

180. Davies, S., Dai, D., Pickett, G. & Leslie, K. K. Gene regulation profiles by progesterone and dexamethasone in human endometrial cancer Ishikawa H cells. Gynecologic Oncology 101 , 62-70 (2006).

181. De Kloet E. & Reul J. Feedback action and tonic influence of corticosteroids on brain function: a concept arising from the heterogeneity of brain receptor systems. Psychoneuroendocrinology. 12 , 83-105 (1987).

182. Korte, S. M. Corticosteroids in relation to fear, anxiety and psychopathology. Neuroscience & Biobehavioral Reviews 25 , 117-142 (2001).

183. Ushijima T. & Okochi-Takada E. Aberrant methylations in cancer cells: Where do they come from? Cancer Sci. 96 , 206-211 (2005).

184. Butcher D., Mancini-DiNardo D., Archer T. & Rodenhiser D. DNA binding sites for putative methylation boundaries in the unmethylated region of the BRCA1 promoter. International Journal of Cancer. 111 , 669-678 (2004).

185. Dumitrescu RG & Cotarla I. Understanding breast cancer risk - where do we stand in 2005? J. Cell. Mol. Med. 9, 208-221 (2005).

186. Sorlie T., Andersen T., Bukholm I. & Borresen-Dale A. Mutation screening of BRCA1 using PTT and LOH analysis at 17q21 in breast carcinomas from familial and non-familial cases. Breast Cancer Research and Treatment. 48 , 259-264 1998.

187. Seery L. et al. BRCA1 expression levels predict distant metastasis of sporadic breast cancers. Int. J. Cancer (Pred. Oncol. ). 84 , 258-262 (1999).

188. Yang Q. et al. Prognostic significance of BRCA1 expression in Japanese sporadic breast carcinomas. Cancer. 92, 54-60 2001.

189. Fearon E. BRCA1 and E-Cadherin promoter hypermethylation and gene inactivation in cancer - associated or mechanism. Journal of the National Cancer Institute. 92 , 515-517 (2000).

190. Mueller, C. R. & Roskelley, C. D. Regulation of BRCA1 expression and its relationship to sporadic breast cancer. Breast Cancer Res. 5, 45-52 (2003).

191. Aurrekoetxea-Hernandez K. & Buetti E. Synergistic action of GA-Binding Protein and glucocorticoid receptor in transcription from the Mouse Mammary Tumour Virus Promoter. Journal of Virology. 74 , 4988-4998 (2000).

192. Doppler W., Groner B. & Ball R. Prolactin and glucocorticoid hormones synergistically induce expression of transfected rat beta-casein gene promoter constructs in a mammary epithelial cell line. PNAS. 86 , 104-108 (1989).

157

193. Feng, Z. et al. Glucocorticoid and progesterone inhibit involution and programmed cell death in the mouse mammary gland. J. Cell Biol. 131 , 1095- 1103 (1995).

194. Schmitt, J. & Stunnenberg, H. G. The glucocorticoid receptor hormone binding domain mediates transcriptional activation in vitro in the absence of ligand. Nucl. Acids Res. 21 , 2673-2681 (1993).

195. Pearce D. & Yamamoto K. Mineralocorticoid and glucocorticoid receptor distinguished by nonreceptor factors at a composite response element. Science. 259 , 1161-1165. (1993).

196. Graves M., Zhou L., MacDonald G., Mueller C. & Roskelley, C. D. Regulation of the BRCA1 promoter in ovarian surface epithelial cells and ovarian carcinoma cells. FEBS Letters. 581 , 1825-1833 (2007).

197. Zheng W et al. Reduction of BRCA1 expression in sporadic ovarian cancer. Gynecol. Oncol. 76 , 294-300 (2000).

198. Antonova L. & Mueller C. Hydrocortisone down-regulates the tumour suppressor gene BRCA1 in mammary cells: a possible molecular link between stress and breast cancer. Genes, Chromosomes and Cancer 2007.

199. Marquis S. et al. The developmental pattern of Brca1 expression implies a role in differentiation of the breast and other tissues. Nature Genetics. 11 , 17-26 (1995).

200. Lane T. et al. Expression of BRCA1 is associated with terminal differentiation of ectodermally and mesodermally derived tissues in mice. Genes Dev. 9, 2712-2722 1995.

201. Bennett M. et al. Isolation of the mouse homologue of BRCA1 and genetic mapping to mouse chromosome 11. Genomics. 29, 576-581 1995.

202. Goya L, Maiyar AC, Ge Y. & Firestone GL Glucocorticoids induce a G1/G0 cell cycle arrest of Con8 rat mammary tumor cells that is synchronously reversed by steroid withdrawal or addition of transforming growth factor-alpha. Molecular Endocrinology. 7, 1121-1132 (1993).

203. Merajver SD et al. Somatic mutations in the BRCA1 gene in sporadic ovarian tumors. Nat. Genet. 9, 439-443 (1995).

204. Takahashi H et al. Mutation analysis of the BRCA1 gene in ovarian cancers. Cancer Res. 55 , 3002 (2007).

205. Khoo US et al. Somatic mutations in the BRCA1 gene in Chinese sporadic breast and ovarian cancer. Oncogene. 18 , 4643-4646 (2007).

158

206. Rae, M. T. & Hillier, S. G. Steroid signaling in the ovarian surface epithelium. Trends in Endocrinology and Metabolism 16 , 327-333 (2005).

207. Ness R. & et al. Factors related to inflammation of the ovarian epithelium and risk of ovarian cancer. Epidemiology. 11, 111-117. 2000. Ref Type: Generic

208. Basuyaux, J., Ferreira E., Stehelin D. & Buttice G. The Ets transcription factors interact with each other and with the c-Fos/c-Jun complex via distinct protein domains in a DNA-dependent and -independent manner. JBC. 272 , 26188-26195. 1997.

209. Gerber B., Muller H., Reimer T., Krause A. & Friese K. Nutrition and lifestyle factors on the risk of developing breast cancer. Breast Cancer Res. Treat. 79 , 265- 276 (2003).

210. Strange K., Kerr L., Andrews H., Emerman J. & Weiberg J. Psychosocial stressors and mammary tumour growth: an animal model. Neurotoxicology and Teratology. 22 , 89-102 (2000).

211. Harbuz M. & Lightman S. Stress and the hypothalamo-pituitary-adrenal axis: acute, chronic and immunological activation. J. Endocrinol. 134 , 327-339 (1992).

212. Keller SE, Weiss JM, Schleifer SJ, Miller NE & Stein M. Stress-induced suppression of immunity in adrenalectomized rats. Science. 221 , 1301-1304 (1983).

213. Homo-Delarche F. et al. Sex steroids, glucocorticoids, stress and autoimmunity. J Steroid Biochem Mol Biol. 40 , 619-637. (1991).

214. VanItallie T. Stress: a risk factor for serious illness. Metabolism. 51 , 40-45 (2002).

215. Land CE. et al. Incidence of female breast cancer among atomic bomb survivors, Hiroshima and Nagasaki, 1950-1990. Radiat Res. 160 , 707-717 (2003).

216. Tokunaga M. et al. Malignant breast tumors among atomic bomb survivors, Hiroshima and Nagasaki, 1950-74. J Natl Cancer Inst. 62 , 1347-1359 (1979).

217. Setlow RB. Repair deficient human disorders and cancer. Nature. 271 , 713-717. (1978).

218. Huizenga NA. et al. A polymorphism in the glucocoritcoid receptor gene may be associated with an increased sensitivity to glucocorticoids in vivo. Journal of Clinical Endocrinology and Metabolism. 83 , 144-151 (1998).

219. Bachmann A. et al. Glucocorticoid receptor polymorphisms and post-traumatic stress disorder. Psychoneuroendocrinology. 30 , 297-306 (2005).

159

220. Di Blasio A. et al. The relation between two polymorphisms in the glucocorticoid receptor gene and body mass index, blood pressure and cholesterol in obese patients. Clinical Endocrinology. 59 , 68-74 (2003).

221. Stansfeld S., Fuhrer R., Shipley M. & Marmor M. Psychological distress as a risk factor for coronary heart disease in the Whitehall II study. International Journal of Epidemiology. 31 , 248-255 (2002).

222. van Rossum E. et al. Polymorphisms of the glucocorticoid receptor gene and major depression. Biol. Psychiatry. 59 , 681-688 (2006).

223. van Winsen L. et al. The impact of glucocorticoid receptor gene polymorphisms on glucocorticoid sensitivity is outweighed in patients with multiple sclerosis. Journal of Neuroimmunology. 167 , 150-156 (2005).

224. Love R., Newcomb P. & Trentham-Dietz A. Prevention of Breast Cancer. In: Donegan Wl, Spratt JP editors. Cancer of the Breast. Fifth edition. 200 (2002).

225. Moynahan M., Cui T. & Jasin M. Homology-directed DNA repair, mitocyn-c resistance, and chromosome stability is restored with correction of a Brca1 mutation. Cancer Res. 61 , 4842-4850 (2001).

226. Tassone P. & et al. BRCA1 expression modulates chemosensitivity of BRCA1- defective HCC1937 human breast cancer cells. Br. J. Cancer. 88 , 1285-1291 (2003).

227. Knight JA. et al. Characteristics associated with participation at various stages at the Ontario site of the cooperative family registry for breast cancer studies. Ann Epidemiol. 12 , 29-33 (2002).

228. Sutherland HJ. et al. The Cooperative Familial Registry for Breast Cancer Studies: design and first year recruitment rates in Ontario. J Clin Epidemiol. 54 , 93-98 (2001).

229. John EM. et al. The Breast Cancer Family Registry: an infrastructure for cooperative multinational, interdisciplinary and translational studies of the genetic epidemiology of breast cancer. Breast Cancer Res. 6, R375-R389 (2004).

230. Holowaty EJ, Marrett LD & Fehringer G Cancer incidence in Ontario: trends and regional variations. In: Cancer incidence in Ontario: trends and regional variations. (1995).

231. Mancuso C. et al. Ethnicity, but not cancer family history, is related to response to a population based mailed questionnaire. Ann.Epidemiol. 14, 36-43 2004.

232. Wedren S. et al. Oestrogen receptor alpha gene haplotype and postmenopausal breast cancer risk: a case control study. Breast Cancer Res. 6, R437-R449 (2004).

160

233. Fan, J. B., Chee, M. S. & Gunderson, K. L. Highly parallel genomic assays. Nat Rev Genet 7, 632-644 (2006).

234. Curran J., Lea R., rutherford S., Weinstein S. & Griffiths L. Association of estrogen receptor and glucocorticoid receptor gene polymorphisms with sporadic breast cancer. International Journal of Cancer (Pred. Oncol. ). 95 , 271-275 (2001).

235. Koper JW. et al. Lack of association between five polymorphisms in the human glucocorticoid receptor gene and glucocorticoid resistance. Human Genetics 99 , 663-668 (1997).

236. Russcher H. et al. Two polymorphisms in the glucocorticoid receptor gene directly affect glucocorticoid-regulated gene expression. The Journal of Clinical Endocrinology and Metabolism. 90 , 5804-5810 (2005).

237. Lin RC, Wang WY & Morris BJ High penetrance, overweight, and glucocorticoid receptor variant: case-control study. Br. Med. Journal 319 , 1337-1338 (1999).

238. Lin RC, Wang WY & Morris BJ Association of coronary artery disease with glucocorticoid receptor N363S variant. Hypertension. 41 , 404-407 (2003).

239. Lin RC, Wang WY, Dalziel B., Caterson ID & Morris BJ Association of obesity, but not diabetes or hypertension, with glucocorticoid receptor N363S variant. Obes. Res. 11 , 802-808 (2003).

240. Ikeda Y. et al. A polymorphism in the promoter region of the glucocorticoid receptor gene is associated with its transcriptional activity. Endocr J. 48. , 723-726 (2001).

241. Lei SF et al. Polymorphisms of four bone mineral density candidate genes in Chinese populations and comparison with other populations of different ethnicity. J Bone Miner. Metab. 21 , 34-42 (2003).

242. van Rossum EFC et al. Identification of the Bcl I polymorphism in the glucocorticoid receptor gene: association with sensitivity to glucocorticoids in vivo, and body mass index. Clin. Endocrinol. 59 , 585-592 (2003).

243. Murray JC, Smith RF, Ardinger HA & Weinberger C RFLP for the glucocorticoid receptor (GRL) located at 5q11-5q13. Nucleic Acids Research. 15 , 6765 (1987).

244. Weaver JU, Hitman GA & Kopelman PG An association between a BclI restriction fragment length polymorphism of the glucocorticoid receptor locus and hyperinsulinaemia in obese women. J. Molec. Endocrinol. 9, 295-300 (1992).

245. Watt GC et al. Abnormalities of glucocorticoid metabolism and the renin- angiotensin system: a four-corners approach to the identification of genetic determinants of blood pressure. J. Hypertension. 10 , 473-482 (1992).

161

246. Buemann B et al. Abdominal visceral fat is associated with a BclI restriction fragment length polymorphism at the glucocorticoid receptor gene locus. Obesity Research. 5, 186-192 (1997).

247. Rosmond R et al. A glucocorticoid receptor gene marker is associated with abdominal obesity, leptin, and dysregulation of the hypothalamic-pituitary-adrenal axis. Obes. Res. 8, 211-218 (2000).

248. Tremblay A et al. Long-term adiposity changes are related to a glucocorticoid receptor polymorphism in young females. J. Clin. Endocrinol. Metab. 88 , 3141- 3145 (2003).

249. Crawford D. & Nickerson D. Definition and clinical importance of haplotypes. Annual Review of Medicine. 56, 303-320 2005.

250. van Rossum E. et al. A polymorphism in the glucocorticoid receptor gene , which decreases sensitivity to glucocorticoids in vivo, is associated with low insulin and cholesterol levels. Diabetes. 51 , 3128-3134 (2002).

251. van Rossum E. et al. The ER22/23EK polymorphism in the glucocorticoid receptor gene is associated with better survival and low C-reactive protein levels in elderly men. Am. J. Med. (2004).

252. van Rossum E. et al. The ER22/23EK polymorphism in the glucocorticoid receptor gene is associated with a beneficial body composition and muscle strength in young adults. J. Clin. Endocrinol. Metab. (2004).

253. van den Akker E. et al. Glucocorticoid receptor polymorphism affects transrepression but not transactivation. The Journal of Clinical Endocrinology and Metabolism. 91 , 2800-2803 (2006).

254. van Winsen L. et al. Glucocorticoid receptor gene polymorphisms associated with more aggressive disease phenotype of MS. Journal of Neuroimmunology. 186 , 150-155 (2007).

255. Rajeevan M. et al. Glucocorticoid receptor polymorphisms and haplotypes associated with chronic fatigue syndrome. Genes Brain Behav. 6, 167-176 (2007).

256. McManaman J. & Neville M. Mammary physiology and milk secretion. Advanced Drug Delivery Reviews. 55 , 629-641 (2003).

257. Rosen J., Wyszomierski S. & Hadsell D. Regulation of milk protein gene expression. Annu. Rev. Nutr. . 19 , 407-436 (1999).

258. Rothman K. & Greenland S. Introduction to stratified analysis. In Rothman K, Greenland S, editors. Modern Epidemiology. 256-257 (1998).

162

259. Boffetta P. & Pearce N. Epidemiological studies on genetic polymorphism: study design issues and measures of occurrence and association. In Vineis P. , Malats N. , Lang M. , d'Errico A. , Caporaso N. , Cuzick J. , Boffetta P. , editors. Metabolic polymorphisms and susceptibility to cancer. 97 (1999).

260. Knight J. et al. Genetic variants of GPX1 and SOD2 and breast cancer risk at the ontario site of the Breast Cancer Family Registry. Cancer Epidemiol Biomarkers Prev. 13 , 146-149 (2004).

261. Bernstein J. et al. The CHEK2*1100delC allelic variant and risk of breast cancer: screening results from the breast cancer family registry. Cancer Epidemiol Biomarkers Prev. 15 , 348-352 (2006).

262. Figueiredo J., Knight J., Briollais L., Andrulis I. & Ozcelik H. Polymorphisms XRCC1-R399Q and XRCC3-T241M and the risk of breast cancer at the Ontario site of the Breast Cancer Family Registry. Cancer Epidemiol Biomarkers Prev. 13 , 583-591 (2004).

263. Bernstein J. et al. Population-based estimates of breast cancer risks associated with ATM gene variants c.7271T>G and c.1066-6T>G (IVS10-6T>G) from the Breast Cancer Family Registry. Human Mutation. 27 , 1122-1128 (2006).

264. Hardenbol P. & et al. Multiplexed genotyping with sequence-tagged molecular inversion probes. Nat.Biotechnol. 21, 673-678 2003.

265. McLaughlin JR, Kreiger N, Marrett LD & Holowaty EJ. Cancer incidence registration and trends in Ontario. Eur J Cancer. 27 , 1520-1524 (1991).

266. Dominguez F. & et al. Accuracy of self-reported personal history of cancer in an outpatient breast center. J Genet Couns. 16 , 341-345 (2007).

267. Hunter D. & et al. A genome-wide association study identifies alleles in FGFR2 associated with risk of sporadic postmenopausal breast cancer. Nature Genetics. Advance online publication. 2007.

268. Meijsing SH, Elbi C, Luecke HF, Hager GL & Yamamoto KR The ligand binding domain controls glucocorticoid receptor dynamics independent of ligand release. Mol. Cell. Biol. 27 , 2442-2451 (2007).

269. Ismail P., Lu T. & Sawadogo M. Loss of USF transcriptional activity in breast cancer cell lines. Oncogene. 18 , 5582-5591 (1999).

270. Chodosh L. Expression of BRCA1 and BRCA2 in normal and neoplastic cells. J Mammary Gland Biol Neoplasia. 3, 389-402 (1998).

163 APPENDIX A

STATISTICAL ANALYSIS

Student t-Test

In order to determine if differences between transfection values are statistically significant, Student’s t-tests were performed using Microsoft Excel based on the following formulae:

¡ 2 2 2 = ( 1 / n1)+( 2 /n2)

¡ t = (x1 – x2)/ where is the standard deviation of each treatment n is the number of replicates for each treatment x is the mean of each treatment

The degrees of freedom were calculated according to the following formula:

Df = (n 1 + n 2 – 2) where n is the number of replicates for each treatment

The calculated t value produced a corresponding tabulated p value which was interpreted as follows:

p = 0.05 < calculated ¢ value significant (*)

p = 0.005 < calculated ¢ value very significant (**)

p = 0.0005 < calculated ¢ value very highly significant (***)

Calculations for Real-Time PCR

In order to compare the expression of the BRCA1 gene vs the control TBP gene, a 2-∆∆Ct value is calculated which compares the differences in the number of cycles at which PCR amplification is exponential for the test and control samples for each of the untreated and treated cells. This value is determined according to the following equation:

Value = 2 -∆∆Ct

Where ∆∆Ct = [(Ct BRCA1 – Ct TBP )untreated - (Ct BRCA1 – Ct TBP )treated

164 Densitometry Calculations

To determine whether a significant difference in protein concentration was produced by addition of GR-targeted siRNA to HeLa cells, the SP1 control and siGR Western Blots were analyzed using the Histogram function of Corel PhotoPaint. The difference in band colour intensity for each of the H1 empty vector and siGR was determined with the following calculation:

(255-siGRmean (GR blot) ) – (255-background mean (GR blot ))*area / (255-siGRmean (SP1 blot) ) – (255-background mean (SP1 blot) )*area

where mean refers to the colour intensity within an area (in pixels) selected to include the band of interest.

165

APPENDIX B

BRCA1 PROMOTER ELEMENT CONSTRUCTS

Probe Name Strand Sequence

FRAG 1 plus GAATTCTTCCTCTTCCGTCTCTTTCCTTTTACGTCATCCGGGGGCAGACT minus ATTCAGTCTGCCCCCGGATGACGTAAAAGGAAAGAGACGGAAGAGGAAGA

RIBS plus GAATTCTTCCTCTTCCGTCTCTTTCCTT minus AATTAAGGAAAGAGACGGAAGAGGAAGAATTC

UP plus CCTTGGTTTCCGTGGCAACGGAA minus AAGGTTCCGTTGCCACGGAAACC

mUP plus CCTTCTTTTAAGTTTCAACGGAA minus AAGGTTCCGTTGCCTATTCAACC

UPFR6 plus CCTTGGTTTCCGTGGCAACGGAAAAGCGCGGGAATTACAG minus CTGTAATTCCCGCGCTTTTCCGTTGCCACGGAAACC

USGAm plus CCTTGGTTTAAGTGGCGGTTTAAAAGCGCGGGAATTACAG minus CTGTAATTCCCGCGCTTTTAAACCGCCACTTAAACC

BrCREO plus CTTTCCTTTTACGTCATCCGGGGGCAGACT minus AGTCTGCCCCCGGATGACGTAAAAGG

166