TRUSTEES OF GULF OF MANNAR BIOSPHERE RESERVE TRUST
1. Chairperson Chief Secretary to Government of Tamil Nadu 2. Vice Chairman Principal Secretary to Government, Environment and Forests Department 3. Official Member Principal Chief Conservator of Forests, Chennai 4. Official Member Principal Chief Conservator of Forests & Chief Wildlife Warden, Chennai 5. Official Member Principal Secretary to Government, Rural Development Department, Chennai 6. Official Member Principal Secretary to Government, Finance Department, Chennai 7. Official Member Chairman, Tamil Nadu Pollution Control Board, Chennai 8. Official Member Secretary to Government, Animal Husbandry, Dairying & Fisheries Department, Chennai 9. Official Member Secretary to Government, Tourism & Culture Department, Chennai 10. Official Member Joint Secretary to Government, Ministry of Environment and Forests, Government of India, New Delhi (Representative of Government of India) 11. Official Member Inspector General, Commander, Coast guard region (East), Chennai 12. Official Member District Collector, Ramanathapuram 13. Official Member District Collector, Thoothukudi 14. Official Member Deputy Commissioner, Customs and Central Excise Department, Ramanathapuram 15. Official Member Conservator of Forests, Virudhunagar Circle, Virudhunagar 16. Official Member Director of Fisheries, Chennai 17. Special Invitee Wildlife Warden, Gulf of Mannar Marine National Park, Ramanathapuram. 18. Special Invitee Programme Analyst, Energy Environment Unit, UNDP, New Delhi. 19. Special Invitee Assistant Country Director & Programme Head, Environment and Energry Division, UNDP, New Delhi. 20. Non Official Member Executive Director, M.S.Swaminathan Research Foundation, Chennai. 21. Non Official Member Executive Director, DHAN Foundation, Madurai. 22. Member Secretary Chief Conservator of Forests & Trust Director, Gulf of Mannar Biosphere Reserve Trust, Ramanathapuram COMPENDIUM OF RESEARCH FINDINGS ON BIODIVERSITY CONSERVATION AND SUSTAINABLE USE IN GULF OF MANNAR BIOSPHERE RESERVE
VOLUME - 2
March 2012
Gulf of Mannar Biosphere Reserve Trust Ramanathapuram - 623 504, Tamil Nadu, India This publication has no commercial value. It is for circulation among various stakeholders and researchers.
March 2012
Published by Gulf of Mannar Biosphere Reserve Trust Ramanathapuram - 623 504, Tamil Nadu, India
Typeset and Printed by Rehana Offset Printers, Srivilliputtur - 626 125, Phone : 04563-260383, E-mail : [email protected] Debendranath Sarangi, I.A.S., Secretariat Chief Secretary Chennai - 600 009
T R S U H TH P A UM LONE TRI
MESSAGE FROM THE CHAIRMAN
I am immensely pleased to learn that the Gulf of Mannar Biosphere Reserve Trust (GOMBRT), an organization specially created to facilitate conservation and sustainable management of coastal and marine biodiversity in Gulf of Mannar region, has caused publication of "Vol-II Compendium of Research findings on Bio-diversity conservation and sustainable use in Gulf of Mannar Biosphere Reserve" at this juncture when UN has declared the theme for the International Biodiversity Day of 2012 as "Coastal and Marine Biodiversity Conservation". The publication also gains significance as the parties to the Convention on Biological Diversity (CBD) would meet later this year at Hyderabad, India to resolve issues concerning integration of coastal and marine biodiversity management with issues of Disaster Risk Reduction and Climate Change Adaptation. The Gulf of Mannar Biosphere Reserve is a mega coastal and marine biodiversity hot spot in the entire continent inhabiting over 4000 species of marine flora and fauna, besides undiscovered microbes like marine viruses. The Trust was commissioned by the Hon'ble Chief Minister of Tamil Nadu in the year 2002 to establish partnership with fisherfolk and other stakeholders in conserving this globally significant assemblage of biodiversity. The Trust has since been spearheading a community movement on awareness creation and capacity building of all stake holders, especially of women and marginalized fishing communities. The Trust has, since inception, commissioned 25 numbers research and monitoring projects on coastal and marine biodiversity conservation and its use. Findings of these studies are disseminated to the fishers who are engaged in the primary production system and the knowledge, thus, gained enables the fishing community to manage the marine resources sustainably. The Trust published its first volume of the Research Compendium last year which dwelt on the habitat management of sea grasses, corals and fishery resources of the region. Volume-II of the Compendium, now released showcases vital research findings pertaining to conservation and management of corals, pearl fishery, molluscs and seaweeds. It also advocates scientific fishing practices to be adopted in the region besides suggesting legislative provisions for Natural Reserve Conservation. This is an outstanding collection which provides a comprehensive review of the unique nexus of high biodiversity environment and many programmes working to sustain them. I fervently believe that findings of these research initatives of the Trust will enhance the capacity of the fishing community and other stakeholders in sustainably managing the rich, but fragile coastal and marine eco-system of Gulf of Mannar Biosphere Reserve. I congratulate the scientists and the staff of the Trust for having brought out this practical and useful publication with significant level of field applicability and adaption. I.A.S., C.V. Sankar, Environment and Forests Dept. Principal Secretary to Govt. & Secretariat Vice Chairman, T Chennai - 600 009 Gulf of Mannar Biosphere Reserve Trust R S U H TH P A UM LONE TRI
FOREWORD
The Gulf of Mannar Biosphere Reserve Trust (GOMBRT) came into existence as a result of the Millennium Development Goal 7 (Ensure Environmental Sustainability) with the aim of integrating the principles of sustainable development into country policies and programmes and to reverse the loss of environmental resources. In addition to being a national priority, the Gulf of Mannar also assumes global significance and importance as this area falls in the Indo-Pacific region, which is considered to be one of the world's richest marine biological resource spots. Consequently, the Gulf of Mannar has been chosen as a biosphere reserve because of its unique biology and ecology. The GOMBRT is a special purpose vehicle to work on the theme of conservation and was established in 2002 with a focus on the documentation of the marine resources of this region. The project titled "Conservation and Sustainable use of the Gulf of Mannar Biosphere Reserve's Coastal Biodiversity" came into vogue keeping in view the overall objective to conserve the Gulf of Mannar's globally significant assemblage of coastal and marine biodiversity and to demonstrate, in a large biosphere reserve with various multiple uses, ways and means to integrate biodiversity conservation into coastal zone management plans. The Trust awarded and funded projects to 24 reputed Marine Research Institutions in the country. The research findings of the first 10 of these projects was complied and brought out as a Compendium of Research Findings Vol. I in 2011. The outcomes of the remaining 14 projects are now being brought out as Vol. 2. I congratulate GOMBRT for bringing out a publication of this nature to create awareness on the plant and animal life of the Gulf of Mannar region and the threats they face. I would like to make special mention of the efforts of Dakshin Foundation, Bangalore in compiling these research findings and also express my heartfelt appreciation to the Technical Staff of GOMBRT for editing these scientific documents.
(C.V. SANKAR) Principal Secretary to Government Environment and Forests Department õ k | A Ì µ ª _
Chennai - 15. Gautam Dey, I.F.S., u Principal Chief Conservator of Forests
Á ® õ´ ø ¾ ©÷¯ öÁÀ
MESSAGE
Tamilnadu has a coastline of 980 kms. that supports livelihood of over 9 lakh fisher community. Gulf of Mannar, situated in the Indo-Pacific region from the south of Pamban pass, is a global repository of coastal and marine bio-diversity with over 4000 floral and faunal species, many of which are endemic and endangered. Due to over harvesting of marine resources by the fishing community - whose livelihood is solely dependent on the marine eco-system - the gulf region was losing its richness and health in recent decades. To facilitate conservation and use of marine diversity sustainably through community participation, the Gulf of Mannar Biosphere Reserve Trust (GOMBRT) was commissioned by the Government, with UNDP-GEF funding in the year 2002, to create awareness and build capacities of all stakeholders, chiefly the fisher folk. The Trust has conducted research studies on various thrust areas of marine eco-system management and has published this Compendium of research findings - Volume II dealing with conservation and management of corals, sea grasses, molluscs and seaweeds. I am pleased to observe that these research findings would enhance the capabilities of the fisher folk and other stakeholders in managing these resources sustainably. I congratulate the scientists and officials of the Trust in their endeavor.
CHENNAI 15. (GAUTAM DEY, I.F.S.) õ k | A Ì µ ª _
O/o. Principal Chief Conservator of Forests Rakesh Vasisht, I.F.S., u Principal Chief Conservator of Forests Panagal Maaligai, Saidapet
Á Chennai - 600 015 and Chief Wildlife Warden ® õ´ ø ¾ Phone : 24321738 ©÷¯ öÁÀ E-Mail : [email protected]
MESSAGE
The Gulf of Mannar Biosphere Reserve Trust, a Non-Governmental Organisation of the State of Tamil Nadu was commissioned by the Hon'ble Chief Minister in 2002, to promote awareness, build capacities and enhance the livelihood options of coastal communities in the Gulf region, who are predominantly dependent on Marine resources for their livelihood. The Trust has conducted 24 research studies, through reputed academic institutions on vital habitats of Coral reef, seagrass meadows, mangroves, fin fishes, crustaceans, molluscs, etc. of the region. Findings of these studies are disseminated to all Stakeholders, especially the fishermen, which enhances their capacity to sustainably manage these resources through community participation. It gives me great pleasure to learn that the Trust has caused publication of Volume 2 of its research findings as a compendium. These studies have gone into indepth sustainable habitat management of seagrasses, seaweeds and corals. It also recommends scientific fishing practices to aid conservation of marine biodiversity. The officials of the Trust and the academicians deserve special commendation for their dedicated efforts in support of the cause of eco-system management of the Gulf of Mannar Biosphere Reserve.
CHENNAI 15-03-2012 GULF OF MANNAR BIOSPHERE RESERVE TRUST (GOMBRT) (A Statutory Trust of the Government of Tamil Nadu)
S. Balaji, I.F.S., Gulf of Mannar Biosphere Reserve Trust Chief Conservator of Forests 102/26, Jawan Bhavan First Floor and Trust Director Kenikarai Ramanathapuram - 623 503
PREFACE
The Gulf of Mannar Biosphere Reserve Trust (GOMBRT), founded by the Hon’ble Chief Minister of Tamil Nadu in 2002, endeavours to promote fisher community participation in conservation and sustainable management of coastal and marine biodiversity resources of the Gulf of Mannar region, which is the richest biodiversity repository in the Continent. About 4050 species of marine floral and faunal diversity has been recorded to occur in the region, many of which are endemic. The UNDP-GEF, in partnership with the Government created an autonomous special purpose vehicle institution in Gulf of Mannar Biosphere Reserve Trust to create awareness and enhance capacity building of various stakeholders, including marginalized fisherwomen folk, in sustainably using the mega marine biodiversity, which is retrograding fast due to intense anthropogenic factors, especially over exploitation of fishery resources and habitat degradation and destruction. As a measure of enriching the knowledge base of the marine resource users, the Trust has so far conducted 25 numbers of research studies on thrust areas of marine biodiversity management, which have a direct and significant bearing on the livelihood of the coastal community is Gulf of Mannar region. The knowledge thus gained is published as “Vol.-II – Compendium of Research findings on Biodiversity Conservation and Sustainable Use in Gulf of Mannar Biosphere Reserve”. These research studies pertain to status and management of critical marine biodiversity such as corals, sea grasses, crustaceans, mollusks, anemones, sea weeds etc. These research findings, specific to the management and use of biodiversity of the region, would be of immense benefit to all the stakeholders, especially to the fisher community, who eventually use them for their livelihood. Publication of this useful Research Compendium coincides with the year of the meeting of parties to the Convention of Biological Diversity (CBD) at Hyderabad, India as also during the year which has the theme as the “Year of Coastal & Marine Biodiversity”. I am thankful to Mr.Srinivasan Iyer, Assistant Country Director, Ms.Lianchawii, Programme Analyst of the UNDP for their support in causing this publication. I am highly grateful to Thiru. Debendranath Sarangi, I.A.S., Chief Secretary to Government and Chairman of Gulf of Mannar Biosphere Reserve Trust and Thiru.C.V.Sankar, I.A.S., Principal Secretary, Environment and Forests Department, Government of Tamil Nadu and Vice Chairman of the Trust, who are dedicated conservationists. The visionary guidance of the Chairman and the Vice – Chairman is a strengthens us in facilitating conservation of this region’s rich marine biodiversity for posterity and livelihood of the future generations of fisher community. I take this opportunity to place on record my heart felt gratitude to them for their unstinted support and guidance in the administration of the Trust and to the cause of marine biodiversity conservation. I thank all the marine scientists who have undertaken the research studies, without whose dedicated efforts the publication of this Compendium would not have been possible. I gratefully acknowledge the painstaking efforts of Ms.Aarthi Sridhar of Dakshin Foundation, Bangalore, Dr.V.Deepak Samuel, Programme Specialist, UNDP, Dr. T.Anbalagan, Biodiversity Programme Officer of the Trust and other staff members of the Trust in compilation of these research studies.
S. Balaji, I.F.S. CONTENTS
11. Analysis of Fishing Practices of Gulf of Mannar Biosphere Reserve management strategy for the Gulf of Mannar 203
12. Assessing Interactions and Connectivity between Critical Habitats in the Gulf of Mannar Biosphere Reserve 216
13. Interrelationship Between Critical Habitats and Ecosystems Found in the Gulf of Mannar Biosphere Reserve 229
14. Status and Distribution of Scheduled Molluscs and their Associated Fauna in Mandapam and Keelakarai Group of Islands 238
15. Study on the Current Status of Scheduled Molluscs along the Tuticorin Coast of the Gulf of Mannar Marine National Park 253
16. Seaweed Diversity and Sustainable use in the Gulf of Mannar Biosphere Reserve management strategy for the Gulf of Mannar 268
17. Scientific Information Available on the Octocorals of Gulf of Mannar 277
18. Octocorals of Gulf of Mannar : A study of the Vembar Group of Islands 284
19. Octocorals of Gulf of Mannar : A study of the Keezhakkarai Groups of Islands 295
20. Reveiw of the Sethusamudram Ship Canal Project - Mitigation and monitoring measures as a management strategy for the Gulf of Mannar 311
21. Enhancing Legislative Provisions for Natural Resource Conservation in the Gulf of Mannar Biosphere Reserve 326
22. Current Status and Distribution of Microbial Diversity and Mangrove Associated Microbial Fauna in Mandapam Group of Islands, Gulf of Mannar Biosphere Reserve 343
23. Pearl Fishery in the Gulf of Mannar Biosphere Reserve 356
24. Preliminary Survey on Plant Animal Interactions and their Impact on the Recovery of Insular Flora of the Mandapam Group of Islands in the Gulf of Mannar Marine National Park 367
25. Role of Microbial Chitinase from Marine Crustacean Shell as a source of Fungicide and Insecticide 376 Published by the Gulf of Mannar Biosphere Reserve Trust
Analysis of Fishing Practices of Gulf of Mannar Biosphere Reserve
science outreach series no 11 Work Title: Analysis of Fishing Practices of Gulf of Mannar Biosphere Reserve management strategy for the Gulf of Mannar
Funding Agency : Gulf of Mannar Biosphere Reserve Trust, Ramanathapuram
Implementing Fisheries College and Research Institute, Thoothukudi Institution:
Duration : 1 Year
Cost : Rs. 13,69,130/ - INTRODUCTION biodiversity. The report also contains Fishing activities of Gulf of Mannar have an recommendations for better fishing old tradition. The fishery resources of Gulf of management options in the Gulf of Mannar. Mannar (GoM) is characterized by multi species Project objectives and is rich in biodiversity. Coral reefs mangroves i. To document the fishing crafts and gears and and seagrass ecosystems are often referred to as fishing practices in use in the GoM. ‘life supporting systems’ and harbour a variety of fauna and flora in the Gulf of Mannar region. ii. To study the fishing pattern and practices by Fishers of this coast were largely depend on traditional fisherman in the Gulf of Mannar traditional fishing gears and they mainly exploted region during 1990s. the coastal fishery resources before the 1960’s. iii. To undertake case studies on the impact of After the introduction of trawl gears and using different types of crafts/gears used in mechanized fishing boats during the 1960’s current fishing practices. fishers landed high fish catches especially high iv. To assess the current status of shallow and value demersal shrimps. Fishing effort also deep water fishing in terms of increased with in this region with the addition of fishers/crafts/gears involved. stern trawlers. Due to this increment in the v. To asses the damages and disturbance to marine fishing effort the fishery resources and biodiversity conservation (with specific ecosystems like coral reefs and seagrass beds are reference to scheduled species) through current impacted. This was clearly reflected in the practices and to analyze by-catch data to catches during late the 1970’s and early 1980’s. determine loss of biodiversity both in This led to a sudden deptetion of stocks. Due to qualitative/quantitative terms. the non selective nature of trawl gears and shore seines serious damage was caused to the marine vi. To study the cost benefit analysis of fishing biodiversity. Trawl gears became known as practices being followed currently in order to ‘bulldozers of the sea’ and are a big threat to the understand the levels of exploitation and biodiversity of the Gulf of Manner. preferences for current practices. This study aims to study the existing vii. To suggest suitable ecofriendly fishing gear and fishing practices and their impact on marine fishing methods in the GoM.
203 Fishing activities in Gulf of Mannar hour duration. All the boats should return the The fishing activities of Gulf of Mannar can concerned fishing harbour before 10.00pm. broadly be classified into mechanized sector and These timings help the traditional fishing boats traditional fishing sector. Mechanized fishing venture into the sea without any conflicts. sector mainly comprising stern trawlers Traditional fishing boats operating bottom and midwater trawl nets Vallam, catamaran and FRP boats come targeting fishes and shrimps. The traditional under the category of traditional fishing boats. sector is comprised of motorized and sailing These boats are mainly operated during night vallams, catamarans and FRP boats. The hours in Gulf of Mannar coasts. traditional fishing crafts mainly operate gillnets, lines, traps and mini trawls. Fishing gears like Vallam gillnets and lines are highly sective in nature. Vallam is one of the traditional fishing Mechanized trawlers boats operating in the Gulf of Mannar coast and targets fishes and shell fishes. During the 1980’s Mechanized trawlers of Gulf of Mannar vallams were fitted with inboard and outboard are mainly constructed by country wood. Stern engines using engine power mainly to reach Gantry-Gallow arrangements and mechanical fishing grounds and to return to shore. Presently winches are essential to operate trawl net and all nearly 90% of vallams are motorised. The typical the boats are fitted with these two. The Over All ‘V’ bottom vallams are popularly known as Length (OAL) of mechanized trawlers are ‘Thoothokkudi vallam’. The overall length of ranging between 35-62 feet and they use Marine vallams of this region ranging between 21-36 Diesel engines with engine power ranging feet. between 100hp to 300hp. Rameswaram, Pamban, Mandapam, Keelakarai, Ervadi, Valinokkam, Catamaran Vembar, Thoothukkudi, Veerapandianpattanam The body of the Catamaran is made by and Chinnamuttam are the fishing harbours in lashing wooden logs together. Catamarans are Gulf of Mannar coast where the mechanized known to never sink. The overall length of trawlers operate. In Taruvaikulam also catamaran ranges between 13-20 feet and most mechanized boats are available but they are not of the catamarans are motorized with outboard trawlers and mainly use gill nets and lines. These engines between 10-15hp. Catamarans are boats have all the features of trawlers except mainly operated for gill netting, long lining, gantries and winches. Midwater trawl nets with seining and trapping. After the 2004 Indian Ocean the aim to catch midwater fishes such as perches, tsunami, catamarans were replaced by FRP boats tuna, squid and cuttle fishes from the depth of in many places of the Gulf of Mannar. 5m-500mits. Bottom trawl nets are operated mainly to catch bottom dwelling fishes and shell FRP boats fishes. Tickler chains and rollers (both wooden Fibre Glass Reinforced Plastic (FRP) is a and rubber) are fitted on the foot rope of a synthetic material used for the construction of majority of bottom trawl nets. Depending on the small classes of fishing boats. After the 2004 season and target species trawlers operate with tsunami, FRP boats were given to fishermen of the aim of catching shrimps, fishes like Odonus the Gulf of Mannar coast. The process of spp, cuttle fish and molluscan shells. The construction, maintenance, operations of FRP mechanized trawlers leave the fishing harbours in boats are much simpler when compared to the early morning hours and reach fishing wooden material. The overall length FRP boats of grounds in 2 to 4 hrs. duration and each boat this coast ranges from 18-30 feet and they are operates nets for about 4 to 5 hauls of each one fitted without board engines.
204 Number of Crafts in parts of the Gulf of Mannar
Trawler Vallam Cattamaram Fibre S.No. Place Length Length Length Length Number Number Number Number (feet) (feet) (feet) (feet) 1. Rameshwaram 1200 35-52 30 29-35 2 13-16 - - 2. Pamban 120 34-58 150 22-36 3 14-18 - - 3. Mandapam (South) 110 34-53 40 21-32 - - - - 4. Olaiguda - - 90 21-34 30 14-17 - - 5. Dhanuskodi - - 80 22-34 10 13-17 - - 6. Keelakarai 27 39-54 60 19-29 5 14-16 - - 7. Bharathinagar - - 80 19-31 2 14-17 - - 8. Eruvadi 90 37-53 120 21-35 3 14-17 - - 9. Valinokkam 11 39-49 180 23-33 15 16-18 - - 10. Vembar 38 35-49 80 22-30 5 14-17 5 22-28 11. Tharuvaikulam 50 (Not 38-52 350 23-36 - - - - trawler) 12. Vellapatti - - 80 22-31 12 14-18 3 22-28 13. Thoothukudi 350 38-62 ------14. Inico nagar - - 100 22-33 5 14-18 25 22-29 15. New beach - - 60 22-31 12 13-18 30 22-28 16. Thireshpuram - - 180 23-36 4 13-17 5 22-28 17. Punnakayal - - 150 22-35 3 13-18 75 20-29 18. Thiruchendur - - - - 5 14-19 220 22-29 19. Kombudurai - - - - 6 14-18 180 22-29 20. Manapadu - - 15 22-33 7 14-19 350 22-24 21. Periyathalai - - - - 4 14-19 290 22-29
22. Veerapandiapattanam 8 36-50 - - 7 14-19 150 22-29
Number of Fishing Gears
140000 120000 117278 100000 83389
80000 74637 60000 Numbers
40000 26175 11973
20000 7850 4790 3254 3509 638 1229 800 1589 0 425 Gill nets Trawl Shore Boat long line trap others nets seine seine Years
1990 2005
205 Fishing gears midwater for fishes. In Gulf of Manar 8 different types of fishing Roller trawls – Roller madi methods are practiced. Each fishing method has Roller trawlers are bottom ttrawls specific fishing gears to capture fish and shell fishes operated on the rockey bottom. Rollers made of in this coast. rubber and wood are rigged in the foot rope which 1. Trawling, 2. Gill netting, 3. Shore seining, 4. Line will help the net to roll over the heard rockey fishing, 5. Purse seining, 6. Trapping, 7. Skin diving and bottom. hand picking, 8. Cast netting Mixture trawl – Mixture madi Trawling Mixture trawl is commonly used in Trawl nets are bag like large sized gears and Rameswaram and Mandapam coasts. Single trawl are towed through water to catch different target net is used to catch both shrimps and fishes. The species in their path. Trawl gears were introduced in catch from this net will have the mixture of shrimps Gulf of Mannar coast in late 1960’s. cotter boards and fishes. are mainly used to keep the net open horizontally. Kilathi trawl – Kilathi madi Rectangular other boards are used in Gulf of Mannar coast. Thereare 8 different types of trawl Special types of trawl net used to operate in nets are recorded in Gulf of Mannar coast. the deep sea (more than 250m depth) of Thoothukudi coast to catch Odonus niger fishes. 1. Shrimp trawl – Iral madi, 2. Fish trawl – Meen madi, 3. Bull trawl – Rettai madi, 4. Roller trawl – Cuttle fish trawl – Kanavai madi Roller madi, 5. Mixture trawl – Mixture madi, This trawl net is mainly used to catch cuttle 6.Kilathi trawl – Kilathi madi, 7. Cuttle fish trawl – fishes and squids and operated in the middle of the Kanavai madi, 8. Chank trawl – Chank madi water column. Shrimp trawl – Iral madi Chank trawl – Sangu madi Shrimp trawl is bottom trawl net mainly Heavy sinkers are attached in the foot rope operated to capture shrimps in Gulf of Mannar. of chank trawl net to make the foot rope to go 3 or Shrimp fishing grounds are mainly muddy bottom. 4 inches deeper in the muddy bottom. This will Heavy iron chain called ‘Tickler chain’ is attached in facilitals to sieve the molluscen shells available on the foot rope of the trawl net and during the the sea bed. operature the iron chain will disturb the bottom Gill netting elorolling shrimps. Fishermen of this coast are operating bottom trawl from 5mts to 500 mts. In Gillnets are walls of netting which may be addition to the target species these nets are also set at water column. Gill netting is probably the catching large quantities of by catch i.e. non oldest form of net fishing having been no use for targeted species. thous ends of years. Fish that attempts to swim through the net which is caught if they are of a size Fish trawl – Meen madi large enough to allow the head to pass through the Fish trawl is operated in the middle of the meshes but not the rest of the body. The fish then water column. Number of floots will be increased becomes entangced by the gills as it attempts to and sinkers in the foot rope are reduce to mate the back out of the net. As the mesh size used depends net float above the ground size of the fish trawl upon the species and size range being targeted then will bigger than bottom trawl net. nets could be used as a tool for requleting the fisheries. There are 21 different types of gillnets are Bull trawl – Rettai madi in use along Gulf of Mannar coast. The gill nets are Very big trawl net is operated with two either drifted or fixed to catch different species of trawlers. Bull trawl is mainly operated in the fishes.
206 Technical details of gill nets in the Gulf of Mannar
Surface gill net S.No. Local name of Mesh size Net length Season Fathom Depth of the Gillnet (mm) (fathom) operation 1. Mural valai 50 25-30 All days 3-150 2. Maya valai 85 22 July-September 01/04/40 3. Echa valai 60 18 May-July 50-70 4. Salai valai 36 14-16 All days 10-13 5. Soodai valai 40 17 October – 5-40 December 6. Ayala valai 60 19 All days 8-34 7. Nethili valai 13 September – 8-10 October 8. Kilaikan valai 42 100 All days 3-5 9. Ooli valai 40 100 December – July 3-6 10. Fish net – No. 3 90 21 October – April 2 ½ - 23
Mid water S.No. Local name of the Mesh size Net length Season Fathom Depth of Gillnet (mm) (fathom) operation 1. Paruvalai 118 100 May-June 25-300 2. Seela valai 110 25 June-October 30-260 3. Keerimeen salai valai 32 18 November – 10-22 April 4. Colour valai 56 19 All days 10-25 5. Fish net – No. 3 90 21 October – 2 ½ - 23 April 6. Fish net – No. 4 75 21 All days 7-30
Bottom set water
S.No. Local name of the Mesh size Net length Season Fathom Depth of Gillnet (mm) (fathom) operation 1. Nandu valai 80 20 All days 5-15 2. Singhi valai 130 19 February- 20-50 November 3. Sangu valai 135 22 January- 3-40 February 4. Thirukkai valai 410 24 May-July 5-16 5. Thangoosi valai 55 22 All days 8-20 6. Fish net – No. 4 75 21 All days 7-30
Technical details of trammel nets in the Gulf of Mannar S.No. Local name of the Mesh size Net length Season Fathom Depth of Gillnet (mm) (fathom) operation 1. Discovalai 200-250 18 July- 22 (Large) September 38-48 (Small)
207 Shore seining total length of about 1000– 1500 mts. The olai Shore seines are old fishing gear valai is a small and older type of shore seine targeting mainly fishes nearshore. This big net normally operated by 5 to 6 people. Palm leaves requires nearly 25-50 people to operate it. Two are attached along the ropes of the olai valai. types of shore seines operate in Gulf of Mannar These nets are operated in Thoothukudi, and they are the karai valai and olai valai. The Ramaswaram and Valinokkam areas of Gulf of karai valai is a very large shore seine having a Mannar.
Technical details of shore seine nets in the Gulf of Mannar
S. Local name of the Mesh size Net length Season Fathom Depth of No. Gillnet (mm) (fathom) operation 1. Oolai valai 28 300 All days 3
2. Veechu valai 30 1-2 All days ½ fathom
Line fishing
Line fishing is considered one of the most and line and operate in nearby areas. After 2-3 fuel efficient fishing methods. Line fishing can be hours of operation the fishers head back to the classified into a) pole and line and b) long lining. vallam and towards the shore. Long lining is a Long lines along Gulf of Mannar mainly target popular passive fishing gear in Gulf of Mannar high value fishes. The size of fish caught is coast. A basket contains 200 fish hooks. Five to six determined by the hook size and the type of bait baskets will be carried per boat with crab meat. used. Pole and line fishing is also used to catch Squid meat, and sardines are also used as bait. fishes near the shore. A special type of line fishing Fishes having high economic value are caught by is practiced along the Keelakarai coast of Gulf of these lines and the quality is good when Mannar, where a vallam will carry 15 – 20 compared to fishes caught by other methods. fishermen with a small float made of thermocole. Purse seining – Surukkumadi Each fishermen will have their own lines for Though these nets are banned in Tamil catching squids and cuttlefish. After reaching the Nadu fishers continue to operate purse seines in fishing ground each fisherman will take their float the Gulf of Mannar.
Technical details of cast nets in the Gulf of Mannar
S. Local name of the Mesh size Net length Season Fathom Depth of No. Gillnet (mm) (fathom) operation 1. Veechu valai 30 1-2 All days ½ fathom
208 Fish traping Mannar coast The fishing pressure in terms of Fishing by traps is quite common and an number of fishermen population, number of old technique to catch serranid fishes, lobsters fishing boats and number of fishing gears and crabs. Walls or compounds of netting / net employed in Gulf of Mannar coast compared with like are set out in a particular way and anchored 1990’s with present situation. to the sea bed so that once fish enter they are A 34% of increment in fishing populations prevented from leaving the trap. The selectivity of was recorded over the past 15 years. Nearly 1.5 trap nets is mainly determined by the size of the lakh fishermen were added to the population of mouth or the entrance of the trap. Fish traps in Gulf of Mannar in the last 15 years and it is said the Gulf of Mannar are fabricated with bamboo that this population is composed of erstwhile splits. In the Gulf of Mannar traps are operated at farmers, from the fisher population itself and a depth of 3-5 mts. The advantage of using traps is toddy tappers. A 57% increment in the that fish are alive and their quality is high. Around mechanized trawlers, 71% increment in vallam 10 fish traps are tied with a line and suitable (both motorized and sailing) and 68% increment weight and keep underwater for 2-3 days. The in the catamaram (outboard and sailing) was also used traps are dried well before the next use. recorded. Since the tsunami, the number of Catamarams or small sized vallams are used to catamarans have considerably reduced and carry the traps to rocky bottom areas and coral replaced by FRP boats. Around 3500 FRP boats beds which are most suitable. are presently in operation in Gulf of Mannar. Cast neting The growth of fishing gears operating in the region is very high and this includes both Locally called veechu valai the cast net is trawl nets and gill nets. There has been a operated by single fishermen at a depth of 2 mts. considerable reduction in the number of shore Hand picking / diving seines, boat seines and long lines. Fishing traps have increased by 52% and these gears are Generally molluscan shells, sea employed mainly in and around coral reef areas. cucumbers, shrimps are caught by hand picking Another reason for the increment in the number and diving methods. of fishing traps, is that fishing traps require less Fishing nets operated along Gulf of manpower and energy for their operation.
209 Fishing grounds of Gulf of Mannar
Information on fishing grounds in the Gulf were also tabulated in the following table. Totally of Mannar were compiled through interviews there are 111 fishing grounds from Rameswaram with fisherfolk. The nature of the fishing ground to Periyathalai. and dominant fish species of each fishing ground
S.No. Area No. of fishing grounds 1. Rameswaram coast 8 2. Mandapam 14 3. Keelakarai 7 4. Chinna Ervadi 15 5. Valinokkam 9 6. Tharuvaikulam 5 7. Thirespuram 9 8. Thoothukudi fishing harbour 23 9. Punnakayal 5 10. Veerapandian pattinam 5 11. Tiruchendu r 11 Total 111
210 Comparison of fishing pressure in the GoM between 1990’s and 2007
Particulars Numbers in Numbers in 2007 Increment 1990’s Fishermen population 2,61,809 4,01,846 +34% Number of Boats 1. Mechanized trawlers 1857 4260 +57% 2V. allam 3878 13165 +71% 3. Catamaran 2452 7634 +68% 4. FRP boats -- ( ? ) 4000
Comparison of fishing pressure in the GoM region between 1990’s and 2007
Numbers in Particulars Numbers in 2007 Increment 1990’s Number of Fishing Gears 1. Gillnets 83,389 1,17,278 +29 % 2. Trawl net 3,509 7,850 +55 % 3. Shore seine 1,229 638 -52 % 4. Boat seine 800 425 -47 % 5. Long line 74,637 26,175 -65 % 6. Trap 1,589 3,254 +52 % 7. Others 4,790 11,973 +60%
211 The catch of species of scheduled animals in various fishing nets Gill nets: the surface gill nets were able to turtles and dugongs occasionally. catch shark species and some of the nets such as Shore seines: They have mostly only landed sea mayavalai and the echa valai even caught thorny grasses and chanks with an occasional report of rays and sea fans. Mid water gill nets such as the sea cows and sea cucumbers landing in the same. paru valai and the seeru valai also targeted shark Trammel nets: the disco valai is known to land species. Sea turtles and dugong were reported many species of coral, sea fans, sponges and sea occasionally in these nets. Bottom set nets horses. however seem to catch the largest number of Trawlers: the ‘paul’ trawler is said to land almost scheduled species with nets such as the Nandu, all species of scheduled animals and plants. Singhi and Sanghu valaicatching corals, sea fans, Almost all trawlers appear to land sea turtles, sea shark, chank, sponges rays, and sea grasses. The horses, sea fans, and many molluscan species. Thirukkai valai is also reported to have caught sea
Particulars Qty / 300kg % Shrimps 5-10 kg 1.5 – 3.00 Fishes of high commercial value 25-50 kg 8.50 – 16.50 Trash fishes 75-150 kg 25 – 50 Cuttle fish & Octopus 5-10 kg 1.5 – 3.00 Star fishes 5-10 kg 1.5 – 3.00 Sponges 25-50 kg 8.50 – 16.50 Sea fanChank & Molluscan shells 1-2 kg 0.30 – 0.60 Sea urchin 10-20 kg 3.00 – 6.00 Sea Cacumber 2-5 kg 0.60 – 1.50 Sea weeds 2-10 kg 0.60 – 3.00 Lobsters 5-10 kg 1.5 – 3.00 Crabs 1-2 kg 0.30 – 0.60 Sea horse 1-2 kg 0.30 – 0.60 Turtle Traces – Others Rare – 10-15 kg 2.00 – 3.00
Commercially valuable catches - 10 – 20 % Trash fishes - 25 – 50 % Discards - 20 – 40 %
212 Economics of Fishing Practices of Gulf of Mannar
One of the objectives of the present study gears were used by the mechanised sector was to estimate the cost and returns of fishing compared to 42 different types of fishing gears practices in the Gulf of Mannar region. This was used by the nonmechanised sector apart from 3 done by a ) comparing the economics of fishing types of line fishing gears. practices through mechanised and non- mechanised fishing in the region and b) by Comparison between mechanised and analysing the changes in the economics of fishing nonmechanised fishing practices in the region before and after the The investment in mechanised sector was involvement of GoMBRT. five times higher than in non-mechanised sector. Methodology The Number of fishing trips performed by mechanised sector works out to 221 in a year The fishing villages spread along the Gulf whereas it was 192 fishing trips in a year in of Mannar were selected for the study. A nonmechanised sector. The cost of fishing was pretested interview schedule was used as the higher in the case of mechanised fishing when tool for data collection. Information on investment in fishing, costs of and returns from compared to non-mechanised fishing. fishing, number of fishing trips, catch obtained, The catch per fishing trip was thrice value of fish caught from both mechanised and higher with mechanized fishing compared to nonmechanised sectors before and after the nonmechanised fishing whereas the value of involvement of GoMBRT in the region were catch was seven times higher from mechanized collected from the respondent fishermen. The fishing than non-mechanised fishing indicating data collected were analysed and results that the high value fishes were landed more by presented. the mechanized fishing crafts compared to Results nonmechanized fishing. Data were collected from 134 The net returns realised from mechanised respondents of which, 86 fishermen operated fishing was seven times higher in the case of mechanised fishing crafts and 48 respondents mechanised fishing (Rs,31,718 per fishing trip) used non-mechanised crafts for fishing earlier when compared to non-mechanized fishing whereas now 125 respondents use mechanised (Rs.4,278 per fishing trip) indicating the crafts and only 9 respondents operate non- possibility of increased catch and income per mechanised crafts. In terms of gears, 12 different fishing trip through mechanized fishing.
213 Changes in the economics of fishing before and after the involvement of GoMBRT The cost of fishing has increased over the returns obtained from the non-mechanised sector years in the mechanised fishing sector mainly due to (Rs.20,455 to Rs.4,278 per fishing trip). the increased cost of inputs whereas in the non- mechanised fishing, the cost of fishing has decreased Conclusion over the years probably because of the reduced From the study, it is concluded that fishing effort in terms of use less fishing inputs and mechanised fishing is popular among the fishermen short fishing duration and short distance of of the Gulf of Mannar region. Though the operation. The number of fishing trips has increased investment for mechanised fishing was higher, many over the years in both mechanised and non- fishermen switched over from non-mechanized to mechanised sector, more in the case of non- mechanized fishing due to the increased fish catch mechanised sector from 155 to 192 fishing trips in a and income. The number of fishing trips performed year. Over this period, there was increase in the by mechanised crafts in this study was higher than number of mechanised fishing crafts, mainly that in the non-mechanised sector. The cost of because of the increased catch and income fishing, fish catch, total revenue and net revenue obtained through mechanised fishing. The number realised were higher with mechanised fishing. of mechanised fishing crafts has increased from 86 Analysis of changes in economics of fishing over the to 125 out of the 134 respondents surveyed. The years indicates that there was not much of a change catch per fishing trip did not vary much in the in the case of mechanized fishing except that of the mechanised sector over the years but there was increase in number of fishing trips. But in the case of decline in catch per fishing trip in the case of non- non-mechanised fishing, though the number of mechanised fishing (302 kg. per fishing trip to 129 fishing trips in a year increased, there was a kg. per fishing trip) probably due to reduced fishing reduction in cost, fish catch and revenue indicating effort over the years. that non-mechanised fishing became less The net returns realised by the mechanized productive and generated less income. This only fishermen did not vary much over the years served to push people towards greater whereas there was drastic reduction in the net mechanization.
214 Management options to regulate fishing practices in Gulf of Mannar coast 1. Gear restriction in the sensitive areas. 14. Bycatch Reduction and Turtle Excluding 2. Seasonal restrictions in sensitive areas. Devices (BRD and TED) for trawl gears. 3. Vessel monitoring system. 15. Fishing industry should co-operate with fishing management for sustainable use of 4. Sign Boards along the Coasts of Gulf of Mannar resources. For good understanding between the regarding sustainable use of resources. managers and industry should be established. 5. Low energy fishing such as line fishing and gill 16. Conversion of fishing boats – Trawlers into net fishing should be encouraged. Gill netters and Long liners. 6. Gear Modifications – Bottom trawls / 17. The essence of responsible fishing should be Midwater trawls popularized among fishermen. 7. Off bottom trawling and midwater trawling to 18. Ecolabelling schemes coluld be introduced be encouraged. for fishing nets – Ecofriendly, Dolphin friendly, 8. Upgrade existing fishing methods and gears Turtle friendly. more selective for better targeting. 19. Setting up community based fishing parks – by 9. Management of fisheries resources should providing FADs where there is less effort and ensure the catches are ecologically sustainable. impact. 10. Conflicts among the resources users needs to 20. Ghost fishing needs to be controlled. resolved. 21. Awareness among fisher folk. 11. Modify the bottom set gill net – to minimize 22. Quick sinking of baited hook should be the impacts. effected to prevent seabird bycatch in long lines. 12. Increase the gill net selectivity. 23. Alternative employment. 13. Encourage deepsea fishing. 24. Better utilization of bycatch.
215
Published by the Gulf of Mannar Biosphere Reserve Trust
Assessing Interactions and Connectivity between Critical Habitats in the Gulf of Mannar Biosphere Reserve
science outreach series no 12 Cover image : Wikimedia Commons
Work Title: Assessing Interactions and Connectivity between Critical Habitats in the Gulf of Mannar Biosphere Reserve
Funding Agency : Gulf of Mannar Biosphere Reserve Trust, Ramanathapuram
Implementing Centre for Advanced Studies in Marine Biology, Annamalai University Institution:
Duration : 1 Year
Cost : Rs. 10,60,185/ - INTRODUCTION
Ecological studies incorporating the also enhance the secondary productivity of coral interactions and flows of energy between reef systems by providing supplementary feeding different groups of organisms and ecosystems and nursery sites for reef species. Although have gained popularity over the past three macrolevel linkages are better known than those decades. Although it is known that coastal and at the microlevel, the latter are also known to be marine ecosystems such as mangroves, critical. Sediment deposition from land has seagrasses and coral reefs are functionally linked, positive as well as negative impacts on coral reefs this interconnectivity is often poorly explored. and seagrass habitats. Reefs serve as sediment Disturbed and undisturbed systems are also traps and provide physical protection for characterised by different pathways and seagrasses and mangrove habitats from wave productivity. The proximity of different systems action and storm surges. Mangroves also provide are also often linked with different levels of the same services to systems inland. Interactions productivity and trophic linkages. For example, between these closely tied coastal systems are the flow of dissolved nutrients from mangroves typically classified into five broad types: physical, are known to enhance productivity levels in dissolved organic matter, particulate organic seagrass systems. Mangrove and seagrass sites matter, animal migration, and human impacts.
Study Area and Sampling Locations Situated between mainland India and Sri seagrass) and 2 interfaces (mangrove-seagrass, Lanka (08° 46' N - 09° 14' N 78° 9' E - 79° 14' E ), the seagrass-coral reefs) were sampled. Gulf of Mannar Biosphere Reserve (GOMBR) is Manoli island (high mangrove, seagrass and India’s first marine biosphere reserve. The reserve coral reef cover) - Located 6 km away from extends over an area of 10,500 km2 (and a core area 2 Mandapam, Manoli island has an area of 25.9 ha. The of 560 km ), and encompasses 21 islands running island has good representation of all three parallel to the coastline of Ramanathapuram and ecosystems. Mangrove cover on the island is 9.3 ha. Tuticorin districts in Tamil Nadu. The area Dominant species include Avicenia marina, Ceriops comprises a unique set of productive coastal and tagal and Rhizophora mucronata. Seagrass habitats marine habitats including mangroves, seagrass beds are dominated by Thalassia hemprichii and Halophila and coral reefs, and equally diverse assemblage of ovalis. Coral reefs occupy 2.35 sq. km of which live species. For the present study, three different coral constitutes 40.68%. Dominants include islands in the Mandapam group were selected for Acropora species including A. formosa, Heliopora sp., sampling, namely, Manoli, Poomarichan and Hare etc. island. These islands were selected on the basis of general environmental similarity but differing levels Poomarichan island (high mangrove and and alignments of mangrove, seagrass and coral reef seagrass, poor coral reef cover) - Poomarichan cover. For example, Poomarichan island although island, located about 4 km away from Mandapam dominant in terms of mangrove and seagrass covers an area of 1.68 ha. The island has good habitats, was represented by poor coral reef mangrove habitats covering an area of 6.87 ha. habitats. On the other hand, in Manoli island, all Dominants include Avicennia marina and Ceriops three ecosystems are healthy and well represented. tagal. Seagrass habitats dominated by Thalassia These differences enabled comparison for the hemprichii and Cymodocea serrulata. Coral reefs interrelationship study. In each of the islands, five cover 2.12 sq. km, with live sampling sites, 3 habitats (mangroves, coral reefs,
216 coral accounting for 35.18% of the cover. currently very little of it remains due to human Heliopora sp., Acropora sp. and Montipora digitata activities which are considerable on this island. are dominants. Avicennia marina and Pemphis acidula are Hare island (high seagrass, poor mangrove dominant species. Dominant species in seagrass and coral reef cover) - Hare island is situated 7 habitats include Syringodium isoetifolium, Halodule km away from Mandapam. With a total area of uninervis and Enhalus acoroides. Coral reefs cover 129.04 ha, Hare island is the largest island in the an area of 13.91 sq. km of which 32.58% is vicinity. This island is characterised by good accounted to by live coral. The dominants among seagrass and coral reef habitats but has a poor corals include species belonging to the genera representation of mangroves. Although the island Heliopora and Acropora as well as the species had a good cover of mangroves historically, Sinularia intacta.
Figure: Study area
217 Objectives refractometer. Salinity of pore water present This study was carried out with the broad within soil samples was also measured in the same objective of studying in detail the interrelationship way. Pore water was collected by straining soil between critical habitats and ecosystems at the samples through a 20 ml syringe. pH microlevel to understand the current measurements were carried out with the help of a interdependent composition, to evolve protocols pH meter with platinum electrode which had an for synergic improvement of various habitats accuracy of ±0.1. Redox potential was measured with the help of a milli voltmeter with a platinum simultaneously, and to evolve management cum electrode. monitoring protocols for ensuring better inter- ecosystem production. To meet these objectives, Analysis of water samples - A number of an analysis of the following parameters were parameters were measured from water samples carried out at five sampling sites located in the using standard methodologies. These include three ecosystems in the three islands: dissolved oxygen, reactive silicate, nitratenitrogen, total phosphate, tannins, total amino acids, total • Environmental variables sugars and particulate organic carbon. • Water and sediment characteristics Analysis of sediment samples - Standard • Primary productivity methodologies were also used for analysing a • Phytoplankton and Zooplankton number of parameters for sediment samples. • Microbes associated with organic matter in These include chlorophyll-a, tannins, total amino different ecosystems acids, total sugars, and total organic carbon. • Major floral components - mangroves, seaweed, Enumeration of microorganisms, plankton, seagrasses major floral and faunal groups - Samples were • Major faunal components - fin fishes, shellfish brought back to the laboratory immediately after collection for carrying out microbial counts. • Gut content analysis of dominant macro fauna Standard methods were followed for isolating and • Fatty acid analysis of different components enumerating microbes. Prominent groups of • Stable isotope analysis of different components isolated microbes were then identified. Prominent groups of phytoplankton and zooplankton were Methods isolated and identified up to the genus level. Major Water and sediment sampling - Pre-cleaned floral components including mangroves, polypropylene containers were used to collect seagrasses and seaweed were collected. Algae water samples. Samples were collected just below associated with corals were scraped. Fish, crab and the water surface. The collected water samples shrimp samples were collected and identified. were filtered through Whatman GF/C filter paper, Analysis of benthic fauna included the analysis of and analysed for nutrients. Sediment samples were macrobenthos and meiobenthos. collected from scooping the top layer (up to 5 cm). Analysis of gut content and fatty acids - Plant roots and other debris were removed before Specimens of dominant species of fin fishes were the samples were ground to fine powder and collected. Gut content was analysed from shade-dried. Constant weight samples were dissected specimens. Food items were identified analysed for organic carbon, nutrients, major up to the species level wherever possible. Fatty elements, trace elements and heavy metals. acid analysis was carried out by converting fatty Environmental variables - Temperature acid methyl ester and analysed using gas measurements were taken using a mercury chromatography. centigrade thermometer with 0.50C accuracy. Stable isotopes analysis-Samples of of Salinity measurements were taken with a hand primary producers (such as mangrove leaves, seagrass,
218 seaweed, plankton, zooxanthellae, etc.) as well as These results, i.e. the declining trend in consumers (fish, shrimp, crabs, molluscs, dissolved oxygen, productivity, tannin, and POC etc.)were collected and analysed to for in water and chlorophyll, tannin and total organic comparison with sediment matter. Using matter in sediments from mangroves to seagrass standard methods, the samples were analysed for meadows and coral reefs, indicate that stable carbon and nitrogen isotope composition mangroves are source areas that are responsible using a mass spectrometer. for replenishing nutrients in the other two habitats. The mangrove rich Manoli island Results and Discussion (dominated by Rhizophora which has greater Nutrients and ecological parameters capacity for litter production) recorded the In the present study, an assessment of maximum values for most of these indicators, spatial and temporal variation among different whereas Hare island which had degraded nutrients and ecological parameters was carried mangroves exhibited minimum values. out. In both water and sediment, pH levels were Poomarichan which had good mangrove cover higher for coral reef areas. There were no (but dominated by Avicennia marina and Ceriops significant differences in temperature, salinity or tagal characterised by low litter redox potential. It can be inferred from these production)recorded intermediate values of values that the general physical and chemical these parameters. These results indicate that parameters are not influenced by any other mangroves are more productive than seagrass factors of the ecosystem. Dissolved oxygen was and reef habitats. The main players within higher in water samples collected from the nutrient cycles are microbes which act in two mangroves, but lower in those collected from the pathways: (1) release of nutrients through reefs. It is also likely that since water samples decomposing and dead organic matter and litter, were collected during the day, the presence of (2) the which are produced are utilised for the phytoplankton could have influenced the levels of growth and multiplication of microbes. dissolved oxygen. The presence of phytoplankton is positively related to that of nutrients and Microbial diversity organic matter. Mangroves which recorded Microbes are among the most diverse higher levels of both nutrients and organic organisms in the world. Occupying a variety of matter also recorded higher levels of habitats, many of them uninhabitable to other phytoplankton and dissolved oxygen. This groups of organisms, microbes are involved in viewpoint could be further substantiated by the primary production, decomposition, nutrient gradient of primary productivity which was cycling, trace gas production and a number of highest in mangroves followed by seagrass beds other functions. In magrove ecosystems, and coral reefs. The presence of higher levels of microbes play an important role in litter reactive silicate at the mangrove-seagrass decomposition. Nutritionally poor mangrove interface also supports this theory. This gradient leaf litter is converted into a protein rich food was also evident for tannin, particulate organic substrate by microbial action. In this study, the matter (POC), chlorophyll, etc. indicating that abundance and distribution of major microbial the mangroves are sources of these flows. Other groups were assessed for all three habitats and parameters such as nitrate in nitrogen, nitrite in their interfaces. Seasonal variation was evident as nitrogen, phosphate, total sugar, amino acids, etc. in general, the counts of all major groups of did not vary significantly. Total sugars and amino microbes were higher during post monsoon acids in sediments also did not exhibit variation. when compared with summer. The maximum No significant differences could be discerned counts for THBs were in mangroves and across seasons. minimum in coral reefs during summer as well
219 as post monsoon. Mangroves recorded the bipunctata, Lucifer hanseni, Acartia clause were maximum microbial loads (most likely as a found common in all sampling sites. Among consequence of high leaf litter) followed by phytoplankton, species such as Skeletonema sp., seagrass and reef habitats. Among other major Coscinodiscus sp., Leptocylindrus sp., Ceratium sp., groups which were assessed, cyanobacteria were were found common in all the habitats studied. In present in high numbers in coral reefs and low in summer, the dominant species of phytoplankton seagrass habitats. This result is likely to have been were Coscinodiscus sp., Skeletonema sp. and brought about by competition between nitrogen Thalassiosira sp. Dominant zooplankton species fixing bacterial and algae. Mangrove systems in summer includes Sagitta bipunctata, Acartia recorded higher values for yeast as a clause and Oithona brevicornis. consequence of the availability of organic matter. Floral analysis The overall results from microbial assessments indicate that mangroves indeed Seven species of mangroves were produce enormous amounts of litter and a recorded from Manoli including Avicennia marina, diverse array of microorganisms are employed Ceriops tagal, Lumnitzera racemosa, Bruguiera for the decomposition of this litter. As mentioned cylindrica, Pemphis acidula, Rhizophora mucronata, before, nutrient poor mangrove leaf litter is and Exoecaria agallocha. Avicennia marina and converted into a microbial protein rich detritus, Rhizophora mucronata were dominant. Seven which in turn supports detritivorous organisms species of mangroves were recorded from (especially fishes) and contributes to the energy Poomarichan as well: Avicennia marina, Ceriops and nutrient budgets of tropical estuarine tagal, Rhizophora mucronata, Lumnitzera racemosa, systems. As nutrients and microbes from Bruguiera cylindrica, Exocoecaria agallocha and mangrove systems are transported out of their Pemphis acidula. Avicennia marina, Ceriops tagal and original habitats, fatty acid biomarkers were also Rhizophora mucronata were dominant on analysed for bacteria. Poomarichan. On Hare Island, six species of mangroves were recorded including Avicennia Yeast and plankton marina, Ceriops tagal, Lumnitzera racemosa, Pemphis During the post monsoon season, counts acidula, Rhizophora mucronata and Rhizophora 4 of yeast ranged between 0.0018×10 to apiculata.Avicennia marina and Pemphis acidula 0.0027×104 cfu/g. Maximum counts were were present dominantly in this island. recorded at mangrove sites in Poomarichan, Off Manoli Island, dominant species minimum values were recorded for the coral reef among seaweed include Enteromorpha compressa, sites off Manoli. During summer, yeast counts Sargassum wightii, Gracilaria edulis and Gracilaria 44 ranged from from 0.0001×10 to 0.0013×10 foliifera. The dominant seaweed species off cfu/g. Reefs off Manoli island recorded the Poomarichan were Enteromorpha compressa, Ulva maximum values, wheras minimum values were lactuca, Padina gymnospora, Sargassum wightii and recorded in coral reefs in Poomarichan. In Gracilaria foliifera. Off Hare Island, the seaweed general, there was no variation in yeast counts species such as Ulva lactuca, Padina gymnospora, between the different islands, however, there Sargassum wightii, Gracilaria edulis, and Gracilaria were seasonal variations. foliifera were dominant. In the waters off Manoli During the post monsoon period, Island, seagrass species such as Thalassia dominant species of phytoplankton which were hemprichii and Halophila ovalis are dominant. The recorded include Cosinodiscus sp., Skeletonema dominant seagrass species off Poomarichan sp., Leptocylindrus sp. and Noctiluca sp. Dominants include Thalassia hemprichii and Cymodocea among Zooplankton include Sagitta bipunctata, serrula. Off Hare Island, seagrass species such as Lucifer hanseni, Acartia clause, Microsetella Syringodium isoetifolium, Halodule uninervis and norvegica, Oithona brevicornis (Table 10). Sagitta Enhalus acoroides were dominant.
220 Faunal analysis and Siganus javus were analysed. Diet Fin fishes - Fin fishes such as Lutjanus composition of the former mainly comprised of lunulatus and Siganus javus were dominant in the fish remains, crustaceans and copepods. Fish waters off Manoli island. Among crustaceans, remains were more for smaller sized individuals Portunus pelagicus and Penaeus indicus; and and diet composition varied significantly molluscans such as Saccostrea cuccullata and between size groups. For Siganus javus, food items Cardium bicolor were dominant. On Poomarichan, included copepod, ostracod, crustacean parts, dominant fin fish species were Lutjanus lunulatus gastropod, nematode, insect, algae, detritus, as and Epinephelus malabaricus. Crustaceans such as well as unidentified plant and animal material. The Portunus pelagicus, Penaues indicus and P. contribution of different food items varied semisulcatus; and molluscans such as Saccostrea significantly between size classes of fishes. cuccullata and Cerithium sp. were found to be However, copepods were the most preferred dominant. On Hare island, fin fishes such as food items. The gut content of Lutjanus lunulatus Epinephelus malabaricus and Mugil cephalus were and Epinephelus malabaricus were analysed for dominant. Crustaceans such as Charybdis feriata, Poomarichan. The dietary preferences of the Portunus pelagicus and Penaeus indicus, P. former were similar to that recorded at Manoli semisulcatus; molluscans; such as Crassostrea island. For Epinephelus malabaricus, fish and madrasensis and Cerithium sp. were dominant. crustaceans dominated, although the composition of content varied significantly by Macrobenthos and meiobenthos - During size class. Crustaceans recorded from the gut of the postmonsoon period, macrobenthos ranged this species included crabs, stomatopods, hermit from 18 no. /m2 to 64 no. /m2. Maximum values crabs, lobsters and both caridean and penaeid were recorded for mangroves in Poomarichan shrimp. Dominant fin fish species of Hare island and minimum at coral reefs off Poomarichan. included Mugil cephalus and Epinephelus During the summer, the numbers declined, malabaricus. The most frequently occurring food ranging from 4 no. /m2 to 12 no. /m2. The maximum items included detritus, copepods and fish was found at mangrove-seagrass site in Manoli remains. Diet composition varied significantly Island and the minimum was found at seagrasss - between size groups with copepods increasing coral reef site in Hare island. In general, there was with size. Epinephelus malabaricus displayed a no significant variation between the seasons but pattern similar to that in the other two islands. variation between sampling sites were recorded. Meiobenthos counts ranged from 102 Fatty acids as biomarkers in tracing 22 no./ m to 1112 no./m during post-monsoon. outwelling of organic matter and as Maximum values were recorded for mangroves trophic tracers in Poomarichan, minimum values were recorded Due to their biological specificity and for coral reefs off Hare Island. During the their ubiquitousness in living organisms, fatty summer, the counts of meiofauna declined and acids often serve as ideal biomarkers for living 22 ranged from 73 no. / m to 1013 no. /m . Maximum organisms. Fatty acids are often employed to counts were recorded at at the mangrove site at trace the origin and flow of mangrove derived Poomarichan and the minimum counts were for organic carbon through estuarine food webs. In the reef sites off Hare island. Variations in this study, fatty acids were used as biomarkers to meiobenthos were significant between sampling understand the out-welling of organic matter and sites. to identify links between ecosystem types. They Fish gut content analysis were also used as trophic tracers to identify The gut content of dominant fin fish potential food sources and trophic species were analysed. In Manoli, the gut contents interrelationships. of different sized individuals of Lutjanus lunulatus Saturated fatty acids have been shown to
221 dominate the fatty acid composition of all samples dissolved in the water and not accumulated in the with Palitic acid (16:0) as the most abundant. The sediment layer. With the exception of mangroves, biomarkers for bacteria (15:0 ISO, 15:O ANTEISO, the seagrass biomarker (18:2n - 6 and 18: 3 n - 3) 17:0 ISO, 17:0 ANTEISO, and 18: 1 n-7) recorded were detected in high quantities as expected. The the highest concentrations among biomarkers presence of long chain fatty acids (LCFAs) in found in sediments and suspended organic matter. sediment and suspended organic matter at all Highest values were recorded in mangrove sites. sampling points (without any distinct change) This was substantiated with the highest microbial indicate that out-welled materials from mangroves counts in mangrove samples. A strong are being utilised by adjacent ecosystems also. Fatty representation of diatoms was also recorded in acid analysis also shows that the organic matter sediment samples which was determined by a high derived from mangrove ecosystems also includes contribution of the biomarker 20:5n -3, and a other plants. The detection of LCFAs and the relatively high value of the ratio S16/S18, which is markers of vascular plants from surface sediments considered to be an indicator for benthic indicate the outwelling of POM from mangroves in phytoplankton. A biomarker for dinoflagellates, all three islands into seagrass and coral habitats. decosahezaenoic acid (DHA) 22:6 n-3, was However, the actual flow of POM from mangroves detected less in sediment in comparison to could also be driven by geomorphology, tidal action suspended organic matter, which is typical of the and precipitation. In this study, bacterial markers pelagic nature of these organisms. It is alsolikely that were more prominent in surface sediments in dinoflagellate cells sink to the bottom or are quickly mangroves in comparison with coral sediment. This decomposed leading to a loss of signature. difference is likely to be caused by higher nutrient Zooplankton components in sediment was also input and organic matter in mangrove sediments low corroborating the small quantities found in and because of a lower specific surface, C influx and suspended organic matter. The brown algal retention of C, N and P on coral sediments which biomarker (18:1n-9), and the biomarker for red are of a sandy nature. The presence of bacterial algae (205n-3/204n-6) were not dominant in biomarkers is correlated with the presence of sediment but was present in suspended organic microbes and nutrients. Bacterial biomarkers are matter at all sample points. Higher quantities of correlated with total organic carbon, particulate these samples in suspended organic matter organic carbon and LCFAs. suggests that when seaweed breaks down, it is
Levels of fatty acid biomarkers specific to different organisms in sediments collected from different sampling sites
Sediment Bacteria Dinoflagellates Diatoms Zooplankton Seaweed Seagrass Mangroves 35
30
25
20
15
10
5
0 Mangrove Mangrove S e a g rass Seagrass Seagrass Coral Coral
222 Levels of fatty acid biomarkers specific to different organisms in sediments collected from different sampling sites
Suspended organic matter
Bacteria Dinoflagellates Diatoms Zooplankton Seaweed Seagrass Mangroves 40
35
30
25
20
15
10
5
0 Mangrove Mangrove- Seagrass Seagrass- Coral Seagrass Coral
The biomarkers for bacteria (15:0 ISO, directly available to feeding bivalves from the 15:O ANTEISO, 17:0 ISO, 17:0 ANTEISO, and 18: water column, whereas benthic diatoms are 1 n- 7) recorded the highest concentrations all more likely to be found on the surface of the consumer groups. The biomarker for diatoms sediment and would need to be resuspended in 20:5n-3 was also present in small amounts in all the water column to be available to bivalves. The consumer groups that were assessed. The zooplankton biomarker component was present decosahezaenoic acid (DHA) 22:6n-3 biomarker in different consumer groups, but in small for dinoflagellates was most prominent for quantities. The brown algal biomarker (18:1n-9) molluscs than any other consumer group. The and the biomarker for red algae (20:5n-3/ 20:4n- fatty acid profiles of filter feeding species 6) were found in all consumer groups. The Crassostrea sp. were dominated by DHA (22:6n - seagrass biomarker (18:2n-6 and 18:3n-3) were 3) and 20:5n - 3 to a lesser extent after the not detected in large quantities in any of the bacterial biomarkers. These biomarkers are for consumer fish groups. LCFAs were found in dinoflagellates and diatoms which are known to quantities similar to that of diatoms suggesting be the major food sources for filter feeders. In that mangrove derived materials were also bivalves, a higher concentration of dinoflagellate consumed by fish. The presence of LCFAs (which markers were observed compared to that of are the biomarkers for mangrove leaves and diatoms. This is most likely due to the fact that terrestrial plants) in most consumer groups are dinoflagellates tend to be pelagic microalgae, indicative of the importance of these systems.
223 Composition of organism-specific fatty acids present in dominant groups of fin fish and shell fish from the three islands
Manoli Island 35 Mugil cephalus Lutjanus lunulatus 30 Siganus javus Penaeus indicus 25 Penaeus semisulcatus Charybdis feriata 20 Portunus pelagicus Saccostrea cuccullata 15 Cardium bicolor 10
5
0 Bacteria Dinoflagellates Diatoms Zooplankton Seaweed Seagrass Mangroves
35 Poomarichan Island 30 25 20 15 10 5 0 Dinoflagellates Bacteria Diatoms Zooplankton Seaweed Seagrass Mangroves
25 Hare Island 20
15 10
5
0 Bacteria Dinoflagellates Diatoms Zooplankton Seaweed Seagrass Mangroves
224 The analysis of fatty acid biomarkers relative trophic position of various organisms provide more support to the role of mangroves within the food web, while ä 13 C provides in nutrient out-welling to adjacent ecosystems information about the source of primary such as seagrass and coral reefs as well as across production as well as the flow of carbon from trophic levels. The elevated presence of branched primary producers to consumers. Average fatty acids (BrFAs) (the biomarkers for bacteria) trophic shifts of carbon and nitrogen is about 0 ‰ indicate the significance of microbial activity in and 3.3 ‰ respectively, and, ä 13 C values of sediments of the Gulf of Mannar region. The consumers typically reflect the composition of relative abundance of bacterial biomarkers assimilated food. By contrast, the value of ä 15 N declined from mangroves to coral reefs, again can be used as a measure of an organism’s trophic reflecting the greater contribution of mangroves. position. This study used the analysis of stable These results were further substantiated by the isotopes of carbon and nitrogen to understand presence of total heterotrophic bacteria which the outwelling of organic matter from different was found in greater quantities in mangroves and coastal ecosystems and also to identify the decreased off shore. Therefore it can be potential food sources of the ecosystems. suggested that mangroves generate the organic The values of ä13 C and ä15 N in both matter as well as habitat for microbes which in sediments and suspended organic matter turn decompose litter of poor nutrient quality to exhibited the same trend of depletion from highly nutritive detritus which is transported to mangroves to coral reefs through seagrasses. The adjacent ecosystems. Seagrass ecosystems also reason attributed to the enrichment of ä13 C and play a similar role, however, their smaller biomass ä15N in mangrove sediment is likely to be due to in comparison to mangroves also reduces their nutrient availability which helped in the growth impact. Although planktonic biomarkers are and multiplication of microbes and present in small quantities, the results also phytoplankton in the mangrove biotope. The indicate the importance of planktonic organic microbes and phytoplankton had more enriched matter inputs to surface sediments in all ä13C and ä15N values and hence the settlement of ecosystems. The plankton are in turn supported these organisms in the sediments and suspended by mangroves which provide essential nutrients organic matter of mangrove biotope produced through outwelling. Although this view is largely more enriched value. Meanwhile, corals and accepted, trophic studies in some circumstances seagrasses had less nutrients and hence had have failed to provide convincing evidence that lower populations of total heterotrophic mangrove organic production is indeed the basis bacteria and phytoplankton, which produced of near shore secondary production. In order to 13 15 more depleted values of ä C and ä N. Thus the examine these propositions further, an stable mangrove-derived material helped in the transfer isotope analysis was designed to study the of organic matter to adjacent coastal ecosystems. outwelling of essential nutrients from mangroves The presence of LCFAs in all sampling points to adjacent coastal ecosystems. provided additional evidences regarding the out- Stable isotope analysis welling of organic matter from the mangroves to adjacent coastal ecosystems. Hence, the present Stable isotopes are increasingly used in study revealed that the potential of a mangrove investigations in trophic ecology. Combined habitat in functioning as a source of organic analysis of carbon and nitrogen stable isotopes is inputs to the adjacent coastal ecosystems, which a powerful tool in identifying ultimate organic is evident from the stable isotope values from matter sources and trophic positions of sediments of mangroves that showed a trend of 15 consumers. ä N is often used to identify the depletion towards coral reef ecosystems.
225 Levels of stable isotopes of carbon and nitrogen in sediment and suspended organic matter in different sampling sites in the three islands
Name of the Sediment Suspended organic matter Sampling sites Island ä13C ä15N ä13C ä15N Mangroves -20.5‰ +6.1‰ -9.3‰- +.6.2‰ Mangrove - -21.9‰ +6.0‰ -11.6‰ +6.1‰ Seagrass Manoli Seagrass -22.7‰ +5.8‰ -13.8‰ +5.9‰ Seagrass-Coral -23.2‰ +5.7‰ -14.6‰ +5.8‰ Coral -24.1‰ +5.6‰ -19.6‰ +5.8‰ Mangroves -21.4‰ +5.9‰ -8.3‰- +7.5‰ Mangrove - -22.3‰ +5.8‰ -10.6‰ +7.1‰ Seagrass Poomarichan Seagrass -23.4‰ +5.8‰ -11.9‰ +6.8‰ Seagrass-Coral -23.9‰ +5.7‰ -12.7‰ +6.1‰ Coral -24.7‰ +5.4‰ -15.9‰ +5.6‰ Mangroves -20.9‰ +5.9‰ -9.6‰ +7.5‰ Mangrove - -20.4‰ +5.5‰ -12.9‰ +7.5‰ Seagrass Hare Seagrass -21.7‰ +5.6‰ -14.2‰ +6.8‰ Seagrass-Coral -21.8‰ +5.6‰ -16.5‰ +6.5‰ Coral -25.9‰ +5.5‰ -17.6‰ +6.1‰
Stable isotopes of carbon and nitrogen to primary consumers. In the present study, the 13 15 15 (ä C and ä N) in the major producers ä13C and ä N signatures for mangrove leaves (phytoplankton, zooplankton, epiphytes, clustered away from all the consumers studied, zooxanthallae, seaweeds and seagrasses) and in although values are within range of other studies. consumer groups from the islands of Gulf of However, the values of pelagic phytoplankton Mannar, in relation to different producers were were in closer value of that of consumers. This analysed. The data reveal that isotope values of all indicated that phytoplankton contributed the consumer groups are distributed very close significantly to the signature of the consumers. to plankton, but not to other producers. The Fatty acid results also support this view with the stable isotope value of the ä13 C falls in a range higher contribution of the fatty acid 20:5n- 3 by between -24.87‰ and -13.33‰ and that of ä15 N diatoms after microbes to the consumers. between +4.85‰ and +10.35‰ for all Hence, the presence of the fatty acid biomarker consumers groups. Among the producers, only of plankton and closer values of ä13 C and ä15 N plankton fall nearer to this range. Previous with the consumer leads to a conclusion that in studies have challenged the paradigm that addition to microbes, plankton also contributes mangroves provide a major source of nutrients significantly to the food web of the Gulf of Mannar.
226 The values of stable isotopes of carbon and nitrogen in different consumers and producers
Name of the 13 15 Name of the species ä C ä N group (‰) (‰)
Coscinodiscus sp. -13.2 3.5 Oithona brevicornis -15.46 3.02 Epiphytes -16.35 2.33 Producers Zooxanthalle -15.98 2.92 Ulva lactuca -17.01 2.23 Sargassum wightii -17.51 2.13 Gracilaria foliifer -18.32 2.01 Halodule uninervis -23.69 1.99 Thalassia hemprichii -21.32 2.06 Halophila ovalis, -23.91 1.92 Rhizophora mucronata -27.07 1.71 Avicennia marina -27.61 1.58 Ceriops decandra -27.32 1.59 Pemphis acidula -28.95 1.29 Mugil cephalus -12.1 4.5 Lutjanus lunulatus -12.4 4.4 Siganus javus -10.4 3.8 Penaeus indicus -8.5 5.4 Consumers Penaeus semisulcatus -8.7 5.1 Charybdis feriata -12.9 4.3 Portunus pelagicus -11.4 4.6 Saccostrea cuccullata -10.9 4.8 Cerithium sp. -10.5 4.9
Hence the present study revealed that contribution by phytoplankton becomes mangrove-derived material could not find direct progressively more significant. This decrease influences on the food web of the other coastal could be due to tidal influence, which might have ecosystem indirect effects as a source of nutrient increased the production and import of enhancer for the production of the microbes and phytoplankton but decreased the export of plankton were found. This was because the mangrove detritus to the offshore. In support of consumer groups in the present study derived this, it has been suggested that the extent of little nutrition from mangrove detritus, intertidal areas and organic matter availability as presumably as the out-welled materials are represented by tidal amplitude rather than dispersed over a wide area in the coastal waters. relative mangrove abundance have a stronger Evidence from the contribution of mangrove influence on prawn catch in tropical near shore carbon decreases in the offshore direction, as the environments.
227 Conclusions
The current study was conducted to exercises are suggested for future work: examine the interactions between mangrove, • Experimental studies on the impact of seagrass and coral reef habitats. Nutrient connecting corridors of coastal ecosystems analyses as well as fatty acid biomarkers and and/or de-linking their connections on changes stable isotope analysis, all point to a definite flow in biodiversity and productivity of ecosystems. of mangrove-derived organic matter to adjacent Such studies would provide more information habitats. The study of faunal elements in different for designing better management practices ecosystems reveals that though the direct especially with respect to augmenting marine contribution of mangroves to the food web resources. seems to be minimal, there are a number of • Studies that aim to assess the results of indirect effects whereby mangroves enhance mangrove restoration and vegetation on other microbial activities and phytoplankton blooms by coastal ecosystems which were not included in providing the nutrients. Therefore, these this study. ecosystems are functionally linked and the • Study of interactions between coastal habitats impacts on one may bring about changes in the with the help of other molecular biomarkers others. The results from this study suggest that to such as DNA, n-alkenes, terpenoids, lignins and maintain a healthier ecosystem, the three tannins. habitats need to be conserved together. However, though this study has provided base • The monitoring of interactions between critical line information, a number of gaps are yet to be habitats with respect to climate change and sea addressed. A series of research and monitoring level rise.
228
Published by the Gulf of Mannar Biosphere Reserve Trust
Interrelationship Between Critical Habitats and Ecosystems Found in the Gulf of Mannar Biosphere Reserve
science outreach series no 13 Work Title: Interrelationship Between Critical Habitats and Ecosystems Found in the Gulf of Mannar Biosphere Reserve
Funding Agency : Gulf of Mannar Biosphere Reserve Trust, Ramanathapuram
Implementing Suganthi Devadason Marine Research Institute, Tuticorin Institution:
Duration : 1 Year
Cost : Rs. 6,26,750/- INTRODUCTION study aimed to assess the physico-chemical parameters of seawater around the islands, The Gulf of Mannar Biosphere Reserve primary productivity and quantitative and (GOMBR), India’s first marine biosphere reserve qualitative analyses of plankton, patterns in is situated between mainland India and Sri Lanka macro benthos and fin fishes. An assessment of (08° 46' N - 09° 14' N 78° 9' E - 79° 14' E ). Located benthic categories on reef and seagrass habitats, off the south eastern tip of the state of Tamil coral size distribution and recruitment, seagrass Nadu, the reserve extends over an area of 10,500 species composition, biomass and shoot density km22 (and a core area of 560 km ), and were also carried out. encompasses 21 islands running parallel to the coastline of Ramanathapuram and Tuticorin Methods districts. The area comprises a unique set of Sampling was carried out in Poomarichan, productive habitats such as coral reefs, seagrass Manoli and Hare islands from October 2007 to beds, and mangroves and an equally diverse December 2008. Sampling sites were selected on assemblage of biological resources. Habitats such the basis of availability of the three habitat types as mangroves, seagrass beds and coral reefs are proximate to each other as well as their status in also fundamentally connected systems. Higher terms of cover and disturbance. Two permanent mangrove cover has been shown to be associated monitoring sites were set up for repeated with healthy reef systems particularly by way of sampling. Physical, chemical and biological protection from sedimentation from land-based parameters were measured or estimated sources as well as filtering nutrients and separately for habitat types and sites. Water particulate matter. Seagrass systems also provide samples were collected each month and analysed similar benefits to reefs. Seagrass habitats and for physiochemical parameters such as mangroves also serve as spawning and nursery temperature, salinity, transparency, pH, dissolved habitats for a number of species of animals that oxygen, TSS, and turbidity and nutrients analysis spend their adult lives on reefs. Coral reefs often was carried out using standard methods. shelter seagrass habitats and mangroves from Plantkon nets were utilised to collect plankton wave action, and the calcium carbonate eroded samples from the water surface; biomass, density from reefs provides sediment for growth. From and primary productivity were also estimated the perspective of biodiversity, since many food using standard methodologies. Macrobenthic webs encompass multiple habitats, the assessment was carried out with the help of 1 sq. maintenance of spatial linkages as well as m. quadrats. The quadrats were placed on the resource flows (e.g. nutrients, detritus and prey) shoreward side of the islands in reef as well as between habitats is important for trophic seagrass areas at depth ranges of 0.5 m to 4 m. integrity. Cross-habitat linkages can have Benthic cover assessments were carried out in important ecological impacts, especially in terms October 2007, January 2008, April 2008, July 2008 of increasing productivity and maintenance of and December 2008. Benthic cover as well as greater numbers of species and populations. coral size class distribution was assessed using the line intercept method. Coral recruit densities Objectives were assessed from 1m x 1m quadrats. A belt This study was carried out with the transect method was used to estimate the objective of assessing the interrelationship diversity and abundance of fish. Before the main between coral reefs, seagrass beds and study was initiated, a preliminary survey was mangroves in the Mandapam group of islands in conducted to assess the islands. During this the Gulf of Mannar. Interrelationships between survey, the benthic community assessment was these three potentially dynamic habitats were carried out using a manta tow method. Seagrass explored for Poomarichan, Manoli and Hare. The was assessed using 0.5m x 0.5m quadrats.
229 Results : General Descriptions and Physico-Chemical Parameters Poomarichan island is a crescent shaped the island from direct wave action. Reef patches island with an inclined narrow beach and sand about 2.5 m deep are also seen in the northern part. dunes that are covered by extensive vegetation. The Seagrass habitats are found within 100 m of the reef island is about 1.5 above msl and coral rubble is and some patches of seagrass are enclosed by reefs. seen in the southern and south western parts of the Depth range for reef habitats are 1 to 3 m whereas island. Poomarichan has rich mangrove habitats and for seagrasses depth ranges are 1 to 3.5 m. seagrass beds in its coastal waters. However, coral Hare island is the largest island in the reef habitats are not as extensive. Fringing reefs are Mandapam group. The island has poor mangroves observed around the island extending to depths but rich reef and seagrass habitiats. This island has ranging from 2 to 2.6 m. The windwards side of the an inclined and narrow, sandy coast and the land is island is protected from wave action by the reefs. about 1.5 m above msl. The western side of the Permanent monitoring sites on Poomarichan were island has a depression which is inundated during selected on the shoreward side where the seagrass high tide. On the north and northeastern parts of is adjacent to the reef are located at depths ranging the island, there is evidence of beach erosion. Coral from 1 to 3m and the reefs themselves occur rubble is dispersed along the south, southeast and between0.5 to 2.5 m. southwest coasts. Sand dunes are found on this Manoli island is an elongated island with an island and are covered by vegetation. Fringing reefs narrow, inclined sandy coast. This island has rich surrounding the island protect the island from dive coral reef, seagrass and mangrove habitats. Coral action. The reefs are on an average 2.2 m depth and rubble is found along the southern and patch reefs are found in the northwestern side at southwestern portions of the island. Sand dunes approx. 3 m depth. On Hare island, permanent which go up to a metre high in the centre of the monitoring plots are on the shoreward side. island are covered by vegetation. The northern and Seagrass habitats are located about 150 m away northeastern portions of the island are affected by from reefs. Depth for coral reefs range from 1 to 3 beach erosion, which is indicated by the presence of m and from 1 to 5 m for seagrass habitats. Ranges of submerged trees in the sea. Fringing reefs are physicochemical parameters in all three islands observed around the island extending to about 2.2 were also recorded . These values are summarised m in depth and they protect the windward side of below.
Physico-chemical factors in coral reefs and seagrass habitats in the three islands Variable Poomarichan Manoli Hare Coral reef Seagrass Coral reef Seagrass Coral reef Seagrass Temperature (0 C) 27.6 - 33.5 27.9 - 33.9 27.1 - 32.6 27.3 - 32.8 27.8 - 32.9 28 - 32.8
Salinity (‰) 34.6 - 36 34.6 - 36 34.7 - 36 34.7 - 36 33.4 - 35.5 33.4 - 35.5 pH 7.9 - 8.3 7.9 - 8.3 7.8 - 8.2 7.8 - 8.2 7.8 - 8.1 7.8 - 8.1 Turbidity (NTU) 2.6 - 10.2 2.8 - 11.2 2.9 - 11.6 2.9 - 11.6 4.5 - 9.2 3.6 - 10.2 TSS (mg/l) 51 - 86 54 - 90 51 - 105 53 - 115 53 - 95 53 - 95 Transparency (m) 0.8 - 3 0.7 to 2.5 1.1 - 3.8 1 - 3.5 1.2 - 3.1 1.1 - 2.9
Dissolved O2 (mg/l) 4.68 - 5.12 4.68 - 5.12 4.65 - 4.96 4.65 - 4.96 3.85 - 4.79 3.85 - 4.79 Ca (mg/l) 400 - 580 480 - 600 400 - 560 440 - 600 400 - 540 440 - 560 Mg (mg/l) 1234 - 1560 1234 - 1560 1234 - 1587 1250 - 1612 1210 - 1562 1210 - 1562
Phosphate (μg/l) 2.71 - 3.84 2.71 - 3.84 2.15 - 3.28 2.45 - 3.81 2.43 - 3.35 2.64 - 3.62
Nitrate (μg/l) 0.36 - 0.61 0.36 - 0.61 0.31 - 0.54 0.32 - 0.71 0.28 - 0.57 0.26 - 0.68 Nitrite (μg/l) 0.01 - 0.05 0.01 - 0.05 0.02 - 0.08 0.02 - 0.08 0.01 - 0.08 0.01 - 0.08
230 The presence of phytoplankton, zooplankton, Plankton biomass and primary productivity and primary productivity values were examined values were uniform across islands. Among for different habitat types in the three islands. macrobenthic communities, gastropods and Phytoplankton densities were not significantly bivalves were most common and showed more different across either habitats or islands. or less uniform densities in different habitat Zooplankton densities were also more or less types and islands. Polychaetes, echinoderms, uniform except for seagrass ecosystems in Hare scaphopods and crustaceans occurred in low island where densities were marginally higher. abundances in all three habitats and islands.
Phytoplankton, zooplankton, primary productivity and molluscan communities in the three islands
Poomarichan Manoli Hare Parameters Coral reef Seagrass Coral reef Seagrass Coral reef Seagrass Phytoplankton 52143 - 62547 53147 - 63452 53147 - 63542 54120 - 64250 49647 - 61245 50500 - 62050 density (cells/l) Zooplankton 10411 - 15120 11065 - 15250 10306 - 15245 11240 - 15950 10258 - 16523 11784 - 17450 density (no/m3) Plankton biomass 2 - 4.8 2.3 - 5 2.3 - 4.9 2.5 - 5.2 1.4 - 4.4 1.6 - 4.6 (g/m3) Primary productivity 3.1 - 5.9 3.3 - 6.1 3.6 - 6.5 3.9 - 6.7 3.2 - 6.3 3.4 - 6.4 (g/m3) Gastropods 4.59 - 6.18 5.87 - 7.95 4.18 - 6.31 5.2 - 7.62 5.11 - 6.74 6.04 - 7.12 (no/m2) Bivalves (no/m2) 1.69 - 3.26 1.36 - 4.62 1.96 - 4.02 1.95 - 4.53 1.94 - 4.01 1.85 - 4.25
Benthic community structure across islands corals and foliose Acropora. Recruit densities revealed highest live coral cover for Manoli island were highest for Acropora, Montipora and and lowest values for Hare island. Hare island also Pocillopora. Dominant size classes were more or recorded maximum values for DCA. Coverage of less uniform across islands with Acropora, algae was greatest for Manoli and lowest for Hare Montipora and Pocillopora recording higher values island. Values for abiotic factors was maximum in for the 6-10, 11-20 and 21-40 size classes and Hare island and lowest for Manoli. Dominant Porites, Favia and Favites being better represented corals in all islands included branching corals by 21-40 and 41-80 size classes. belonging to the genus Acropora as well as massive
231 Benthic community structure, coral recruitment and size class distributions in coral reef habitats in the three islands
Parameters Poomarichan Manoli Hare Live coral cover (%) 29.22 - 30.75 42.25 - 43.55 19.25 - 21.74 DCA (%) 31.25 - 32.85 12.87 - 16.25 33.22 - 34.52 Algae (%) 10.15 - 11.15 12.25 - 13.87 8.36 - 9.78 Abiotic factors 10.26 - 13.45 15.23 - 18.44 20.14 - 22.65 Others 13.74 - 16.74 9.22 - 14.77 14.36 - 18.11 Dominant corals Acropora (branching) - 8% Acropora (branching) - 12% Acropora (branching) - 8% Acropora (foliose) massive corals massive corals massive corals Acropora (foliose) Acropora digitate Acropora (foliose) High recruit Montipora, Acropora,Pocillopora Montipora, Acropora,Pocillopora Acropora ,Pocillopora ,Montipora densities (no/m2) Dominant size Acropora, Montipora, Pocillopora Acropora ,Montipora ,Pocillopora Acropora ,Montipora ,Pocillopora (6- classes (6-10, 11-20) (6-10, 11-20, 21-40) 10, 11-20, 21-40) Porites, Favia, Favties Porites, Favia, Favties Porites, Favia, Favties (21-40, 41-80) (21-40, 41-80) (21-40, 41-80)
Seagrass habitats - species composition, shoot density and biomass The percentage contribution of different On Manoli island, the dominant species were the seagrass species varied across islands. In same, however, actual densities were lower. Poomarichan, Cymodocea serrulata and Thalassia Highest biomass was recorded for Cymodocea hemprichii were most common. Manoli island had serrulata, Enhalus acoroides and Thalassia the same dominant species as did Hare island. On hemprichii. In Hare island, shoot densities were Poomarichan island, shoot densities were highest highest for Cymodocea serrulata and Thalassia for Cymodocea serrulata, Thalassia hemprichii, hemprichii and Syringodium isoetifolium. Seagrass Syringodium isoetifolium and Enhalus acoroides. biomass followed a similar patterm. Seagrass biomass also followed a similar pattern.
Species cover in seagrass habitats in Poomarichan Sea grass species composition
15.2% 21.3%
11.9% 2.6%
5.85%
14.95% 25.05% 3.15%
Thalassia hemprichii Halophila ovata Halophila decipiens Cymodocea serrulata Halodule pinifolia Halodule uninervis Syringodium isoetifolium Enhalus acoroides
232 Species cover in seagrass habitats in Manoli
Sea grass species composition
10.2 20.9%
16.1% 2.7%
8.15% 7.3% 3.6% 31.05% Thalassia hemprichii Halophila ovalis Halophila decipiens Cymodocea serrulata Halodule pinifolia Halodule uninervis Syringodium isoetifolium Enhalus acoroides
Species cover in seagrass habitats in Hare island
Sea grass species composition
7.82%
17.22% 31.53%
4.34%
2.87% 4.21%
32.01% Thalassia hemprichii Halophila ovalis Cymodocea serrulata Halodule pinifolia Halodule uninervis Syringodium isoetifolium Halodule wrightii
233 Fish diversity and abundance in coral reefs and seagrass habitats in the three islands
More fish species were recorded in coral Siganus canaliculatus, Sardinella gibbosa and reef habitats than in seagrass. Abundant species Odonus niger. In seagrass sites, common fish included abundant fish species were Lethrinus species included Lethrinus nebulosus, Parupeneus ornatus, L. nebulosus, Lutjanus lunulatus, L. sp., Lutjanus lutjanus, L. malabaricus, Terapon sp., malabaricus, L. fulviflamma, Carangoides Carangoides malabaricus and Sardinella gibbosa. malabaricus, Chaetodon sp., Scarus ghobban,
Fish diversity in coral reef habitats in Poomarichan island ) 2 15 12 9 6 3 0 s s s s s s .. s n s ta r a . a .. u u u u . u ca tu a tu a e .. s Fish abundance (100m t s t tus g pp rum r. a nu ic a o ic c a a a o b a l ja r n b d lu s bb ea ni ige b ru u t ulo la in o s o usselii n s a lab n u ba b a u h r i licul us m u ib n a u a e s m c g s a r n w g l m u s e s l u o on m a tro m s l us l a s e ri d s u n h d hr lla n u n s n n e n u aru n a t t rc e e s n ja m u e r c a c O o lu a t in thrinus o rid e h o a g s an r in oc e tj u us e o up p d c S i u c A ope rd g L n thr L g r m to S S n A Lu a e n a e e a Sa eph tj L ra P P a ig mm Sar in u a h a p L C S s E C P
Oct'07 Jan'08 Apr'08 Jul'08 Dec'08
Fish diversity in seagrass habitats in Poomarichan island )
2 15 12 9 6 3 0
. p p. p. us s s a s s n us u u s n n s s a ic s c o o tj r b o p u a ulo ori ib Fish abundance (100m a l g r neu s b e e lab ne a T a alab ll rup m s m e tja nu in Amphipri Pa u us inu es d L n r a hr id a et S utj L go L n ra Ca Oct'07 Jan'08 Apr'08 Jul'08 Dec '08
234 Fish diversity in coral reef habitats in Manoli island ) 2 15 12 9 6 3 0
. n r s m . s s a s us us ca o s a u . tu u u t ... c d an tu asi tu s Fish abundance (100m r. ic s a o i b ige s la appa o br n sp r mm lo b d to a n n u b ba o u la a la u a in olu c e ob ul s m ib ru a b if m a h ic u d n al al s h l g po g la eb m u is s g on s be tro A a n e r C n a d u x un lla n m s n a e thron e us fulv u e aru c O ra ro in lus m janus lun n in ides c s en o d oce e t r ethrinus orno up S u A r g h u nus ja th L g r m phe n Up oth a r p L tja ut e n a e a n S a e u L L P P g S in ra ym p L a Si E C G
Oct'07 Jan'08 Apr'08 Jul'08 Dec
Fish diversity in seagrass habitats in Manoli island ) 2 15 12 9 6 3 0
. p. p. s s . s s sp u u us . sa n . o n n s ja ric los bo o o u u bb Fish abundance (100m p ri a a p ne lu t l r i e eb a gi n m a Te p h p us ll ru n s s m a ja u e ne A ut in d P r oi rdi L h g et Sa L ran Lutjanus malaba a C
Oct'07 Jan'08 Apr'08 Jul'08 Dec '08
235 Fish diversity in coral reefs of Hare island ) 2 15 12 9 6 3 0 . n r i a m . p s s .. s a o n s e s s p a u . . s tus u s u t u . u c d a tu g a tu p s Fish abundance (100m r r a ic s a o ic c b s a o b n l r mma b lu to b la ni n l a b go u a la ulo rn a nd o o u s e b ru n if b o i ae h ic d u i n alaba o lu ab v e al s m h g l nu n g o p l u s s o s b u a tr m A s ful n nus e i C u n a u x ll n ma s i s m er r a e thron m e s nu us u r e Od n ra ne c lu ja s n in th id pe n ph ca s c e o ro di o e u o u S u th A r g h n tja thr Le g r m n Up o r p Lut tja e n a e a n Sa e Lu L a P P g Sa in u r p L a Si ym E C G
Oct'07 Jan'08 Apr'08 Jul'08 Dec
Fish diversity in seagrass in beds of Hare island )
2 15 12 9 6 3 0
. . p s sp . s . . a sp s sus . s n n s a nu icu o o o o io tj r b b Fish abundance (100m p a u l a pr lu b la r eneu a a e hi s l neb m a g ib T p p a ll ru m s s e m a jan u u n A s n ide P ri o rdi Lut n u th a ja e S ut L L arang C
Oct'07 Jan'08 Apr'08 Jul'08 Dec '08
236 Summary and Recommendations
During the study period (October 2007 seagrass habitats, coral cover is relatively poor. to December 2008), considerable increases were The latter could be due to pollution especially recorded for live coral cover as well as recruit from the Madapam fishing harbour. density. With respect to individual parameters, in Considering the current Poomarichan, live coral cover increased from interrelationships between the three 29.22 to 30.75 between samplings. The ecosystems, it is important to develop percentages of DCA, algae, abiotic factors and conservation as well as management strategies others were 30.55, 10.5, 13.32 and 24.88 which include monitoring as well as restoration respectively. Manoli also recorded an increase protocols. Regular, seasonal monitoring could be from 42.25 to 43.55 during the same period. attempted on parameters of significance. For DCA, algae, abiotic and other components were reef and seagrass habitats, these could include 12.89, 13.87, 15.32 ad 14.33 respectively. In the monitoring of physico-chemical (e.g. habitats off Hare island, the percentage of live temperature salinity, pH, nutrients, turbidity, TSS coral increased from 33.22 to 34.52%. The and sedimentaton. Biological factors that could percentages of DCA, algae, abiotic and others be investigated for reefs include: were 20.11, 8.56, 21.11 and 15.7 respectively. · Percentage cover of corals, sponges, algae and Among corals, Acropora, Montipora and Pocillopora non-living material (i.e. dead coral, rock and sand. showed high recruit densities followed by Porites, · Species composition and size structure of coral Favia and Favites. Size class distributions were communities. more or less the same, however, a few new recruits skipped to the next size class and a few · Coral larval recruitment. got added on. · Numbers, species composition, size and Fish abundance was fair in most islands structure of fish populations. and both coral as well as seagrass ecoystems · Juvenile fishes, especially target and indicator shared a number of common species indicating species. strong linkages. No significant changes were · Extent and type of coral disease. observed in seagrass abundances. Among · Extent of coral bleaching macrobenthos, gastropods and bivalves were Biological factors which could be studied for most commom. Physico-chemical parameters seagrass systems include: which were analysed from the three sites and islands, show little variation. Micro and macro · Species composition and size structure of sea benthos were also uniform as were density of grass communities. plankton, biomass and primary productivity. · Assessment of associated fauna and flora on sea The presence of rich reef, seagrass and grass community. mangrove habitats in Manoli island point to · Numbers, species composition, size and strong interrelationships between these three structure of fish populations. ecosystems in exchanging species and resources. · Fishes, especially target species. Athough Poomarichan has rich mangrove and
237
Published by the Gulf of Mannar Biosphere Reserve Trust
Status and Distribution of Scheduled Molluscs and their Associated Fauna in Mandapam and Keelakarai Group of Islands
science outreach series no 14 Work Title: Status and Distribution of Scheduled Molluscs and their Associated Fauna in Mandapam and Keelakarai Group of Islands
Funding Agency : Gulf of Mannar Biosphere Reserve Trust, Ramanathapuram
Implementing Department of Oceanography and Coastal Area Studies Institution: Alagappa University, Thondi Campus, Thondi
Duration : 1 Year
Cost : Rs. 9,96,791/ - INTRODUCTION Located between the Indian mainland and population of over 200,000 and a significant Sri Lanka (08° 46' N - 09° 14' N 78° 9' E - 79° 14' E), proportion of people are directly dependent on the off the south eastern tip of the state of Tamil Nadu, resources of the Gulf of Mannar for their livelihood. the Gulf of Mannar Biosphere Reserve (GOMBR) Although a zone of global conservation significance, was established as India’s first marine biosphere the region faces a number of problems relating to reserve in 1986. Extending over an area of 10,500 overexploitation of its resources. Overfishing and 22 km (and a core area of 560 km ) the region other unsustainable fishing practices, illegal coral comprises a unique set of productive habitats mining, aquaculture and coastal development are including coral reefs, seagrass beds, and mangroves threatened the already fragile ecosystems. Fishing and a diverse assemblage of biological resources and associated activities are carried out in the associated with them. The GOMBR encompasses waters surrounding most of the islands. Over 650 21 islands running parallel to the coast of mechanised vessels and 2500 traditional craft Ramanathapuram and Tuticorin Districts. The operate from the 47 fishing villages located on the coastal buffer zone of the park also supports a coast. The ecology and importance of molluscs Molluscs are a diverse group of soft-bodied shells (350 species), Gastropoda such as snails and animals with a range of body structures typified by slugs (37,500 species), and Cephalopods such as common molluscs such as clams, oysters, snails, octopus and squid (600 species). Molluscs have slugs, squid and octopus. A few features are been an important food source for humans for common to most species and these include their several millennia. Other species have been characteristic crawl motion on a single, flat, exploited for their potential to serve as luxury muscular foot and a body which would at least have goods, industrial products and to produce dyes and a suggestion of a head at one end and an anus at the chemical compounds. On account of their other. In most mollusc, the body structure is also tendency to accumulate heavy metals and other characterised by a mantle which secretes a hard pollutants many species of molluscs now serve as external shell (or shells made of calcium carbonate useful indicators of pollution and water quality. The and other minerals and covered by an outer complex venoms of a number of species of periostracum) which is mounted on a visceral molluscs (e.g. cone snails) are being increasingly hump that contains the internal organs. Currently, finding use in pharmaceutical and cosmetics seven primary classes are recognised: the wormlike, industries. As prominent members of marine shell-less Aplacophora (250 species), ecosystems, molluscs also play a very important Monoplacophora (10 species), Bivalvia such as role in maintaining the integrity of food chains clams (7500 species), Polyplacophora such as performing multiple roles as detritivores, chitons (600 species), Scaphopoda such as tusk herbivores, grazers or predators.
238 Records of exploitation of molluscan resources from the Gulf of Mannar The pioneering work of molluscs in Tamil A number of molluscan resources have Nadu was carried out by Melvill and Standen in been exploited from the Gulf of Mannar region. the late 1870s as well as Preston around 1911 and While some species are used as food, other 1916. Molluscan resources of the Gulf of Mannar species bring significant revenues on account of region have received considerable attention on their use for industrial and ornamental purposes. account of their subsistence and commercial A number of species are also in demand by shell value and also as subjects of subjects of study by collectors. Commonly exploited clam resources naturalists and taxonomists. Earlier include Meritrix, Katelysia, Paphia, Anadara, and investigations in the Gulf of Mannar include the Villorita. Other genera which are exploited in work of Francis Henry Gravely from the 1920s to moderation include Perna and Placenta. Although the 1940s which resulted in publications on Crassostrea (oyster)are not very common, these molluscs as wells collections for the Madras are exploited wherever they are available. An Government Museum. In the 1940s further work assessment of bivalve and gastropod resources on molluscs in Tamil Nadu and the Gulf of Mannar by CMFRI scientists in 2004 provide a good idea Region was carried out by Crichton (1940, 1941) of the degree of exploitation of some of the and Satyamoorthy from the 1940s to the 1970s. species. Large numbers of Xancus pyrum (chank) The recent contributions by Subba Rao and Day as well as Hemifusus pugilinus were recorded (2000) as well as Subba Rao (2003) are also from trawl landings in the region. significant.
239 Methods In the Mandapam group of islands, the each transects, 4-8 quadrats were laid to record mollusk survey was carried out in the waters the status of mollusks. A quadrat was further surrounding the seven islands: Shingle, Krusadai, divided into 16 subdivisions each measuring 25 Pullivasal, Poomarichan, Manoliputti, Manoli and cm x 25 cm. Intertidal areas, reef habitats and Hare. In the Keelakarai group, the islands seagrass beds were sampled. Seagrass- as well as surveyed include Anaipar, Valimunai, Appa, coral reef associated molluscs were recorded. Poovarasanpatty, Thalaiyari, Vali and Mulli. In each Gastropods and bivalves were sampled of the islands, 7-8 transects were randomly laid separately. Sampling was carried out using from the shore up to a distance of 150 metres. snorkeling and SCUBA diving. The depth ranged from 0.5 to 1.5 metres. Within
240 Present Status, Distribution and Threats of Scheduled Molluscs of Mandapam and Keelakkarai Groups of Islands (Intertidal Area and Underwater Observations)
In the Mandapam and Keelakarai groups a total number of individuals. Placenta placenta and total of 854 individuals belonging to 11 scheduled Pleuroploca trapezium were the most common species were recorded. The maximum number of among these and found at all sites. Two scheduled species were recorded from Anaippar which molluscs, Strombus plicatus and Cassis cornuta recorded 8 species. Poomarichan, Manoliputti, were represented by a single individual at Mulli and Thalaiyari recorded the lowest species Pullivasal and Krusadai respectively. Pullivasal richness (5 species each). Their representation recorded the maximum number of individuals, ranged from 5 to 8 species and 2.6% to 8.9% of Poovarasanpatty recorded the least.
Scheduled molluscs collected from Mandapam and Keelakarai groups of islands
Scheduled No
molluscs Mulli Valai Hare Hare Appa Single Manoli Talaiyari Talaiyari Krusadai Krusadai Anaippar Anaippar Pullivasal Valimunai Valimunai Manoliputti Poomarichan Poomarichan Poovarasanpatty Poovarasanpatty
1 Placenta placenta 34 52 59 62 23 29 55 32 29 48 23 43 21 39 2 Pleuroploca 18 19 13 23 10 8 13 9 11 21 2 19 12 17 trapezium 3 Lambis chiragra 4 - - 4 - 1 2 1 3 6 2 3 2 3 4 Lambis truncata 2 5 6 3 2 3 - 1 2 3 - 2 1 2 5 Lambis chiragra - 2 3 - 1 - 1 - 1 2 1 3 2 1 arthritica 6 Lambis crocea - 1 1 3 2 - 1 - 1 2 1 1 1 1 7 Lambis scorpius 2 - - 1 - 3 1 1 2 1 - - - 1 8 Lambis millipeda - - - - - 1 ------1 - 9 Strombus plicatus - - - 1 ------10 Cassis cornuata - 1 ------11 Tudicla spirilus 1 - - 1 ------1 Species richness 6 6 5 7 5 6 6 5 7 7 5 6 7 8
Total individuals 61 80 82 98 37 44 73 44 47 83 29 71 40 65 Percentage 5.5 7.2 7.5 8.9 3.4 4.0 6.6 4.0 4.2 7.5 2.6 6.5 3.6 5.9
241 242 Present Status, Distribution and Threats of Scheduled Molluscs and their Associated Fauna of Mandapam and Keelakkarai Groups of Islands
When compare across islands in both the recorded from Poovarasanpatti whic recorded groups, Thaliyari recorded the maximum number only 36 species. A maximum density of more than of associated species followed by Hare, Appa and 12 individuals per sq. Krusadai. The lowest species richness was
Density and total number of species identified in Mandapam and Keelakarai groups of islands
S.No Name of the Island Total no of Species Density No/m2 Identified
1 Shingle Island 48 9.97
2 Krusadai Island 52 12. 31 3 Po omarichan Island 44 12.61 4 Pullivasal Island 48 11. 07 5 Manoliputti Island 44 9. 96 6 Manoli Island 41 8. 53 7 Hare Island 57 12. 6 8 Anaipar island 44 10. 50 9 V ali Munai 47 7. 56 10 AppaIsland 54 9. 98 11 Poovarasan Patti 36 8. 73 12 Talaiyarai island 64 10. 52 13 V ali island 47 9. 93 14 Mulli island 44 9. 93
243 244 Survey and Identification of Scheduled Molluscs in Fish Landing Centres from Kundukal to Valinokkam
Eleven fish landing centres from Kundukal accounted for the maximum number of Point to Valinokkam were selected to survey individuals (7179). P. trapezium which was scheduled to collect details about scheduled recorded from all sites except Sethukarai mollusc landings, and to compile information on recorded 7007 individuals. L. cornuta recorded people involved in skin diving and craft that were the minimum number of individuals and was utilised for collections. These included Kundukal recorded only from two sites. Among landing Point, Pamban, Madapam, Vethalai, Pudumadam, centres, mollusc diversity within bycatch ranged Muthupettai, Periapattinam, Keelakarai, from a single species to 4 species. While Sethukarai, Ervadi and Valinokkam. Monthly Sethukarai recorded only one species, average landings of molluscs as well as other Pudumadam and Ervadi recorded 4 species. The commerically important species were calculated number of scheduled molluscs were greatest at and seasonal variations recorded. Kundukal Point where they accounted for 2761 A total of 15161 individuals belonging to individuals and over 18% of catch. Periapattinam five species of scheduled molluscs were recorded recorded the least number of individuals (455) from the landing centres. These included and the lowest percentage of scheduled molluscs. Pleuroploca trapezium, Placenta placenta, Lambis With the exception of Sethukarai, gastropod millipeda, L. truncata and L. cornuta. Among these, P. diversity was greater in comparison to the placenta was recorded from all 11 centres and diversity of bivalves.
Scheduled molluscs collected from 11 fish landing centres
Scheduled No. molluscs Valai Valai Mulli Hare Hare Manoli Manoli Shingle Shingle Talaiyari Talaiyari Krusudai Pullivasal Pullivasal Manoliputti Poomarichan Poomarichan Poovarasanpatty Poovarasanpatty
1 Pleuroploca 780 1538 868 680 759 568 320 - 763 578 153 trapezium 2 Placenta placenta 1832 170 890 1800 108 348 135 865 678 112 241 3 Lambis millipeda - - - - 210 - - - - 141 - 4 Lambis truncata 149 42 - 149 ------72 5 Lambis cornuta - - - - 160 - - - - 158 - Species richness 3 3 2 3 4 2 2 1 2 4 3 Total individuals 2761 1750 1758 2529 1237 916 455 865 1441 989 460
Percentage 18.21 11.54 11.59 16.68 8.15 6.04 3.00 5.70 9.50 6.52 3.03
245 This survey also recorded mechanised After the northeast monsoon collection is done boats, catamarans, vallam and vathai as the by skin diving. Commercially important species primary craft which were used in the villages. of gastropods are harvested by somewhere During the fishing season about 70 to 100 craft between 200 to 400 skin divers who earn were utilised for this purpose. In all 11 landing between Rs. 500 - Rs. 2500 based on the season centres, considerable quantities of gastropods and the amount of fishing that was carried out. and bivalves were recorded as bycatch. Mollusc Species that are collected using this technique harvests were maximum during the monsoon include P. trapezium, Xancus pyrum and Chicoreus and lowest during the summer. ramosus. Gastropod fishery in much of the Gulf of Most commercially important gastropods Mannar region was initially associated with are collected for their shell and operculum. Shells lobster fishery. Gastropods were collected as are collected as part of bycatch while bottom bycatch from this fishery, but if lobster fishing was trawling, lobster netting or by skin diving. Sales of affected in any way, the former was also impacted. shells are carried out at the fish landing centres to More recently, due to escalating demand, middlemen who resell the shells to shell gastropods are targeted using separate nets. industries for export.
246 Present Status, Distribution and Threats of Scheduled Molluscs and their Associated Fauna in the Coastal Region (Intertidal Area) from Mandapam to Valinokkam Intertidal areas proximate to the 11 fish survey, the scheduled species P. placenta was landing centres were also surveyed for scheduled recorded in all the sites. Pamban, Pudumadam molluscs and their associated fauna. Across sites, and Sethukarai were the maximum number of the species richness ranged from 14 to 22 this species was recorded. The lowest abundance species. The highest species richness was of P. placenta was recorded from Muthupettai and recorded at Kundukal Point and Vathalai. Species Valinokkam. In Sethukarai, exploitation of bivalve richness was lowest at Sethukarai. In all sites, resources, particularly P. placenta has been for gastropod diversity was greater than that of was for the collection of pearls as well as empty bivalves. Gastropod and bivalve richness shells for the ornamental shell collection. reflected a pattern similar to that of overall Extensive collection of the same species was also species richness, i.e. highest in the two sites with reported from Vellapatti near Tuticorin for food maximum species richness (Kudunkal Point and as well as for the use of shells in the cosmetic, Vathalai) and lowest at Sethukarai. During the paint, poultry feed and lime industries.
Species richness of molluscs at 11 intertidal sites from Kundukal Point to Valinokkam No. of gastropod No. of bivalve Total no. of Percentage (%) Area species species species scheduled molluscs Kundukal Point 14 8 22 1.8 Pamban 11 6 17 3.0 Mandapam 10 6 16 2.5 Vethalai 14 8 22 2.9 Pudumadam 10 7 17 3.2 Muthupettai 11 7 18 1.3 Periapattinam 11 7 18 1.6 Sethukarai 9 5 14 3.0 Keelakarai 10 5 15 1.7 Ervadi 13 6 19 2.4 Valinokkam 11 5 16 1.4
247 Methods and Patterns of Exploitation of Molluscs in the 11 Fish Landing Centres and Surounding Areas
Mandapam - In the Mandapam area, more than molluscs species that were recorded include P. 400 mechanised boats are utilised for fishing. trapezium and Placenta placenta. Catamarans and inboard motor boats, especially Kundukal Point - Kundukal Point situated near STBs are primarily in use. Shingivalai, thirukai Pampan is a site where fishermen from valai, gill nets and trawl nets are the main types of Keelakarai and Valinokkam make temporary gear which are utilised in this area. Chanks are fishing visits. Skin diving for gastropods is carried harvested from substrates comprised of dead out in sites around Kundakal and Vethalai. The coral reef and sand, and harvesting is done from peak season for fishing is from December to July. depths ranging from 4 m to 5 m. The peak About 45 to 50 vallam and 25 to 30 crafts are harvesting season starts in July and ends in employed for this purpose. At the landing centres December. The Mandapam area has 50 to 60 considerable quantities of Chicoreus ramosus and divers who are engaged in gastropod extraction. Fasciolaria trapezium were recorded. Other Depending on the season and the catch, divers species found as by-catch include Murex trapa, earn between Rs. 1500 and Rs. 2000 each day. Murex tribulus, Lambis lambis, Chicoreus virgineus, Considerable quantities of mollusks were also Hemifusus pugilinus, Rapana bulbosa,Meretrix recorded from bycatch. The most common meretrix, Anadara granosa, Donax faba ,Donax among these was Xancus pyrum. Other important spinosus. species that were recorded include Chicoreus Vethalai - The Vethalai area as over 60 vallam ramosus, P. trapezium, Lambis lambis, Murex traba, and 40 country boats. The main fishing gear used Xancus pyrum, Chicoreus virgineus, Chicoreus include nandu valai, singivalau and mural valai. species, Donex faba Fasciolaria filamentosa and Gastropod fishing is carried out throughout the Conus sp. year. Chank beds are found at depths ranging Pamban - The Pamban area situated between from 4.5 m to 6 m. Over 200 shell divers operate Mandapam and Rameshwaram is characterised in this area and target species such as Xancus by shallow waters that are utilised for lobster and pyrum and Fasciolaria trapezium. Placenta placenta is also known to be found in this region. The prawn fishery. In this area, about 200 to 400 species that were observed and identified from mechanised boats are operational year round. landing centres in Vethalai include Fasciolaria About 100 to 200 catamarans are also present. trapezium, Chicoreus ramosus,Chicoreus virgineus, The area employs 70 to 80 shell divers diving for Murex traba , Murex tribulus, Xancus pyrum, Tonna commercially important species at depths of 20 dolium, Mertrix meretrix, Anadara granosa, Donex to 28 metres. December to June is the peak faba and Rapana bulposa. season. During the study, considerable quantities of molluscs were also recorded from bycatch. Pudumadam - Situated near Vethalai, These include Xancus pyrum, Chicoreus ramosus Pudumadam has 25 vallam and 50 country boats and P. trapezium. Other species such as Lambis which are used on a daily basis by fisherfolk. The lambis, Chicoreus ramosus, Chicoreus virgineus, typical gear used include nandu valai, singavalai Murex traba, Babylonia spirata, Xancus and mural valai. Different species of Lambis form pyrum,Turritella attenuate, Telescopium an important component of bycatch. These telescopium, Ficus ficus, Tonna dolium, Bursa rana, include scheduled species such as Lambis Bursa spinosa, Anadara granosa Donax faba, and truncata, Lambis millepeda and Lambis crocata. Donax spinosus. were also found The scheduled Other species of gastropods and bivalves are also found in by-catch.
248 Muthupettai - Located near Pudumadam, virgineus, Murex trapa, Tonna dolium, Meretrix Muthhupettai village has 30 vallam and 35 vathai meretrix, Anadara granosa, Donax faba, Arca craft; the latter are typically used for cephalopod symmetrica Pteria brevilata and Perna viridis. fishing. Other types of gear which are used Sethukarai - Sethukarai is a village situated include nandu valai and singivalai. The largest close to Keelakarai. In this village, 40 vallam and number of species are harvested during the 25 vathai are operated on a daily basis. Among all monsoon. P. trapezium was a scheduled species the sites which were surveyed, bivalve extraction which was observed in considerable quantities. was considerably higher that that of other sites in Other species that were recorded in by-catch the two island groups. The species which were include Tonna dolium, Chicoreus virgineus, Chicoreus recorded as by-catch from Sethukarai include ramosus, Donax faba, Placenta placenta, Sunetta Pinctada vulgaris, Pteria brevialata, Pteria chinensis, donacina, Paphia textile, Cardium flavum, Perna Perna viridis, Cardium asiaticum, Murex tribulus, viridis, Gafrarium divaricata, Pinna bicolor and Cardium flavum, Murex trapa, Meretrix meretrix, Anadara granosa. Anadara granosa, Donax faba and Placenta Periapattinam - Located near Muthupettai, placenta. Periapattinam village has 40 vallam and 50 Keelakarai - Located about 60 km from country craft which are operated on a daily basis. Mandapam, Keelakarai has about 30 mechanised Singi valai, nandu valai and mural valai are the trawlers and 20 catamarans which are engaged primary gear used for fishing. The fishing season largely in the lobster fishery. Singi valai, gill nets starts in September and extends to December. In and trawl nets are the predominant types of gear this village, over 50 skin divers are employed to that are used. In this village over 200 skin divers collect chanks and other commercially significant are employed to collect chanks and other species. Their daily wage ranges form Rs. 1000 to commercially valuable species of molluscs. Rs. 2000 depending on the season and catch. Mollusc collection is mostly carried out in the Chanks are also caught in nandu valai. Species monsoon. Placenta placenta was the most recorded from by-catch in the Periapattinam abundant species of scheduled mollusc whuch landing centre include Murex tribulus ,Chicoreus was recorded in by-catch. Other species which
249 were recorded in by-catch from Keelakarai quantities. Lambis lambis, Chicoreus ramosus, include Cardium setosum, Cardium flavum, Chlamys Chicoreus virgineus, Lambis truncata, Lambis tranquebaricus, Pinctada vulgaris, Pteria chinensis, crocata,Lambis millipeda, Rapana bulbosa, Tona Pteria brevialata,Perna viridis, Paphia malabarica, dolium and Hemifusus pugilinus are species which Murex tribulus, Chicoreus virgineus, Gafrarium have been recorded from by-catch. divaricata, Venus reticulate, Murex trapa, Babylonia Valinokkam - Situated proximate to Ervadi, spirata, Meretrix meretrix, Anadara granosa, Donax Valinokkam village has 80 vallam and 120 craft faba and Donax spinosus. which are used in fishing. The main fishing season Ervadi - Located 12 km from Keelakarai, Ervadi is from February to July. In this area, scheduled has about 20 mechanised trawlers, 30 species such as Placenta placenta are found in catamarans and 80 vallam which are engaged in considerable numbers. Species that were fishing. The primary fishing gear used include singi recorded and identified in by-catch include valai, nandu valai gill nets and trawl nets. Rapana bulbosa, Hemifusus pugilinus, Murex Gastropods which are of commercial value are tribulus, Lambis lambis, Chicoreus ramosus, exploited year round. Scheduled species such as Chicoreus virgineus, Murex trapa, Xancus pyrum, Lambis truncata, Lambis crocata and Lambis Meretrix meretrix, Anadara granosa, Donax faba, millepeda are found in this area in significant and Placenta placenta.
250 General Observations Among all the islands, the most number of recorded the highest values and Valimunai (3.6%) scheduled molluscs were reported from recorded the lowest. In terms of species richness, Pullivasal and Anaipar. The least number of both the Mandapam and Keelakarai groups had species were recorded from Poovarasanpatty. similar representations; however, the Mandapam Pullivasal and Talaiyari recorded the largest group had a greater number of scheduled number of individuals belonging to scheduled individuals. A few scheduled species were species; Manoli and Poovarasanpatty recorded reported from all surveyed islands in both island the fewest. With respect to percentage groups. These include F. trapezium, L.truncata, L. composition of individuals belonging to crocera, L. millipeda and P. placenta. scheduled species, Poomarichan (8.9%)
Species richness and density of mollusks in Mandapam and Keelakarai groups of islands Name of the Total no. of No. Gastropods Bivalves Density No/m2 island species 1 Single 20 28 48 9.97
2 Kurusadai 13 39 52 12. 31 3 Poomarichan 15 33 44 12.61
4 Pullivasal 20 24 48 11. 07 5 Manoliputti 13 29 44 9. 96
6 Manoli 21 23 41 8. 53
7 Hare 15 42 57 12. 6 8 Anaipar 10 34 44 10. 50
9 Valimunai 21 26 47 7. 56
10 Appa 27 37 54 9. 98 11 Poovarasanpatti 22 24 36 8. 73
12 Talaiyarai 16 38 64 10. 52
13 Vali 17 30 47 9. 93 14 Mulli 18 26 44 9. 93
When species other than scheduled highest densities of mollusk species were recorded molluscs were taken into account, the maximum the Mandapam group. For all the islands that were number of gastropods and bivalves from Mandapam sampled in both Mandapam and Keelakarai groups, group were recorded from Hare island (57 species), gastropod diversity was higher than that of bivalves. and the minimum number was recorded from The survey recorded a total of 132 gastropod Manoli island (41 species). In the Keelakarai group, species belonging to 25 families and 3 orders. A the maximum numbers for molluscs were recorded total of 90 bivalve species belonging to 19 families from Talaiyari (64 species) and the minimum and 3 orders were recorded. Among bivalves, 30 number from Poovarasanpatty (36 species). The species were first time records.
251 List of new records of species identified in Mandapam and Keelakkarai group of islands
No Species Numbers 1. Barbatia amygdalumtostum 3 2. Scapharca inaequivalis 3 3. Mytilus galloprovincalis 2 4. Septifer virgatus 2 5. Pteria coturnix 1 6. Pteria penguin 3 7. Ptereletroma sp-1 1 8. Malleus anatinus 3 9. Chlamys senatoria nobilis 2 10. Agropecten irradians irradians 3 11. Pecten maximum 2 12. Pecten pyxidatus 2 13. Spondylus longitudinalis 3 14. Spondylus obliquus 2 15. Placuna ephippium 2 16. Trachycardium angulium 2 17. Dinocardium ciliatum 2 18. Acanthocardia echinata 5 19. Paphia euglypta 2 20. Irus ishibushianus 3 21. Dosinia gibba 3 22. Lioconcha castrensis 2 23. Venus multicostata 2 24. Callithaca adasmi 3 25. Donax tranculus 3 26. Pinna muricata 2 27. Glauconome chinesis 2 28. Potamocorbula ustuala ustala 1 29. Gelonia bengalensis 2
This survey revealed a declining trend in mollusc species richness and abundance when compared with that of earlier reports and surveys. This study also recorded a number of threats to scheduled molluscs and associated species in the region. These include overexploitation both as by-catch and from skin diving activities which target specific species.
252
Published by the Gulf of Mannar Biosphere Reserve Trust
Study on the Current Status of Scheduled Molluscs along the Tuticorin Coast of the Gulf of Mannar Marine National Park
science outreach series no. 15 Work Title: Study on the Current Status of Scheduled Molluscs along the Tuticorin Coast of the Gulf of Mannar Marine National Park
Funding Agency : Gulf of Mannar Biosphere Reserve Trust, Ramanathapuram
Implementing Suganthi Devadason Marine Research Institute, (SDMRI), 44- Beach Road, Tuticorin-628001 Institution:
Duration : 1 Year
Cost : Rs. 3,68,000/ - INTRODUCTION species), and Cephalopods such as octopus and The Gulf of Mannar squid (600 species). Molluscs have been an important food source for humans for several Located between the Indian mainland and millennia. Some are exploited by fishermen on Sri Lanka (08° 46' N - 09° 14' N 78° 9' E - 79° 14' E), account of their high palatability and nutritious the Gulf of Mannar consists of unique productive content whereas others have been exploited for habitats and resources including coral reefs, their potential to serve as luxury goods, dyes, and seagrass beds, mangroves and associated fauna. a variety of chemical compounds. Among The area was declared as a Marine National Park in different groups, the gastropods are the most 1986 on account of its rich biodiversity. Covering diverse and wide ranging. They are characterised an area of 10,500 km2 , it covers close to 15% of the by a single shell with an asymmetric body and the length of Tamil Nadu’s coastline and encompasses presence of Tarson, where the visceral organs are 21 islands running parallel to the coast from twisted 180 degrees. In addition to their high Tuticorin to Dhanushkodi. Although highly diverse, economic value as food resources, groups such as these fragile ecosystems have also been subject to gastropods are also used as ornamental artifacts, overfishing, illegal coral mining and a number of for the manufacture of lime and other industrial other human impacts. Fishing and associated purposes. Cephalopods comprises predatory activities are carried out in the waters marine molluscs such as squid, octopus and surrounding most of the islands including but not nautilus. Some species among squid and octopus restricted to Vaan, Koswari, Kariyachalli, are used as food and bait, whereas others such as Vilanguchalli, Upputhanni, Pulvinichalli and Nallathanni. nautilus are prized for their decorative shells. Bivalves as their name suggests are characterised The ecology and importance of molluscs by a shell divided into two halves, hinged on one The faunal diversity of the Gulf of Mannar side and with specialised gills for feeding. Clams, is diverse and complex with representation from cockles, mussels, oysters, scallops and multiple phyla including Mollusca. Molluscs are a shipworms fall in this category and a number of very diverse group of soft-bodied animals with a them are important to humans in terms of food range of body structures typified by common and as prey for food fish. The secretions of molluscs such as clams, oysters, snails, slugs, squid oysters form the basis of the pearl industry and and octopus. However, few features are common their shells are also used for a variety of to all such as their characteristic crawl motion on a single, flat, muscular foot and a body which would at least have a suggestion of a head at one end and an anus at the other. Most molluscs are characterised by a mantle which secretes a hard external shell (or shells made of calcium carbonate and other minerals and covered by an outer periostracum) which is mounted on a visceral hump containing the internal organs. Currently, seven primary classes are recognised: the wormlike, shell-less Aplacophora (250 species), Monoplacophora (10 species), Bivalvia such as clams (7500 species), Polyplacophora such as chitons (600 species), Scaphopoda such as tusk shells (350 species), Gastropoda such as snails and slugs (37,500
253 decorative purposes. Some species of bivalves Methodology are regarded as pests as they burrow into wood, brickwork and metal and destroy piers, vessels, The survey for molluscs was carried out etc. On account of their tendency to accumulate in the Gulf of Mannar Marine National Park heavy metals and other pollutants, the between October 2007 and December 2008. The consumption of bivalves have to be monitored stretch between Tuticorin to Vembar was with care; at the same time they can serve as covered and important landing centres including useful indicators of pollution and water quality. The sophisticated venoms of a number of species Tuticorin Fishing Harbour, Thereshpuram, of molluscs (e.g. cone snails) are being Tharuvaikulam, Vellapatti, Keezhavaipar and increasingly used as neurological tools in medical Vembar were targeted. The survey methods and cosmetics research. As abundant members of involved the observation of by-catch in fish nets marine ecosystems, molluscs also play a very from different fishing craft as well as skin diving important role in maintaining the integrity of food chains. They perform multiple roles as and interviews with fishermen. detritivores, herbivores or grazers feeding on sediment matter deposited on the sea floor or acquiring nutrients filtered from water, a number of molluscs are also carnivores feeding on other species. Exploitation of molluscs in the Gulf of Mannar A large number of fisherfolk in the Gulf of Mannar are involved in the exploitation of molluscan resources from the region. Shell collection brings in significant revenue for many coastal villages. However, as a result of this largescale exploitation, molluscan communities in the intertidal areas seem to be locally degraded. Increased fishing practices and Study area : Vembar to Tuticorin associated pressures like dynamiting and Between March and June 2008, surveys trawling, pollution and environmental hazards, coupled with high market demand for shells, and for molluscs were also conducted along the exploitation of shells by professional shell seven islands including Koswari, Kariyachalli, collectors are the factors contributing to this Vilanguchalli, Upputhanni, Pulivinichalli and depletion. Among species harvested from the Nallathanni. This assessment was carried out region, Turbinella pyrum Linnaeus (Xancidae, using 1 m2 quadrats laid at four different sites Gastropoda), is among the most valuable. This around each island at depths ranging from 0.5m species is utilised not only for its meat, its shell to 5m. Sites were selected based on the (commonly referred to as the chank) has abundance of reef and seagrass habitats but considerable religious and cultural significance. within each of these sites, the quadrats were laid The Gulf of Mannar and the Palk Bay are the main randomly and varied according to the extent of areas from which this species is extracted. It has been estimated that well over one lakh habitat. The total number of quadrats are given individuals of this slow growing species were within parantheses: Vaan (50), Koswari (60), being extracted on a yearly basis in the mid Kariyachalli (80), Vilanguchalli (75), Upputhanni 1990s. (80), Puluvinivhalli (75) and Nallathanni (120).
254 Summary: Survey of Molluscs of Villages along Tuticorin Coast A total of 13 species of scheduled molluscs 33 species of non scheduled molluscs belonging to belonging to 8 genera were recorded from the six 27 genera were recorded from the six sites. Species sites that were surveyed. Species composition was composition varied across sites. A number of more or less similar across sites with richness species were found in all sites whereas a few were varying from 11 to 13 species. Species other than found only at a single site. Species richness ranged Placuna placenta (applala chippi), and Strombus from 13 species at Tuticorin Harbour to 33 species plicatus were recorded from all six sites. A total of at Thirespuram. Scheduled molluscs
Tuticorin Species Thirespuram Vellapatti Tharuvaikulam Keezhavaipar Vembar Harbour
Cassis cornuta - maatu thalai Y Y Y Y Y Y Cypraea lamacina Y Y Y Y Y Y Cypraea talpa Y Y Y Y Y Y Cypraecassis rufa - pineapple Y Y Y Y Y Y chanku Lambis chiragra - theli chanku Y Y Y Y Y Y Lambis scorpius Y Y Y Y Y Y Lambis millipeda Y Y Y Y Y Y Lambis crocata Y Y Y Y Y Y Lambis truncata - aiviral Y Y Y Y Y Y Placuna placenta - appala chippi Y Y - - Y - Pleuroploca trapezium - kuthirai Y Y Y Y Y Y mulli Strombus plicatus sibbaldi Y Y - - Y Y Tudicla spiralis - vella poodu Y Y Y Y Y Y Total 13 13 11 11 13 12
255 Non-scheduled molluscs
Species Tuticorin Thirespuram Vellapatti Tharuvaikulam Keezhavaipar Vembar Harbour Anadara granosa - Y - - - - Anadontia edentula - Y - - - - Babylonia spirata Y Y Y Y Y Y Babylonia zeylanica Y Y Y Y Y Y Bufonaria rana Y Y Y Y Y Y Bursa sp. - Y - - - - Chicoreus ramosus Y Y Y Y Y Y Chicoreus virgeneus - Y Y Y Y Y Y kotakka mulli Conus madagascariensis Y Y - - Y - Conus sp. Y Y Y Y Y Y Cypraea tigris - Y Y Y - - Cypraea caurica - Y Y - - - Ficus ficoides - Y - - Y - Ficus variegata - Y - - - - Fusinus longicaudus - Y - - - - Hemifusus pugilinus - Y Y Y Y Y Y manja mulli Lambis lambis Y Y Y Y Y Y Melo melo - thiruvodu , Y Y Y Y - Y paathira chank Mimachlamys - Y Y Y Y - sanguinea Modiolus philippinarum - Y - - - - Minnivola pyxidata - Y - - Y - Murex tribulus - shanku - Y Y Y Y Y mul ,pey mulli chank Natica didyma - Y - - - Y Natica lineata - Y - - - - Phalium glaucum - Y Y Y - Y Pinctada fucata - Y - - - Pinna bicolor - Y - - - - Rapana bulbosa - Y Y Y - - Solen aspersus - Y - - - - Strombus sp. Y Y Y Y - Y Tonna dolium - Y Y Y Y - Y pathram Turbinella pyrum Y Y Y Y Y Y Turris indica - Y - - - - Total 13 33 18 17 14 15
256 A number of molluscs listed in the followed by Tuticorin, Thiruvaikulam, Vellapatti, schedule of the WLPA, 1972 were recorded as Vembar and Keezhavaipar. The percentage of incidental bycatch. Thirespuram accounted for landed scheduled molluscs are shown in the the highest number of scheduled molluscs following figure.
Percentage of scheduled molluscs landed in bycatch from different sites
Percentage of Scheduled molluscs
3% 4% 11% 26%
8%
48%
Tuticorin Thereshpuram Vellapatti Tharuvaikulam Keezhavaipar Vembar
Our surveys of bycatch revealed that in areas including gastropod beds. mollusc resources are being heavily depleted and Interviews with fishermen also reveal that current levels of harvest cannot be sustained both fish stocks as well as stocks of commercially unless effective management measures are harvested molluscs are on the decline. This is designed and enforced. In some sites along the indicated by the longer distances that fishermen Tuticorin coast, the presence of egg masses and have to travel and the longer operational effort, undersized juveniles in bycatch from trawlers, time and costs involved in acquiring the same traditional craft and shoreline nets indicate the amount of catch. Several respondents reported destruction of potential resources. Juvenile serious declines in levels of shrimp and molluscs whelks (Babylonia spirata) were recorded in even from new fishing grounds. Many fishermen considerable quantities in many sites and measures should be undertaken to prevent the feel this could be due to shifts in ocean currents loss of recruitment stocks. Although many forms and due to poor monsoonal rains in recent years. of extraction are carried out, bottom trawling is A number of other factors have also been particularly damaging. Bottom trawling disturbs associated with the degradation of marine benthic habitats and causes extreme amounts of communities. These include the disposal of damage to marine communities inhabiting the sea industrial waste and thermal pollution, discharge floor. Tuticorin District has approximately 400 of untreated domestic sewage, aquaculture, poor trawlers each of which operates 3 to 6 trawl nets land use practices and port related activities.
257 Tuticorin Fishing Harbour Tuticorin is one of the most important December 2007. The most important fish landing centres in Tamil Nadu. Mechanised commercially exploited species which were boats in the region are confined to this area and recorded in considerable numbers included on an average about 225 trawlers run their Turbinella pyrum, Chicoreus ramosus, Babylonia operations from here on a daily basis from 5 am spirata and Babylonia zeylanica. Scheduled to 12 pm. These trawlers range from 40 to 60 feet molluscs such as Cassis cornuta, Cypraecassis rufa, and travel up to 110 km for fishing. Each boat Pleuroploca trapezium, Lambis chiragra arthritica, which typically has five to seven crew members Lambis scorpius and Lambis crocera were also carry four to six nets; the nets are usually of one recorded (see summary tables for a complete list type with a mesh size ranging from 30 to 40 mm at of species that were recorded from each site). the cod end, increasing in size to 120 mm at the Enquiries with the fishermen revealed the top. Fishing is carried out through the year commercially important species of gastropods except for a period of 45 days in April and May which amounted to 15% of the bycatch were when the trawl ban is in effect. Trawlers from this retained the rest were discarded in order to save region target resources from Punnakayal and space for the more lucrative catch such as Manapad in the south to Erwadi in the north and prawns. Boat owners as well as fishermen in also trawl the deep sea at depths ranging from Tuticorin also reported declining catch for both 100 m to 300 m. Shellfish including penaeid fish and shellfish in the past decade, increasing prawns, crabs, lobsters and cephalopods are distances and expenses towards fishing. The exploited in large quantities from this region. number of traders who depend on gastropods Gastropods and bivalves were observed have also declined due to the reduction in from trawl bycatch and were recorded gastropod numbers and traders involved in the throughout the period except during the trawl illegal sea cucumber industry (which went hand ban. The peak period for these molluscs was in hand with collection of chanks) have also been observed to be between July and December and fewer as a result of increased enforcement by the the maximum number of shells were recorded in authorities.
Scheduled and non-scheduled molluscs collected from Tuticorin during survey months
Tuticorin Scheduled mollusc Non Scheduled mollusc 14000
12000
10000
8000
6000 No. of shells 4000
2000
0 Oct- Nov- Dec- Jan- Feb- Mar- Apr- May- Jun- Jul- Aug- Sep- Oct- Nov- Dec- 07 07 07 08 08 08 08 08 08 08 08 08 08 08 08
258 Thirespuram Located adjacent the main Tuticorin are engaged in the collection and marketing of Fishing Harbour, Thirespuram is a major mollusc shells. Some of the fishermen from these collection centre for molluscs. About 1100 communities skin dive for shells up to 75 ft depth traditional vallams and 50 fibre boats are engaged without the use of assisted breathing apparatus. in fishing which takes place six days a week and About 80% of commercially important species throughout the year (except for some days in were acquired by this method. The main species November when the sea is rough). Fishing is targeted by this method include the sacred conch carried out in a variety of ways and used different Turbinella pyrum (which is highly valued due to its types of nets such as salai valai (for sardines), religious significance) and Chicoreus ramosus mandal valai, disco valai and maya valai (for (which is being increasingly sought after for its snappers and carangids), echa valai (for beautiful shells, delicious meat and valuable mackerel), murrel valai (for belonids), thirukkai operculum). About 100 vallams are involved on a valai (for rays), paru valai (for tuna and needlefish), daily basis for chank diving engaging over two push nets and prawn nets (for prawn), shore hundred people. Diving is carried out about 20 seine and crab nets (for crabs), singi valai (for km away from the shore and commercial diving lobsters), sangu valai (for molluscs) and longlines efforts are also concentrated in offshore waters (for seer fish, groupers, carangids and barracuda). ranging from 17 to 75 ft in depth. Fishermen Sardines and tuna are the major catch in this report that the sacred chank is found on chank village, followed by groupers, seer fish, snappers beds located in soft, sandy substrates found and carangids. Large quantities of crabs, prawns and cephalopods are also caught. Around 40 between Nallatanni island and Valinokkam Point vallams are engaged exclusively for crab fishing in the north and the shallow waters off throughout the year. Fishermen typically set out Tiruchendur in the south. Skin divers from for fishing in the evening between 4 pm and 11 pm Thirespuram collect about 1050 and 475 and return in the morning by 8 am or 2 pm. Many individuals of Turbinella pyrum and Chicoreums vallams are also engaged in longline fishing and ramosus each day and each diver earns between some fishermen remain at sea for two to five days Rs. 250 and Rs. 800 depending upon the season. for this purpose. The highest landings of chank are recorded during November and the lowest between the Considerable quantities of gastropods months of May and July when adverse winds are harvested throughout the year. Ambalakkar restrict the operation of vallams and skin diving. and Paravar are the two main communities which
259 During the lean period, many chank divers Although these species were observed work as labourers on mechanised fishing vessels throughout the year in bycatch, the peak season from the Tuticorin harbour. The surveyed was found to be between August and December fishermen were knowledgeable about the and the lean season was between May and July. scheduled species, however, none of the After removing the operculum, the shells are sold scheduled species were recorded during the to local traders who collect them from the survey. fishermen or from the landing centres. The shells In addition to shells collected by divers, are then sold to wholesalers, retailers and gastropods and bivalves were also observed in processors. Two small level preliminary by-catch in crab nets, lobster nets, shrimp nets processing units are also located in Thirespuram. and maya valai. The highest numbers of Wholesalers transport shells of ornamental gastropods were recorded from bottom set crab value to areas such as West Bengal where they are nets. Large numbers of Lambis lambis were carved and made into bangles and other jewelry; observed within bycatch. Other species low value shells are processed by the lime recorded from bycatch include Anadara granosa, industry. Anodontia edentula, Babylonia spirata, Babylonia The data from Thirespuram shows a zeylanica, Bufonaria rana, Bursa sp., Circe scripta, gradual decline in shell quantities. This could be Chicoreus virgeneus, Conus sp., Cypraea sp., Ficus attributed to increased demand and prices variegata, Fusinus longicaudus, Hemifusus pugilinus, leading to overexploitation. However, the Modiolus philippinarum, Pinctada fucata, Pinna fishermen and divers who were interviewed bicolor, Phalium glaucum, Strombus sp. and a were of the opinion that these resources were number of scheduled species were also observed not declining and that they could dive further (see summary tables for other species). offshore in previously unexploited areas.
Scheduled and non-scheduled molluscs collected from Thirespuram during survey months
Thirespuram
Scheduled mollusc Non Scheduled mollusc 25000
20000
15000
10000 No. of shells
5000
0 Oct- Nov- Dec- Jan- Feb- Mar- Apr- May- Jun- Jul- Aug- Sep- Oct- Nov- Dec- 07 07 07 08 08 08 08 08 08 08 08 08 08 08 08
260 Vellapatti
Located 7 km away from Tuticorin, Some fishermen from the village are also involved Vellapatti village has a total population of 1167. in the manufacture or value added fishery Over 90% of the population is involved in fishing products such as pickled fish and crabs. and the rest works on salt pans and as labour for Considerable quantities of gastropods companies. The village has 70 traditional vallams were recorded as bycatch in the crab fishery. and 4 fibre boats and on an average, 40 boats are Lambis lambis was the most frequently recorded operated daily. Fishing is fone largely in carried species. Other species which were recorded out in the nearshore waters and rarely go beyond include Turbinella pyrum, Chicoreus ramosus, 15 km from the shore. Vellapatti is well known for Babylonia spirata, Bufonaria rana, Chicoreus its exclusive crab fishery. The target species virgeneus, Conus sp., Hemifusus pugilinus, Lambis which includes blue swimming crabs (Portunus truncata, Lambis chiragra arthritica and Phalium pelagicus), three spot crabs (Portunus glaucum. Scheduled molluscs such as Cassis sanguinolentus), crucifx crabs and mud crabs cornuta, Cypraea lamacina, Cypraea talpa, constitute about 305 tonnes of annual catch. Cypraecassis rufa, Lambis crocata, Lambis scorpius, Crab nets are the primary form of gear used and Lambis millipeda, and Lambis truncate were though fishermen go out throughout the year, the observed occasionally during the survey period fishing season is between August and December. as bycatch. The peak season for shell availability During the Months between March and May, was found to be between July and March. During about 25 boats are involved in pelagic fishing and March, fishermen also use maya valai along with use maya valai for snappers. Between November crab nets and get small quantities of gastropods. and February, about 20 boats are involved in Fishermen from Vellapatti also collect dead shells cephalopod fishing and use handlines to capture of some bivalve species such as Circe scripta, commercially important species such as Sepia Anadara granosa, and Anodontia edentula from the pharaonis, Sepioteuthis lessoniana and Octopus sp. shore and sell these for Rs. 8 per kg.
Scheduled and and non-scheduled molluscs collected from Vellapatti during survey months
Vellapatti
4500 Scheduled mollusc Non Scheduled mollusc
4000
3500
3000
2500
2000 No.of shells 1500
1000
500
0 Oct- Nov- Dec- Jan- Feb- Mar- Apr- May- Jun- Jul- Aug- Sep- Oct- Nov- Dec- 07 07 07 08 08 08 08 08 08 08 08 08 08 08 08
261 Tharuvaikulam
Tharuvaikulam, situated 15 km away from targeting fin fishes stay at sea for multiple nights. Tuticorin has a population of 10115 of which 80% The mechanised boats in this village do not use of people are involved in fishing. About 312 boats trawl nets, instead gill nets are used to target are used for fishing of which 45 are mechanised pelagic fishes. Flotaing nets (paru valai) extending and the rest are traditional vallams. This village to a depth of 7-9 m are used. The fishing grounds has the maximum number of traditional boats are nearly 30 nautical miles away from and traditional fishermen. Maya valai, crab nets, Tharuvaikulam. June to September is the peak lobster nets, paru valai, 2 number valai, chala valai, fishing season and considerable catches of disco valai, kola valai, ola valai, kara valai, push nets belonids, emperors, groupers, jacks, skates, and and hooks are the commonly used fishing gear. snappers are obtained using maya valai and other Both mechanised vessels and traditional boats nets such as 5 number, 2 number and irupuri valai. are engaged in fishing throughout the season Gastropods are primarily caught as by- except on Sundays and when the weather is catch in these nets. The scheduled and non rough, and also during the trawl ban period (for scheduled species which were recorded from mechanised craft). Fishermen involved in crab this area is listed in the summary tables. fishing set their nets overnight whereas those
Scheduled and non-scheduled molluscs collected from Tharuvaikulam during survey months
Tharuvaikulam
Scheduled mollusc Non Scheduled mollusc 10000
9000
8000
7000
6000
5000
4000 No.of shells 3000
2000
1000
0 Oct- Nov- Dec- Jan- Feb- Mar- Apr- May- Jun- Jul- Aug- Sep- Oct- Nov- Dec- 07 07 07 08 08 08 08 08 08 08 08 08 08 08 08
262 Keezhavaipar
Keezhavaipar village situated 27 km away Commonly caught sardines include Sardinella from Tuticorin has a population of 2400 of which gibbosa, Sardinella albella, and Sardinella longiceps, only 40% is engaged in fishing. A total of 45 fishing followed by snapper (Lutjanus and Lethrinus) and craft which includes traditional wooden vallams crabs (Portunus pelagicus, Portunus and fibre boats are used for fishing. Fishing is sanguinolentus). carried out close to the island (within 15 km from Gastropods are landed as bycatch. the shore) as the vallams are much smaller than Scheduled and non scheduled gastropods which those of surrounding villages. Gill nets and crab were recorded from Keezhavaipar are listed in nets are frequently used for fishing. The major the summary tables. groups of fish landed include Sardinella which are caught using chala valai, followed by reef fishes.
Scheduled and non-scheduled molluscs collected from Keezhavaipar during survey months
Keezhavaipar
Scheduled mollusc Non Scheduled mollusc
3500
3000
2500
2000
1500 No. of shells 1000
500
0 Oct- Nov- Dec- Jan- Feb- Mar- Apr- May- Jun- Jul- Aug- Sep- Oct- Nov- Dec- 07 07 07 08 08 08 08 08 08 08 08 08 08 08 08
263 Vembar Vembar, located 50 km north of Tuticorin declining catch and fewer boats access the is a village with a population of 2500. Vembar is Mandapam area even during the peak season. The considered to be an important fishing centre and traditional vallams largely exploit shrimp in areas has both traditional vallams (about 60 in number) close to Erwadi. as well as trawlers (of which there are 25). Vembar Considerable quantities of scheduled and village has no harbour, however, there are other non scheduled molluscs were recorded as supporting facilities for fishermen. Fishing boats bycatch from both trawlers and traditional craft. are typically operated from Monday to Saturday When compared with other villages which were and fishing schedules and timings are dependent surveyed for molluscs, the data collected in on target species, seasons and locations where October to December 2008 showed an fishing is carried out. In June boats usually leave at increasing trend in mollusc numbers than the dawn and return at 9 pm and night fishing is a previous year. Skin diving yielded maximum common practice. However, depending on the molluscs followed by trawling (bycatch). It also situation, fishermen sometimes stay at sea for a came to be known that during peak gastropod few days. The mechanised boats operating in this seasons, divers from Thirespuram shifted to village are exclusively engaged in bottom Vembar and dived at depths of 35 to 45 feet and trawling. The trawl boats which are usually 40 ft in landed considerable quantities of Turbinella length and carry out two forms of bottom pyrum and Chicoreus ramosus. In Vembar, three trawling: one specifically for prawns (used traders are engaged in gastropod trading. Shells between June and August) an the second with are transported to other centres such as small mesh size at the cod end for capturing Keezhakarai and Tuticorin. Fishermen who were pelagic fish. Shrimp, mackerel, carangids, and surveyed in this village also expressed a number barracuda are targeted for fishing. Trawling is not of worries about the effect of erosion, the lack of carried out during the trawl ban period. Recently, berthing facilities and the irregular prices for there are fewer mechanised boats due to seafood from processing industries.
Scheduled and non-scheduled molluscs collected from Vembar during survey months
Vembar
Scheduled mollusc Non Scheduled mollusc
5000 4500 4000 3500 3000 2500 2000 No. of shells 1500 1000 500 0 Oct- Nov- Dec- Jan- Feb- Mar- Apr- May- Jun- Jul-08 Aug- Sep- Oct- Nov- Dec- 07 07 07 08 08 08 08 08 08 08 08 08 08 08
264 Summary: Survey of Molluscs of Islands off the Tuticorin Coast
Mollusc surveys were carried out in seven (Gastropods, Bivalves and Scaphopods) were different islands off the coast of Tuticorin. compared across islands. Gastropods were the Surveys were carried out in Vaan, Koswari, best represented group in both habitat types Kariyachalli, Vilanguchalli, Upputhanni, followed by bivalves and scaphopods. A summary Puluvinichalli and Nallathanni. Species associated of scheduled molluscs occurring in seagrass and with seagrass habitats and coral reefs were listed coral reef habitats is also provided. and densities of the three main groups
Scheduled Vaan Koswari Kariyachalli Vilanguchalli Upputhanni Puluvinichalli Nallathanni molluscs Lambis 18(11) 14 (17) 19(14) 7(11) 12 14(9) 21(16) truncata Lambis chiragra (16) 8 11 (8) - - 18(11) arthritica Pleuroploca - 7 14(11) - - 11 - trapezium Placenta - - (9) 8 - - - placenta
Note : Values outside parentheses are for seagrass habitats, values within parentheses are for coral reef habitats.
Gastropod densities were highest in were highest in seagrass beds off Nallathanni seagrass habitats in general. Kariyachalli island; lowest values were recorded for Vaan recorded the highest density of gastropods island. There was no clear cut difference in among all islands. Densities for this group were scaphopod densities between habitats. Highest considerably lower in coral reefs and was lowest densities for this group were recorded in in Koswari island. Bivalves were also more Upputhanni’s seagrass beds and lowest values abundant in seagrass habitats. Bivalve densities were recorded for coral reefs in Vilanguchalli.
Group Vaan Koswari Kariyachalli Vilanguchalli Upputhanni Puluvinichalli Nallathanni Coral Reef Gastropods 4.24 3.2 4.96 4.84 4.48 5.12 4.92 Bivalves 2.32 2.4 3.6 3 2.56 2.92 3.12 Scaphopods 0.56 0.52 0.56 0.32 0.68 0.84 0.44 Seagrass Gastropods 7.44 6.16 9.56 6.92 7.24 7.24 9.6 Bivalves 4.92 3.48 6.28 4.84 5 4.72 6.36 Scaphopods 0.84 0.68 0.88 0.44 1 0.72 0.68
265 Measures for Propagation: Restoration and Management Protocol for Scheduled Molluscs
Mollusc resources which are depleted • Monthly data has to be collected from all could be preserved in-situ using practices such as villages. Harvesting of molluscs by skin diving as sea ranching. However, it is necessary to point well in the form of bycatch from trawlers and out that dedicated research effort will be traditional craft needs to be assessed. required to develop technologies for culture of • Particular attention needs to be given during these species. An immediate solution on the the peak season. other hand maybe to develop a more effective • Reef and seagrass ecosystems surrounding the enforcement system which protects the islands should also be monitored on a monthly brooders and egg masses and increase the stock. basis. The development of awareness • Monitoring could be carried out using the same programmes is also necessary especially among methods that were followed in this study. fisherfolk. Although they are aware of the issues • Enforcement mechanisms to check illegal associated with depleting stocks, their attitudes harvesting and trade in scheduled molluscs to harvesting are still exploitative. should be strengthened. With the available baseline information, a • Awareness generation activities need to be monitoring protocol could be developed for initiated hand in hand with enforcement. scheduled molluscs which stresses on the following items:
266 Conservation of Mollusc Resources
A number of conservation measures can of shells that are collected have decreased be undertaken to regulate prevent considerably due to overexploitation. Although overexploitation and to facilitate regeneration of there are rules against collecting undersized mollusc resources in Tuticorin district: chanks from traditional chank beds, there is poor • Some of the current trawling practices are enforcement. Similarly, the continuous destructive and are likely to be detrimental to the exploitation of a few species may have long term long term sustainability of molluscs. Excessive consequences for the ecological balance of numbers of juveniles have been found in the marine communities. Therefore a set of rules landings of mechanised boats using meshed trawl need to be developed and enforced with the nets. This indicates potential loss of future sustainability of molluscs in mind. populations of adults. Bottom trawl nets with • Like in the case of the trawl ban, a minimum iron chains drag over gastropod beds leading to period of ban on exploitation of chanks could be largescale destruction of egg masses and removal imposed on skin diving during the breeding of juveniles. If trawling over gastropod and bivalve season. beds can be restricted, and mesh sizes regulated, • Although this survey was a first attempt, data on the exploitation of undersized animals could be mollusc stocks are still lacking. An evaluation of prevented. These trawl free zones could also total landings of molluscs from the entire Gulf of serve as refuges to displaced fish species. Mannar region (Rameshwaram to Kanyakumari) • The disposal of untreated sewage is rampant in should be carried out through a long-term many of the coastal areas in the region. Water monitoring programme. quality monitoring should be carried out on a • Hatchery development and sea ranching regular basis and special attention needs to be technologies could developed to supplement given to identifying the level of heavy metal natural stocks of molluscs. Research on these concentrations. More research is also required aspects is currently lacking. to understand relationships between mollusc • Community-based conservation and populations and water quality. management of mollusc resources are likely to • Skin divers who have been collecting shells for give good results and would go a long way in many years pointed out that the size and weight changing attitudes of harvesters and traders.
267
Published by the Gulf of Mannar Biosphere Reserve Trust
Seaweed Diversity and Sustainable Use in the Gulf of Mannar Biosphere Reserve
science outreach series no 16 Work Title: Seaweed Diversity and Sustainable use in the Gulf of Mannar Biosphere Reserve management strategy for the Gulf of Mannar
Funding Agency : Gulf of Mannar Biosphere Reserve Trust, Ramanathapuram
Implementing Central Salt and Marine Chemicals Research Institute, Marine Algal Research Station Institution: Mandapam Camp - 623 519, Tamil nadu
Duration : 1 Year
Cost : Rs. 1,53,500/ - Introduction Seaweed species are primary producers below their capacities as the required amount of in marine ecosystems. Many of these species find raw material is not available. Only 10 out of the 21 use commercially as they are rich in protein, agar factories are functional as the requirement carbohydrate, vitamins, iodine, bromine, of about 400 tonnes per annum is not being met. mannitol, minerals, trace elements and bioactive Similarly, there is demand for about 1000 tonnes substances. Seaweed is also the only source of of alginate against which only 40% is met production of phytochemicals such as agar, indigenously. As a result only 12 of the 25 alginate carrageenan and algin which are used extensively factories are actively involved in production. in the dairy, paint and varnish industries as gelling, Most of these industries are located within Tamil stabilising and thickening agents. Globally, on an Nadu and the Gulf of Mannar coast is a primary annual scale about 4 million tonnes (wet weight) source of raw material. Over exploitation of a of seaweed worth approx. USD 1 billion is number of species such as Gelidiella spp., harvested and used for human consumption and Gracilaria spp., Sargassum spp. and Turbinaria sp., as raw material for the extraction of have also been reported. The present study was phytochemicals. Currently in India, there are undertaken to assess the present status of about 46 seaweed based industries - 21 agar and seaweed diversity, its abundance and harvest 25 alginate industries - but these are functioning practices along the Gulf of Mannar coast.
Objectives 2. Thonithurai (Mandapam) This survey was carried out along the 3. Velankanni Nagar (Mandapam) intertidal and subtidal areas of the Gulf of 4. Seeniappa Dharga Mannar (from Rameshwaram to Tuticorin) with 5. Nochiurani the following primary objectives: 6. Pudumadam · To identify places of seaweed abundances 7. Thalathoppu · To study the diversity of seaweed species 8. Sullimunthal · To document seaweed diversity and to list out 9. Sethukarai threatened / rare, and endemic species of 10 Kanchirankudi seaweed. 11. Kilakarai · To identify localities along the GoMBR where 12. Bharathinagar commercial harvest of seaweed is currently 13. Ervadi being undertaken 14. Sadamuniyan valasai · To recommend suitable sites in GoMBR where 15. Valinokkam seaweed collection can be allowed in a 16. Tuticorin sustainable manner. At each of the sampling stations, three Methods parallel transects were established. GPS locations of all transects were recorded. The transects were The intertidal and subtidal areas of the aligned parallel to the shore and were spaced 50 m coastal region of Gulf of Mannar (between apart. Within each transect, 1 sq. m quadrats were Rameswaram and Tuticorin) were initially laid perpendicular to the shore at depths of 0, 0.5, surveyed to identify and select places which had 1.0, 2.0 and 4.0 metres. The nature of the substrate seaweed abundance. Based on this survey, the was noted at each of these depths. The number of following stations were selected to study the quadrats at each depth varied with the availability of seaweed biodiversity and its abundance. seaweed. Seaweed from each quadrat was sorted 1. Rameswaram according to species.
268 Results Seaweed Diversity species) , Kanchirankudi (12 species), The total of 99 species of seaweed were Sadamuniyan valasai (16species), Valinokkam (14 collected from the 16 sampling stations species) and Tuticorin (13 species). Within distributed across the Gulf of Mannar coast. Of Chlorophyceae, Caulerpa is most dominant genus these, 25 species were green algae and was represented by 10 species followed by (Chlorophyceae), 27 species were brown algae Enteromorpha and Ulva which were represented (Phaeophyceae) and the rest of the species by 3 species each. The species which was werered algae (Rhodophyceae). Percentage recorded from the maximum number of sites was contribution of these groups were 25, 27 and 47 Caulerpa taxifolia which was recorded from 11 respectively. The most number of species (36) locations. Within Phaeophyceae, Sargassum was were recorded from Valinokkam and the fewest recorded as the most dominant genus and was number of species (15) were recorded from represented by 9 species followed by Turbinaria Rameswaram. Chlorophycean species were with 3 species. Dictyota dichotoma was recorded dominant in Rameswaram ( 7 species); from maximum number of places (12 locations) Pphaeophycean species were dominant in followed by Padina tetrastromatica (10 sites) and Sullimunthal (9 species), Sethukarai (13species), Sargassum wightii ( 9 locations). Within Kilakarai (13 species), Bharathi nagar (14 speices) Rhodophyceae, Gracilaria dominated with 9 and Ervadi (12 species). Rhodophycean species species followed by Laurencia and Hypnea which were dominant in Thonithurai (10 species), were represented by 4 species each. Gelidiella Velankanni nagar (7species), Seeniappa Dharga acerosa was recorded from maximum number of (10 species ), Nochiurani (12 species), sites (13 locations) followed by Acanthophora Pudumadam (19species), Thalathoppu (11 spicefera ( 10 locations) and Gracilaria corticata (8 locations).
Seaweed diversity in the Gulf of Mannar
50 47 45 40 35 30 27 25 25 20 15 10 5 Number of seaweed species Number 0 Chlorophyceae Phaeophyceae Rhodophyceae
269 Seaweed species and genera belonging to each group recorded from 16 locations on the Gulf of Mannar
Location Chlorophyceae Phaeophyceae Rhodophyceae To t a l species Genera Species Genera Species Genera Species
R am esw aram 3 7 3 3 4 5 1 5
T h o n ith u rai 3 5 3 3 8 1 0 1 8
Velan kan n i N agar 3 6 3 4 6 7 1 7
Seen iap p a D h arga 2 6 4 4 1 0 1 0 2 0
N o ch iuran i 4 8 4 4 1 2 1 2 2 4
Pudumadam 4 6 6 6 11 11 23
T h alath o p p u 5 5 5 5 1 1 1 1 2 1
Sullimunthal 3 5 7 9 6 6 20
Seth u karai 2 5 9 1 3 7 8 2 6
K an ch iran ku di 4 5 5 5 1 0 1 2 2 2
K ilak arai 4 5 9 1 3 9 1 0 2 8
B h arath in agar 2 4 8 1 4 7 1 0 2 8
E r vadi 3 6 1 0 1 0 8 8 2 4
Sad am u n ian Valasai 3 1 0 5 5 1 0 1 2 2 7
Valinokkam 7 10 9 10 13 16 36
Tutico rin 4 4 3 3 1 0 1 3 2 0
270 Rare Seaweed Species Endangered Species Of the 99 seaweed species which were Gracilaria edulis has become an recorded, 21 species were classified as rare. endangered species due to overexploitation. This These were recorded at either one or two alga which finds commercial importance as an stations and had low representation in terms of important agarophyte yielding food grade agar, quantityy. Among these, 5 species belong to was once available in large quantities along this Chlorophyceae, 4 species belong to coast. Phycocolloid industries routinely Phaeophyceae and 12 species belong to collected this alga for their raw material Rhodophyceae. A few of the commercially requirements up to 2003. The present study important seaweed have also become rare. These confirmed the presence of this alga in only a include Gracilaria verrucosa (agarophyte) , couple of localities and that too in very meagre Sarcodia montagneana, Agardiella robusta and quantities. Following the depletion of algal stocks Spyridia filamentosa (all carrageenophytes). from these localities, the industry has moved to Kattumavadi and Kottaipattinam (Pudukottai Rare seaweed species belonging to different District) along the Palk Bay coast for collecting G. groups recorded from the Gulf of Mannar edulis.
S.No Seaweed Species Threatened Species Green algae (Chlorophyceae) 1 Ulva fasciata Like Gracilaria edulis, Gelidiella acerosa was 2 Bryopsis plumose also being collected in large quantities quantity 3 Boodlea composite by the local agar industries till 2003. In the 4 Cladophora fascicularis present study, though the alga has been recorded 5 Cladophora flexuosa in many places, the recorded biomass was very Brown algae (Phaeophyceae) 6 Chnoospora minima low. This depletion is believed to be due to 7 Iyengaria stellata indiscriminate harvesting by the local fisher 8 Spathoglossum asperum women in the area. 9 Cystoseira indica Red algae (Rhodophyceae) Comparison of Present Status of 10 Laurencia nana 11 Enentiocladia prolifera Seaweed with Previous Survey 12 Dasya noccarioides A comprehensive survey of seaweed 13 Sarcodia montagneana resources was carried out in 1971-72 by the 14 Gracilaria bustapastoris Central Salt and Marine Chemicals Research 15 Gracilaria verrucosa 16 Agardiella robusta Institute (CSMCRI). This survey was undertaken 17 Spyridia filamentosa in collaboration with the Central Marine 18 Halymenia dubia Fisheries Research Institute (CMFRI) targeted 19 Rhodymenia dissecta the mainland coast of the Gulf of Mannar as well 20 Corynomorpha prismatica as its islands. This survey reported 150 species of 21 Cryptonemea undulata seaweed. While the earlier survey reported only 54 species from the mainland, the present study recorded 99 species. Therefore, 61 species have been reported from this study alone.
271 Seaweed Harvests
The Gulf of Mannar is the primary same period varied from 651 to 5534 tonnes (dry resource centre for the supply of seaweed raw weight). Total seaweed landings ranged from 1173 material to the phycocolloid industry (agar and to 6417 tonnes (dry weight). Some information algin producing industies) for the country. The on landings of agarophytes and alginophytes from major seaweed collection centres are distributed 1978–79 to 2002–03 are also available. It has to from Rameswaram to Valinokkam. The coastline be noted that the collections for both the species, has about 13 seaweed landing centres. Some G. acerosa and G. edulis have shown fluctuating prior data on the scale of commercial seaweed trends from year to year, probably as a extraction is available. Commercial extraction consequence of overexploitiation and targeting agarophytes (G. acerosa, G. edulis, G. denudation. For alginophytes, during the same crassa, G. foliifera and G. verrucosa) during 1978–79 period, Sargassum collections amounted to 2587 to 2002–03 ranged from 240 to 1518 tonnes (dry tonnes (dry weight), whereas Turbinaria weight), whereas the same for alginophytes collections were only 265 tonnes (dry weight). (species of Sargassum and Turbinaria) during the
272 The primary species of seaweed collected from different localities in the Gulf of Mannar
Places Dominant Seaweed species
Rameswaram Caulerpa taxifolia Thonithurai (Mandapam) Hypnea musciformis ,Acanthophora spicefera Velankanni nagar Sargassum wightii ,Gelidiella acerosa Seeniappa Dharga Acanthophora spicefera Nochiurani Sargassum wightii ,Gracilaria corticata Puduamadam Sargassum wightii ,Gracilaria corticata Thalaithoppu Sargassum wightii ,Padina boergesenii Sullimunthal Gelidiella acerosaT ,urbinaria conoides ,Chondrococcus harnemanii Sethukarai Sargassum wighttiT ,urbinaria conoides ,Gelidiella acerosa ,Chondrococcus harnemanii Kanchirankudi Sargasuum sp. Kilakkarai Sargassum wightiiT ,urbinaria conoides ,Hypnea pannosa ,Padina tetrastromatica ,Gelidiella acerosa ,Chondrococcus harnemanii Bharathinagar Sargassum wightiiT ,urbinaria conoides ,Hypnea pannosa , Chondrococcus harnemanii,Gelidiella acerosa Ervadi Gelidiella acerosa ,Sargassum wightiiT ,urbinaria conoides ,Padina boergesenii Sadamunianvalasai Gelidiella acerosaT ,urbinaria ornata ,Hypnea pannosa Valinokkam Sargassum wightii ,Gracilari spp. Tuticorin (Hare island) Gracilaria spp.
In the Gulf of Mannar area, there are about Rs. 30-35 ; Gracilaria edulis – Rs. 7-9; Sargassum and 5000 fisher folk, mostly fisher women, who are Turbinaria are Rs. 3-4.50. Average earnings of sea involving in seaweed collection. The majority of weed collectors range from Rs.50- 150/- per day. women belong to the 18-35 age group and have The agent sells the raw material to the industry. acquired primary level education. They venture into Many of the seaweed collectors also habitually the sea early in the morning with the receding tide collect prior advance from agents and hence they starts recedes and carry out extraction for 4-5 are compelled to sell the dry seaweed to the hours in a day. Gelidiella acerosa, Sargassum spp. and particular agent even at lower prices. Seasonal Turbinaria spp. are the commercial seaweeds employment, middleman exploitation, lack of targeted for this purpose. The collected seaweed is adequate area for drying the collected seaweed are sold to an agent or middle man. The price of some of the problems encountered by the seaweed seaweed (Kg dry wt.) is as follows: Gelidiella acerosa- harvesters.
Economics of the Seaweed Industry Globally, about 7.5-8 million tonnes of developed. Later a process for industrial wet seaweed are harvested for commercial manufacture of agar was developed using consumption. In India, seaweed utilisation by the Gelidium micropterum (= G. acerosa) as raw industry is primarily for the commercial material. With the development of this industrial production of agar and alginate. Due to lack method, a few industries started agar production availability of indigenous raw materials for using either G. acerosa or G. edulis as raw material. carrageenan production, this industry is poorly Currently, there are 46 seaweed based industries developed. Agar production in India began in – 21 agar and 25 alginate –however, these 1940 as a cottage industry which used G. edulis as are not functioning as per their rated capacity, raw material. Subsequently, a viable cottage as there has been a short supply of raw industry method for the manufacture of agar materials. Among the 21 agar factories, only ten from Gracilaria lichenoides (= G. edulis) was are presently functioning. Although the
273 Landings of commercially important seaweed during 1978 to 2003 along the coast of the Gulf of Mannar
Agarophytes Alginophytes Year Gelidiella Gracilaria Sargassum Turbinaria To t a l acerosa edulis wightii conoides 1978-79 288 395 3636 1021 5340 1979-80 5 4 1 342 4253 1281 6417 1980-81 247 213 3090 438 3988 1981-82 131 117 2522 222 2992 1982-83 102 225 3176 704 4207 1983-84 293 2911 (85) 2070 375 3114 1984-85 210 3201 (96) 780 235 1641 1985-86 189 2691 (96) 2016 385 2984 1986-87 261 2331 (28) 491 160 1173 1987-88 217 3171 (34) 868 250 1686 1988-89 366 3301 (15) 2605 523 3839 1989-1990 370 4001 (2) 3106 459 4337 1990-91 307 982 2867 224 4380 1991-92 274 3182 (3) 5000 160 5755 1992-93 312 3992 (50) 2921 122 3804 1993-94 261 187 2867 256 3571 1994-95 232 165(110)2 2249 307 3003 1995-96 280 6012 (20) 2298 257 3456 1996-97 423 323 2922 336 4004 1997-98 322 974 3479 244 5019 1998-99 365 4961 (35) 1704 180 2780 1999-2000 491 664 (20)12 (25) 2066 99 3683 (310)3 2000-2001 560 3523 (224) 1424 9 2569 2001-2002 571 4643 (130) 1760 50 2975 2002-2003 665 2791 (21) 2011 274 3250
Indian requirement for agar is about 400 Ranipet contributes half of the indigenous tons per annum, only about 30% is produced production. Most of the industries involved in indigenously. Among the existing agar industries, phycocolloid production are are located in Tamil M/s Marine Chemicals, Cochin contributes 50% Nadu. Seaweed raw materials are collected from of the indigenous production. Similarly, though the specific selected sites along the Gulf of the Indian requirement of alginate is 1000 tons Mannar and a few other locations. Compared to per annum, and indigenous production is less the world phycocolloid production of 1,46,730 than 40%. Among the 25 alginate industries, only tonnes during 2001, Indian phycocolloid 12 are actively involved in production. However, production was found to be a meagre 430 tonnes M/s SNAP Natural and Alginate Products Ltd, (0.2%).
274 Awareness about Sustainable Seaweed Harvesting
In June 2007, a series of awareness raising seaweed (especially species such as Gelidiella meetings jointly organised by the GOMBRT and acerosa) were likely to cause further denudation CSMCRI were conducted with seaweed of seaweed populations. It was further suggested collectors. The meetings were held at Pamban, during the meeting, to initiate a three month Kilakarai, Bharathinagar and Ervadi. A large collection holiday from April to June to facilitate number of saweed collectors and seaweed the regeneration of seaweed in the area. The agents participated in the meetings. During the seaweed collectors were willing to agree to this meeting, the importance of sustainable proposal if they were provided compensation harvesting was stressed. GOMBRT officials from the government during the leave period. The adviced seaweed collectors to desist from agents who participated in the meetings also collecting the seaweed around the islands. agreed to pay marginally higher prices for Officials also explained to the collectors that the Gelidiella acerosa and Sargassum. use of objects such as scrapers to remove
Observations from the Present Study
From the present study, the following over-exploitation. observations can be summarised: • The genus Sargassum has several species with • A total of 99 seaweed species were recorded high biomass. This is closely followed by from the coastal region of Gulf of Mannar. Of Turbinaria conoides. these, 25 species belong to Chlorophyceae • The coastal stretches between Rameswaram (green algae) 27 species belong to Phaeophyceae and Thalathoppu are mainly sandy beaches with (brown algae) and 47 species belong to rocks in the intertidal regime. Rhodophyceae ( red algae). • The coastal areas between Sethukarai and • A total of 21 seaweed species have been Valinokkam have coral reefs in the lower classified as rare species (5 greem algae, 4 brown intertidal as well as subtidal regimes. algae and 12 red algae) which were recorded only • A previous seaweed survey conducted along from a few locations and had meager biomass. this mailand coast during 1971-1972 has • Gracilaria edulis which was collected in large reported 54 seaweed species. However the quantities from these localities till 2003 has been present study has 61 new records taking the classified as an endangered species on account of overall number to 99 species. indiscriminate over-exploitation by the seaweed • Seaweed harvest practices are mainly carried industy. This species was recorded only from out by local fisherwomen especially in Kilakarai, three localities (Mandapam, Bharathinagar and Bharthi nagar, Ervadi and Sadamuniyan valasai. Valinokkam), and the recorded biomass levels ·• Seaweed collectors sell the harvested seaweed were low. to agents or middlemen who supply the raw • Gelidiella acerosa has been classified as a material to the factories. threatened species now. Though this species was • Gelidiella acerosa gets a higher price of Rs-30/- recorded from a number of localities with to 35/- per Kg dry wt. while the price for considerable biomass, it has been noticed that Sargassum and Turbinaria are Rs. 3.50/- to 4.00/- this resource is dwindling as a result of continued per Kg dry wt.
275 Recommendations The following recommendations emerged from in a year, this species sells for a higher price. So it this study: can be taken up along with Gracilaria edulis • A detailed survey of seaweed resources of Gulf cultivation. of Mannar islands should be taken up • Meeting of scientists and seaweed collectors immediately. may be arranged periodically to impress upon the • Harvesting of Sargassum and Turbinaria could be seaweed collectors the importance of continued to be allowed along the mainland coast sustainable harvest of natural resources such as because both seaweeds have very rich biomass seaweed. resources.However, harvesting of Gelidiella • GOMBRT should make efforts to involve the should be restricted to particular period in a year. seaweed industry as a partner in the cultivation The recommended period is during January to of commercial seaweed. March and again during July September. These are • GOMBRT could arrange for loans with low the peak growth period of this alga. interest to seaweed collectors and encourage • Gracilaria edulis cultivation should be taken up them to start land based business, so that the to augment its resource. This activitiy can be seaweed exploitation can be restricted to some entrusted to the fisher women who are involved extent. in seaweed collection. Gelidiella acerosa A study on seaweed and animal cultivation can also be undertaken. Although interaction should be taken up along this coast slow growing and only two harvests are possible facilitated and funded by GOMBRT.
276
Published by the Gulf of Mannar Biosphere Reserve Trust
Scientific Information Available on the Octocorals of Gulf of Mannar
IERSE
science outreach series no 17 Work Title: Scientific Information Available on the Octocorals of Gulf of Mannar
Funding Agency : Gulf of Mannar Biosphere Reserve Trust, Ramanathapuram
Implementing Institute of Environmental Research and Social Education, Nagercoil Institution:
Duration : 1 Year - Part I
Cost : Rs. 7,81,500/ - (Part I, II & III) INTRODUCTION
Octocorals (soft corals and sea fans) Reefs of the Gulf of Mannar areinteresting groups of animals and form major The reef formations of Southeast coast of faunal components of coral reef ecosystems. India along the Tamil Nadu coast is scattered They provide food and shelter for many animals. between 79Ú to 79Ú 9’ E and 8Ú 45’ to 9Ú 11’ N They occur commonly in all reef habitats and covering 21 islands from Tuticorin to Adams serve as a protective cover for free swimming and Bridge. Though, the reefs are mostly of fringing sedentary animals of the ecosystem. type around the islands, Stoddart and Fosberg in Coral reefs host about 27 phyla of animals their 1972 study called it a discontinuous Barrier many of which are sessile. However, octocorals and termed it the Mannar Barrier. Recently a differ from other major groups of such animals. series of taxonomic and ecological papers on the One of the first macro-scale characteristics used reef environs have been published. The fringing to distinguish octocorals from others is the reefs around the islands normally have a lagoon presence of polyps bearing eight tentacles, which 100 to 150m wide and 1-2 m deep. In some nearly always have conspicuous rows of pinnules islands, near Tuticorin (e.g. Karaichalli Tive), there on both sides. In all cases of hard corals existed well-formed flats up to 100 m wide resembling soft corals or even of other animals mimicking soft coral features, the presence or (subsequently quarried and mostly nonexistent absence of polyps with pinnules, or the number of now). tentacles, make it easy to distinguish the groups. Status of Octocoral research in the Gulf of Our knowledge on Octocorals has Mannar region increased significantly from the last half of 19th Soft corals under the Order Alcyonacea century. of Phylum Coelenterata are the vital components Systematics of coral reef ecosystem in Gulf of Mannar. Prof. Drawing from the description used by Herdman was the first one to collect Octocorals Fabricius and Alderslade in their 2001 book on from Gulf of Mannar. He did it as a side coelenterate taxonomy, the authors of this observation while studying the Pearl Oyster report also recognize that the term soft coral has Fisheries of Ceylon in the year 1902. Later on, the different meanings in different parts of the world material collected by Herdman were studied by and is used largely to refer to Octocoralllia, naturalists like Edith M. Pratt, J. Arthur Thomson which have no massive skeleton or internal axis and W.D. Henderson and the results were and gorgonians. Therefore the authors use the published as supplementary reports upon the term octocorals to refer largely to soft corals and Marine Biology of Ceylon in the year 1905 at the sea fans classed as: request of the Colonial Government by the Royal Phylum : Coelenterata Society, London. Thus, these reports became the first ever on the octocorals from this area. Other Class : Anthozoa studies on soft corals and sea fans by various Subclass: Ocotocorallia (or Alcyonaria) authors from Gulf of Mannar so far, are given in Order : Alcyonacea (Soft corals and sea fans) Tables I and II, respectively.
277 Table I: Soft Corals of the Gulf of Mannar Reported by Various Authors
AUTH0RS
S. No SPECIES Pratt (1905) Gravely (1927) Gravely Hickson (1931) Thomson (1905) (1905) Thomson Jeyasree and Parulekar (1997) (1997) Parulekar and Jeyasree Rani Mary George et al. (2007a) (2007a) al. et Mary George Rani Rani Mary George et al. (2007b) (2007b) al. et Mary George Rani Thomson and Henderson (1905) (1905) Henderson and Thomson Suresh Kumar and Venkataraman (2005) (2005) Venkataraman and Kumar Suresh 1 Alcyonium pachyclades X X 2 Anthelia sp X 3 Capnella manaarensis X 4 C hironephthya variabilis X 5 Cladiella laciniosa X 6 Clavularia margaritifera X X 7 C. crassa X 8 Cornularia cornucopiae X 9 Dampia poecilliformes X 10 Eunephthya purpurea X 11 Fusticulavia herdmani X 12 Lobophytum pauciflorum X X X X X 13 L. sarcophy-toides X 14 L. crassum X X 15 L. ransoni X 16 L. compactum X X 17 L. variatum X X 18 L. latilobatum X 19 Nephthya chabrolli X 20 Nephthya sp. X 21 N. lobulifera X 22 Paraspongodes striata X 23 Sarcophyton oligotrema X 24 S. bicolor X 25 S.ehrenbergi X 26 S. trochel-iophorum X X 27 S. crassocaule X X 28 S. cherbonneri X X Pratt (1905) described 17 species of about the names of specific islands. Moreover, the Alcyonaria, out of which 11 species were collected materials were collected while studying the Pearl from Gulf of Mannar region and all of them Oyster Fisheries of Ceylon and therefore it can be belonged to the group soft corals. Thomson and safely presumed that they were collected from the Henderson (1905) described 87 species from Sri Lankan (Ceylon) side of Gulf of Mannar. Herdman’s collection of which 26 belonged to Gulf After 1905 there was no work on this group of Mannar region. Thomson (1905) described 17 from this area till 1927 when F.H. Gravely published spe-cies of Alcyonaria representing 9 genera. In this, an account on the Alcyonaria as a part of the 3 species were from Gulf of Mannar region. All the Littoral Fauna of Kurusadai island which was above three works give the locality of collection of published as a Bulletin of the Madras Government material as Gulf of Mannar and there is no mention Museum.
278
29 S. stellatum X X 30 S. glaucum X X 31 S. elegans X X X X 32 Spongodes pulchra X 33 S. rosea X 34 S. dendrophyta X 35 S. splendens X 36 Sclerophytum polydactylum X 37 S. gardineri X 38 S. querciforme X X 39 S. marenzelleri X 40 S. palmatum X X 41 S. densum X 42 S. durum X 43 S. herdmani X 44 Sinularia dissecta X X 45 S. polydactyla X X 46 S. abrupta X X 47 S. leptoclados X X 48 S. hirta X X 49 S. mannaa-rensis X 50 S. exilis X 51 S. intacta X X 52 S. grandilobata X 53 S. brassica X X X 54 S. granosa X X 55 S. erecta X 56 S.kavarattiensis X X 57 S. jasminae X X 58 S. gaveshaniae X 59 S. parulekari X X 60 Xenia nana X 61 X. umbellata X
Commercially exploitation of Octocorals in India
India initiated the commercial exploitation gorgonids from India during the 1970s and 1980s of gorgonids during 1975 and the material was necessitated a more comprehensive investigation exported to countries like France, West Germany, on this hither to obscure group from our waters. Belgium, USA, and the Netherlands. The total Venkataramanujam and Sanjeeviraj (1982) quantity exported from India during the period gave an account of the export of gorgonian from 1974 to 1984 was estimated at 36.4 tonnes Tamil Nadu and Venkataramanujam and Santhanam (Thomas and Rani Mary George, 1986). The (1989) reported the gorgonian resources of the demand for gorgonids of Indian waters was said to East Coast of India with some suggestions for their be a part of world – wide ‘hunt’ for raw materials for conservation. Saravanan (1990 unpublished), the preparation of prostaglandins, a ‘wonder drug’ studied the biology and biotechnology of the for many a systemic disease in man and animals. This gorgonians of the Tuticorin Bay. Velayutham et al. also created interest among Indian scientists (2005) studied the commercially important involved in the field of drug research. As such, the gorgonians of the Gulf of Mannar by selecting three rate of exploitation exceeded the limit and the centers, such as, Rames-waram, Thoothukudi and Government took legal measures to prevent the Kanyakumari. Without visiting the landing centers, exploitation by including gorgonids under the Wild they collected the data from an exporter of Life (Protection) Act, 1972 Shedule I Part IV A. Tuticorin and reported species wise monthly The unprecedented rise in the export of landings for
279 Table II : Sea Fans of the Gulf of Mannar Reported by Various Authors
AUTHORS
S.No
SPECIES Gravely (1927) (1927) Gravely Thomson (1905) Anita Mary and Lazarus (2004) (2004) Lazarus Mary and Anita Rani Mary George et al (2007 b) b) (2007 al Mary et Rani George Thomson and Henderson (1905) (1905) Henderson and Thomson Thomas and Rani Mary Jacob (1987) (1987) Mary Jacob Rani and Thomas Thomas and Rani Mary George (1986) (1986) George Mary Rani and Thomas 1 Bebryce indica X 2 Echinogorgia complexa X X X 3 E. reticulata X X 4 Echinomuricea indica X X X 5 E. indo-malaccensis X 6 Ellisella andamanensis X 7 Gorgonella umbraculum X X 8 G. rubra X 9 Heterogorgia flabellum X X 10 Junceella gemmacea X 11 J. juncea X 12 J. fragilis, var. rubra, n. X X 13 Lophogorgia lutkeni X 14 L. irregularis X 15 Leptogorgia australiensis, var. flavotiveta X X 16 Muricella complanata X X 17 M. ramosa X 18 Nicella dichotoma X 19 Plexauroides praelonga X X 20 Plexauroides antipathies, var. flexuosa,n. X 21 Solenocaulon tortuosum X X X 22 Scirpearella aurantiaca X 23 S. filliformis X 24 Subergorgia suberosa X X 25 S. reticulata X X 26 Virgularia X indica 27 Virgularia sp. X 28 Verrucella rubra X 29 V. flexuosa, var. gallensis X 30 Thesia flava X X X one year from March 1991 to February 1992. Rameswaram. The same trend was observed Among the four different types of at Tuticorin centre also. But in the Kanyakumari commercially important gorgonids, the Red centre the Black type was more in quantity type contributed more followed by the Black followed by red, monkey tail and flower tail type, Monkey tail type and Flower tail type at types.
280 Table III: Systematic Position of Soft Corals Reported from Gulf Of Mannar
S.No. Family Genus Species Place of Collection
1 Alcyoniidae Alcyonium pachyclades Gulf of Mannar, Krusadai 2 Cladiella lasiniosa Gulf of Mannar 3 Dampia poecilliformos Tuticorin 4 Lobophytum pauciflorum Gulf of Mannar, Krusadai 5 sarcophytoides Krusadai 6 crassum Krusadai 7 ransoni Mandapam 8 compactum Tuticorin 9 variatum Mandapam 10 latilobatum Krusadai 11 Sarcophyton oligotrema Gulf of Mannar 12 bicolor Gulf of Mannar 13 ehrenbergi Krusadai 14 trocheliophorum Vadakadu Rameswaram 15 crassocaule Vadakadu Rameswaram 16 cherbonneri Mandapam 17 stellatum Mandapam 18 glaucum Krusadai 19 elegans Gulf of Mannar, Krusadai 20 Sclerophytum polydactylum Gulf of Mannar 21 gardineri Gulf of Mannar 22 querciforme Gulf of Mannar, Krusadai, Rameswaram 23 marenzelleri Gulf of Mannar 24 palmatum Gulf of Mannar, Krusadai, Rameswaram 25 densum Gulf of Mannar 26 durum Gulf of Mannar 27 herdmani Gulf of Mannar, Krusadai 28 Sinularia dissecta Manauli, Krusadai 29 polydactyla Pulli 30 abrupta Pulli, Tuticorin 31 leptoclados Mulli 32 hirta Mulli 33 mannarensis Krusadai 34 exilis Mandapam 35 intacta Mandapam 36 grandilobata Mandapam 37 brassica Tuticorin 38 granosa Mandapam 39 erecta Mandapam 40 jasminae Mandapam 41 gaveshaniae Gulf of Mannar 42 kavarattiensis Mandapam 43 parulekari Mandapam 44 Xeniidae Anthelia Anthelia sp. Gulf of Mannar 45 Xenia nana Krusadai 46 umbellata Pamban cont...
281
S.No. Family Genus Species Place of Collection
47 Nephtheidae Capnella manaarensis Pearl banks Gulf of Mannar 48 Eunephthya purpurea Pearl banks Gulf of Mannar 49 Nephthya chabrolli Pearl banks Gulf of Mannar 50 nephthya sp. Tuticorin 51 lobulifera Gulf of Mannar 52 Paraspongodes striata Pearl banks Gulf of Mannar 53 Spongodes pulchra Pearl banks Gulf of Mannar 54 rosea Pearl banks Gulf of Mannar 55 dendrophyta Gulf of Mannar 56 splendens Pearl banks Gulf of Mannar 57 Clavulariidae Clavularia margaritifera Pearl banks Gulf of Mannar 58 crassa Shingle Island Krusadai 59 Cornulariidae Cornularia cournucopiae Krusadai 60 Cavernulariidae Fusticulavia herdmani Cheval Paar, 61 Nidalidae Chironephthya variabilis Pearl banks Gulf of Mannar
Table IV: Systematic Position of Sea Fans Reported from Gulf of Mannar
S.No Family Genus Species Place of Collection
1 Plexauridae Bebryce indica Gulf of Mannar 2 Echinogorgia complexa Southeast coast 3 reticulata Tuticorin, Rameswaram, Mandapam 4 Echinomuricea indica Rameswaram, Tuticorin 5 indo-malaccensis Pearl banks, Gulf of Mannar 6 Lophogorgia lutkeni Gulf of Mannar 7 irregularis Pearl banks, Mandapam 8 Plexauroides paralonga Pearl banks, Gulf of Mannar 9 antipathies, var. flexusosa, n. Gulf of Mannar 10 Ellisellidae Ellisella andamanensis Keelakarai 11 Gorgonella umbraculam South East Coast 12 rubra Gulf of Mannar 13 Junceella gemmacea Gulf of Mannar 14 juncea Gulf of Mannar 15 fragilis, var. rubra, n. Gulf of Mannar 16 Nicella dichotoma Tuticorin 17 Verrucella rubra Gulf of Mannar 18 flexuosa, var. gallensis Gulf of Mannar 19 Paramuricidae Heterogorgia flabellum Gulf of Mannar 20 Thesia flava Vedalai, Gulf of Mannar 21 Gorgoniidae Leptogorgia australiensis, var. flavotiveta Gulf of Mannar 22 Scirpearia aurantiaca Out side Pearl banks Gulf of Mannar 23 filliformis Off Cape Comorin 24 Acanthogorgiidae Muricella complanata Tuticorin, Cape Comorin 25 ramosa Out side Pearl banks, Gulf of Mannar 26 Anthothelidae Solenocaulon tortuosum Kanyakumari, Gulf of Mannar 27 Subergorgiidae Subergorgia suberosa Gulf of Mannar 28 reticulata Tuticorin, Rameswaram 29 Virgulariidae Virgularia indica Gulf of Mannar 30 Virgularia, sp. Rameswaram
282 Remarks
A total of 61 species of soft corals inadequate and in some cases they are also belonging to 18 genera representing 7 families imperfect. Describing species and re-describing and 30 species of sea fans belonging to 18 genera the old ones are the need of the hour. representing 8 families have been reported so far A study of the population structures of from Gulf of Mannar area by different authors. octocoral species and their phylogenetic For most of these species, the area of distribution relationships has not been done till date. Because was given as either Gulf of Mannar or Pearl banks of the variability of the characters among the and there was no mention about the actual place octocorals it has been suggested that molecular of collection of material. data be used for the identification of octocorals. It is necessary to re-check the names of In addition to these, their species composition species and reconfirm their identification from and area – wise distribution and abundance also earlier studies, applying suitable and standard need to be studied along with other associated keys. Even available taxonomic keys are fauna and flora found in coral reef ecosystems.
Suggestions
Given that little is known about the conservative measures. octocoral diversity or ecosystem functions of 6. Study of the ecology of soft corals and sea fans the groups in the Gulf of Mannar the following so as to know their interaction with other animal suggestions are offered: communities of the ecosystem. 1. Identification of soft corals and sea fans of Gulf 7. Long-term monitoring of the qualitative and of Mannar using underwater eco-friendly quantitative distribution of soft corals and sea techniques and island-wise documentation of the fans in all the islands of Gulf of Mannar. population of the different species. 8. Study of the impact of the Sethusamudram Ship 2. Re - evaluation of earlier findings so as to avoid Canal Project on the growth and survival of soft errors in their identification. corals and sea fans of the area. 3. Identifying the endangered and threatened 9. Regular monitoring of the impact of pollution species, if any, in the two groups of animals and on the growth and diversity of soft corals and sea taking remedial measures to conserve them. fans. 4. Adopting suitable restoration techniques for 10. Study of the impact of climate change and sea the conservation and management of soft corals level rise on the growth and survival of the soft and sea fans. coral and sea fans of the area. 5. Study of the biology of all the species of soft 11. Creation of awareness among local people for corals and sea fans so as to suggest suitable the protection of this ecosystem.
283
Published by the Gulf of Mannar Biosphere Reserve Trust
Octocorals of Gulf of Mannar A study of the Vembar Group of Islands
IERSE
science outreach series no 18 Work Title: Octocorals of Gulf of Mannar A study of the Vembar Group of Islands
Funding Agency : Gulf of Mannar Biosphere Reserve Trust, Ramanathapuram
Implementing Institute of Environmental Research and Social Education, Nagercoil Institution:
Duration : 1 Year - Part II
Cost : Rs. 7,81,500/ - (Part I, II & III) Keelakarai group of islands Material and Methods Gulf of Mannar is unique within the Indo- 1. Study Area Pacific Oceanic realm by harbouring one of the The Coral reef beds surrounding the richest biodiversity of living resources, which had three Islands off Vembar Upputhanni, evolved in the past millennia. Most probably Puluvinichalli and Nallathanni were surveyed in owing due to the semi enclosed nature, seclusion, the present study. The maps in this report were shallowness, and having more or less stable taken from Google Earth and other details as temperature regimen; presence of multiple observed at the time of field studies. niches, recycling and enrichment of nutrients Upputhanni Island is about 29.94 ha in amply derived from land drainage by the rich square area. The circumference of the island is variety of coastal, sedimentary, medowan, reef 2,292 meters. It is located opposite to Mookaiyur and paar biota, Gulf of Mannar came to acquire village. The island is about 8 Km away from ecological uniqueness, biodiversity, pluralism Vembar. The island has few trees here and there, along with endemism; a natural heritage deserves with number of tall bushes. Grass covers the entire Island to be called Biologist’s Paradise. The circumference of Puluvinichalli Vembar group of islands lie in between 78o oooIsland is 1,372 meters and the total area is 6.12 31’00" to 78 35’ 00"E and 9 05’30" to 9 06’ 30" ha. This island has good sandy beach. A large N. well within the sub tropics and support portion of the island has thick vegetation. A few biologically diverse marine flora and fauna. Coral Thespesia trees are found on the eastern side of fringing reefs of these islands support different the Island. species of soft corals and sea fan in addition to Nallathanni Island is 2 Km away from fishes and algal species. Due to population Mundhal village. The circumference of the island pressure and industrial development along the is about 4,700 meters and the square area is 110 coastal regions, they are subjected to intense hectares. This is one of the biggest islands having a anthropogenic stresses. Direct physical large number of Coconuts, Palmyra and other destruction through dredging, boat anchoring woody trees. Coral reefs and coral boulders are and destructive fishing practices have degraded distributed all around the island at a distance of the coral growth in this region. 0.5 Km on the southern side and near to the northern shore. Bottom Profile of the Islands off Vembar
Upputhanni Island Nallathanni Island Puluvinichalli Island
284 2. Measurement of Environmental of polyps with pinnules, or the number of tentacles, Parameters make it easy to distinguish the groups. All survey of living resources of coral reefs With increased familiarity, most octocorals should include environmental parameters, which can be reliably identified to family level, and large characterize the conditions at the site when the numbers to genus level, using external features data were collected. The parameters are important underwater. Characteristic that need to be taken to the health of the reef. Temperature, salinity, into account are: turbidity, cloud cover, wind and sea state and the • The shape, typical size, hardness, softness, environmental parameters recorded during the smoothness, prickliness, and colour of colonies. present investigation. • The arrangement, ralative density, retractability or Method of Identification: contractibility and roughness of the polyps. One of the first macro-scale characteristics • Whether there are just autozooids or used to distinguish octocorals is the presence of siphonozooids as well. polyps bearing eight tentacles, which nearly always • Sclerite characteristics, such as presence of have conspicuous rows of pinnules on both sides. calyces or large sclerites in the colony base. Polyps may be invisible because they are retracted, • The presence of a solid axis, whether it is in which case it may be possible to make out the segmented. very evenly sized calyces or pores into which the • Characteristic such as smell or response to touch. polyps have withdrawn. Pores (oscula) in sponges There are, however, many opportunities for and ascidians are often irregular in size and density, error if just relying on underwater photographs, so and are never associated with polyps, excepting in a it is necessary to check certain features in the few rare cases of symbiotic association between laboratory to verify field diagnoses. The most sponges and hydroids. It should also be pointed out valuable features are the skeletal sclerites, but they that there are a number of species of octocorals cannot be used in isolation, and their details need to that become overgrown by a sponge without be considered in conjunction with many other apparent detriment and a few encrusting sponges characteristics of any colony. In most genera that and ascidians which resemble octocorals that often include more than just a few species, sclerite shapes keep their polyps retracted during the day, such as can vary quite considerably. However, in the present Briareum or Rhythisma. study, sclerites were not used for identification, as Within the phylum Coelenterata, several there was a ban for sampling since corals are listed types of animals have a soft and fleshy appearance in Schedule I of Wild Life (Protection) Amendment just like the soft corals. The hard corals, Gonipora Act, 2002. The identification of octocorals to and Alveopora are often mistaken for soft corals species level is often extremely difficult, and in the such as Sarcophyton when the skeleton is invisible extremely diverse centers it is quite often under the thick layer of expanded polyps. Similarly, impossible. There are large number of very similar Pleryogyra and members of the Caryophyllidae may species and a large proportion that are still have large, soft and flexible polyps, which effectively undescribed. In contrast, species identification may hide their stony coral skeleton. Similarities to present less difficulty for well-described species in certain soft corals also exist in some anemones and areas of low diversity. A considerable problem to zoanthids that have colonized a gorgonian axis and people starting out in this field is that many of the can look just like calyces, and can easily fool an existing taxonomic descriptions are fairly observer. Further, Antipatharians and hydroids may inaccessible as they are scattered throughout the resemble some gorgonians and whip corals. literature in small papers written in a number of However in all these cases, the presence or absence different languages. Species recognition is
285 additionally hampered by numerous occasions in data sheet was Percentage cover of life form which diagnostics seem to overlap between species category = Total length of category x 100 (eg, the number of pinnules per tentacle in Xenia), preprinted to assist the observer record a set of and where character variability within a species biological variables and other significant appears high (eg. variability in growth forms in some observations. nephtheids). Some of the apparent intermediate The technique involved is to tow an forms and within-species variability may be the observer using a rope and manta board, behind a product of hybridization, which occurs when the small boat powered by an outboard motor. Tows reproductive products from parents belonging to were carried out at a constant speed of 3 to 5 km/h different species cross, resulting in offspring those around the perimeter of the reef and were broken are viable and fertile. Colony shape and other into units of 2 minutes duration. During each 2- characteristics of such offspring may show various minute tow, observations were made on several degrees of intermix between those of the parent variables (e.g. percent cover of soft coral, live hard species, and species boundaries become blurred for and dead corals, associates, etc.). These were the researcher. Hybridization is difficult, if not recorded onto data sheets as categories. Additional impossible, to detect in such primitive animals using information like bottom profile, associates, etc. colony shape and skeletal features. Three possible were also collected. Tow continued till the end of outcomes are 1. new species are named based on the reef. Tow was made parallel to the reef crest in hybrid specimens; 2. inaccurately large degrees of order to get better view of the slope. Marking the variability of characteristics are attributed to valid beginning tow point as ‘0’ and the first 2 minute tow species; 3. valid species are split into two or more break point as ‘1’ and proceeded clock-wise till the nominal species. end of the reef margin. Estimation of Population: Line Intercept Transect Technique (LIT): Line Quantitative studies of coral reefs are Intercept Transect survey was made to assess the necessary and reliable estimates of population size soft coral and sea fan diversity. This technique are important in many types of ecological studies, categorized the reef community as life form especially those concerned with the management categories, categories, which provide a of protected areas. In addition to this, here the morphological description of the reef community. A problems stem from the patchy distribution of 50 - m fiber glass measuring tape with hooks, Octocorals at all spatial scales was considered. This underwater paper, pencils and plastic clips were patchiness was taken into account while designing used. Based on the Manta Tow Survey, the LIT the surveys. Manta Tow Survey and Line intercept Survey Stations were selected. In each site, five Transect Survey are the two methods used in replicate transects of 20 meters were laid. Transects present study. were laid in such a way that they followed the Manta Tow Survey: contour of the reef. The tape was pegged with The Manta Tow Survey was done to assess plastic clips at regular intervals to hold it intact in the soft coral diversity. A 17 m (10 mm thick) position. The data sheet of LIT contains life form polyethylene rope with three marker buoys placed categories list with designated code. One person at six m interval (to record the visibility), attached had to lay the tape while the other followed him to to the towing bridle was used. A manta board (40 x peg the tapes. After laying the tape the observer 60 x 2 cm) made from marine ply painted white swim over the tape recording the life form constructed with two indented handgrips categories on data sheet. Soft corals and sea fans positioned towards each corner of the front of the were identified and recorded while in under water board and a handhold at the central back position itself by using under water octocoral identification was used. Data sheet (A4 underwater paper) was photo sheet. placed with a grip on the centre of the board. The The percentage cover of each life form category was calculated using a simple formula: Total length of category Percentage cover of life form category = x 100 Length of transect 286 Results now from Puluvinichalli and Upputhanni Islands Distribution of Octocorals respectively. A total of 23 species of Octocorals 7. Family Clavulariidae had one genus, Carijoa, belonging to 7 families and 11 genera were with one species, rissei, and was found in all the recorded from Vembar group of Islands. In this, 11 three Islands. species representing 5 genera under 2 families 8. Sinularia parulekari was the most dominant were soft corals and 12 species belonging to 6 species in all the 3 Islands. genera under 5 families were sea fans. 9. Among gorgonians Subergorgia suberosa was 1. Family Alcyoniidae had 3 genera (Sinularia, the most abundant species. Lobophytum and Dampia) each having 4,3 and 1 10. Sinularia and Lobophytum species were species respectively. All the four species (S. common in the reef slope up to its bottom. parulekari, S. exilis, S. brassica and S. hirta) reported 11. Other gorgonians were found in the bottom under the genus Sinularia were new to Vembar of the reef slope and sandy bottom around the groups of Islands. In this S. hirta was found only in Islands. Upputhanni Island. The other three were found common in other two Islands also. All the three 12. Carijoa rissei, Dendronephthya aurora and species under the genus Lobophytum were found Lobophytum solidum were found to be new to in Upputhanni Island. In this L. solidum was found Gulf of Mannar Islands. in Puluvinichalli Island also. There was only one 13. Among the known species, Sinularia species, pocilloporaeformis under the genus parulekari, S. exilis S. brassica, S. hirta, Dampia Dampia and that was found only in Nallathanni pocilloporaeformis, Subergorgia subarosa, Island. Leptogorgia australiensis and Junceella juncea 2. Family Nephtheidae had 2 genera are found to be new to Vembar group of (Dendronephthya and Umbellulifera) having 2 Islands.(Table10) and 1 species respectively. All the three species, 14. Some species like Lobophytum solidum, Dendronephthya aurora, Dendronephthya sp.1 Dendronephthya aurora and Carijoa rissei are and Umbellulifera sp., were found in Upputhanni new to Gulf of Mannar. Island and none of them was found in 15. There are about 12 species (Lobophytum sp.1, Puluvinichalli Island. Lobophytum sp.2, Dendronephthya sp.1, 3. Family Subergorgiidae had one genus, Umbellulifera sp., Subergorgia sp.1, Leptogorgia Subergorgia, with 2 species Subergorgia subarosa sp.1, Leptogorgia sp.2, Leptogorgia sp.3, and Subergorgia sp.1 and were present in all the Leptogorgia sp.4, Echinogorgia sp.1, three Islands. Echinogorgia sp.2 and Menalla sp.) seems to be 4. Family Gorgoniidae had one genus, new to Gulf of Mannar area, but they could not be Leptogorgia, having 5 species. In this only identified up to species level due to want of Leptogorgia australiensis could be confirmed up samples. to species level. The other 4 species were found to be new and were present in Puluvinichalli Island and one of them (Leptogorgia sp.1) was found in Upputhanni Island also. 5. Family Ellisellidae had one species, Junceella junecea, and it was found only in Nallathanni Island. 6. Family Plexauridae had 2 genera (Echinogorgia & Menella) having 2 and 1 species respectively and are new to Gulf of Mannar area and reported
287 Station-wise list of octocorals recorded from Vembar group of islands No. Family Genus Species Common Island & Stations Name U.T.I(2&4), P.C.I(1&2), Sinularia parulekari N.T.I(3&4) Sinularia exilis U.T.I(3), P.C.I(2) 1 Sinularia Sinularia brassica U.T.I(3), P.C.I(1&2) Sinularia hirta U.T.I (2) Alcyoniidae Lobophytum solidum U.T.I(3), P.C.I(3) Lobophytum Lobophytum sp1 Softcorals U.T.I(3) Lobophytum sp.2 U.T.I(3) Dampia Dampia pocilloporaeformis . N.T.I(3&4) Dendronephthya aurora U.T.I(4) Dendronephthya Dendronephthya sp.1 U.T.I(4) 2 Nephtheidae Dendronephthya sp.2 U.T.I(4), N.T.I(2) Umbellulifera Umbellulifera sp. U.T.I(4) Subergorgiidae Subergorgia Subergorgia subarosa U.T.I(2&3), P.C.I(2&3), 3 N.T.I(4&5&6) Subergorgia sp.1 U.T.I( 3), P.C.I(2), N.T.I(4,5&6) Leptogorgia australiensis P.C.I(3)
4 Gorgoniidae Leptogorgia Leptogorgia sp.1 Seafans U.T.I(3), P.C.I(2&3) Leptogorgia sp.2 P.C.I(2&3) Leptogorgia sp.3 P.C.I(2) Leptogorgia sp.4 P.C.I(2&3) 5 Ellisellidae Junceella Junceella juncea N.T.I(6) Echinogorgia sp.1 P.C.I(2) 6 Plexauridae Echinogorgia Echinogorgia sp.2 P.C.I(2) Menella Menella sp. U.T.I(3) 7 Carijoa Carijoa rissei. U.T.I(3), P.C.I(3), N.T.I(4) Clavulariidae
N.T.I= Nallathanni Island, P.C.I= Puluvinichalli Island and U.T.I= Upputhanni Island Figures within parenthesis relate to station numbers.
Species Composition of Octocorals
Soft Corals Among soft corals Sinularia parulekari was species(Sinularia parulekari 55%, Sinularia exilis found to be dominant in all the three Island. They 10%, Sinularia brassica 20% and Lobophytum sp1 formed 60% in Nallathanni Island, 55% in 15%) and Nallathanni Island (Fig.6) only 3 species Puluvinichalli Island and 48% in Upputhanni ( Sinularia parulekari 60%, Dampia Island. A total of eight species formed the pocilloporaeformis 35% , Dendronephthya aurora population of soft coral in Upputhanni Island 5%). Out of 8 species located from Upputhanni (Fig.4.) They are Sinularia parulekari 48%, Sinularia Island only 4 could be identified up to species exilis 5%, Sinularia brassica 11%, Lobophytum level. In Puluvinichalli Island also out of 4 species solidum 16%, Lobophytum sp1 5%, Lobophytum sp.2 name of only one could not be fixed. In the case of 7%, Dendronephthya sp.1 6% and Umbellulifera sp Nallathani Island all the three were identified up 2%. Puluvinichalli Island (Fig.5.) had only 4 to species level.
288 Species composition (%) of Softcorals in Upputhanni Island
Sinularia parulekari 2% 6% Sinularia exilis 7% Sinularia brassica 48% Lobophytum sp.1 16% Lobophytum solidum Lobophytum sp.2 Dendronephthya sp.1 5% 5% 11% Umbellulifera sp.
Species Composition (%) of Softcorals in Puluvinichali Island
15%
Sinularia parulekari Sinularia exilis 20% Sinularia brassica 55% Lobophytum sp.1 10%
Species Composition (%) of Softcorals in Nallathanni Island
5% Sinularia parulekari 35% Dampia pocilloporaeformis 60% Dendronephthya aurora
289 Gorgonids (Subergorgia subarosa, Leptogorgia australiensis, In the sea fan (Gorgonid) category Carijoa rissei) could be identified up to species Subergorgia subarosa was found more in all the level. Similarly in Upputhanni island also, out of 5 three Islands. It formed 55% in Nallathanni island species only 2 (Subergorgia subarosa, Carijoa rissei) and 40% each in other two Islands (Figs.7,8 and 9). could be identified up to species level. The total More number of species was recorded in number of species recorded from Nallathanni Puluvinichalli Island followed by Upputhanni and island was 4 (Subergorgia subarosa, Subergorgia Nallathanni Islands. sp.1, Junceella juncea and Carijoa rissei) out of Total number of species recorded in which only one could not be identified up to Puluvinichalli Island were 11, out of which only 3 species level.
Species Composition (%) of Gorgonids in Upputhanni Island
20% 40% Subergorgia suberosa 5% Subergorgia sp.1 Leptogorgia sp.1 Menella sp. 10% 25% Carijoa rissei
Species Composition (%) of Gorgonids in Puluvinichalli Island
Subergorgia suberosa 3% 18% Subergorgia sp.1 1% Leptogorgia sp.1 Leptogorgia sp.2 2% 40% Leptogorgia sp.3 Leptogorgia sp.4 7% Leptogorgia australensis Leptogorgia sp.5 3% Echinogorgia sp. 2% Menella sp. 5% 4% 15% Carijoa rissei
Species Composition (%) of Gorgonids in Nallathanni Island
20% Subergorgia suberosa 5% Subergorgia sp.1 55% Junceella juncea 20% Carijoa rissei
290 Soft corals found new to the study area
No. Family Genus Species Island & Stations Previous report Sinularia parulekari@ Upputhanni, Puluvinichalli, Mandapam Nallathanni Sinularia Sinularia exilis@ Upputhanni, Puluvinichalli Mandapam 1 Alcyoniidae Sinularia brassica@ Upputhanni, Puluvinichalli Tuticorin Sinularia hirta@ Upputhanni Mulli Lobophytum solidum* Upputhanni, Lobophytum Puluvinichalli Lobophytum sp1 Upputhanni Lobophytum sp.2 Upputhanni Dampia Dampia N allathanni pocilloporaeformis@ Tuticorin Dendronephthya aurora* Upputhanni Dendronephthya Dendronephthya sp.1 Upputhanni, 2 Nephtheidae N allathanni Umbellulifera Umbellulifera sp.* Upputhanni Subergorgia Subergorgia subarosa@ Upputhanni, 3 Subergorgiidae Puluvinichalli, Gulf of Mannar Nallathanni Subergorgia sp.1 Upputhanni, Puluvinichalli, Nallathanni Leptogorgia australiensis@ Puluvinichalli Gulf of Mannar 4 Gorgoniidae Leptogorgia Leptogorgia sp.1 Upputhanni, Puluvinichalli Leptogorgia sp.2 Puluvinichall i Leptogorgia sp.3 Puluvinichall i Leptogorgia sp.4 Puluvinichall i
5 Ellisellidae Junceella Junceella juncea@ N allathanni Gulf of Mannar Echinogorgia sp.1 Puluvinichalli 6 Plexauridae Echinogorgia Echinogorgia sp.2 Puluvinichalli Menella Menella sp. Upput hanni Upputhanni, 7 Clavulariidae Carijoa Carijoa rissei*. Puluvinichalli, Nallathanni
* = New to Gulf of Mannar @ = New to the Vembar group
291 292 Threats 8. Some hard corals were found damaged due to Corals and coral reefs are extremely predator bite in all the three Islands (Fig.33 & 34). sensitive. Slight changes in the reef environment 9. Some fishermen were found breaking acropora may have detrimental effects on the health of coral branches got entangled in their fish nets entire coral colonies. These changes may be due using hammer. to natural and anthropogenic disturbances. 10. Huge quantities of seaweeds found entangled Although natural disturbances may cause severe in the crab nets operated at Upputhanni Island. changes in coral communities, anthropogenic disturbances have been linked to the vast Remarks majority of decreases in coral cover and general 1. The discovery of prostaglandins in the colony health when coral reefs and humans occur Caribbean sponge triggered off a world-wide together. During the present investigation “Hunt” for the species or its congers like Indian following threats could be observed in the sponges and gorgonids. Vembar group of islands. 2. Though gorgonids and soft corals are 1. Cup corals were found up side down, but some distributed all along the coat of India, their of them were still alive mainly in Upputhanni and presence in fishable magnitude is noted only in Puluvinichalli Islands. This may be due to dragging the Gulf of Mannar. of net operation in that area (Fig.24). 3. The absence of any stock assessment prior to 2. Sand particles brought out by water current commencement of commercial exploitation were found deposited on the cup corals leading makes the assessment of damage caused to the to bleaching in some places in the above two gorgonid beds by indiscriminate fishing rather Islands (Fig.25 & 26). complicated. Same situation is applicable for the 3. Bleached hard corals were also found in the 3 soft corals also. Islands of Vembar region (Fig.27). Some hard 4. When commercial exploitation of gorgonids corals were found bleached mainly due to the started in 1975, the specimens fished out were Allelopathic effect caused by the neighboring soft large. So characteristic of any virgin bed and 10- corals (Fig.28). 15 of them made 1 kg but by 1982 the condition 4. Few lesions caused by predators were found on changed drastically and the average size of soft corals. Some large lesions inhabited by fishes specimen started showing a decrease in trend were also noticed in all the three Islands (Fig.29). resulting in the dominance of smaller specimen 5. Some soft corals with tissue decay due to numbering 40-45/kg (Thomas and Rani Mary disease were also noticed in Nallathanni Island George, 1987). The present study also could see (Fig. 30). only smaller specimens in the natural bed. 6. Sea whips were found damaged and their 5. It has been found that in a gorgonid colony, 2 cm tissues peeled off due to fish net operation in (average) growth/year amounts to 22% increase Nallathanni Island. in total weight. The weight removed from the stock by damage every year should not go above 7. Soft corals inhabiting the bottom of the reef this limit to maintain a balanced stock. So it is crest were found deposited with sediments (Fig. important to keep a vigil on the stock for its 31 & 32). sustainability.
293 Recommendations 1. The octocoral population in “reserves” may help in replenishing the adjacent beds trough larvae liberated during breeding season. So it becomes necessary to keep the resources “undisturbed” always. 2. In case any of these species become scare, steps may be taken to cultivate them in natural habitat. This is possible only through periodical monitoring. 3. Fishing practices like bottom trawling, bottom set gill net operation destroy the coral colonies. So this type of fishing should be prohibited in the Island areas. 4. Dynamite fishing and poisonous fishing are fatal to coral colonies. Even though they are prohibited by law, efforts should be taken to monitor its occurrence in the reef area 5. Sedimentation affects the growth and survival of Octocorals. So direct physical destruction through dredging and boat anchoring should not be permitted near to the reef region.
294
Published by the Gulf of Mannar Biosphere Reserve Trust
Octocorals of Gulf of Mannar A study of the Keezhakkarai Groups of Islands
IERSE
science outreach series no 19 Work Title: Octocorals of Gulf of Mannar A study of the Keezhakkarai Groups of Islands
Funding Agency : Gulf of Mannar Biosphere Reserve Trust, Ramanathapuram
Implementing Institute of Environmental Research and Social Education, Nagercoil Institution:
Duration : 1 Year - Part III
Cost : Rs. 7,81,500/ - (Part I, II & III) Keelakarai group of islands An overall review of literature related to corals of this area belong to the fringing type, and octocorals (soft corals and sea fans) of the world wide varieties of soft corals and sea fans are including that of the Gulf of Mannar has been available here. Due to pollution, boat anchoring presented by the Institute for Environmental and destructive and unscientific fishing practices Research and Social Education in 2007. The corals in general and octocorals (soft corals and present report relates to the octocorals of the sea fans) in particular are very much affected. Vembar and Keelakarai group of Islands. Hence, a detailed study was made to Keelakarai group of Islands are located document the distribution, abundance and between N 9º 09´ 02" E 78º 41´ 50" and N 9º 11´ species diversity of octocorals found in and 17" E 78º 49´ 20" within the Gulf of Mannar area around Keelakarai group of Islands (Anaipar, and the surrounding areas of these Islands Vallimunai, Poovarasanpatti, Appa, Thalayari, Valai support a wide variety of marine flora and fauna and Mulli Islands) using latest underwater of scientific and economic importance. The observation facilities.
Material and Methods 1. Study Area square area of 28.63 ha. This Island is travestied on The 7 Islands located off Keelakarai - the southern side by intervening coral stone Anaipar, Vallimunai, Poovarasanpatti, Appa, Thalayari, studded sand that is flooded during high tide Valai and Mulli - were surveyed for the octocoral preventing easy accessibility from one end to the diversity through this study. other. The southern portion of the Island is highly Anaipar Island is 9 km away from elevated (6 m) and the northern portion has an Keelakarai with a circumference of 1,605 m. The elevation of only 2.5 m. square area of the Island is 11 ha. This Island is fully Thalaiyari Island is located 10 km away covered with tall shrubs and trees. A large amount from the Keelakarai. This is an extensively elongated of dead coral blocks could be seen on the southern Island with a circumference of 8,338 m. The square shore up to a distance of 200 m where lush growth area of this Island is about 75.15 ha. The widest of seaweeds is found. There is a sand dune at the portion of this Island is on the western tip. The northern leeward side seen at low tide periods. Island is thickly covered with trees and cattle Vallimunai Island is also called by the grazing meadows are seen in between. There is a name Palliyarumunai. This Island is about 9 km from narrow strip of foreshore on the northern side and the main land. The circumference of the Island is a restricted foreshore on the southern side. 1,170 m and the square area is 6.72 ha. This is a small Valai Island is a small Island lying parallel to Island with an elongated shape and it lies parallel to the main land. Interconnecting this with Thalaiyari the mainland. It is close to Thalaiyari Island and is Island is a channel found submerged during high separated by a channel that is seen submerged tide. This Island has a circumference of 1,889 m and during high tide. an area of 10.15 ha. The western side of the Poovarasanpatti Island is a narrow northern shore has a good cover of boulder reefs sandy flat Island, seen exposed only during low tide. as well as branching corals. The southern reef is far It is fully covered by seawater during high tide. The out beyond and lies at 3 m depth. square area is only 0.25 ha. It is a misnomer to call it Mulli Island is about 1,712 m in an Island. It actually lies mid way between Appa and circumference with a square area of 10.20 ha. It is Vallimunai Islands. located 9 km away from Keelakarai. It is a sandy Appa Island is located in 8 km away from Island completely covered with tall shrubs and Keelakarai. It has a circumference of 4,840 m and a bushes with a swamp inside.
295 2. Measurement of Environmental Parameters In order to detect changes in the level of keys. coastal climate, environmental parameters have Estimation of Population: to be studied. By comparing the collected data with the earlier ones we can find out the changes, Quantitative studies of coral reefs are if any. The environmental parameters are also necessary and reliable estimates of population important to know the health of the reef. size are important in many types of ecological Temperature, salinity, turbidity, cloud cover, wind studies, especially those concerned with the and sea state are the environmental parameters management of protected areas. In addition to studied during the present investigation. this, here the problems stem from the patchy distribution of Octocorals at all spatial scales was * Temperature considered. This patchiness was taken into * Salinity account while designing the surveys. Manta Tow * Turbidity Survey and Line intercept Transect Survey are the * Cloud Cover two methods used in present study. * Wind and Sea State * Location Manta Tow Survey: The Manta Tow Survey following English Method of Identification: et al. (1997) was done to assess the soft coral Octocoral experts with SCUBA diving diversity. A 17 m (10 mm thick) polyethylene rope skill did the survey and identified the octocorals with three marker buoys placed at six m interval using underwater octocoral plates. As far as (to record the visibility), attached to the towing possible specimens were identified up to species bridle was used. A manta board (40 x 60 x 2 cm) level in the field itself. Underwater photos were made from marine ply painted white constructed also taken for reconfirmation. In the present with two indented handgrips positioned towards study, sclerites could not be used for each corner of the front of the board and a identification, as there was a ban on sampling. handhold at the central back position was used. A keen observation was made on the Data sheet (A4 underwater paper) was placed octocorals morphological characters with a grip on the centre of the board. The data underwater and the animals could be identified sheet was preprinted to assist the observer up to species/genus levels by giving due record a set of biological variables and other importance to the following factors. significant observations. • The shape, size, hardness, softness, smoothness, The technique involved is to tow an prickliness, and colour of colonies. observer using a rope and manta board, behind a • The arrangement, relative density, retractability small boat powered by an outboard motor. Tows and contractibility and roughness of the polyps. were carried out at a constant speed of 3 to 5 • The presence of autozooids and siphonozooids. km/h around the perimeter of the reef and were • The presence of a solid axis, whether it is broken into units of 2 minutes duration. During segmented or not. each 2-minute tow, observations were made on • Response to touch. several variables (e.g. percent cover of soft coral, live hard and dead corals, associates, etc.). These • Morphometry of the parts of the colonies and were recorded onto data sheets as categories. • Associated organisms Additional information like bottom profile, With the help of morphological associates, etc. were also collected. Tow characters and underwater photos octocorals continued till the end of the reef. Tow was made were identified using both published (Alderslade, parallel to the reef crest in order to get better 1983; Ofwegen, 2002; Verseveldt, 1980, 1982a, b, view of the slope. Marking the beginning tow 1983) and online (De Victor and Morton, 2007) point as ‘0’ and the first 2 minute tow break point
296 as ‘1’ and proceeded clock-wise till the end of the laid in such a way that they followed the contour reef margin. of the reef. The tape was pegged with plastic clips Line Intercept Transect Technique (LIT): at regular intervals to hold it intact in position. Line Intercept Transect survey was made The data sheet of LIT contains life form to assess the soft coral and sea fan diversity categories list with designated code. One person (English et al., 1997). This technique categorized had to lay the tape while the other followed him the reef community as life form categories, to peg the tapes. After laying the tape the categories, which provide a morphological observer swim over the tape recording the life description of the reef community. A 50 - m fiber form categories on data sheet. Soft corals and sea glass measuring tape with hooks, underwater fans were identified and recorded while in under paper, pencils and plastic clips were used. Based water itself by using under water octocoral on the Manta Tow Survey, the LIT Survey Stations identification photo sheet. were selected. In each site, five replicate The percentage cover of each life form category transects of 20 meters were laid. Transects were was calculated using a simple formula: Total length of category Percentage cover of life form category = x 100 Length of transect
Results Distribution of Octocorals Sarcophyton crassocaule and Dampia Octocorals are known to be the most pocilloporaeformis were the soft coral species of dominant species next to hard corals in the Gulf this Island. They were found distributed up to a of Mannar area. Maximum species diversity of depth of 6-10 m at the seaward side. octocorals was recorded from Poovarasanpatti Nine species of soft corals contributed to Island; the number of species recorded was 25 the soft coral diversity of Vallimunai Island. They (15 soft coral species and 10 sea fan species). are: Sinularia parulekari, S. erecta, S. brassica, S. Minimum species diversity of octocorals was exilis, S. gibberosa, Sarcophyton crassocaule, S. recorded from Anaipar and Thalayari Islands, roseum, Clavularia margaritiferae and Cervera sp.1. where number of species recorded was 7 in both The depth of their occurrence ranged from 5 to the Islands. In this Anaipar and Thalayari had 4 10 m in this Island. species of soft corals in both the Islands and rests were sea fans. Vallimunai Island was the second Poovarasanpatti Island had 15 species of most octocoral diversed Island and the number soft corals and they were found between 6 and 10 of species recorded was 9 species of soft corals m depth. Sinularia parulekari, S. brassica, S. rigida, and 3 species of sea fans. Valai Island had 6 species S. whiteleggei, S. triangular, S. ceramensis, of soft corals and 5 species of sea fans. Appa Island Lobophytum solidum, L. crebriplicatum, L. had 6 and 3 species of soft corals and sea fans pauciflorum, Sarcophyton crassocaule, S. roseum, respectively and Mulli Island had 4 species of soft Dampia pocilloporaeformis, Cervera sp.1, corals and 4 species of sea fans. Dendronephthya sp.1 and D. sp.2 are the species Soft corals recorded. Soft coral cover of Anaipar Island is given In Appa Island soft corals were found in all in Table 12. Sinularia parulekari, S. compacta, stations of the seaward side with more numbers
297 in stations 3 and 4 and they were found upto a had 6 species of soft corals. They are: Sinularia depth of 7 to 9 m. Appa Island’s soft coral cover parulekari, S exilis, S. ceramensis, S. rigida, Sarcophyton consisted of Sinularia parulekari, S. brassica, crassocaule and S. roseum. Sinularia parulekari was Sarcophyton crassocaule, S. roseum, Dampia found in all the stations of Mulli Island. Other pocilloporaeformis and Cervera sp.1. species were common in Stations 3 and 4. Only 4 Soft corals were found only in Station 2 of species of soft corals were recorded in Mulli Island Thalayari Island. Four species of soft corals, three and they are, Sinularia parulekari, S. brassica, S. species from the genus Sinularia and one from the elongata and Sarcophyton crassocaule and they were genus Sarcophyton formed the soft coral cover of found distributed in a depth range of 4-11m. this Island. They are Sinularia parulekari, S. brassica, Sinularia parulekari was the most dominant S. exilis and Sarcophyton roseum. They were soft coral species in the Keelakarai group of Islands. found distributed at a depth range between 7 to Out of the total octocoral cover of each Island a 10 m. maximum percentage (54%) of Sinularia parulekari Stations 2 and 3 were the places where soft was recorded in Thalari Island and the least cover corals could be observed in Valai Island. The depth- (26%) in Poovarasanpatti Island. Next to Thalayari wise distribution was almost uniform in all the Island, Anipar Island had 48%; Mulli had 45%, Appa stations starting from 7 m upto 10 m . Valai Island 39%, Vallimnai 35% and Valai had 34%.
Octocorals recorded from Keelakarai group of Islands Soft corals S.No Species Family Species No* 1 Sarcophyton crassocaule 33 2 Sarcophyton roseum 34 3 Sinularia brassica 3 4 Sinularia ceramensis 29 5 Sinularia compacta 25 6 Sinularia elongata 30 7 Sinularia erecta 26 8 Sinularia exilis 2 9 Sinularia gibberosa 28 10 Sinularia parulekari Alcyoniidae 1 11 Sinularia rigida 27 12 Sinularia triangular 32 13 Sinularia whiteleggei 31 14 Lobophytum crebriplicatum 35 15 Lobophytum pauciflorum 36 16 Lobophytum solidum 5 17 Dampia pocilloporaeformis 8 18 Dendronephthya sp.1 Nephtheidae 23 19 Dendronephthya sp.2 37 20 Clavularia margaritiferae Clavulariidae 43 21 Cervera sp.1 42 Sea fans 22 Carijoa rissei Clavulariidae 15 23 Subergorgia suberosa Subergorgiidae 11 24 Subergorgia sp.1 12 25 Junceella juncea Ellisellidae 16 26 Leptogorgia alba 39 27 Leptogorgia hebes 38 28 Leptogorgia sp.1 13 29 Leptogorgia sp.5 Gorgoniidae 40 30 Leptogorgia sp.6 41 31 Leptogorgia sp.7 44 32 Leptogorgia sp.8 45 * = These numbers are given in the distribution map and tables to denote the species names
298 Distribution of soft corals in the Keezhakarai group of islands. Stations are denoted by numbers
299 Species composition (%) of softcorals in Ananipar Island
18 %
25% 48%
9% Sinularia parulek ari Sinularia compacta
Sarcophyton crassocaule Dampia pocilloporaeformis
Species composition (%) of softcorals in Vallimunai Island
Sinularia parulek ari Sinularia brassica 6% 2% 5% Sinularia exilis 35% 16% Sinularia erecta Sinularia gibberosa 5% Sarcophyton crassocaule Sarcophyton roseum 13% 6% 12% Clavularia margaritiferae Cervera sp.
Species composition (%) of softcorals in Poovarasanpatti Island
Sinularia parulekari Sinularia brassica Sinularia rigida Sinularia ceramensis 2% 5% Sinularia whiteleggei 6% 2% 26% 4% Sinularia triangular 7% Sarcophyton crassocaule Sarcophyton roseum Lobophytum solidum 11% 6% 5% Lobophytum crebiplicatum 6% 2% 10% 4% 4% Lobophytum pauciflorum Dampia pocilloporaeformis Dendronephthya sp.1 Dendronephtya sp.3 Cervera sp.
300 Species composition (%) of softcorals in Appa Island
6% 15% 39%
10% Sinularia parulek ari Sinularia brassica 18% 12% Sarcophyton crassocaule Sarcophyton roseum Dampia pocilloporaeformis Cervera sp.
Species composition (%) of softcorals in Thalayari Island
16%
Sinularia parulek ari 24% 54% Sinularia exilis Sinularia brassica 6% Sarcophyton roseum
Species composition (%) of softcorals in Valai Island
17% Sinularia parulek ari 34% Sinularia exilis Sinularia rigida Sinularia ceramensis 26% Sarcophyton crassocaule 6% 12% 5% Sarcophyton roseum
301 Species composition (%) of softcorals in Mulli Island
29% 45% Sinularia parulek ari Sinularia brassica
9% Sinularia elongata 17% Sarcophyton crassocaule
Sea fans Sea fan diversity of Anaipar Island was Valai Island had 5 species of sea fans and constituted by three species, Subergorgia sp.1, were: Subergorgia suberosa, Subergorgia sp.1, Carijoa rissei, Junceella juncea. Station 3 had all the Carijoa rissei, Leptogorgia alba, and Leptogorgia 3 species. Carijoa rissei was found in Stations 1 and hebes. The first three species were found in 2 and Subergorgia sp.1 in Stations 2 and 4 in Station 3 and the last three (Carijoa rissei, addition to Station 3. Their depth of distribution Leptogorgia alba and Leptogorgia hebes) were in was up to 11 m. Vallimunai Island had three Station 2. Mulli Island had Subergorgia sp.1, Carijoa species of sea fans, Subergorgia sp.1, Carijoa rissei, rissei, Junceella juncea and Leptogorgia sp.5. They and Leptogorgia sp.5. Station 4 was found to be had a discontinuous distribution. Subergorgia sp.1 accommodating all the 3 species (Table 20). was found in Stations 1 and 5, Junceella juncea in Subergorgia sp.1 was found in Stations 1, 3 and 4, Station 1, C. rissei in Stations 1, 3 and 4 and Carijoa rissei in Stations 2 and 4 and Leptogorgia Leptogorgia sp.5 in Stations 3 and 5 and they were sp.5 in Station 4. They were found distributed at found in the deeper zone up to 12 m. 6-8 m depth. Among sea fans, Subergorgia sp.1 was the Poovarasanpatti Island had the most most dominant species in all Islands of diverse type of sea fan cover among the Keelakarai group. Maximum percentage (63%) Keelakarai group of Islands. The following 10 of Subergorgia sp.1 was observed in Vallimunai species were recorded from there: Subergorgia Island and minimum percentage (46%) in sp.1, Carijoa rissei, Subergorgia suberosa, Poovarasanpatti Island. Thalayari Island (58%), Junceella juncea, Leptogorgia sp.1, Leptogorgia alba, Appa Island (55%), Anaipar Island (54%), Mulli Leptogorgia hebes, Leptogorgia sp.8, Leptogorgia Island (53%) and Valai Island (52%) had almost sp.7 and Leptogorgia sp.6. All the species were uniform representation. A total of 21 species of found in Stations 1 and 2 except Leptogorgia sp. 6 soft corals and 11 species of sea fans were and sp. 8. Station No. 3 had Carijoa rissei. reported from the Keelakarai group of Islands Subergorgia suberosa, S. sp.1 and Leptogorgia sp.7. Poovarasanpatti Island had the maximum cover Subergorgia sp.1, Carijoa rissei and (24%) of Octocorals out of the total biotic Leptogorgia hebes were the sea fans reported from Appa Island (Table 22). All the 3 species were cover, exceeding even the hard coral cover found in Station 4 and the first two in Station 3. (22.7%). Next to Poovarasanpatti Island, Subergorgia sp.1, Carijoa rissei, and maximum cover was recorded in Appa (10.7%), Leptogorgia hebes constituted the sea fans cover Anaipar (6.2%), Vallimunai (5.4%), Mulli (5.0%) of Thalayari Island. They were found only in and Valai (4.1%) Islands. Least (3.9%) octocoral Station 2. cover was observed in Thalayari Island.
302 Species composition (%) of sea fans in Poovarasanpatti Island
Carijoa rissei Subergorgia suberosa 1% 2% 1% 4% 5% 18% 2% Subergorgia sp.2 9% Junceella juncea 12% Leptogorgia sp.1 Leptogorgia hebes Leptogorgia alba 46% Leptogorgia sp.7 Leptogorgia sp.8 Leptogorgia sp.6
Species composition (%) of sea fans in Ananipar Island
30%
54% 16%
Carijoa rissei Junceella juncea Subergorgia sp.1
Species composition (%) of sea fans in Vallimunai Island
5%
32% Subergorgia sp.1 Carijoa rissei Leptogorgia sp.5 63%
303 Species composition (%) of sea fans in Appa Island
11%
34% 55% Subergorgia sp.1 Carijoa rissei Leptogorgia hebes
Species composition (%) of sea fans in Thalayari Island
10%
Subergorgia sp.2 32% 58% Carijoa rissei Leptogorgia herbs
Species composition (%) of sea fans in Valai Island
8% 6% 11%
23% Subergorgia suberosa Subergorgia sp.1 52% Carijoa rissei Leptogorgia alba Leptogorgia herbs
304 Species composition (%) of sea fans in Mulli Island
7%
28% Subergorgia sp.1 53% Junceella juncea 12% Carijoa rissei Leptogorgia sp.5
Octocorals Found New to the Study Area A total of 32 species of octocorals Dendronephthya sp.1 was already reported by comprising 12 genera under 6 families are Lazarus et al. (2007) from Upputhanni Island reported from Keelakarai group of Islands. Out of under the Vembar group. the 32 species, 21 species belonged to the group Three genera with one species each were soft corals and 11 species to sea fans recorded under the family Clavulariidae. Family Alcyoniidae had 4 genera, Presence of Clavularia margaritiferae in Sarcophyton, Sinularia, Lobophytum and Dampia Keelakarai group of Island after 80 years was and they had 2, 11, 3 and 1 species respectively. In confirmed by the discovery of this colony from this, Sarcophyton roseum, Sinularia gibberosa, Vallimunai Island now. A species of Cervera was Lobophytum crebriplicatum were found to be new observed in Vallimunai, Poovarasanpatti and Appa to Gulf of Mannar area and Sinularia ceramensis, Islands and is reported here as new to India. The Sinularia compacta, Sinularia elongata, Sinularia species level identification could not be done to erecta, Sinularia rigida, Sinularia triangular and all due to prohibition of sample collection. Carijoa Sinularia whiteleggei were reported as new to rissei is another species belonging to the family Indian waters. Clavulariidae found common in all the Islands of Sarcophyton roseum found distributed in Keelakarai group. Vallimunai, Poovarasanpatti, Appa, Thalayari and Subergorgia suberosa and Subergorgia sp.1 Valai Islands. Sinularia gibberosa and Sinularia were the species recorded under the family erecta were found only in Vallimunai Island. Subergorgiidae. Subergorgia suberosa was the Lobophytum crebriplicatum, Sinularia rigida, most dominant sea fans species in Vembar group Sinularia triangular and Sinularia whiteleggei were of Island and found only in lesser number in found only in Poovarasanpatti Island. Sinularia Vallimunai and Poovarasanpatti Islands. compacta was distributed in Anaipar Island. Subergorgia sp.1 was found in all Islands of Family Nephtheidae had two species Keelakarai group. under the genus Dendronephthya which could not Vallimunai and Mulli Islands. Leptogorgia be identified up to species level. Both the species sp.6, Leptogorgia sp.7 and Leptogorgia sp.8 were were found in Poovarasanpatti Island. recorded only from Poovrasanpatti Island.
305 Family Ellisellidae is represented by only Poovarasanpatti, Appa and Thalayari Islands were one genus and one species, Junceella juncea. This identified up to species level and known to be colony was found in Anaipar, Poovarasanpatti and new distribution report to India. Leptogorgia sp.1 Mulli Islands. was already reported from Vembar group. Seven species of Leptogorgia coming Leptogorgia sp.5 was found in Vallimunai and Mulli under the family Gorgoniidae were recorded Islands. Leptogorgia sp.6, Leptogorgia sp.7 and now. Leptogorgia alba found in Poovarasanpatti Leptogorgia sp.8 were recorded only from and Valli Islands and Leptogorgia hebes found in Poovrasanpatti Island.
Soft corals found new to the study area
Place of Previous Report S.No Species Family occurrence Gulf of Mannar India Anaipar, Rameswaram Andaman 1 Sarcophyton crassocaule Vallimunai, Island Islands Poovarasanpatti, Appa, Valai and Mulli Vallimunai, Liitle and 2 Sarcophyton roseum* Poovarasanpatti, South Appa, Andamans Thalayari and Valai Vallimunai, Mandapam 3 Sinularia brassica Poovarasanpatti, Keelakarai?, Andaman Appa, Vembar? & Islands Thalyari and Mulli Tuticorin groups Poovarasanpatti 4 Sinularia ceramensis? Alcyoniidae and Valai 5 Sinularia compacta? Anaipar 6 Sinularia elongata? Mulli 7 Sinularia erecta? Vallimunai Vallimunai, Mandapam & 8 Sinularia exilis Thalayari and Valai Vembar? groups Vallimunai Andaman 9 Sinularia gibberosa* Islands All Keelakarai Mandapam & Kavaratti 10 Sinularia parulekari group of Islands Vembar? groups Island Poovarasanpatti and 11 Sinularia rigida ? Valai 12 Sinularia triangular? Poovarasanpatti 13 Sinularia whiteleggei? Poovarasanpatti Poovarasanpatti North 14 Lobophytum crebriplicatum* Andaman Poovarasanpatti Mandapam Keelakarai? & Andaman 15 Lobophytum pauciflorum Tuticorin group Islands of Islands 16 Lobophytum solidum Poovarasanpatti Vembar?group Anaipar, Vembar?, 17 Dampia pocilloporaeformis Poovarasanpatti and Tuticorin groups Appa 18 Dendronephthya sp.1 Poovarasanpatti Vembar? group 19 Dendronephthya sp.2 Nephtheidae Poovarasanpatti Vallimunai Single & Krusadai 20 Clavularia margaritiferae Clavulariidae Islands Vallimunai, 21 Cervera sp.1? Poovarasanpatti and Appa
306 Seafans found new to the study area
Previous Report S.No Species Family Islands Gulf of Mannar India All Keelakari Vembar 1 Carijoa rissei Clavulariidae group of Islands group of Islands? Tuticorin, Off Kaniyakumari, 2 Subergorgia Keelakarai?, Vizhinjam, Paradeep, suberosa Poovarasanpatti Vembar? Visakhapatnam and Subergorgiidae and Valai groups and Veraval coasts Rameswaram Island All Islands of Vembar? 3 Subergorgia sp.1 Keelakarai group Tuticorin, Off Veraval & south west 4 Junceella juncea Ellisellidae Anaipar, Keelakarai?, coast Poovarasanpatti Vembar? and Mulli groups and Rameswaram Island 5 Leptogorgia Poovarasanpatti alba? and Valai
6 Leptogorgia Poovarasanpatti, hebes? Appa, Thalayari and Valai
7 Leptogorgia sp1 Poovarasanpatti, Vembar? group Gorgoniidae 8 Leptogorgia sp.5 Vallimunai, Mulli
9 Leptogorgia sp.6 Poovarasanpatti
10 Leptogorgia sp.7 Poovarasanpatti
11 Leptogorgia sp.8 Poovarasanpatti
* = New to Gulf of Mannar % = New to Indian waters Ï% = Reported from Vembar group (Lazarus et al., 2007) ‘& = Locality of occurrence notavailable.
307 Distribution of gorgonidsin the Keezhakarai group of islands. Stations are denoted by numbers
308 Threats Remarks The following threats to corals were As reported already (Lazarus et al. 2008) the observed in the Keelakarai group of Islands. Since following points deserve immediate attention. octocorals are highly sensitive to environmental • The discovery of prostaglandins in the changes they have to be protected properly. Caribbean sponge triggered off a world wide • Acropora table corals were found broken in “Hunt” for the species or its congers like Indian many places. sponges and sea fans. • Heaps of dead Acropora corals were found in the • Though sea fans and soft corals are distributed seaward side of the Islands all along the coast of India, their presence in • The top of patch corals were found damaged in fishable magnitude is noted only in the Gulf of some places. Mannar. • Cup corals were found up-side-down in many • When commercial exploitation of sea fans places. started in 1975, the specimens fished out were • The seaward sides of Anaipar, Vallimunai, large, so characteristic of any virgin bed, and 10- Thalayari, Valli and Mulli Islands were found 15 of them made 1 kg but by 1982 the condition covered by sea weeds mainly Sargassum spp. This changed drastically and the average size of sea weed cover may be hampering the settlement specimen started showing a decreasing trend of planula (coral larvae) in the substratum. resulting in the dominance of smaller specimens numbering 40-45 / kg. (Thomas and Rani Mary • Sand deposition on soft coral colonies due to George, 1987). The present study also could see siltation was found in some places of only smaller specimens in the natural bed. Poovarasanpatti, Thalayari and Vallimunai Islands. • It has been found that in a sea fan colony, 2 cm • Only juvenile colonies of sea fans were noted in (average) growth/year amounts to 22% increase all these Islands. This, as reported already, is due in total weight. The weight removed from the to the large scale commercial exploitation of stock by damage every year should not go above grown up sea fans which took place in these areas this limit to maintain a balanced stock. So it is during seventies. important to keep a vigil on the stock for its • Damage of massive corals due to anchoring sustainability. could be seen in some stations of Anaipar, • The absence of any stock assessment prior to Vallimunai and Appa Islands. commencement of commercial exploitation • Fish traps were found kept in between massive make the assessment of damage caused to the sea corals in Anaipar and Appa Islands. fan beds by indiscriminate fishing rather • Operation of ‘Madi Valai’ over the reefs in Mulli complicated. Same is applicable to the soft corals Island was noticed. also.
309 Recommendations 1. Fishing operation around the Islands especially at the seaward side should be banned. 2. Seaweed collection should be made with out giving stress to live corals. 3. Boating or berthing the boats at the seaward sides of the Islands should be prohibited. 4. Coral restoration has to be done in the submerged Poovarasanpatti Island immediately. Other wise the existing corals may also will disappear. 5. There are less natural threats found for soft corals and sea fans in these Islands. However, keen monitoring should be there to protect these populations from further destruction.
310 Published by the Gulf of Mannar Biosphere Reserve Trust
Review of the Sethusamduram Ship Canal Project – Mitigation and monitoring measures as a management strategy for the Gulf of Mannar
science outreach series no 20 Work Title: Reveiw of the Sethusamudram Ship Canal Project - Mitigation and monitoring measures as a management strategy for the Gulf of Mannar
Funding Agency : Gulf of Mannar Biosphere Reserve Trust, Ramanathapuram
Implementing Ashoka Trust for Research in Ecology and the Environment, Bangalore Institution:
Duration : 4 Months
Cost : Rs. 2,71,000/- INTRODUCTION Project Area of the SSCP The GOMBRT is a statutory Trust The SSCP is a 167 km. long shipping canal, established by the Government of Tamil Nadu in which is to pass through the Gulf of Mannar, the 2001 with the Chief Secretary to the Palk Strait and the Palk Bay. It involves dredging in Government of Tamil Nadu as its Chairperson. an 89-kilometer stretch for a width of 300 During the fourth meeting of the Board of meters and for a depth of 12 meters for ships less Trustees on 15.07.2005, the issue of the than 30, 000 DWT with draft restricted to 10m. Sethusamudram Ship Canal Project (SSCP) was The project is said to have been conceived in discussed. The Chairman suggested that the Trust undertake an impact assessment study about the 1860 by Commander Taylor and the project has SSCP. The GoMBRT thought it appropriate to been subject to several reviews in the 20th engage an expert agency / institution to century. The project route is shown below: undertake this task. It is in this light that the GOMBRT commissioned ATREE to assist it in critically reviewing various reports and literature available on the impacts of the SSCP on the Gulf of Mannar Biosphere Reserve’s biodiversity and in developing recommendations related to its conservation in light of SSCP activity.
311 Gulf of Mannar socioeconomic and cultural profile shaped by its The Gulf of Mannar falls in the Indo-Pacific geography. It has an ancient maritime history and region, considered to be one of world’s richest was famous for the production of pearls. Pearl has marine biological resources. The proposed SSCP been an important item of trade with the Roman site is located in a globally significant ecologically Empire as early as the first century A.D., while sensitive marine ecosystem – the Gulf of Mannar Rameswaram, with its links in legend to the Biosphere Reserve. It is one of the four major coral Ramayana epic, has been an important pilgrim reef ecosystems of India. The reefs in Gulf of centre. The region has been and continues to be Mannar are around a chain of 21 uninhabited islands famous for its production of chank (Indian conch). that lie along the 140 km stretch between Tuticorin The GoM thus constitutes a live scientific and Rameswaram of Tamil Nadu, on the southeast laboratory of national and international value. It has coast of India. These islands are located between 3,600 species of plants and animals that make it latitude 8Ú 47’ N and 9Ú 15’N and longitude 78Ú India’s biologically richest coastal region. 12’E and 79Ú 14’E. The average distance of these The proposed Sethusamudram Shipping islands from mainland is about 8 km. The islands in Canal Project (SSCP) canal between India and Sri the Gulf of Mannar can be classified into four major Lanka across the Adam’s Bridge connecting the groups: Arabian Sea with the Bay of Bengal has the potential 1. Mandapam Group (7 islands): Musal, Manoli, to effect very significant consequences on this Manoliputti, and Poomarichan, Pullivasal. Krusadai globally significant marine biodiversity area. The and Shingle. construction and maintenance of the canal will involve a range of coastal and marine engineering 2. Keezhakkarai group (7 islands): Yaanaipar, activities, and when completed will be the largest Pallimunai, Poovarasanputti, Appa, Thalaiyari, Vaalai such undertaking of its kind for India. In a broad and Mulli. sense, this review aimed at understanding how 3. Vembar Group (3 islands): Upputhanni, project planning considered the biological diversity Pulivinichalli and Nallathanni. of the region. 4. Tuticorin Group (4 islands): Vaan, Koswari, This review involved an analysis of all the Kariachalli and Velanguchalli (submerged) SSCP documents and relevant literature to arrive at The GoM has chains of shoal, nearly seven in a multi-pronged assessment of the implications of all, 30 km long called the Adam’s Bridge. It is an inlet the SSCP particularly its implications for the of the Indian Ocean, between southeastern India biodiversity of Gulf of Mannar and Palk Bay regions. and western Sri Lanka. It is through this area This report drew from the work of several experts (Adam’s Bridge) that the SSCP will run through, who had examined the SSCP project such as Dr. which will be pathway connecting the Gulf of Ramesh of Doctors for a Safe Environment, Mannar to the Palk Bay. During high tide, the Comibatore (www.sethusamudram.in), Shri seawater is known to rise more than 1.2 meters Rajendran, Shri Krishnaswamy and others to name above the mean sea level. a few. This brief summary of this report consists The Gulf has been chosen as a biosphere only of the main points and the extensive reserve primarily because of its biological and literature reviewed is not present here for reasons ecological uniqueness. The region has a distinctive of brevity.
312 Issues Relating to Technical Aspects in Project Design, EIA and Related Studies For a project such as the Sethusamudram 1. Sub-surface geology Ship Canal Project (SSCP), to be environmentally 2. Bathymetry sound and well designed, a full understanding of the project area, its ecology, its environmental 3. Sedimentation process and transport regime processes, the project activities – namely in the project dredging and waste disposal and movement of 4. Any element/factor that impacts and influences ships in the region is a must. It has been stated the above such as monsoons, storm surges, that the navigation channels of ports on the East cyclones, tsunamis, land-use etc. 5. Assessment of Coast of India face three major and persistent the implications of the loss of bottom fauna along problems - (1) problems due to sedimentation, dredged area (2) problems due to tropical cyclonic disturbances, and (3) issues related to dumping of 6. Assessment of the implications of dredge dredged material. disposal on the ecosystem Thus the Sethusamudram Ship Canal 7. Assessment of the implications/impact of the Project should have been backed by a complete channel on the existing sediment transport scientific understanding of the following regime/process of the Palk Bay and Gulf of parameters and factors in the project area: Mannar.
The area of the Gulf of Mannar
313 8. Assessment of the implications/impact of the this is done the impact of the sedimentation on previous three points on biodiversity and biodiversity especially reefs can be extrapolated. fisheries. Sedimentation and transport regimes and 9. Assessment of the implications/impact of the factors affecting these, determine the level of operational phase of the project on biodiversity maintenance dredging required as well as the and fisheries in the region. possible sites for disposal of dredged material The sub-surface geology and the and the environmental impacts of this activity. bathymetry help determine the alignment of the Only after full information and data on the above canal and the type of dredging required. Once this is obtained can the details of points 5-9 be is known, the sedimentation from the dredging derived. Points 8 and 9 would come under an activity as well as dredge disposal can be ecological risk assessment report. It should be ascertained. This also determines the amount of pointed here that other than the NEERI report capital dredging and its costs. This sediment stating that all bottom fauna and flora in the dispersion can be predicted by knowing the dredged part of the canal will be lost, no impact sediment quality (from the surface-geology study using primary data on the biodiversity is studies) coupled with the modelling of various available. The quantum and details of the loss of scenarios of ocean-met and physico-chemical bottom flora and fauna along the canal is also not parameters. The scenarios should be based on detailed in the literature and documents. primary data as well as past historical data. Once
Chronological Timeline of Project
Dec 1998 NEERI Initial Environmental Examination (IEE) May 2003 & Feb 2004 NEERI-NSDRC Sea Geo Survey in the Pamban Pass Area
Jan-Feb 2004 NHO Bathymetry survey (25 January – 18 February 2004) May 2004 NEERI EIA (this version titled ‘Rapid EIA’ was circulated for the public hearings) July 2004 NEERI’s TFEAR Report (incorporates NHO Bathymetry survey)
August 2004 NEERI EIA (Final Version appears online without the words ‘Rapid EIA’) (incorporates NHO Bathymetry survey)
August 2004 L&T- Ramboll was entrusted with preparing the Detailed Project Report in August 2004 Nov-Dec 2004 NIOT Bathymetry Survey (6-23 November 2004 and 16-17 December 2004) February 2005 L&T-Ramboll DPR
February 2005 Indomer-Alkyon, Hydrodynamic Modelling Sedimentation Studies and Ship Manoeuvring Study for Sethusamudram Ship Canal 31 March 2005 Ministry of Environment grants Environment Clearance to SSCP
314 1. Sub-Surface Geology From the literature review and the various In order to identify the method of dredging critiques it is clear that the all project documents for the various sections of the canal, the knowledge had a poor understanding and information of the of sub-surface geology is absolutely essential. As sub-surface geology. Consequently the kind of mentioned earlier, this knowledge is also essential, dredging that is required in this region and its to identify the potential impacts of the dredging on impacts on the environment were not estimated the environment. Experts pointed out that the EIA accurately. Thus the present views of project and other investigations conducted by the project documents on environmental impacts of the authorities contain very scanty information on the dredging and disposal of dredge material in this sub-surface geology of the channel’s alignment. This region are incomplete are informed. has also been admitted in the L& T Ramboll 2. Bathymetry Detailed Project Report (DPR) and in the Technical Precise data on bathymetry is essential to Feasibility and Economic Analysis Report (TFEAR) estimate the amount of capital dredging required prepared by the National Environmental (along with sub-surface geology data). From this Engineering Research Institute (NEERI). information, the quantum of dredging required Dr.V.S. Krishnasamy, renowned expert, using various techniques (based on sub-surface engineering geologist and former Director General geology data) in different sections of the canal can of the Geological Survey of India states that the be ascertained to arrive at an accurate estimation L&T-Ramboll DPR considers the soil to be mostly of capital dredging costs. The bathymetry, sub- dregdeable but in some reaches, blasting may be surface geology and the type of dredging determine required before dredging, due to the hard nature of the total sediment that may be dispersed and hence the sandstone that may be encountered in drilling. are also relevant inputs for dredge management The project documents such as the DPR and the programme which can based on the above EIA directly do not envisage blasting but the NEERI information can mitigate and reduce the TFEAR does state, “In the event that hard strata environmental impact and sediment dispersal. comprising rock is encountered, the dimension of A bathymetric survey was done by NEERI dredging costs will drastically change as blasting (along with the National Ship Design and Research might be required.” The project documents do not Centre) in the Pamban Pass area of the Adam’s assess impacts in the event of blasting being Bridge in May 2003 and February 2004. In addition required. Krishnaswamy also points out that the to this, the National Hyrdographic Office (NHO) costs of blasting has not been taken into account had done a survey in January-February 2004 for the while estimating the cost of capital dredging and channel alignment proposed by NEERI earlier, more importantly, the impact of blasting on the starting from the north side of the Adam’s Bridge marine environment, ecology and fisheries has not area. The L&TRamboll DPR suggested that a fresh been taken into account in the NEERI EIA. Bathymetry Survey with much finer resolutions The lack of knowledge on the nature of the than the one presented by NHO would be substratum of the region is also pointed by experts necessary to arrive at reasonably accurate such as Rajendran. He adds that the impact of the estimates of capital dredging. It is quite clear from bottom topography as a result of possible blasting the above that there were gaps in the knowledge of especially on the movement of currents is not bathymetry along the sections of the channel, known or studied and that the nature of the especially the Adam’s bridge. The revised dredged spoil is currently known only for about information was not incorporated into the 38.5 to 40.5% of the total dredged spoil. environmental assessments of the channel.
315 3. Prediction of Sediment Dispersal and Adam’s Bridge might increase this sediment flow Environmental Impact into the Gulf of Mannar from the Palk Bay thus This sediment dispersion can be impacting and affecting its sensitive ecosystem. predicted by knowing the sediment quality (from This literature on this dimension and impact is the surfacegeology studies) coupled with the not available. modelling of various scenarios of ocean-met and Critics have stated that the NEERI EIA physicochemical parameters. The scenarios needs to incorporate the information and data should be based on primary data as well as past from the most important research papers on historical data. Once this is done the impact of sedimentation process in the project area that the sedimentation on biodiversity especially had been published in peer reviewed science reefs can be extrapolated. The bathymetry, sub- journals after the year 1989. Furthermore, surface geology, type of dredging and the whether the operational phase of the canal will sediment dispersal modeling determine the total have any implications to the sediment transport sediment that may be dispersed and hence are has not been ascertained by any of the literature. also relevant inputs for dredge management A satellite picture illustrates this in the adjoining programme/protocol which can mitigate and pages. reduce the environmental impact and sediment 5. Dredge Disposal dispersal. No literature on this was available prior to the project clearance or even till date. The NEERI TFEAR states, “It is very necessary to carry out a Radio Active Tracer 4. Information base and Data on Study to optimise the dredge disposal areas as Sedimentation 80% of the cost of the project is on dredging and As stated earlier, one of the three major disposal of dredged spoil” (NEERI TFEAR, page persistent problems that navigation channels of 5.1.65). It is re-stated here that the NEERI EIA ports on the East Coast have been facing is had not carried not any studies on this aspect and the NEERI EIA itself mentions (in section 6.4.1.2, sedimentation. The lack of studies and data in the page 318), “tracer studies have been initiated for EIA and other documents on the littoral further studies to select suitable locations. In no processes and flow characteristics that will affect case will dredged spoil be allowed to be the channel in the Palk Straits region has been dispersed in the Palk Bay.” The SSCP’s EIA should highlighted and further stresses that this area have included information on suitable disposal (the Palk Bay/Straits) is noted for unusually high sites, since the project is located in an sedimentation rate and is one of the five ecologically sensitive area and this activity permanent sediment sinks of India. Rajendran involves obvious environmental implications. also points out that the EIA has looked at the Krishnaswamy is of the view that it is very sedimentation dynamic of very few areas of the premature to come to any conclusion on the canal and not studied the adjacent portions of suitability or otherwise of the proposed dredge Palk Strait, which is noted for its unusually high disposal areas. He states that opinion of sedimentation rate. specialists in oceanographic studies / with The sediment sink and transport regard to the disposal of the dredged material is mechanism in the region (both Palk Bay and Gulf that it is better to dispose the dredged waste in of Mannar) is yet to be fully understood. In fact, waters 50-60m deep instead of the current there is evidence to suggest that there is an proposal of 25-30m. This view is also held by Prof. annual seasonally cycle that allows sediment flow G.Victor Rajamanickam who mentions in his from the Palk Bay into the Gulf of Mannar along interview to www.sethusamudram.in that the the Adam’s bridge. Thus, the canal through the present chosen depths of 25-30m for the
316 Satellite image showing sediment dispersal patterns from Palk Bay to Gulf of Mannar through the Adams bridge area
dumping sites would be disturbed by any cumulative) and associated navigational and monsoon (leave alone cyclones or a tsunami). landward activities in and around the project Rajendran further states that the EIA is region ambivalent on the identification of sites for · Quantification of ecological risks with recourse environmentally safe disposal of dredged to appropriate ecosystem models material thus posing an environmental hazard to Section 6.6 in the NEERI EIA, which is marine organisms. “Impacts on Productivity and Ecology in 6. Ecological Risk Assessment GoM/Palk Bay” only very briefly and qualitatively, NEERI’s Terms of Reference (ToR) for the lists the impacts and risks with no quantification EIA also specifies the need for an ecological risk of the same as suggested by the ToRs and assessment. This is also mentioned in the section introduction of the EIA. It should be pointed here 1.5.4.6 in the EIA which is given below: that, other than stating that all bottom fauna and flora in the dredged part of the canal will be lost, · Quantification of ecological risks and there is no impact study on the biodiversity is delineation of ecological risk mitigation available. The quantum and description of the measures bottom flora and fauna lost due to dredging along · Analysis of information with regard to the canal is also not detailed in the documents or environmental impact (direct, synergistic and any other literature.
317 7. Distance from Islands para 3, executive summary of the EIA. There is also There are no details of the distance of the no information on coordinates of the navigation islands from the navigational route of the canal or route up to the canal from Tuticorin or the canal itself except for a mention in the EIA that Kanyakumari. However, a possible route is “a navigational route keeping a minimum 6-8 km illustrated below by ATREE’s GIS team and the distance from Van Tiu near Tuticorin and more than distances from the islands have been shown in the 20 km from Shingle Island in Adams Bridge table below: approach area has been suggested.” in Section 1.0 Distances of Islands to possible navigational route of cana Distance from route Code on map Name of island (km) 0 Van Tivu 9.20 1 Kasuvar Island 12.50 2 Karaichalli Island 20.50 3 Villanguchalli Island 18.37 4 Upputhanni Island 29.06 5 Pulvinichalli Island 29.10 6 Nallathanni Island 28.30 7 Appa Island 30.50 8 Valimunai Island 30.00 9 Adda Island 28.50 10 Poovarasanpatti Island 29.30 11 Talairi Island 28.50 12 Valai Island 28.30 13 Mulli Island 28.40 14 Hare / Musal Island 25.60 15 Manoli Island 26.60 16 Manoliputtu Island 26.30 17 Poomarichan Island 28.30 18 Pullivasal Island 27.30 19 Krusadai Island 28.30 20 Shingle Island * 27.10 Shingle Island * 27.80 Average distance of possible Navigational Route 27.04 * (island to pt on route) ** (island to pt on canal)
Distances of Islands to possible navigational route of canal The images and the computations suggest a distance more than 20 km and are in line with the above statement in the EIA.
318 Issues Related to Environmental Management Plan (EMP) & Environment Monitoring 1. Environment monitoring program Phytoplankton and Zooplankton. Thus only The NEERI EIA does not have an physical properties - pH, EC (electrical environmental monitoring program despite the conductivity), salinity, temperature, turbidity, TSS ToR for NEERI’s EIA clearly stating that the (Total Suspended Solids) is being monitored. It Environmental Management Plan (EMP) will also seems that it is being done only for marine “essentially consist of details of work proposed water quality and not for sediment quality. The under mitigative measures, implementation SSCP had earlier publicly announced that results schedule of such measures, fund and manpower of all the environmental monitoring would be requirements and arrangements for monitoring updated everyday on the website. on a long-term basis.” In fact, the NEERI EIA itself 2. Monitoring of Sub-Marine Conditions further states in section 1.5.2, the Scope of the The L&T-Ramboll DPR in section 12.9.2 Study, “Formulation of an environmental quality page 12-11 bullet point 5 states, “The submarine monitoring programme for various phases of the conditions during the dredging activity should be project to be pursued as per the requirements of inspected by divers and photographic and video statutory authorities.” records should be maintained. This activity This lacuna, indeed omission in the EMP of should also cover the disposal grounds (at sea)”. the EIA is pointed out by L&T-Ramboll in their This is evidently not being done as seen from the DPR in section 2.5.4 on page 2-12. It states, “The information on the SSCP website where the Environment Management Plan reported is well entire environment monitoring detail is being presented but does not cover pre and post maintained. project monitoring requirements and mechanisms for environmental management.” In 3. Monitoring of other parameters fact, it is the L&T-Ramboll DPR that lays down the Prof. Rajamanickam stresses that detailed environmental monitoring currently important factors like hydrography, requirements for the implementation & bathymetry, current dynamics, total suspension operational phase in appendix A.12.2 on page 2-1 load, climate changes, sea level alterations etc., and appendix A.12.2.1 on page 2-3 respectively. that have the ability to affect the Project and the This includes monitoring of marine water and Bay are not being monitored either. sediment quality. This has been adopted by the SSCP and is also on their website on Seralathan highlights that other environmental monitoring. However, a closer conditions from the MoEF’s clearance letter, such look at the details of environmental monitoring as the stoppage of dredging during the fish as updated on the website implies that the breeding & spawning periods, and the condition following parameters are either not being that suspended matter at the dredging sites followed or not being posted on the website: should not spread more than a kilometer on Chemical Properties: DO, BOD, COD, Oil & either side of the channel route have been Grease, Nutrients, Sulphates, Chlorides Heavy disregarded by project authorities (Seralathan, Metals: Fe,Zn,Mg,Mn,Cd,Cr,Hg Bacteriological 2006). None of the project documents or the parameters: Coliform count Marine Biology: MoEF clearance conditions refers to this.
319 Dredging, Sedimentation, and its Impacts on Coral Reefs and Seagrass Meadows : Recommendations for the Gulf of Mannar
Given the shallow nature of the Palk Bay and potentially affect dispersal and settlement of and the Adam’s Bridge area, it will require benthic organisms. In areas of high flow, recovery considerable dredging of the sea floor to attain could be relatively rapid, in areas where flow this depth. These activities, along with the rates are much reduced, recovery could take as increased coastal development that will long as 5-10 years. doubtless result with the establishment of the Dredging activity associated with the canal will introduce dramatic changes in the construction of the canal will result in large marine environment of the Gulf of Mannar . quantities of dredge spoils, which will have to be efficiently disposed. Although the project Consequences of Dredging Activity on proponents propose to dispose the spoils in Marine Environments deep waters 25-30m offshore, the dumping of Marine dredging, by its very nature, is an dredge materials could result in a range of earthmoving exercise of immense proportions. deleterious consequences for ecosystems, from The SSCP canal proposes to dredge up regions of burial of the ecosystem to changing the Adam’s bridge to between 9m and 12 m depth, sedimentation regimes. This is particularly from its current 3m to 5m depth. The L&T- important given the fact that dredge spoils will be Ramboll DPR states that the expected dredging generated not merely during the construction amount is 0.1 x 106 m.. The dredging itself will phase of the canal, but throughout the result in large-scale benthic scarring and removal operational phase as well, as maintenance of all sedentary organisms on the ocean floor. The dredging will need to continue through the life of specific kind of dredging used will eventually the project. One of the fallouts of this is that we determine the nature of the impact on the should expect a marked increase in fine sediment benthic floor, but the commonly used forms of suspension in the waters around the Gulf of dredging – anchor dredging and trailer dredging Mannar, and will result in increasing sediment both cause considerable damage. The project deposits in marine habitats, and a lowering of documents refer to trailer suction dredgers are light conditions. being used for most areas of the dredging of the Although only a very small percentage of canal. However, for the Adam’s bridge the dredge spoils are represented by fine silty documents state that cutter section dredgers particles, these are generated in sufficiently large will be being used. amounts to considerably increase sedimentation This direct habitat destruction will result levels in dredged areas, sometimes for up to 4 in losses of marine benthic environments along years of the dredging activity. The spread of these the course of the canal, and can also lead to sediments is likely dependent on a combination significant alterations in the characteristics of the of particle size, local current patterns and sea bed, which may make benthic recovery a weather conditions. The penumbra of influence protracted process. Recolonisation could begin of the dredging operations is likely to extend far as early as a year after the event in the case of beyond the dredging zone itself, and may increase early successional species, but in the case of more the sediment and nutrient loads in nearby marine slow-growing, long-lived marine organisms, the systems, potentially impacting the region’s coral recovery could be considerably slower. Large- reefs and seagrasses. The rest of the report scale changes in bathymetry will also result in attempts to clarify these impacts and its alterations in local flow patterns that could implications for the environmental management change patterns of sediment flux in these waters, of the region.
320 Management Strategies in the Gulf of Mannar Biosphere Reserve in Response to the Proposed Canal Building Activity
There is little doubt that the construction it is not possible to discount changes to sediment of the Sethusamudram canal will result in some regimes, turbidity and nutrient increases within consequences for important marine ecosystems the Gulf of Mannar Biosphere Reserve in the region of its construction. What is less jurisdiction as a direct result of this activity. As clear is how far the influence of the canal building stated earlier, there is no direct physical removal will spread to the surrounding waters. Much of of corals or sea grasses being envisaged within this will be dependent to a large extent on how the National Park. While jurisdictional sensitively the construction effort is managed boundaries may certainly restrict what marine and controlled, and whether adequate managers can do outside their administrative precautions are taken to ensure that limits, it must be understood that the particularly surrounding ecosystems do not decline below fluid environments of coral reefs and seagrasses previously determined thresholds of acceptable are strongly influenced by forces often well loss. Given time, and with adequate protection outside the protected area. Management needs from other pressures, many marine systems to constantly keep an eye on these factors and be show remarkable resilience, and may recover aware of any potential impacts and subsequent fairly quickly from even the worst disturbances, changes in parameters (ocean-met, ecological, but ensuring that this resilience is not physico- chemical, or biological). Given the fact compromised because of developmental that many marine ecosystems also show sudden pressures is often a huge task. shifts in their functioning, a fire fighting approach This section attempts to give an overview may not be of much use if the system is tipped of the potential consequences and responses of over the cusp of its resilience potential. It has also coral reefs and seagrass beds to the canal been pointed earlier in this section as well as development activity. This is based completely on previous sections that there is inadequate a reasoned assessment of the secondary literature and data on the environmental impacts literature available from other areas and other especially on the Gulf of Mannar ecosystem in developmental projects. If the section is terms of its ecology, biodiversity, and fisheries. circumspect in its conclusions, it reflects the Hence in the light of this, developing and adopting natural circumspection that any scientist must a strong monitoring programme is the most maintain in the absence of primary data. The list prudent approach to be followed by the of scientific documents available in the GOMBRT. The following are a series of small but peerreviewed literature on the potential effects essential measures that can be undertaken by the of sedimentation on the Gulf of Mannar is, to this GoMBRT in the light of these potential impacts author’s knowledge, practically non-existent, on the ecological systems of the Gulf: necessitating the largely derivative approach 1. Mapping the distribution of corals and taken here. Having said that, it is not an seagrasses in the Gulf of Mannar Biosphere unreasonable best practice to use experiences reserve. This community cartographic exercise is elsewhere to prepare for the range of potential absolutely essential to get an idea of what species scenarios that the construction of the canal can of seagrass and coral are present in what throw up. locations. Apart from being a useful baseline from A large proportion of any possible which ecologically-relevant ecosystem impacts to marine ecosystems is likely to be felt management can proceed, this will give by seagrasses in the Palk Bay, since that is where Biosphere managers a good sense of which most of the capital dredging is focused. However, species and communities are most at risk from
321 sedimentation impacts. Different species of measures of nutrient and heavy metal seagrass and corals respond very differently to accumulation directly in seagrasses. While there near and distant sedimentation impact, but it is are a few monitoring programmes already impossible to determine the long-term designed that can be used, most are not geared to consequences to community composition, dealing with specific functional aspects that may population numbers and diversity, unless be important in the Gulf and therefore cannot be distributional information is available at a fairly applied without considerable modification. To be detailed level for the Gulf. A well-planned adequate, a monitoring programme needs to exercise of this nature can be conducted within prove its sensitivity to changes in sedimentation 12-18 months, and will be an invaluable resource regimes at sub-lethal levels. To do this, detailed for the Biosphere Reserve. standardisation studies are required for coral 2. Establish a monitoring protocol for seagrasses reefs as well as for seagrasses. These studies and coral reefs that directly address the issues of should be designed to examine the efficacy of a sedimentation, eutrophication and turbidity whole range of ecological parameters, to impacts. As global best practice, most impact determine which of them, when combined, allow assessments will standardly be based on a BACI the most sensitive assessment of ecological (Before-After-Control-Impact) design. In the change in relation to the developmental activities absence of this best practice being employed in in the Gulf. Ideally, these studies should be the current EIA notification, it may be imperative conducted over an annual cycle, and will for the Trust to enforce it at the local level at least eventually lead to the development of a to document any potential impacts of the comprehensive protocol for monitoring. dredging activity. This will serve as an early 3. Establishing tight controls over the treatment warning system to alert the manager on remedial and deposition of dredge spoils in relation to the action to be taken. Using a functional indicator reserve boundaries. This should ideally extend system approach is ideal for such a monitoring well beyond the limits of the boundary, given the programme, and it could potentially include inherent connectivity of marine systems.
322 Findings and Recommendations of the Review
Findings Indomer’s Hydrodynamic Modelling (both of The first two sections of this review which have), Radio Active Tracer Study reveal shortcomings in the literature and other Dredge Spoil and Dumping related documents of the SSCP project in terms · Nature of the dredged spoil is currently known of adequacy and methods used to assess only for about 38.5 to 40.5% of the total dredged environmental impacts, but more importantly, in spoil. terms of data on basic parameters such as subsurface geology, bathymetry, and · No Radio Active Tracer Study to optimise the sedimentation process in the project area. These dredge disposal in dredge dumping sites data gaps result in the inability to assess and Environment Monitoring & Environmental review the risks, hazards and environmental Clearance impact of the project on the ecosystem. · No monitoring of heavy metals, bacteriological As result of the poor understanding of the parameters, and marine biology: phytoplankton subsurface geology and the bathymetry, the type and zooplankton, only physical properties are of dredging required and the characteristics of being monitored. the dredged sediments are not known. This · It also seems that it is being done only for means the exact impact while dredging as well as marine water quality and NOT for sediment dredge disposal cannot be ascertained and so quality. also the impacts on the environment. · No monitoring of the submarine conditions The poor knowledge base of the during the dredging by divers and photographic sedimentation process and dynamics of the and video records project area across all the documents implies · No monitoring of important factors like that there is a likelihood of the instability of the hydrography, bathymetry, current dynamics, total dredging dump sites and in turn environmental suspension load, climate changes, sea level impacts as a result of this instability. alterations. A summary of these gaps is presented below: Miscellaneous Geology and Bathymetry · Not taken into account impacts of blasting (as a · Bathymetry survey by NEERI in the Pamban possible activity that might be required later) on Pass area of the Adam’s Bridge and National the ecosystem. Hyrdographic Officer (NHO) starting from the · Inadequate Ecological Risk Assessment In light north-side of the Adam’s Bridge area is of all the above, we conclude that is not possible inadequate to adequately assess the exact environmental · Lack of full knowledge base of the sub-surface impacts to the biodiversity and habitat of the Gulf geology along canal · Bathymetric Survey data of Mannar from all the available literature and was carried out by NIOT (6-23 November 2004 more detailed studies may be required for the and 16-17 December 2004) not incorporated same. Reviewing the current status of the into NEERI EIA implementation phase of the project, it prudent · Non inclusion of vital studies in EIA -NIOT’s to undertake a strong long-term monitoring Geological & Geo-technical Assessment, programme in the GOMBR area.
323 Recommendations
In light of the above the reviewers have specific · Map the distribution of corals and seagrasses in recommendations, which are listed below: the Gulf of Mannar Biosphere reserve. Apart · Based on the dredge spoil characteristics, from being a useful baseline from which quantum and sedimentation of the region ecologically-relevant ecosystem management identify suitable sites for dredge disposal after can proceed, this will give Biosphere managers a assessing their stability using a full year’s primary good sense of which species and communities data (for normal and cyclonic conditions). The are most at risk from sedimentation impacts. As disposal sites should be in waters at least 50-60m different species of seagrass and corals respond deep instead of the current proposal. Establish very differently to near and distant tight controls over the treatment and deposition sedimentation impact, distributional information of dredge spoils in relation to the reserve will need to be available at a fairly detailed level boundaries. This should ideally extend well for the Gulf in order to determine the long-term beyond the limits of the boundary, given the consequences to community composition, inherent connectivity of marine systems. population numbers and diversity. A well-planned · Ensure monitoring of all the parameters exercise of this nature can be conducted within suggested in the DPR and MoEF clearance 12-18 months, and will be an invaluable resource conditions are being carried out and is fully for the Biosphere Reserve. published on the project website regularly. · Establish a monitoring protocol for seagrasses · The environmental factors and parameters that and coral reefs that directly address the issues of have the ability to affect the project need to be sedimentation, eutrophication and turbidity expanded to include other aspects such as impacts. This will serve as an early warning hydrography, bathymetry, current dynamics, total system to alert the manager on remedial action suspension load, etc., should be monitored in the to be taken. Using a functional indicator system GOMBR and GOMNP. Specifically the following approach is ideal for such a monitoring ocean-met parameters should also be programme, and it could potentially include monitored: a) wind speed & direction b) wave measures of nutrient and heavy metal height, period & direction c) current speed & accumulation directly in seagrasses. direction d) tide &water level. This could be · Divers should inspect the submarine conditions funded and undertaken by the SSCP jointly with during the dredging activity and photographic the GOMBR and be incorporated into EMP and and video records should be maintained. This post-project environmental monitoring. activity should also cover the dredge disposal · Studies on other factors such as implications of sites. This should be incorporated into EMP and climate change and sea level alterations for the post-project environmental monitoring. GOMBRR and project area based on modeling · All of the above monitoring recommendations studies should be explored and developed. and the existing the SSCP monitoring should · Seralathan highlights that other conditions be linked up and synergized with all the from the MoEF’s clearance letter, such as the research projects of the GOMBRT such as the stoppage of dredging during the fish breeding & recently commissioned study by Suganthi spawning periods, and the condition that Devadason Marine Research Institute (SDMRI) suspended matter at the dredging sites should which includes mapping of corals and sea grasses not spread more than a kilometer on either side in the GOMBR that aims to establish some of the channel route have been disregarded by baselines and rigorous monitoring. A suitable project authorities (Seralathan, 2006). coordinating mechanism would need to be
324 established for all such projects, monitoring and constituted by the Government of India on the studies in the GOMBR. The GOMBRT and its SSCP. scientific advisory committee could function as · The SSCP should proactively support and assist the lead agency for this mechanism. the monitoring programmes undertaken by the · The GOMBRT Trust Director and the Chief GOMBRT and Forest Department official in the Wildlife Warden should be made members of the Gulf of Mannar in the form of human, financial monitoring committee on environmental issues resources as well as logistical support. This could on SSCP. This will enable a closer monitoring of be done under a Corporate Social Responsibility activities towards achieving the objectives of the (CSR) programme by the SSCP. The GOMBRT Trust. Trust Director and the Chief Wildlife Warden · The GOMBRT Trust Director and the Chief may be made members of the body that will Wildlife Warden should also be made members develop the CSR the activities of SSCP. of the Committee of Eminent Persons
325
Published by the Gulf of Mannar Biosphere Reserve Trust
Enhancing Legislative Provisions for Natural Resource Conservation in the Gulf of Mannar Biosphere Reserve
C A G
Citizen, Consumer and Civic Action Group
science outreach series no 21 Work Title: Enhancing Legislative Provisions for Natural Resource Conservation in the Gulf of Mannar Biosphere Reserve
Funding Agency : Gulf of Mannar Biosphere Reserve Trust, Ramanathapuram
Implementing Citizen, Consumer and Civic Action Group, Chennai Institution:
Duration : 1 Year
Cost : Rs. 2,40,000/ - INTRODUCTION biologically rich and fragile coastal zone. The effectiveness of legal measures for There is a genuine need to examine the conservation of the Gulf of Mannar and the various policies, laws, regulations, guidelines and promotion of ecological and social benefits is rules of various institutions, which have legal, and primarily dependent on the appropriateness of policy mandates and which are in one or the legal design and implementation mechanisms. other way influencing the conservation and Marine conservation approaches in the sustainable use of resource and sustainable country have followed largely terrestrial systems development of the area. The GOMBRT engaged of management, which are often not appropriate the project team put together by the Citizen, from the ecological point of view and may also consumer and civic Action Group (CAG), ignore socio-economic complexities. The GoM Chennai to critically review and analyse various region has a number of environmental laws, policies, laws, regulations, guidelines and rules which pertain to both the marine as well as land related to protection, conservation, sustainable areas. For each of these, there are multiple use of marine resources and developmental government departments and agencies activities in GoMBR and to recommend to the responsible for implementation aside from the Trust, their expert opinion on revision, role played by the GoMBR Trust. The jurisdiction modification and amendments at relevant places of these laws both in terms of space as well as in order to reduce conflicting provisions and to their subject matter is often overlapping. bring a cohesive approach towards protection Therefore there are significant overlaps in the and use of the GoMBR’s natural resources. duties of the agencies and their powers to act on specific issues. This report compares the implementation experience of environmental The complexities involved in the laws applicable to this region to arrive at a picture management of this coastal region often results of implementation of biodiversity protection in in conflicts among various agencies, which have distinct mandates to attend to. This is a problem the GoMBR. The report also proposes a plan for since a coordinated approach is vital for a enhancing conservation through changes to the cohesive management and administration of this legislative framework governing this region.
326 Methodology Under this project, a combination of research methods was employed to answer the following specific research questions: Q1. Are the current marine legislations related to conservation and fisheries contributing effectively to the conservation and sustainable use of the GoMBR’s resources? Q2. What are the ways by which these laws, the relevant implementing agencies and the legal strategies and mechanisms can be improved to positively impact the sustainable use and conservation of the natural resources of the GoMBR? Q3. What improvements are required within the 28th February 2007, 17th–21st March, 2007 and legal framework to ensure better biodiversity 9th–15th May, 2007. A set of interviews were also conservation and sustainable use of the GoM’s conducted with representatives of the coastal natural resources? community, people with several years of expertise Primary data in working with these communities and merchants Primary data was collected by conducting trading in marine products in these two districts, as interviews with key informants from the various also in Kanyakumari District between the 17th- government departments of the region. 21st March 2007 and 26th March to 1st April, 2007. Information about the role and functioning of these These interviews were conducted to help identify departments in conserving the GoMBR was grey areas in the legislations and the difficulties gathered and used to better our understanding of involved in their implementation. the efforts taken to protect the Reserve. Various Secondary data interview schedules were prepared based each the Secondary data collected included various legislation and administered to the relevant officials central and state legislations, maps pertaining to the in Ramanathapuram and Tuticorin Districts in three GoMBR, details about the GoMBRT, activities rounds of interviews conducted between the 27th- within the GoMBR (fishing, sea weed cultivation and harvesting practices in the region). Maps were obtained from the GoMBRT and the Tamil Nadu Forest Department. Details pertaining to the structure and functioning of the GoMBRT and data collected by the Trust on activities within the GoM were collected from the office of the GoMBRT, in Ramanathapuram. Acts and Rules governing the GoMBR area were collected from the official websites, government offices and from personal libraries of various environmental organisations. Notifications, collector’s orders and GOs specific to the region were collected from the relevant departments and the GoMBRT. Information about the fishing practices in the region was collected from the coastal community and the library of CMFRI, Mandapam was referred to for material on sea weed cultivation and harvesting.
327 Policy Analysis belongs only to the Central Government. Wild Life (Protection) Act, 1972 In concentrating its efforts to protect little pockets of areas identified as sanctuaries The Wild Life Protection Act (WLPA) was and national parks, the conservation efforts of enacted to provide for the protection of wild the Act appear myopic since they do not take into animals, birds and plants with view to ensure the account other development activities that take ecological and environmental security of the country place in the marine area other than the national and is probably one of the most important laws in park that might have direct implications on it. operation in the GoM. This Act is the only law in Therefore when corals that lie in the Park Bay or operation which focuses on habitat [Sections 18 even in areas of the GoM outside the National – 38] and species [Annexure 5] conservation Park are destroyed, or where land based with an end to meet its objectives. Thus several pollution from coastal towns and industries marine species are included in the schedules of takes place, no action can be initiated by the the Act. Wildlife Warden’s office to stem this problem. The Act however fails to provide The greatest failing perhaps, of this Act is definitive timeframes for fulfilling its various its inability to ensure the coordination of various provisions. For instance, though the Act requires laws and agencies for its effective the boundary of the National Park to be implementation. For instance, though the WLPA demarcated [Section 35(2)] it fails to provide for prohibits the entry into sanctuary with weapon any actual timeframe by which such demarcation without previous permission in writing of the should be carried out. This then leads to several Chief Wildlife Warden or the authorised officer problems, as is the case in GoM since the [Section 31], however the Arms Act that controls implementation of the Act especially in the licensing of arms and ammunitions finds no territorial waters becomes exceedingly mention of this provision. This leaves challenging in the absence of boundaries for both conservation efforts in a vacuum of sorts the implementers and the local communities that especially because the WLPA mandates that all use the resources of the area. Similarly, there is persons in possession of arms as defined under no timeframe specified for the issue of final the Arms Act, 1954 should register their names notification declaring a specific area as a national with the Chief Wildlife Warden [Section 34] and park and thus, as in the case of the GoM where no new licenses are to be granted under the Arms even after 22 years have elapsed there is still no Act within a radius of ten kilometres of the final notification of the national parks. protected areas without the prior concurrence The whole settlement of rights of the Chief Wildlife Warden [Section 34(3)]. procedure is mired in problems since Section 26A(1)(b) of the Act states that adequate measures should be taken to protect the occupational interests of local fishermen. Section 26A(2) states that the right of innocent passage of any vessel or boat through territorial waters is not to be affected by the declaration of a protected area. Our research in the GoM area indicates that these clauses are interpreted differently by different officials with a few officers holding the view that it is not necessary to provide notice, or settle claims over marine spaces since ownership over the waters which are part of India’s territorial waters technically
328 Recommendations for strengthening the success. legislation * Review Schedule I of the notification based on * Commission studies to evaluate the pros and scientific studies. Explore options for modifying cons of newer PA categories such as the list and including other threatened species ‘Conservation Reserve’ under section 36A or such as ornamental fishes. the Community Reserve and their applicability * Review Section 29 and 35(6) and explore the for a resource rich region such as the GoM and implications of applying this section to all areas given the present land rights and resource usage around sanctuaries and national parks especially patterns. Conservation Areas. * Such assessments should be accompanied by * Complete the notification process for the participatory processes before such a GoMNP area and issue final notification declaration can take place. The involvement of * Clarify the terms ‘wrongful seizure’ and local communities and other stakeholders in the ‘vexatious’ in Section 53 and review the need for process of conservation is critical to its future the Section. The Territorial Waters, Continental Shelf, Exclusive Economic Zone and other Maritime Zones Act, 1976 The Territorial Waters, Continental Shelf, peace, good order or security of India. This Exclusive Economic Zone and other Maritime provision fails to incorporate the Precautionary Zones Act 1976 was enacted to apply the Principle and the Polluter Pays Principle since it International Convention on Law of Sea in India. does not prohibit ships that are identified as The law clarifies and demarcates areas in the sea potential pollution hazards, even in ecologically as territorial waters, Contiguous zones, sensitive areas such as the GoM thus exposing Exclusive Economic Zones and continental shelf. such areas to potential pollution incidents. The right of the nations vary in these areas, for Sections 6(3)(d) and 7(4)(d) confer example, the State has complete sovereign exclusive jurisdiction on the Central authority over the territorial zones whereas the Government to preserve and protect the marine rights of the State parties is restricted to environment and to prevent and control marine economic interests like exploitation and pollution within the Continental Shelf and the exploration of resources in the Exclusive Exclusive Economic Zone. However, the Act Economic Zones. The law on the demarcation of stops short of actually providing for mechanisms the areas in the sea as territorial waters, by which such protection and prevention and control of marine pollution can be carried out. Exclusive Economic Zones etc is considered to be very important since various other Recommendations for strengthening the enactments like the Coast Guard Act, 1978, the legislation Customs Act, 1962 etc. refer to the provisions of Review Section 4(1) and expa nd the the Territorial waters, Continental shelf, definition of ‘innocent passage’ to read: For the Exclusive Economic Zone and other Maritime purposes of this section, passage is innocent so Zones Act, 1976. long as it is not prejudicial to the peace, good This Act also permits the innocent order or security of India or to the ecosystem passage of all the foreign ships, other than health of the marine waters especially with warships, submarines and other under water respect to passage through ecologically sensitive vehicles in the territorial waters [Section 4(1)]. It areas. d include the protection of species and goes on to define innocent passage as passage is habitat as prescribed under the Wild Life innocent so long as it is not prejudicial to the Protection Act
329 The Coast Guard Act, 1978 smuggling, pollution, to enforce other maritime The maritime zones of India is patrolled by laws in those areas and to ensure the safety of life the Coast Guard who is also responsible for taking and property at sea [Section 14]. In keeping with such measures as are necessary to preserve and this the Coast Guard is mandated to apprehend protect the maritime environment and to prevent any person/vessel that carries marine life that is and control marine pollution [Section 14(2)(c)]. protected by the Wildlife Protection Act (WLPA). The Coast Guard Act does not however, provide However, since the Coast Guard is not empowered for the mechanism of regulation of pollution. Our under the WLPA, their role is limited to interview with the Commandant of the Coast apprehending contraveners of the provisions of the Guard Office, Tuticorin reveals that currently, due WLPA and handing them over to the Wildlife to the lack of procedural clarity, any discharge of Warden. pollutants above a certain limit is currently Thus there are no specific provisions to regulated by the IMO and the MARPOL (The regulate marine pollution in either of the above International Convention for the Prevention of Acts. The Acts also fail to recognise the need for a Pollution from Ships). joint state-centre cooperation to help protect The Coast Guards who are appointed coastal waters especially in ecologically sensitive under the Coast Guard Act work under the areas such as the GoM. general superintendence, control and direction of Recommendations for strengthening the the Central Government [Section 5]. Since legislation fisheries is a State subject and the maritime zones in the GoM are governed by the Tamil Nadu Marine * Review Section 14(2)(c) of the Act to read: taking Fishing Regulation Act, 1983 (TNMFRA) fisheries such measures as are necessary to preserve and falls outside the jurisdiction of the Coast Guard. protect the maritime environment to conserve This State – Centre disconnect therefore leads to a ecologically sensitive areas, implement the Wild situation where the Coast Guard, the best Life Protection Act and prevent and control marine equipped to patrol the seas, cannot take pollution. cognizance of offences under the TNMFRA. * Include Clause 14(3A) to read: To coordinate with The duties of the Coast Guard also various Central and State Agencies to ensure the includes the prevention of illegal activities like effective implementation of Sections 14(1)-14(3).
330 The Maritime Zones of India (Regulation of Fishing by Foreign Vessels) Act, 1981 The Maritime Zones of India (Regulation of keeping with the public interest of that area Fishing by Foreign Vessels) Act was enacted to [Section 4(3)], a provision that is already mired in regulate the fishing activities of the foreign vessels in procedural hurdles due to the absence of any clear certain maritime zones of India. “Maritime zones” is requirements/procedures in either the Act or the defined as the territorial waters and the Exclusive Rules. Economic zones of India [Section 2(g)]. The Act The Act and the Rules also stop short of necessitates authorisation from the Central providing any mechanisms for monitoring and Government for entry any ship, boat, sailing vessel implementation. Thus, the provisions in the Act that or any other description of vessel which is not lays down procedures for cancellation or owned by a citizen of India shall into the maritime suspension of licence or Permit if the Government zones of India. of India has reasonable cause to believe that either The Act requires foreign vessels to obtain a the information supplied to it in the license license [Section 3(a)] and permit [Section 3(b)] for requisition form is wrong or if conditions of the carrying out fishing activities in the maritime zones license have been contravened [Section 6(1)] and of the GoM. The licensing procedure itself is fraught the Rules which allows for the levy of fine extending with provisions that go against any meaningful up to Rs. 50,000 [Rule 16] if provisions of the Rules regulation of fishing, especially in ecologically are contravened are rendered meaningless in the sensitive areas such as the GoM. absence of strict monitoring mechanisms. For instance, the Act and Rules indicate that Foreign vessels are also prohibited from the license can be issued for any term as decided by catching any fish of a species, size or age that are the Government of India [Section 4(5)(b)] or prohibited under the Wild Life Protection Act and required by the Licensee [Rule 3(1)(e)]. This where such fish are caught they shall be retained provision vests discretionary powers with the and preserved on board the vessel and shall be Government of India without providing for the surrendered to the authorized officer along with period of validity of license, taking into account the the report accounting for the same[Rule 5]. This biological diversity of the area, the status of species provision is however meaningless since effective proposed to be caught etc. monitoring procedures are not prescribed under The Act also indicates that the license must this Act or under the Coast Guard Act (Since it be issued within one month of application [Rule is the Coast Guard that is to implement this 3(2)], a provision that does not provide for enough Act). Further, just requiring the surrender of time for reconnaissance studies of ground realities species caught in contravention of the Wild in the area that such fishing is proposed. This Life Protection Act makes it seem like the Act provision will also impede any real effort on the is just making a token gesture towards actual part of the Government of India to conduct species and habitat protection as prescribed by inquiries into whether the issue of such license is in the Wild Life Protection Act. This supposition
331 is further strengthened by the fact that the Act grant of license. fails to prescribe several provisions that would *Review Rule 3(1)(e) and include the following help in species conservation such as the Proviso ‘Provided that the period for which regulation of the number of foreign vessels that licence is required does not exceed the can be allowed in the area at a given time, the maximum period for grant of licence as need for protection of ecologically sensitive prescribed by the Act Include Schedule 1 in Act to areas etc. define the procedure to be followed for such scientific studies Include Section 4(6) to read: Recommendations for strengthening the legislation * The Government may, based on scientific studies as prescribed in sub section 4 5(ba): (a) * Review Section 4(5)(b) and include: maximum regulate, restrict or prohibit the fishing in any periods for the license after which the licence specified area by such class or classes of fishing will expire. vessels; and (b) regulate, restrict the number of * Include Section 4(5)(ba) to mandate scientific fishing vessels which may be used for fishing in studies of the carrying capacity of the region in any specified area as prescribed in the Schedule 2 which the license for fishing is sought before the of this Act
The Merchant Shipping Act, 1958 The Merchant Shipping Act of 1958 from escape or discharge of oil from that ship, provides civil and criminal liability regimes in the wherever such escape or discharge occurs, and case of marine pollution. Part XI A of the Act, includes the costs of preventive measures and amended in 2003, contains provisions for incidents further loss or damage caused by preventive of marine casualty or acts relating to such casualty measures [Section 352H(d)] and excludes any occurring with grave and imminent danger to Indian liability due to pollution by the release/spillage of coast line or related interests from pollution or ballast water or noxious liquids. Another threat of pollution in the sea or air either by discrepancy in the Act is that though it seeks to deliberate, negligent or accidental release of oil, penalise all pollution incidents irrespective of the ballast water, noxious liquid and other harmful manner in which it is committed, provisions are substances into sea or including such incidents made to provide immunity to persons who are able occurring on the high seas. It necessitates Indian to prove that such damage has not been caused ships to have several certificates such as the wilfully. international oil pollution prevention certificate Also, the provisions for containment of 356C(1), international pollution prevention accident pollution [Section 356K] in Part XI A are certificate if it is an Indian oil ship or ship carrying also limited to oil pollution and do not include noxious liquid substances in bulk 356C(2), pollution due to other contaminants such as ballast international sewage pollution prevention certificate 356C(3), international pollution water. prevention certificate 356C(4). Just necessitating these ‘certificates’ seems Part X B of the Act which deals with the civil like an ad hoc measure taken to accommodate but liability of the owner of an Indian or foreign vessels not enforce commitments made at international that cause marine pollution in the territorial waters conventions such as the International Convention or EEZ and defines the liability of owner [Section for the Prevention of Pollution from Ships, 1973 352J] due to pollution damage. Here the definition and stops short of actually protecting the of pollution damage is restricted to loss or damage territorial waters of India, especially in caused outside the ship by contamination resulting ecologically sensitive areas such as the GoM
332 region from pollution. Though these certificates and other harmful substances from that ship, are mandatory there is no method to verify their wherever such escape or discharge occurs, and authenticity and it thus fails to regulate pollution includes the costs of preventive measures and incidents as defined by Indian environment further loss or damage caused by preventive legislations or destruction caused to habitat or measures; so, however, that the provisions of species by Indian or foreign ships due to causes clause (a) of sub-section (1) of section 352B shall other than release or spillage of liquid not apply to such loss or damage; contaminants. * Similarly review Section 356 K provisions for Recommendations for strengthening the containment of accident pollution due to oil legislation spills to also include incidents due to discharge of ballast water, noxious liquid and harmful * Clarify the definition of ‘pollution damage’ as substances defined in Section 352H(d) of the Act and expand to include means loss or damage caused outside * Include a provision for ensuring compliance the ship by contamination resulting from escape with conditions of licence in Section 356G or discharge of oil, ballast water, noxious liquid Review Act to include any incident that may cause habitat destruction in marine areas The Water (Prevention and Control of Pollution) Act, 1975 The Water (Prevention and Control of these regions is provided for by the Territorial Pollution) is a Central Act enacted by the Waters, Continental Shelf, Exclusive Economic Parliament in pursuance of powers given under Zone and Other Maritime Zones Act, 1976. Articles 249, 250 and 252 of the Constitution of The Act identifies offenders as those who India. The basic scheme of this Act is to ensure the knowingly pollute or obstruct the flow of water in prevention and control of water pollution and to streams [Section 24(1)(a) & (b)], thereby maintain and restore the wholesomeness of devolving the burden of proof of intention upon water. The Central and State Pollution Control the PCBs. The Act excludes persons who are Boards (PCBs) are the implementing bodies involved in the construction, improvement and under the Water Act. maintenance of several structures such as The GoM region comes under the buildings, and the deposition of material for purview of the Tamil Nadu Pollution Control reclamation to protect the bank or bed of the Board (TNPCB), set up under Section 4 of the stream [Section 24(2)(a) & (b)]. The Act also Act. Since this Act has been enacted for the allows for conditions to be imposed on any protection of water resources from pollution, industry or process, treatment and disposal this Act is considered to be very significant in system, or addition thereto that has either been preserving the marine environment of the Gulf of established or altered without obtaining Mannar region. permission [Section 25(5)], thereby granting post It is also important to note that the Act facto clearance. This then encourages detractors defines streams in the marine context as sea or to not seek consent of the board initially since, tidal waters to such extent as notified by the the PCBs are forced to grant consent in this Act State Government in the Official Gazette once work has begun. The grant of deemed, [Section 2(j)(v)]. This definition excludes unconditional consent shall be granted on the Exclusive Economic Zones and other maritime expiry of four months from the date of zones which fall under the jurisdiction of the application [Section 25(7)] curbs the spirit of the Central Government from its ambit. The Act and is extremely detrimental, especially in framework for controlling marine pollution in areas of ecological significance such as the GoM.
333 Recommendations for strengthening the accordance with such standards as may be laid legislation down by the State Board to enter (whether directly or indirectly) into any stream or well or * Include Section 17(1)(ga): lay down, modify or sewer or on land; or, 24(1)(b) no person shall annul effluent standards for the sewage and trade deliberately, negligently or accidentally cause or effluents for ecologically sensitive areas resulting permit to enter into any stream any other matter from the discharge of effluents and to classify which may tend, either directly or in combination waters of the State. with similar matters, to impede the proper flow * Review Section 19(1) and include the following of the water of the stream in a manner leading or Proviso: Provided that any ecologically sensitive likely to lead to a substantial aggravation of marine area is declared ‘water pollution, pollution due to other causes or of its prevention and control area or areas’. consequences. * Review Section 24(1)(a) & (b), and modify as: * Review Section 25(5), especially in ecologically 24(1)(a) no person shall deliberately, negligently sensitive areas such as the GoM or accidentally cause or permit any poisonous, * Review Section 25 (7), especially for noxious or polluting matter determined in ecologically sensitive areas such as the GoM
334 The Coastal Regulation Zone (CRZ) Notification, 1991
The Central Government has issued the enforcing the same. Thus though the region is Coastal Regulation Zone Notification under granted the CRZ-1 status, any legal protection Section 3 of the Environmental Protection Act that is afforded to the region is not by the virtue and under Rule 5(3) (d) of Environmental of it being protected under the CRZ Notification Protection Rules, 1986, declaring the coastal but under other laws (the WLPA in this instance). stretches in the country as Coastal Regulation This then raises the question of the Zone. The Coastal Regulation Zone (CRZ) legalprotection of the GoMBR (excluding the Notification was introduced in 1991 and sought GoMNP) since though identified as ecologically to govern industrial and other activities in the sensitive, only the national park is protected coastal zones. The ‘Coastal Regulation Zone’ or under the WLPA, not the rest of the biosphere the zone under the purview of the CRZ reserve. Notification comprises the coastal stretches of This invalidation of the CRZ notification seas, bays, estuaries, creeks, rivers and due to lack of procedural clarity is seen in several backwaters which are influenced by tidal action instances along the GoM region. For instance, the (in the landward side) up to 500 meters from the Tuticorin Thermal Power Station allegedly High Tide Line (HTL) and the land between the releases its fly ash directly into the sea, an activity Low Tide Line (LTL) and the HTL. Within this that is prohibited under the CRZ notification region, a number of activities are prohibited and [Para. 2(v)] but since the CRZ notification stops certain activities are permitted depending on the short of prescribing a mechanism for the nature of the area itself which are ‘zoned’ as CRZ prevention of dumping of fly ash or any other –I, II, III or IV areas depending on ecological material directly into the sea, effective sensitivity. implementation of this clause is curbed. Also, the Implementation of the CRZ notification is CRZ notification allows mining activities (a severely hampered by the several amendments significant threat in the GoM region) [Paragraph made to it (21 amendments between 1991 and 2(ix)], in coastal areas provided that certain 2007). This was observed in our study of the GoM safeguards are followed but fails to define the region where lack of clarity on the law and scope of these safeguards, thus making any legal inability to stay abreast of the various changes action against mining activities detrimental to made to it has translated into poor the GoM almost impossible. implementation with a lack of clarity amongst the Recommendations for strengthening the ground staff of the Pollution Control Board legislation (PCB), or the Department of Environment on who actually implements this notification in the * Review the amendments to the principal region. Notification in light of their detrimental effects on the ecology of the GoM. The failure of the CRZ notification to * Ensure the area of the GoMBR (ecologically provide for accurate definitions and procedural sensitive area) is included as a Coastal Regulation mechanisms to implement its various provisions Zone is another impediment to the realisation of coastal protection. For instance, though the GoM * Review the rationale behind permitting any NP would fall under the CRZ-1 category and activity that does not require foreshore facilities therefore be protected by the CRZ notification, in the GoM region this protection remains largely notional in the * Include an Annexure 2 to prescribe a absence of actual definition of the legal mechanism for protection of CRZ-1 Areas as protection afforded to the region by virtue of its identified by the Notification to extend legal being a CRZ-1 area and a mechanism for protection to such areas
335 The Special Economic Zone Act, 2005 The Special Economic Zone (SEZ) Act, suitable for economic development (due to easy 2005 has been enacted by the Parliament in 2005 access to land, water, transport and waste to provide for the establishment, development disposal). It is in keeping with this that the Act and the management of the Special Economic contains several provisions to facilitate such Zones for the promotion of exports in the establishment. country. The Act is applicable to the whole of The SEZ Act also states that it can nullify India. The SEZ Act has been enacted with the twin all other laws of the country [Section 51]. Since objectives of specifying the procedures for the environmental impacts of these activities setting up the Special Economic Zones and also gain significance in the Gulf of Mannar there governing the industries and other activities must be clear provisions preventing the established in such Zones. Other Acts such as the establishment of SEZs in and around this region. Customs Act of 1962 also contains several provisions (sections 76A – 76N) exempting Recommendations for strengthening the customs duties for the exports and imports from legislation or to the Special Economic Zones in the country. There must be a prohibition against the The Act has implications for the GoM establishment of SEZs in and around the GoM region since coastal areas are considered highly region owing to its ecological fragility
336 Tamil Nadu Marine Fishing Regulation Act, 1983 (TNMFRA) Each maritime state has a Marine Fishing the Act. The Tamil Nadu Marine Fishing Regulation Act (MFRA) derived from the Indian Regulation Rules, 1983 only makes a perfunctory Fisheries Act, 1927. The TNMFRA was mention of these requirements [Rule 6]. promulgated in the year 1983 to provide for the Recommendations for strengthening the regulation, restriction and prohibition of fishing by legislation fishing vessels in the sea along the whole or part of the coast line of the State. The TNMFRA uses * Section 5(1) – include schedules to define exact spatial and temporal restrictions as well as gear procedure to determine how to restrictions to implement its various provisions. regulate/restrict Therefore there are monsoon bans which are - fishing in any specified area by such class or seasonal bans, and restrictions on gear in the classes of fishing vessels state. - number of fishing vessels An often repeated statement is that the - species of fish TNMFRA has been unable to address the - specific types of fishing gear problem of overcapacity. The Act calls for the regulation, restriction or prohibition of fishing in * Include a Schedule in the Act to prescribe the specified area [Section 5] and makes specific mechanism for conducting inquiries to demands to regulate/restrict or prohibit fishing determine public interest as prescribed by in any specified area by such class or classes of Section 5(2)(a) of the Act. Such a procedure may fishing vessels [Section 5(1)(a)], number of fishing be along the lines of the public consultation vessels [Section 5(1)(b)], catching of such species process prescribed by the Environmental Impact of fish as may be specified in the notification Assessment Notification, 1994 (without the [Section 5(1)(c)], use of such fishing gear [Section clauses modified/ added in the 2006 amendment) 5(1)(d)] in any specified area. However, no Review the Penalty imposed [Section 18] and directions have been prescribed for their modify. Include the impoundment of fishing gear operationalisation in the subsequent sections of and or vessel and increase the fine imposed.
The Marine Products Export Development Authority (MPEDA) Act, 1972
The Marine Products Export of marine products [Section 9(2)(f)] etc. it, as was Development Authority (MPEDA) Act, 1972 was the case with the Tamil Nadu Marine Fisheries promulgated to provide for the establishment of Regulation Act this Act also fails to regulate/ an authority for the development of the marine restrict fishing and provide for actual procedures products industry under the control of the for implementing the same. Union. Recommendations for strengthening the While the Act prescribes developing and legislation regulating off-shore and deep-sea fishing and undertaking measures for the conservation and * Review Section 4(3)(e) and include 4(3)(e)(va): management of off-shore and deep-sea fisheries the interests of persons engaged in traditional [Section 9(2)(a)], registering fishing vessels fishing [Section 9(2)(b)], fixing of standards and * Prescribe procedures for the implementation specifications for marine products for purposes of Section 9(2)(a); Section 9(2)(b); Section of export [Section 9(2)(c)], regulating the export 9(2)(c); Section 9(2)(f) in Schedules to the Act.
337 Indian Fisheries (Tamil Nadu Amendment) Act, 1980 and Tamil Nadu Chank Fisheries Rules, 1981 The Indian Fisheries Act was enacted to institutions [Section 6-E2(c)] from the regulation as provide for the regulation of fisheries, especially to prescribed by this Act is irrational, especially given control private industry and ensure Government the implications of their collective numbers (such monopoly over the fisheries sector. This Act was as several thousand religious establishments, further fortified and amended by the Tamil Nadu individuals etc.). Thus the Act and the Rules merely Government in 1980. The aforementioned Act and appear to focus more on the sale/ exploitation of Rules amended and applied by the Tamil Nadu chanks rather than actually regulating/ restricting Government follow the same principles of State- their catch. dominated resource exploitation [Section 6D] and Recommendations for strengthening the provision of licenses for persons seeking to catch legislation chank and process it. * The above Act and Rules must be revisited and The Act fails to rely on adequate/ periodic amended based on scientific studies of the actual scientific research on the status of chanks in the biological resource availability of the region region. This is reflected in the various provisions of * Review Section 6D of the Act and include Section the Act and Rules such as the conferring of 6 D (3) to mandate scientific studies before discretionary powers on the State Government in Government exploits chank resources or grants the matters of licensing chank collection, licences for the same exploitation etc. [Section 6G]; arbitrary period for * Make a similar provision applicable under Section the issue of license (no timeframe for expiry of the 6 G of the Act license is prescribed by the Act or Rules). Even * Review Sections 6E(2) of the Act, include licensing where the Rules provide for the prohibition of for individuals, religious establishments and fishing of chanks below a certain size by the State educational or research institutions Government [Schedule 3 of the Rules], it fails to * Clarify the use of ‘inadvertent catch’ in Section 6F, actually prescribe such minimum sizes or mandate Rule 4 (ii) scientific studies for the determination of these sizes for various species. * Review Penalty clauses (Section 6J) and modify Include Section 6-GA to deal with regulation of Further, the exemption of individuals or chank exploitation families [Section 6-E2(a)]] religious establishments * Ensure that Such regulation is based on scientific [Section 6-E2(b)] and educational or research studies as prescribed by Section 6D of the Act
338 The Coastal Aquaculture Authority Act 2005
The Coastal Aquaculture Authority Act and implementation; lack of specifications for and Rules were enacted to establish a Coastal effluent quality monitoring, not mandating Aquaculture Authority and to regularize effluent treatment systems for farms under 5 ha. aquaculture activities. The Authority has been in size; no requirement for environmental constituted [Section 4] to make regulations for clearances, environmental monitoring and the construction and operation of aquaculture environmental management plans for farms farms within the coastal areas [Section 11(1)(a)]; lesser than 40 ha. in size; etc. to inspect coastal aquaculture farms with a view to ascertaining their environmental impact Recommendations for strengthening the caused by coastal aquaculture [Section 11(1) (b)]; legislation to register coastal aquaculture farms [Section * Prohibit the establishment of aquaculture farms 11(1) (c)]; to order removal or demolition of any in and around the GoM area coastal aquaculture farms which is causing * Review the guidelines for coastal aquaculture pollution after hearing the occupier of the farm (Annexure of Rules) especially with regard to [Section 11(1) (e)]. permitting coastal aquaculture between 200-500 The Act and Rules have been challenged m from the high tide line Not requiring: effluent on various grounds such as allowing coastal treatment systems for farms under 5 ha in size aquaculture to be carried out between 200- environmental clearances, environmental 500m from the HTL (high tide line), a provision monitoring and environmental management that is in contravention of the Coastal Regulation plans for farms lesser than 40 ha in size Zone Notification [Clause 2(xii)]; failure to * Include provisions on monitoring and regulate farms that have come into existence implementation of the act. In particular include prior to 2005 and farms that are used for provisions to suggest how all the guidelines will research purposes by the Government, a be implemented. provision that is especially detrimental in CRZ-1 areas of ecologically sensitive areas such as the * Ensure timelines for the completion of various GoM; the lack of clear guidelines for monitoring provisions of this Act
339 Customs Act, 1962
The main purpose of the Customs Act is Similarly, the penalty clauses [Sections 111- 127] to prevent illegal imports and exports in the of the Act remain unclear on several grounds country. The Tuticorin Port and proximity to Sri such as the mode of disposal of confiscated Lanka makes GoM region an important goods, the procedure for dealing with import/export hub and therefore the Customs confiscated vessels etc. This lack of clarity might Act gains relevance in this region. The jurisdiction prove expensive to the GoM region since it might of the Act includes territorial water and water lead to the berthing of confiscated vessels for extending up to the limit of contiguous zone of unregulated periods of time or its pollution by India including any bay, gulf, harbour, creek or tidal these confiscated goods. water [Section 2(28)]. Recommendations for strengthening the The Act also provides for the Central legislation Government to impose stringent conditions in * Review Section 11 G especially with respect to order to detect and prevent the illegal exports of marine products specified goods in the specified area i.e. the customs water [Section 11H (c)] as defined in * Include Section 111 A - procedures to be Section 2(28). This provision when read with undertaken to prevent loss or damage of Section 11M of the Act which provides for the habitat/species due to berthing of vessels regulation of the sale or transfer of these * Review discretionary powers given to specified goods can help prevent the illegal adjudicating officer in Section 125 export of marine products from the GoM region.
The Arms Act, 1959
The Arms Act was legislated to control However, arguably the most important the possession of the arms and ammunitions discrepancy with regard to the application of the recognising its potential to disrupt public peace Arms Act in the GoM region is that it does not and tranquillity. The Act is significant in the GoM incorporate provisions complimentary to the region since the marine environment and the regulation/restriction of arms in sanctuaries and biosphere reserve zones in this region come national parks as provided for by the Wild Life under threat due to the usage and the possession Protection Act. The Arms Act regulates/restricts of arms and ammunitions in this region. For only the possession and transfer of the arms and instance, dynamite fishing is rampant in the ammunitions and not the use of such arms and ammunitions. region (See Chapter 2). The importance of restricting arms in ecologically sensitive areas Recommendations for strengthening the has been recognised by the Wild Life Protection legislation Act of 1972 which contains provisions regulating * Include Section 3(1A) – licence request to be the possession of arms and ammunitions inside sent to Chief Wildlife Warden if arms and protected areas declared under the Wild Life ammunition are sought by person or persons Protection Act [Section 34]. residing in and around a protected area
340 Reccommendations: The GoMBR Authority (GoMBRA)
There is need to create an Authority that should be outlined in the notification. This has legal powers under the provisions of the EP expressly should contain the responsibility of Act which is currently the most flexible and coordination, and legal powers to take action on appropriate. specific conservation matters. This would entail issuing a separate 6. The GoMBRA should be provided with a notification for the creation of this authority regular budgetary provision to ensure its lasting under section 3(2)(v) of the EP Act which allows performance. The notification should contain for the creation of such authorities. This clauses specifying sources of finances for its notification would contain the following broad functioning. points: 7. The GoMBRA notification should contain 1. The notification would specify the powers of provisions that outline both a protective as well each of the officers of the trust and also their as a proactive responsibility. This means that both rules of procedure. regulatory as well as restorative measure should be undertaken. 2. The GoMBRA should be designed as a operational body that deals with the day to day 8. The GoMBRA notification should encourage matters of the GoM. This would mean that its further scientific study to inform all its constitution should be separate and distinct conservation actions. It should be empowered to from the current constitution of the GoMBRT. garner funds for this purpose. 3. The process of the constitution of the 9. The staff of the Gulf of Mannar should be GoMBRA should be through an open and appointment for longer time periods. The transparent procedure and a search committee appointment period of all its officers needs to be should be constituted for this purpose. specified. 4. The conditions under which a revision of the 10. Working agreements should be developed members of the GoMBRA would take place and between the GoMBRA and all the various the process of doing this should also be specified. government departments involved in conservation of GoMBR with time-bound 5. The roles and responsibilities of the GoMBRA deliverables.
Options for better management of the GoMBR
One of the key problems identified in this a habitat protection measures is not at all suitable studyis that the entire Biosphere Reserve itself for an area this large and with its various multiple lacks any legal protective mechanism. Declaring use regimes. The GoMNP has already created a this region as a special zone needing protection sense of alienation among the local people of the also provides legitimacy to a specific agency that region and utilisation of this Act will vest sole is created specifically for its protection. In responsibility of the region’s management with actuality this should have preceded the creation an already over-burdened Wildlife Wing of the of the GoMBRT. Therefore the provision of legal Forest Department. protection to the entire region, taking into Of the slew of options that can be made consideration the various use requirements of its available for the better management of the GoM, stakeholders is of immediate need. the best option appears to be the declaration of The current option of creating Protected the region as an Ecologically Sensitive Area under Areas under the Wild Life Protection Act, 1972 as the Section 3(2)(v) of the EP Act.
341 ESAs under the Environment Protection Act, 1986 The Environment Protection Act (EP Act) One such powerful action that the MoEF has been extensively and creatively used since its can take is– that of restriction of development introduction in 1986. The Act can be cursorily processes in particular sensitive areas. The MoEF described as a central legislation that makes the is empowered to plan for particular regions. This Central Government a ‘pro-active watchdog’ of is done through restricting certain kinds of the environment. It strives to improve activities in these regions. environmental quality and it also reigns in Some of the regions declared as ESA by development processes where they threaten the MoEF have been accorded special statuses, environmental resources. Despite the fact that which have been spelt out in individual there are very serious questions regarding notifications. The terms used to describe such aspects of planning, execution / poor areas in the notifications are: Ecologically implementation, inaction etc directed at the Sensitive Areas (ESA) or Ecologically Fragile Centre, the Act per se still holds much promise as Areas (EFA) or No Development Zones (NDZ a tool for environmental security. or, Ecologically Sensitive Zones (ESZ). It is to be The crux of the Act and its Rules is that it noted that the EP Act / Rules do not make any empowers the Centre [which translates as the mention of such terms. They merely refer to the Ministry of Environment and Forests (MoEF)] powers of the Centre to restrict activities in with tremendous power to take actions ‘for the particular areas. purpose of protecting and improving the quality of the environment and preventing, controlling The term ‘Ecologically Sensitive Area’ and abating environmental pollution’. In practice (ESA) is however gaining popularity especially in this has included an interesting assortment of official parlance. Unlike the Wild Life things. Some of the actions taken by the MoEF (Protection) Act, the EP Act does not mention through the EP Act include the formulation of exclusive conservation categories like ‘National standards, guidelines, Rules, creation of Boards, Parks’ and ‘Wildlife Sanctuaries’. In fact we see Authorities, appointment of officers, taking that the ESA actually covers areas already punitive action against offenders of the Act, covered by the WLPA where it imposes establishment of institutions, labs, dissemination additional restrictions besides that existing in of information to name a few. that particular PA.
The Gulf of Mannar Ecologically Sensitive Area under the EP Act It is suggested that the Gulf of Mannar * Identification should be made for the various Biosphere Reserve be declared an Ecologically industrial activities that will be allowed in the Sensitive Area under the Environment GoM (such as the current classification of Red, Protection Act, 1986. Green and Orange category of industries done * A statutory Authority (the GoMBRA) be by the PCB) created for the management of this region with * The drafting of such a notification should entail a powers and functions to regulate all activities participatory and well coordinated process within GoMBR. comprising inputs from expert groups from the * The notification for the Gulf of Mannar fields of natural science, social science, legal Ecologically Sensitive Area GoM ESA should experts and members of other ESA authorities contain restrictions on certain restrictions on activities in the region. It can contain prohibitions to gain a better understanding of the experiences and permitted activities. in these regions.
342
Published by the Gulf of Mannar Biosphere Reserve Trust
Current Status and Distribution of Microbial Diversity and Mangrove Associated Microbial Fauna in Mandapam Group of Islands, Gulf of Mannar Biosphere Reserve
science outreach series no 22 Work Title: Current Status and Distribution of Microbial Diversity and Mangrove Associated Microbial Fauna in Mandapam Group of Islands, Gulf of Mannar Biosphere Reserve
Funding Agency : Gulf of Mannar Biosphere Reserve Trust, Ramanathapuram
Implementing Department of Oceanography and Coastal Area Studies Institution: Alagappa University, Thondi Campus, Thondi
Duration : 1 Year
Cost : Rs. 3,75,000/ - INTRODUCTION microbes such as protease and amylase India’s first marine biosphere reserve, the inhibitors, bacteriolytic and antibacterial Gulf of Mannar Biosphere Reserve (GOMBR) is substances, plant hormones and toxins such as situated between mainland India and Sri Lanka tetrodotoxin and saxitoxin are beingincreasingly understood. marine microbial studies have also (08° 46' N - 09° 14' N 78° 9' E - 79° 14' E ). Located been important for pharmacology. Marine off the south eastern tip of the state of Tamil bacteria are known to produce a variety of Nadu this protected area was established in 1986. chemical compounds which find use as effective The reserve extends over an area of 10,500 antifungal, antibacterial, antifungal and km22 (and a core area of 560 km ) comprising a antitumour drugs. Medically important genera unique set of productive habitats such as coral include Actinomyces, Streptomyces, Alteromonas, reefs, seagrass beds, and mangroves. A diverse Chromobacterium, Pseudomonas, Aeromonas, assemblage of biological resources are Alcaligenes, Bacillus, Flavobacterium, Micrococcus, associated with these habitats. The GOMBR also Serratia, Vibrio, Flavobacterium, Pseudomonas, Vibrio, encompasses 21 islands running parallel to the etc. In many ways, marine microbes are preferred coast of Ramanathapuram and Tuticorin for pharmacology (as opposed to higher Districts. organsims) since agents produced The significance of microbes and microbial extracellularly by microbial fermentation are diversity more easily purified than those produced by higher organisms. Marine environments also Microbes provide benefits as well as cause yield microbial strains with new genetic elements harm to human societies. Studies on microbes which are encoded in plasmids and these strains are significant from multiple perspectives. maybe capable of producing new metabolites and Microbes provide many important benefits novel bioactivities. Other than in medicine, ranging from provision of food supply and marine microbes are also increasingly explored medicines, the decomposition of chemicals such as inhibitory agents for barnacle larvae and as PCB’s, pesticides, etc., and in pollution control. mussels as well as for epizootics in fish culture. Microorganisms are also involved in bio- geochemical cycling of the earth’s major systems. However, surprisingly little is known about microorganisms in the marine realm. During the last ten years, however, a number of marine microbiology studies have been carried out, which throw light on the important ecological role that microorganisms play in biological production and cycling of material in coastal, open ocean and other marine habitats. These include studies of ecological interactions including symbiosis, antagonism, and grazing between different bacterial groups as well as that between bacterial and other organisms such as protozoa, zooplankton and seaweed. The role of bioactive compounds produced by marine
343 Objectives faecal coliform bacteria). The five key objectives of this study were to: • Undertake an analytical study during the field • Review secondary scientific information and survey to evaluate the limiting environmental existing literature on microbial diversity in the parameters viz., salinity, pH, nitrate, nitrite, Mandapam group. phosphate, organic carbon, etc. • Carry out intensive field surveys in Krusadai, • Compile intensive field survey data, secondary Manoli and Manoliputty islands in order to assess information, analytical study report and the diversity of microorganisms (THB, fungi, preparation of exhaustive maps for drafting an Actinomycetes, and Phosphate solubilising effective management plan. microorganisms (PSB), Phosphatase producing • Identify isolated microorganisms by following microorganisms (PPB)), and nitrogen fixing biochemical identification methodologies and 16 S microorganisms (Azotobacter, Azospirillum, and r RNA sequencing methods.
Review of Literature A review of literature performed as part of this study identified the following publications related to the Gulf of Mannar region:
• Kathiresan, K and N. Rajendran 1998. Mangroves • Chacko, P.I., S. Mahadevan and R. Ganesan 1955. A - Associated Communities. Proc. Technical workshop guide to the field study of the fauna and flora of on Biodiversity of Gulf of Mannar Marine Biosphere Krusadai Island, Gulf of Mannar. Contr. Mar. Biol. St. Reserve, MSSRF Publ. pp. 156-164. Krusadai Island, 3: 1-16. • Kannan, L. 1996. Report on the biodiversity of • Balasubramanian, V., N. Ramesh, C.S. Sumathi and microbial flora (bacteria and phytoplankton) of V.R. Kannan 2008. Isolation of Efficient the coral reef of the Gulf of Mannar. Report Polyethylene Degrading Bacterial Species from submitted to Ministry of Environment and Forest New Marine Ecosystem of Gulf of Mannar in India. Delhi. Govt of India. • Ananda Rao, T., K.R. Aggarwal and A.K. Mukherjee • Kannan, L., K. Kathiresan and A.Purushothaman 1963. Ecological studies on the soil and vegetation 1998. Biodiversity of microbial flora (Bacteria and of Krusadai group of Islands in the Gulf of Mannar. Phytoplankton) of the Coral reef of the Gulf of Bull. Bot. Surv. India, 5(2): 141-148. Mannar. Himavikas Occasional Publ., 12: 207-220. • Kumaraguru, A.K., V. Edwin Joseph, N.Marimuthu, • Kannapiran, E. 1997. Heterotrophic phosphatase J. Jerald Wilson - plant ecology with a description producing and phosphate solubilising bacteria of of soils and other related features of the krusadai the coral reef environment of the Gulf of Mannar group of Islands situated in the Gulf of Mannar. Biosphere Reserve (Southeast coast of India): An • Bakus, G.J. 1994. Coral reef ecosystem. Oxford and inventory. Ph.D. Thesis, Annamalai University, India, IBH publishing Co. Pvt. Ltd. New Delhi, India, 232 103 pp. pp. • Surajit Das, P. S. Lyla and S. Ajmal Khan 2006. • DOD. 2001. Development of GIS based Marine microbial diversity and ecology: Information system for Gulf of Mannar. Aspects on importance and future perspectives, Current Microbiology and Plankton. Report submitted by Science 90: 10. Centre of Advanced Study in Marine Biology, • Chandrika, V and C.S.Gopinadha Pillai 1962. Annamalai University, p: 55. Bacterial flora on corals, sponges and reef • Kannapiran, E., A. Purushothaman, L. Kannan and sediments of Manoli Island in Gulf of Mannar. S. Saravanan 1999. Magneto bacteria from Associatin of Microbiologists of India 32nd Annual estuarine, mangrove and coral reef environs in Conference, Madurai. p. 174. Gulf of Mannar. Indian J. Mar. Sci., 28(3): 332-334.
344 • Babuselvam, M., G. Ramanathan, S. Ravikumar, S. Proc. Technical workshop on Biodiversity of Gulf of Babu, K. Muniyandi and I. Essakiraj 2005. Mannar Marine Biosphere Reserve., MSSRF Publ. • Moses, J.S and C. Balachandran 1986. A study on pp. 86-91. the microbial ecology of certain water sources of • Raghukumar, C. 1987. Fungal parasites of marine Kanyakumari District. Natl. Sem. on Microbial Ecol. algae from Mandapam (South India). Dis. Aquat. Jan, 23-24, 1986. p. 51. Org., 3(2): 137-145. • Nadimuthu, M. 1998. Studies on the fungi of the • Ganesh Babu, T., P. Nithyanand, E. Kannapiran, A. coral reef environment of the Gulf of Mannar Veera Ravi, and S. Karutha Pandian Molecular biosphere reserve. Ph.D. Thesis, Annamalai identification of bacteria associated with the University, India. 117 pp. coral reef ecosystem of Gulf of Mannar Marine • Purushothaman, A. 1998. Microbial diversity. Biosphere Reserve using 16S rRNA sequences.
Methods Collections were carried out in three medium). The pure culture of bacteria isolated island locations: Krusadai, Manoli and using appropriate media were subjected to Manoliputty. Habitats which were surveyed generic level identification by using molecular include mangrove, coral reef and seagrass tools (16 S r RNA sequencing). Specific habitats. Water and sediment samples were extraction protocols were devised for the collected from all locations during different extraction of marine derived total heterotrophic seasons (pre-monsoon, mosoon, post monsoon bacterial genomic DNA and the extraction of and summer). These were collected in previously marine derived actinomycete genomic DNA. The unused plastic containers and were transported 16S r RNA gene which was amplified from to the laboratory in a refrigerated condition. genomic DNA (obtained from the culture) using Microbial examinations were carried out within PCR techniques and complete gene sequencing two hours of collections. was carried out. The nucleotide sequences which Standard methods of serial dilution and were derived were compared to those in the plating were administered for the isolation of Gene Bank Database with the Basic Local THB, fungi, Actinomycetes, Phosphate Alignment Search Tool (BLAST) algorithm solubilising microorganisms (PSB), Phosphatase inorder to identify known as well as closely producing microorganisms (PPB), nitrogen fixing related sequences. After aligning the DNA microorganisms viz., Azotobacter, Azospirillum, sequences, phylogenetic trees were constructed and faecal coliform bacteria. The media used for using the neighbour joining method outlined at different groups are given within parantheses: http://www.ncbi.nlm.nih.gov/blast/tree_view/bl THB (Zobell 2216e agar medium), fungi (Rose ast_tree_view.cgi . Bengal agar medium), Actinomycetes (starch A number of physiochemical parameters caesin agar medium), E. coli (tergitol agar were analysed in water and sediment samples medium), Pseudomonas (tergitol agar medium), across the three habitats in all three islands. PSB (Pikovsky’s agar medium), Azotobacter These include micro and macro nutrients, salinity (Azotobacter agar medium), PPB (heterotrophic and pH. plate count agar), Azospirillum (nitrogen free agar
345 Results : Microbial Counts Microbial counts were carried out in coral reef Actinomycetes and Azotobacter sp. were not ecosystems in water and sediment samples in present in water samples. There were no Krusadai island. Counts for THB were significant differences between sediment and significantly higher for sediment than water. PSB water for E. coli, Pseudomonas aeruginosa, fungi samples were higher for water samples. and PPB.
Microbial counts in coral ecosystems of Krusadai Island
Water (CFU x 104.l-1) Sediment (CFU x 104.g-1) Microbial groups Pre- Monsoon Post Summer Pre- Monsoon Post Summer monsoon monsoon monsoon monsoon THB 320 339 337 270 1242 1621 1378 1007 E .coli 10 12 6 8 5 7 5 4 Pseudomonas 26 34 31 299 110 135 114 358 aeruginosa Actinomycetes - - - - 136 154 128 104 Fungi 3 5 4 1 4 6 4 4 PSB 123 153 176 105 4 6 24 60 PPB 986 1131 1300 110 1120 1440 1420 301 Azotobacter sp. - - - - 88 112 91 61
In seagrass ecosystems, THB counts were similar water samples, PSB counts were evenly across water and sediment samples. E. coli and distributed across sediment and water. PPB counts greater for sediment layers. Pseudomonas aeruginosa counts were higher in Actinomycetes and Azotobacter sp. were absent in sediment.
Microbial counts in seagrass ecosystems of Krusadai Island
Water (CFU x 104.l-1) Sediment (CFU x 104.g-1)
Microbial groups Pre- Monsoon Post Summer Pre- Monsoon Post Summer monsoon monsoon monsoon monsoon THB 410 513 410 270 386 414 386 391 E .coli 4 5 4 4 12 18 13 8 Pseudomonas 188 251 193 219 580 720 630 285 aeruginosa Actinomycetes - - - - 96 103 84 55 Fungi - - - - 5 7 5 - PSB 253 309 410 158 206 212 484 166 PPB 288 314 523 112 1213 1814 2112 326 Azotobacter sp. - - - - 187 263 202 228
346 In mangrove habitats, counts for THB and samples and found only in sediment. Counts for Pseudomonas aeruginosa were greater in fungi were greater in sediment. There were no sediment samples than in water. E. coli which was discernible differences in PSB and Azotobacter sp. absent in summer were also found in greater counts between water and sediment. PPBs were numbers in sediment during the rest of the distributed in water and sediment with lower seasons. Actinomycetes were absent from water numbers in summer.
Microbial counts in mangrove ecosystems of Krusadai Island
Water (CFU x 104.l-1) Sediment (CFU x 104.g-1)
Microbial groups Pre- Monsoon Post Summer Pre- Monsoon Post Summer monsoon monsoon monsoon monsoon THB 264 430 384 276 946 1984 1430 1498 E .coli 4 6 4 - 33 54 43 - Pseudomonas 188 256 182 215 1014 1584 1234 281 aeruginosa Actinomycetes - - - - 196 222 94 114 Fungi 2 3 102 104 184 208 308 3 PSB 142 212 280 107 94 142 186 173 PPB 1816 3313 4316 323 994 1475 2012 815 Azotobacter sp. 56 76 84 73 78 81 93 79
In Manoliputty island, sediment samples Actinomycetes were absent from sediment recorded higher THB counts than water. samples. Counts of fungi were uniformly low. Pseudomonas aeruginosa counts were also greater PSBs were uniformly distributed. Azotobacter sp. in sediment samples, except in summer where were only found in low counts during monsoon the counts were uniformly low. E. coli bacteria and and post monsoon.
Microbial counts in coral reef ecosystems of Manoliputty Island
4 -1 4 -1 Water (CFU x 10 .l ) Sediment (CFU x 10 .g )
Microbial groups Pre- Monsoon Post Summer Pre- Monsoon Post Summer monsoon monsoon monsoon monsoon THB 710 845 740 161 1233 1374 1014 1219 E .coli 38 51 43 3 - - - - Pseudomonas 713 916 603 9 2286 2286 1984 11 aeruginosa Actinomycetes - - - - 4 4 2 3 Fungi 2 3 2 2 2 2 2 2 PSB 214 306 413 105 113 113 262 112 PPB 223 323 428 59 34 34 56 247 Azotobacter sp. - 6 2 - - - - -
347 Seagrass habitats in Manoliputty recorded greater very low in summer. Both Actinomycetes and fungi concentrations of THB in sediment. The presence of were absent from water samples. PSBs were E. coli was very low in water and not recorded in distributed uniformly across seasons and samples, sediment. Pseudomonas aeruginosa was found in PPBs were more numerous in sediment. Azotobacter higher numbers in sediment, however, values were sp. count was higher in sediment. Microbial counts in seagrass ecosystems of Manoliputty Island
Water (CFU x 104.l-1) Sediment (CFU x 104.g-1)
Microbial groups Pre- Monsoon Post Summer Pre- Monsoon Post Summer monsoon monsoon monsoon monsoon THB 112 175 162 166 473 659 554 385 E .coli 1 1 1 1 - - - - Pseudomonas 970 1114 987 4 1102 1226 1100 8 aeruginosa Actinomycetes - - - - 4 8 3 7 Fungi - - - - 82 154 93 400 PSB 168 211 264 106 120 221 273 173 PPB 84 112 180 106 1014 1231 1378 262 Azotobacter sp. 42 58 75 - 263 322 404 278
THB counts in mangrove habitats in Manoliputty Actinomycetes were absent from water samples were uniform across sites and for most seasons and present in sediment samples. The presence of other than summer when counts were low. The fungi was variable across sites and seasons. PSB presence of E. coli was greater in water samples. counts were largely uniform across sites, as were Counts were very low in sediment samples and those of PPBs excepting in summer when counts absent in summer. Pseudomonas aeruginosa counts were low. Actinobacter sp. wee also found in were high in sediment samples in all seasons except relatively higher numbers in sediment than in water summer, the counts were low in water samples. samples. Microbial counts in mangrove ecosystems of Manoliputty Island
Water (CFU x 104.l-1) Sediment (CFU x 104.g-1)
Microbial groups Pre- Monsoon Post Summer Pre- Monsoon Post Summer monsoon monsoon monsoon monsoon THB 1710 2186 1918 282 2004 2233 2013 1758 E .coli 89 102 93 2 2 4 2 - Pseudomonas 53 64 52 2 1916 2675 2004 10 aeruginosa Actinomycetes - - - - 213 317 296 215 Fungi 43 53 42 250 1 1 1 100 PSB 286 319 413 108 184 258 320 228 PPB 1210 1382 1610 168 1933 2104 2836 740 Azotobacter sp. 84 97 113 173 186 274 316 231
348 In Manoli island, coral reef habitats recorded sediment, but low in summer. Actinomycetes uniform values of THBs across seasons for were absent from water samples across seasons sediment and water samples, counts were but found in small numbers in sediment. Fungi comparatively lower for water samples. E. coli was recorded very low counts across samples and found in very low numbers in water samples, seasons. PSB counts were somewhat variable, numbers were significantly higher in sediment PPB counts were uniform across sites and samples, excepting in summer when they were seasons. Azotobacter sp. were found in very low absent. In a pattern similar to that of E. coli, counts numbers in all samples and seasons except in of Pseudomonas aeruginosa was much higher in summer.
Microbial counts in coral reef ecosystems of Manoli Island
Water (CFU x 104.l-1) Sediment (CFU x 104.g-1) Microbial groups Pre- Monsoon Post Summer Pre- Monsoon Post Summer monsoon monsoon monsoon monsoon THB 380 640 330 325 786 779 686 655 E .coli 2 3 2 2 93 104 106 - Pseudomonas 8 14 6 12 940 1741 1220 17 aeruginosa Actinomycetes - - - - 78 104 82 104 Fungi 2 2 5 1 3 5 14 4 PSB 83 116 264 105 42 54 98 60 PPB 184 224 316 110 263 312 486 301 Azotobacter sp. 2 4 5 3 5 3 8 -
In seagrass habitats, THB values were greatest among sediment samples collected in the monsoon as well as pre-monsoon and post monsoon periods. E. coli were found only in sediment samples in the monsoon and post monsoon periods, and absent during other periods. Pseudomonas aeruginosa was recorded in very low numbers in water samples in all seasons; counts were much higher in sediment except in summer. Actinomycetes were recorded only from sediment samples but in very small quantities. Counts of fungi were moderate for all seasons and samples except in summer where there were no records. PSB counts were variable in different sites and seasons, PPBs were relatively more numerous in sediment. Azotobacter sp. were found in water samples collected in the monsoon, and found in sediment samples in all seasons.
349 Microbial counts in seagrass ecosystems of Manoli Island
Water (CFU x 104.l-1) Sediment (CFU x 104.g-1) Microbial groups Pre- Monsoon Post Summer Pre- Monsoon Post Summer monsoon monsoon monsoon monsoon THB 613 839 730 217 1820 2137 1713 326 E .coli - - - - - 109 84 - Pseudomonas 5 7 5 7 987 1361 1108 21 aeruginosa Actinomycetes - - - - 8 12 9 55 Fungi 102 157 184 - 134 167 213 - PSB 310 331 410 158 674 700 822 166 PPB 113 184 263 112 194 230 340 326 Azotobacter sp. - 79 - - 98 144 96 225
In mangrove habitats of Manoli island, THBs found in all samples and seasons, numbers were occurred in comparatively large numbers in lower in summer for sediment. Greater counts of sediment samples. E. coli was absent from all PSBs were recorded in sediment samples than samples except in summer when water samples water, PPB counts were high and were reported a very small number. Pseudomonas distributed evenly across seasons and samples. aeruginosa values were higher in sediment Azotobacter sp. were found in moderate numbers sampled. Actinomycetes were not recorded in across seasons and in both water and sediment water during any season, but occurred in samples. moderate numbers in sediment. Fungi were
Microbial counts in mangrove ecosystems of Manoli Island
Water (CFU x 104.l-1) Sediment (CFU x 104.g-1) Microbial groups Pre- Monsoon Post Summer Pre- Monsoon Post Summer monsoon monsoon monsoon monsoon THB 286 312 264 280 1402 1704 1322 1601 E .coli - - - 2 - - - - Pseudomonas 42 51 48 9 97 112 102 20 aeruginosa Actinomycetes - - - - 180 215 193 114 Fungi 120 156 170 104 148 207 250 3 PSB 103 160 195 107 754 874 900 173 PPB 973 1001 1050 323 990 1051 1500 815 Azotobacter sp. 143 172 152 120 170 186 180 177
350 Summary – Microbial Counts For water samples, counts for THBs and PPBs found in moderate numbers in most habitats. E. were high across most sites, whereas coli, Actinomycetes and Azotobacter sp. recorded Pseudomonas aeruginosa were found in high low counts in many sites. numbers in coral and seagrass sites. PSD’s were
Counts of microbial groups in water samples across habitat types
THDs, PPBs and Pseudomonas aeruginosa values in some sites. Fungi, E. coli and Azotobacter occurred in higher abundances when compared sp. recorded low values in most sites. across sites. PSBs recorded moderately high
Counts of microbial groups in water samples across habitat types
351 Microbial Species From the samples collected from the three identified: Bacillus sps RPAUOCAS 0102, islands, seven microbial species were identified. Acinetobacer sps RPAUOCAS 103, Acinetobacter The identification and authentication were sps RPAUOCAS 101, Vibrios sps., Streptomyces carried out by 16s rRNA sequencing and and Nocardiopsis sps. An example is shown using a comparing them with the cultures deposited in screenshot of the NCBI site, a phylogenetic tree the NCBI website. The following microbes were and a chromatogram.
Blast of Acinetobacter sp. (RPAUOCAS0101)
352 Phylogenetic tree of Acinetobacter sp. (RPAUOCAS0101)
Chromatogram of Acinetobacter sp. (RPAUOCAS0101)
353 The island-wise distribution of different species of bacteria is also shown below. Bacterial species identified based on 16s rRNA sequencing in different habitats
Island Seagrass Coral Reef Mangrove
Krusadai Bacillus sp. Acinetobacter sp . RPAUOCAS0101 Acinetobacter RPAUOCAS0102 (GenBank Acc.No: HM75539), sp.RPAUOCAS0103 (GenBank Acc.No: Streptomyces sp . RPAUOCAS0105 (GenBank Acc.No: HM75540) (GenBank Acc.NO: HQ442361) 755941) Nocardiopsis sp.RPOCAS0106 (GenBank Acc.No: HQ442362)
Manolip utty Vibrio sp.RPAUOCAS0104 (GenBank Acc.No: HQ442360)
Manoli Bacillus sp.RPAUOCAS0107 (GenBank Acc.No: HQ442363)
Summary Krusadai Island highest in the monsoon for both water and • In coral reef ecoystems, all microbial groups samples in seagrass habitats. Concentrations of K were present in maximum numbers in both water and Fe were higher than that of other nutrients. and sediment during the monsoon. • In mangroves, all bacterial groups showed • THB and PPB counts were present in highest maximum abundances during monsoon for both numbers in all seasons in water and sediment in water and sediment. Actinomycetes were not coral reefs. recorded in water. However, PPB counts were • All macro and micro nutrients were recorded in highest in water samples, THB and Pseudomonas coral reef ecosystems aeruginosa counts were highest for sediment • In seagrass ecosystems, maximum count of all samples. microbial groups were recorded during • In summary, highest counts of PPB, THB, N, K monsoon for both water and sediment samples. and Fe (as well as low counts of fecal coliform E. Actinomycetes, fungi and Azotobacter sp. were coli) indicate a highly productive ecosystem. not found in water samples. Phosphate producing Manoliputty Island bacteria were found to be in highest densities in • In coral reefs, maximum counts for most groups all seasons and in both water and sediment were found during the monsoon in both water and samples. sediment samples. Actinomycetes were absent • Micro and macro nutrient concentrations were from water samples and E. coli were absent from
354 sediment. Fecal coliforms of Pseudomonas of microbial counts in the monsoon for both aeruginosa were also found to be maximum in all sediment and water samples. Actinomycetes, E. seasons in both water and sediment. coli and Azotobacter were not reported from • Micro and macro nutrients also peaked in water samples. THB, PSB and fecal coliform monsoon in both water and sediment in water as counts were found to be maximum in sediment well as sediment. samples. • In seagrass, all microbial groups peaked in • Micro and macro nutrients also peaked during monsoon in both water and sediment. the monsoon. K and Fe concentrations were Actinomycetes and fungi were not reported from higher than that of other nutrients. water and E. coli were not reported from • Mangrove habitats also recorded similar sediment. Fecal coliforms of Pseudomonas patterns to those of other habitats, i.e. counts aeruginosa were recorded. peaked during the monsoon. E. coli was not • In mangrove habitats, microbial counts followed reported from either sediment or water. typical patterns of peaking in themonsoon for Actinomycetes were not found in water. PPB, PSB both water and sediment. Actinomycetes were and THB counts were higher than that of other not reported from water samples, PPB and THB groups. peaked in water and sediment for all seasons, • In Manoli island, coral and seagrass ecosystems Pseudomonas aeruginosa was recorded from are threatened as evidenced by high populations sediment during all seasons. of fecal coliforms and lower counts of useful • Macro and micro nutrient concentrations microorganisms. Mangrove ecosystems are peaked during monsoon in magroves. healthier as indicated by higher numbers of PSB. Concentrations of N and Fe were greater than PPB and THB counts along with low populations that of other nutrients. of fecal coliforms. • All three ecosystems in Manoliputty island are damaged. This is evidenced by the high concentrations of fecal coliforms in water as well as sediment and low levels of other microorganisms involved in nutruent cycling. Anthropogenic activities are also high in this island. Manoli Island • In coral reef habitats, microbial counts showed typically high counts during the monsoon. Actinomycetes were not recorded from water samples. Maximum counts of fecal coliforms were reported from sediment samples during the monsoon. • Micro and macro nutrients also peaked during the monsoon in coral reefs. Fe and K were found at greater concentrations. • Seagrass habitats also recorded highest values
355
Published by the Gulf of Mannar Biosphere Reserve Trust
Pearl Fishery in the Gulf of Mannar Biosphere Reserve
science outreach series no 23 Work Title: Pearl Fishery in the Gulf of Mannar Biosphere Reserve
Funding Agency : Gulf of Mannar Biosphere Reserve Trust, Ramanathapuram
Implementing Department of Oceanography and Coastal Area Studies Institution: Alagappa University, Thondi Campus, Thondi
Duration : 1 Year
Cost : Rs. 16,57,897/ - Introduction introduction to pearl oysters and their distribution, this reports also reviews historical Pearls have been exploited from the Gulf accounts of oyster fishery in the Gulf of Mannar of Mannar region for many centuries. However, region. The primary objective of this study has the pearl fishery itself was of a sporadic nature was to survey the Mandapam, Kilakkari and with little predictability or uniformness. During Tuticorin groups of islands to record the the last one and a half centuries, pearls were presence of oysters and pospects for their exploited in 26 different fishery events (each utilisation. extending over a certain period of time), after somewhat irregular gaps from the Gulf of Mannar, Methods Tuticorin area and the coast of Sri Lanka. The latest period of extraction was between 1955 To understand the historical patterns of and 1961. About 80 pearl banks (rocky ground oyster exploitation the records of inspection where oysters occur, known locally as ‘paar’ or surveys as well as administrative records of the ‘pearl banks’) have been identified in the Gulf of colonial administration and the Indian Mannar. These banks are periodically examined government are reviewed and summarised. For by skin divers for the maturity and harvestability the field survey, the Mandapam, Kilakkarai and of oysters. In recent years, there have been no Tuticorin groups were surveyed using standard harvests and the disappearance of oysters has transect methodology. Within each transect, 4 - 5 been attributed to destruction by predators or quadrats were randomly laid to record the due to suffocation by drifting sand banks. presence of pearl oysters and the presence of other cover. Each quadrat was divided into 16 Objectives grids (each 25 x 25 cm). The sampling was carried This study focuses on pearl oyster fishery out using SCUBA equipment. in the Gulf of Mannar region. Apart from giving an
356 Pearl Oysters and their Distribution
Pearl oysters belong to the genus Pinctada the Palk Bay, pearl oysters, especially P. cheminitzii (Roding, Family Pteriidae) and are represented by occurs in sandy areas. There has only been one P. fucata (Gould) (= P. vulgaris Schumaker), P. fishery event in the region (in 1914 off Thondi) margaritifera (Linn.), P. chemnitzi (Philippi), P. and oysters have not been found in significant anamoides (Reeve) and P. atropurpurea (Dunker), numbers since then. In the Gulf of Kutch, pearl and P. maxima (Jameson). Pearl oysters are oysters are found in the intertidal reefs and a distributed in almost all tropical and subtropical regular fishery is operational every 3 to 4 years waters where they occur from the low tide zone or longer. In south-west India, near Vizhinjam to depths up to 80 m. P. fucata is widely (near Trivandrum), the spat of P. fucata were distributed and found in the Red Sea, Persian Gulf collected from mussel culture ropes. In the and the Indian and Pacific Oceans. In the Persial Lakshadweep islands, the spat of P. anomoides has Gulf, pearl oysters are found occurring in the been observed on the ridges and reefs in some of waters of Bahrain, Kuwait, Muscat and Bushira; in the islands. In the Andaman and Nicobar islands, the Red Sea, the Farasan Islands, areas south of the black-lip oyster (P. margaritifera) is some Sabia and Jidda, and areas west of Mecca and times known to occur. Sudan are prominent; oysters are alson It is also imporatnt to mention here about distributed in the Philippines, Japan, China, Korea, the presence of the window-pane oyster Myanmar, Indonesia, Papua New Guinea, French (Placenta placenta, Family Anomiidae) as a Polynesia, Cook Islands, Australua, Gulf of producer of small inferior quality seed pearls. California, Mexico, Panama and Venezuela. These find use in medicine and are found In Indian waters, pearl oysters occur in 6 occurring in the muddy bottoms of bays, harbour key regions: the Gulf of Mannar, Palk Bay, the and similar environments. This species is waters off Trivandrum, the Gulf of Kutch, and the abundant in Balapur and the Rann Bay in the Gulf Andaman and the Nicobar islands. Although six of Kutch, in Bombay and its vicinities, and the species occur in the region (P. fucata, P. Corangi Bay of Kakinada. Although this fishery in margaritifera, P.chemnitzii, P. sugillata, P. anomioides the Gulf of Kutch were fetching high rentals fifty and P. atropurpurea), P. fucata alone supports the years ago, a fall in demand from the medicine pearly fishery. In the Gulf of Mannar, pearl banks industry of the Far East has been evident. The occur between Kelakkarai and Cape Comorin on shells of this species which are large, shiny, dead coral and rocky areas 15-20m deep. The lustrous and translucent find use in glazing northern and southern banks are now almost shutters, lamp shades, etc. in places such as the barren and the central sector (between Philippines but remain unutilised in the region Kayalpatnam and Vaippar) alone is productive. except for the preparation of lime. Here the fishery is operated from Tuticorin. In
357 The Pearl Banks and their Inspections: Historical Patterns Reports and records of pear bank eastward. The records of the 1858 and 1859 inspections in different parts of the Gulf of Mannar, inspection reveal that a pearl fishery was held in throw some light on the pearl fishery in the past. 1860 off Tuticorin for a period of 23 days yielding a The report of an inspection in 1834 by Jadhi gross reveune of Rs. 250, 276-0-0. Records of pearl Thalaivan records the discovery of 34 beds bank inspections in 1860 and 1861 were optimistic between Kootapuli and Kooduthalai villages (Cape of a fishery in 1867 in the northern beds. Similarly Comorin Zone). Although harvesting was in 1861 and 1862, plenty of oysters were recorded predicted for 1835, poaching by fishermen before from the Tiruchendur beds and a fishery was the date led to the total disappearance of predicted in 1864. Inspections in 1862 and 1863 on harvestable individuals. In 1835 and 1836, further a large number of banks in the Tuticorin area inspections were carried out in Tirunelveli district reported disappointing results. Similar results with the same result: clandestine fishing before the were also reported from surveys in 1865-1866 appointed time resulted in no harvests or revenues (Tuticorin, Manapad, Tiruchendur), 1868-1869 for the colonial administration. Further (Manapad). In 1869 and 1870, further surveys inspections in 1837 were followed by plans to reported the extensive presence of Modiolus in appoint guards to prevent poaching. Pearl bank Vaipar banks but good populations of 2 1/2 year old inspections were again carried out in 1839 and oysters in Tuticorin, Manapad and Pamban. 1840 for 12 banks in the Vaipar to Mookur segment, However, most of these populations were 21 banks off Tuticorin, 24 banks off Pinnakayal and harvested clandestinely. Inspections in the early 14 banks off Tiruchendur. The report of these 1870s also yielded disappointing results due to inspections recorded the existence of 21 two year predation of oysters or removal by local fishermen. old oysters in 13 beds but population estimation From this point, significant fisheries were reported could not be done due to the overgrowth of ‘suram only 1889 and 1890 when 12,6000,531 individuals (Modiolus)’. In Tuticorin, 21 banks were reported as and 1,806,762 individuals were fished respectively good for the fishery and the areas which could not from Tollayiram paar. In 1900 2,801,036 oysters be harvested by divers were recommended for were fished off Tiruchendur. In 1908, 1.1 million dredging. The records of the 1840 and 1841 oysters were harvested in 20 days from inspections report the loss of oysters due to Thollayiram paar. In 1914, a fishery was reported natural causes. In 1847 and 1848, in an effort to from Thondi in Palk Bay. Oyster beds off Karangadu stop clandestine extractions, it was suggested that and Pasipatnam were exploited and yielded oyster harvests could be contracted to wealthy 315,998 and 39,613 individuals respectively. In merchants on a 50:50 basis. The government 1923, inspection records show dense oyster beds rejected this suggestion and plundering of the pearl from Vaipar to Manapad. Surveys conducted after banks continued unabated. Further inspections in this period record either poor results or sporadic 1848 and 1849 confirmed these fears, although the collections till 1954 and 1955 when harvesting was master who conducted this inspection attributed again carried out at Thollayiram paar. Pearl fishery their disappearance to the increased current was again reinitiated in areas such as Thollayiram occasioned by the enlargement of the Pamban Pass paar, Pinnakayal, Tiruchendur, Karuval, Kudamuthu and also as a consequence of the increased passage paar, etc. Another fishery was conducted from of trading vessels. In 1849 and 1850, 17 young 1959 onwards in areas including Thollayiram paar, oysters were reported; in 1855 and 1856, Kuthadiar paar, etc. inspections of 6 banks were carried out and only reported to the extensive presence of ‘suram’. It is also important to note that in 1922, the Pearl banks inspections in 1857 and 1858 reported Gulf of Mannar, the paars (pearl banks) were the possibility of a fishery provided the oysters did classified into three divisions by Hornell. These not migrate from 23 beds off Tuticorin and the 6 are the northern or the Kilakkarai division, the
358 central or the Tuticorin division, and the southern of and 1968. Apart from three oyster spats recorded the Cormorin division. The northern and central at Vallai malai karai paar in 1930, there were no divisions were further subdivided onto seven and significant results. seventeen groups respectively. In 1922, Hornell Group V or the Valinukkam Group - This group charted nearly all the banks in the central division. In is comprised of Valinukkam paar, Valinukkam thundu 1967, the paars of the northern part of the central paar and Nalla Tanni paar. Valinukkam paar is division were charted by a survey party. The paars in situated about 2 - 3 km from Valinukkam point. The the northern and southern division are also charted other two banks are situated 7 - 9 km south of now. The history of the pearl banks have been Valinukkam. The depth ranges from 9 - 13 m. traced from 1904 and the descriptions are also Inspections of the banks were carried out in 1917, given according to the various groups: 1930, 1933 and 1936, but were found to be barren. Group I or the Inner Pamban Group - Group VI or the Inner Vembar Group - This Comprised of Pamban Karai paar and Pamban group consists of Uppu Tanni paar, Vembar karai Velangu paar, this is the northern most group of paar and Kumulam paar located at depths ranging paars in the Gulf of Mannar. Pamban Karai paar is from 9.5 - 12. 5 m. The latter two banks are located situated approx. 9.5 km SSE of Pamban at a depth of 13 km south east of Vembar, 11 km south of Mookur 9 - 13 m. The Pamban Vilangu paar is situated at and 3 km north of Uppu Tanni Tivu. Inspections similar depths about 4 km southeast Pamban Karai were carried out in 1917, 1930, 1933, 1936 and paar. Historically, very few inspections were carried 1939, but oysters were not reported. out in this group presumably due to their Group VII or the Outer Vembar Group - This comparative unimportance. Pear bank inspections group is named after the Vembar Periya paar which were carried out in 1930, 1931, 1932 and 1936. No is also known as St. Patrick’s Bank. This is a oyster settlements have bee reported from these comparatively larger paar (extending 4 km in an groups. east-west direction and 2.5 km north-south) in this Group II or Pamban Periya Paar Group - This is region and is located about 14.4 km south of a fairly extensive bank located at 15 to 17 m depth Mookur. This bank has a depth of 15 to 16.5 m in the and situated about 19 km south of Kundukal Point. southern and western portions and 17.5 to 18.5 m The longer side which measures 3 km is aligned in in the north and east. Surveys were carried out in an east-west direction. This group was inspected in 1917, 1930, 1933, 1936, 1939 and 1966. However the same year as Group I and yielded the same despite favourable habitat and environmental results. conditions only 12 oysters were recored in 1936 Group III or the Musal Tivu Group - This group and 5 in 1966. located southeast of Musal Tivu Island is comprised In terms of commercial value, the fishery of two banks situated close to each other: Musal produced high revenues in the past. During the Tivu Paar and Cholava Karai Paar. They are situated 1955 to 1061 period, the average annual production at depths ranging from 8 to 13 m. These paars were was close to 11 million oysters. In 1958 which was inspected in 1917, 1930, 1033, and 1936. During the best year of harvests, 21.48 million oysters inspection in 1930, two oyster spats were obtained were fished yielding Rs. 465,000. Compared to the from Musal Tivu paar but did not yield any other Gulf of Mannar, other pear yielding regions such as results. the Gulf of Kutch yield only very small quantitaties Group IV or the Kilakkarai Group - This group of pearls and revenue. Since the banks in this has three banks: the Valli malai paar andVallai malai division have not been shown to support significant velangu paar located 12 km directly south of oyster populations in this century, it is clear that Kilakkarai, and Anna paar situated SSW of currently there is hardly any potential for Kilakkarai about 13 km away. The depth ranges from commercial pearl fishery. Vembar Periya paar in this 9.5 m to 13 m. Inspections of this group were region is probably the only bank that possesses the carried out in 1917, 1930, 1933, 1936, 1958, 1965 necessary environmental conditions to support pearl oysters.
359 The Distribution of Pearl Oyster in Mandapam, Kilakkarai and Mandapam Groups of islands: Results of the Field Survey
In the Kilakkarai group of islands, pearl minimum umber of individuals were recorded in oyster beds were identified in 17 paars out of 26 paars 15 and 17. Average depths ranged from 7 - sampling locations. The maximum number of 13 m in the paars. Average densities of oysters 22 individuals were recorded in paars 1, 4 and 8; the ranged from 1.04 ind./m to 11.92 ind./ m .
Sampling effort and results for Kilakkarai group of islands
Paars GPS Location Transect Quadrat Number of Species No/m2 Remarks
N 09°04'54.2" 1 E 078°46'43.8" 5 25 202 8.08 DC N 09°04'52.2" E 078°46'52.0" N 09°04'45.5" 2 5 25 111 4.44 DC E 078°46'40.7" N 09°04'15.3" E 078°47'16.6" 3 5 25 98 3.92 DC N 09°04'14.3" E 078°47'17.6"
N 09°05'55.4" E 078°47'13.5" N 09°05'50.2" 4 5 25 298 11.92 DC E 078°47'30.7" N 09°05'50.2" E 078°47'35.4"
N 09°05'26.9" 5 5 25 57 2.28 SB E 078°45'25.9" N 09°06'17.0" E 078°45'02.7" 6 5 25 120 4.80 SB N 09°06'52.9" E 078°43'36.7" N 09°07'10.5" 7 5 25 14 0.56 SB E 078°44'32.6" N 09°08'22.2" E 078°55'17.6" N 09°08'26.3" 8 5 25 160 6.40 DC E 078°54'00.0" N 09°08'29.9" E 078°54'43.7"
N 09°08'33.0" E 078°54'33.5" 9 5 25 83 3.32 SB N 09°08'48.2" E 078°53'26.4"
N 09°09'20.5" 10 5 25 27 1.08 SB E 078°53'26.4"
360
Paars GPS Location Transect Quadrat Number of Species No/m 2 Remarks
N 09°10'00.1" 11 5 25 75 3.00 DC E 078°49'57.0" N 09°00'39.8" 12 5 25 88 3.52 DC E 078°49'47.4" N 09°01'20.2" 13 5 25 91 3.64 DC E 078°49'30.9" N 09°04'03.3" E 078°46'37.0" 14 5 25 83 3.32 DC N 09°04'30.5" E 078°46'20.0" N 01°05'20.2" 15 5 25 26 1.04 SB E 078°46'12.2" N 09°01'20.4" 16 5 25 28 1.12 SB E 078°48'33.0" N 09°00'11.2" 17 5 25 42 1.68 SB E 078°46'15.6"
In the Mandapam group, pearl oyster beds and 15 and the fewest number of individuals were were identified in 21 paars out of the 35 locations found in paars 6, 14 and 20. Average depth ranged which were sampled. The maximum number of from 15 - 20 m. Densities of pearl oysters ranged 22 individuals were recorded from paars 1, 3, 4, 8, 11 from 1.96 ind./m to 14.72 ind./ m .
361 Sampling effort and results for Mandapam group of islands Number of Paars GPS Location Transect Quadrat No/m2 Remarks Species N 09°10'11.2" E 078°46'15.6" 1 5 25 368 14.72 HC/DC N 09°00'11.2" E 078°46'15.6" N 09°00'11.2" 2 5 25 143 5.72 SB E 078°46'15.6" N 09°00'11.2" E 078°46'15.6" 3 5 25 311 12.44 HC/DC N 09°00'11.2" E 078°46'15.6"
N 09°00'11.2" E 078°46'15.6" 4 5 25 310 12.40 HC/DC N 09°00'11.2" E 078°46'15.6"
N 09°00'11.2" E 078°46'15.6" 5 5 25 306 12.24 HC/DC N 09°00'11.2" E 078°46'15.6"
N 09°00'11.2" E 078°46'15.6" 6 5 25 103 4.12 SB N 09°00'11.2" E 078°46'15.6" N 09°00'11.2" E 078°46'15.6" 7 5 25 271 10.84 HC/DC N 09°00'11.2" E 078°46'15.6" N 09°00'11.2" E 078°46'15.6" 8 5 25 304 12.16 HC/DC N 09°00'11.2" E 078°46'15.6" N 09°00'11.2" E 078°46'15.6" 9 5 25 202 8.08 HC/DC N 09°00'11.2" E 078°46'15.6" N 09°00'11.2" E 078°46'15.6" 10 5 25 138 5.52 SB N 09°00'11.2" E 078°46'15.6" N 09°00'11.2" E 078°46'15.6" 11 5 25 293 11.72 HC N 09°00'11.2" E 078°46'15.6" N 09°00'11.2" E 078°46'15.6" 12 5 25 199 7.96 SB N 09°00'11.2" E 078°46'15.6"
362 Number of Paars GPS Location Transect Quadrat No/m2 Remarks Species N 09°00'11.2" E 078°46'15.6" 13 5 25 221 8.84 DC N 09°00'11.2" E 078°46'15.6" N 09°00'11.2" 14 5 25 105 4.20 SB E 078°46'15.6" N 09°00'11.2" E 078°46'15.6" N 09°00'11.2" 15 5 25 349 13.96 HC/DC E 078°46'15.6" N 09°00'11.2" E 078°46'15.6" N 09°00'11.2" E 078°46'15.6" 16 5 25 255 10.2 HC/DC N 09°00'11.2" E 078°46'15.6" N 09°00'11.2" E 078°46'15.6" 17 5 25 114 4.56 SB N 09°00'11.2" E 078°46'15.6" N 09°00'11.2" E 078°46'15.6" N 09°00'11.2" 18 5 25 112 4.48 SB E 078°46'15.6" N 09°00'11.2" E 078°46'15.6" N 09°00'11.2" 19 5 25 121 4.84 SB E 078°46'15.6" N 09°00'11.2" 20 5 25 49 1.96 SB E 078°46'15.6" N 09°00'11.2" E 078°46'15.6" 21 5 25 152 6.08 SB N 09°00'11.2" E 078°46'15.6"
363 In the Tuticorin group of islands, oyster beds individuals were in locations 16 to 20. Average were identified in 20 paars out of the 32 sampled. depths at these sites ranged from 15 - 20 m. The largest number of oysters were recorded in Densities of individuals ranged from 7.97 ind./m2 to paars 1, 3, 4, 6 and 8. The fewest numbers of 13.80 ind./ m2 . Sampling effort and results for Tuticorin group of islands Number of Paars GPS Location Transect Quadrate No/m2 Remarks Species N 08°55'54.2" 1 E 078°17'29.4" 7 35 486 13.8 SC & SB
N 08°55'40.6" 2 E 078°17'32.4" 7 35 342 9.7 SC & SB
N 08°55'48.1" 3 E 078°17'40.1" 7 35 453 12.9 SC & SB
N 08°55'36.6" 4 E 078°17'29.4" 7 35 424 12.1 SC & SB
N 08°55'38.4" 5 E 078°17'36.5" 7 35 335 9.57 SC & SB
N 08°54'38.2" 6 7 35 415 11.8 HC&SB E 078°17'59.6" N 08°54'34.2" 7 7 35 388 11.08 SC & SB E 078°17'54.4" N 08°54'32.2" 8 7 35 441 12.6 SC & SB E 078°17'48.4" N 08°53'52.6" 9 E 078°17'36.9" 7 35 350 10.0 HC&SB
N 08°54'24.9" HC & SB 10 7 35 369 10.5 E 078°17'50.0" N 08°54'46.2" 11 E 078°17'18.4" 7 35 397 11.3 HC & SB
N 08°53'34.4" 12 E 078°18'12.5" 7 35 341 9.74 HC&SB
N 08°55'28.2" 13 E 078°17'10.4" 7 35 324 9.25 SC & SB
N 08°53'13.7" 14 7 35 357 10.2 HC&SB E 078°18'13.5" N 08°53'38.2" 15 E 078°18'12.9" 7 35 348 9.94 HC&SB
N 08°53'20.8" 16 E 078°18'20.4" 7 35 279 7.97 SC & SB
N 08°53'05.4" 17 7 35 324 9.25 HC&SB E 078°18'10.9" N 08°53'08.2" 18 7 35 298 8.51 DC & PB E 078°18'20.0" N 08°53'20.1" 19 7 35 306 8.74 DC & SB E 078°18'28.9" N 08°53'04.8" 20 7 35 316 9.02 SC & SB E 078°18'12.4"
364 When compared across groups, the rocks, other molluscan shells, sponges and other Mandapam group recorded a higher densitiy of hard substrata, where they were seen forming individuals in comparison to the Kilakkarai and beds or found attached to each other. In the Mandapam groups. In this island group, oyster Kilakkarai and Tuticorin groups, oysters were beds were found attached to live or dead coral, observed in the sandy bottom areas.
365 Faunistic features of the three island groups
The physical as well as faunistic features of Conus spp., Nassa sp. and Bulla ampulla are the the island groups are similar in some ways and other common shells that were recorded. The different in others. The sea floor is essentially area is rich in molluscan species. Bivalves which covered by sand grains of a coarse nature, coral were recorded include Pinna spp., Malleus sp., fragments, and dead sea shells. Large drifted Cypraea spp., Murex spp., Nassa spp., Conus spp., shells such as thos o Bulla sp., Pinctada fucata, Dentalium formosum , Pecten spp., Avicula zebra and Pecten spp., Arca spp., Anomia spp. and Turritella sp. Pinctada fucata lying loose in crevices and fissures. make up the dead shell material. TModiolus spp. Shells o Pteria penguin Xancus pyrum were also which covers the seafloor in many places and it is recorded. The faunastic features of the pearl beds speculated that this could have negative of Mandapam and KilaKarai groups of islands consequences for these areas. Pinna sp. are found were similar to those recorded by previous in good numbers in sandy areas that cover rocks. surveys starting with 1906. Cypraea tigrinus are seem in rocky pits. Oliva spp.,
366
Published by the Gulf of Mannar Biosphere Reserve Trust
Preliminary Survey on Plant Animal Interactions and their Impact on the Recovery of Insular Flora of the Mandapam Group of Islands in the Gulf of Mannar Marine National Park
science outreach series no 24 Work Title: Preliminary Survey on Plant Animal Interactions and their Impact on the Recovery of Insular Flora of the Mandapam Group of Islands in the Gulf of Mannar Marine National Park
Funding Agency : Gulf of Mannar Biosphere Reserve Trust, Ramanathapuram
Implementing Bat Research Laboratory, Advanced Zoology and Biotechnology Institution: Department and Research Centre, Sarah Tucker College, Tirunelveli
Duration : 1 Year
Cost : Rs. 1,92,000/ - Introduction Objectives On account of them being isolated and This study had the following major objectives: relatively simple, island ecosystems serve as * Survey the major types of plant-animal laboratories for the study of evolutionary interactions among native biodiversity. ecology. At the same time, although there are * Document ‘key-stone mutualists’ and bioagents, some general patterns that are comparable to especially pollinators and seed dispersers. those of continental ecosystems, islands are * Assess the role of pollinators and seed dispersal considered to be quirky and idiosyncratic in agents in the different habitats found on these some ways. For example, islands depending on islands. their location have the representation of fewer taxonomic groups in general and the * Assess the impact of plant-animal interdependency in different habitats. Identify the representation of fewer groups that are non- highly interactive native plant species for mobile, are characterised by higher rates of afforestation programmmes. extinction and are vulnerable to devastation by invasive alien species. * Document existing threats that are currently operational on native species of plants and animals. In recent decades, Manadapam group of islands in the Gulf of Mannar have been Methods characterised by the degradation of its This study was conducted in the Mandapam ecosystems stemming from various group of islands. The seven islands which were anthropogenic activities. Although the island selected for the study include Muyal island (129.04 group hosts a diverse array of species and ha), Manoli (25.9 ha), Manoliputti (2.34 ha), ecosystems (such as littoral forests, mangroves, Poomarichan (16.58 ha), Pullivasal (29.95 ha), tidal swamps, dry deciduous forests and scrub), Krusadai (65.8 ha) and Shingle (12.69 ha). Sampling about 30 - 40% of these forests are in a degraded was carried out during all four seasons: spring (July, state. When such levels of degradation are August, September), winter (October, November, operational, the consequences for plant-animal December, monsoon), autumn (January, February, interactions need to be assessed. However, to March) and summer (April, May, June, monsoon). study these impacts in detail it is imprortant to Four visits per island were carried out covering all identify the types of interactions especially in seasons. Both field sampling and laboratory terms of the interdependency between different sampling was carried out. Field sampling involved floral and faunal elements. the setting up of observation plots and line transects in all representative vegetation types (littoral forest, mangrove, tidal swamp, dry deciduous forsts, scrub), vegetation sampling, identification, tagging and observation of key species of plants which had high visitation rates, photo documentation of species and preparation of herbarium specimens, mist netting for birds, insect sampling, etc. Laboratory work involved identification of various species of plants and animals, graphical representation of phenologies and mutualistic interactions, identification of plant species with high bio-active agents, statistical Study area : Mandapam group analysis, etc.
367 Interacting Percentage of Insect These three groups contribute the maximum in Orders terms of ecosystem services via. pollination. The other groups which were represented include Among insect orders, Lepidoptera (butterflies Hymenoptera (ants, bees and wasps), Diptera and moths) were the most frequent accounting (true flies), Odonata (dragonflies and damselfies), for 30% of species involved in pollination. Other Chelicerata (spiders, scorpions, mites, etc.), The prominent orders included Hemiptera (true contribution of lesser mutualistic orders of bugs) which had a contribution of 20% and insects was also assessed. Coleoptera (beetles) which contributed 16%.
Representation of various insect orders
Hemiptera 20% Coleoptera 16%
Hymenoptera 8%
Diptera 10%
Lepidoptera 30% Odonata 8%
Chelicerata 4% Lesser Mutualistic insects 4%
The contribution of lesser mutualistic orders of insects Isoptera, 5% Ephemeroptera 5%
Odonata, 13%
Dictyoptera, 15%
Plecoptera, 4%
Phasmida, 8%
Orthoptera, 51%
368 The contribution of different families belonging to Lepidoptera
Pieridae Hesperidae 13% Papilionidae 17% 17%
Lycaenidae Nymphalidae 17% 36%
Among Lepidoptera, certain families such Lycaenidae each accounted for 17% and Pieridae as Nymphalidae dominate, accounting for 36% of accounted for a further 16% of records. all records. Papillonodae, Hesperidae and
Role of Insect Bio-Agents Insects play various roles in different habitat bugs, dragonflies, etc. as predators, etc. During this types. While insects derive many benfits from plants, study, insect visitation was observed for a number plants themselves depend on insects for a variety of of species of focal shrubs and trees. Insect visitation services including pollination, seed dispersal and when pooled across families of plants was pest control. It has to be noted here that insects considerable. Among shrubs, families such as also play the role of predators. Typical interactions Asclepiadaceae and Cactaceae recorded the inlcude bees, butterflies, moths, etc. as pollinators; highest visitation rates. Among trees, Mimosaceae ants and beetles as seed dispersers; wasps, spiders, recorded the maximum number of insect visitors.
Insect visitation of focal families of shrubs and trees
Shrub Family members Total Insect Tree Family members Insect Visitors Sl.No Sl.No visited by the insects Visitors visited by the insects Number 1 1 Amaranthaceae 8 Apocynaceae 18 2 Asclepiadaceae 16 2 Arecaceae 14 3 Avicenniaceae 15 3 Asclepiadaceae 7 4 Cactaceae 16 4 Boraginaceae 21 5 Capparaceae 13 5 Caesalpiniaceae 8 6 Chenopodiaceae 12 6 Celastraceae 10 7 Euphorbiaceae 10 7 Euphorbiaceae 16 8 Goodeniaceae 11 8 Malvaceae 14 9 Goodeniaceae 12 9 Meliaceae 15 10 Lythraceae 13 10 Mimosaceae 36 11 Papilionaceae 11 11 Moraceae 12 Papilionaceae 12 12 12 13 Rhamnaceae 12 Pandanaceae 14 14 Sapindaceae 13 13 Papilionaceae 12 15 Solanaceae 8 14 Rhizophoraceae 18 16 Surianaceae 14 15 Salvadoraceae 16 17 Verbenaceae 12 16 Verbenaceae 11
369 Interactions with Birds
Birds perform similar services to plants as insectivorous birds also provide some forms of do insects and also derive a variety of benefits pest control. It has also been reported from a from them. Strong interactions are often number of studies that birds not only take the recorded between birds and plants. seeds further away from the parent tree (thereby Nectarivorous birds provide pollination ensuring better fitness), the seeds of some services, where as frugivoirous and granivorous species germinate birds are primarily involved in seed dispersal;
Visitation rates by different bird guilds on different families of shrubs
Shrub Family members Nectivores Frugivores Insectivores Total Sl.No visited by the insects Birds Birds Birds visitors 1 Asclepiadaceae 42 612 2 Avicenniaceae 63 312 3 Cactaceae 74 415 4 Capparaceae 65 718 5 Chenopodiaceae 32 49 6Euphorbiaceae 34 411 7 Goodeniaceae 23 49 8Goodeniaceae 45 514 9 Lythraceae 56 415 10 Papilionaceae 54 514 11 Papilionaceae 43 310 12 Rhamnaceae 56 617 13 Sapindaceae 64 414 14 Solanaceae 54 211 15 Surianaceae 64 414 16 Verbenaceae 43 613
Visitation rates by different bird guilds on different families of trees
Tree Family members Nectivores Frugivores Insectivores Total S.No visited by the birds Birds Birds Birds visitors 1 Apocynaceae 38 415 2Arecaceae 75 333 3Asclepiadaceae 59 317 4Boraginaceae 76 637 5Caesalpiniaceae 57 416 6Celastraceae 75 618 7Euphorbiaceae 86 822 8Malvaceae 64 919 9Meliaceae 44 917 10 Mimosaceae 63 853 11 Moraceae 43 613 12 Pandanaceae 0 3 4 7 13 Papilionaceae 43 512 14 Rhizophoraceae 43 426 15 Salvadoraceae 610824 16 Verbenaceae 57 820
370 Interactions with Reptiles A number of reptiles also feed on the fruit plant matter. In the study area, common reptilian and nectar of plants and it has been speculated species included snakes, lizards, skinks, varanus, that this process could facilitate pollination. At calotes and land tortoises. Reptiles such as the the same time, plants provide cover and varanus are also known to be effective seed susbstrates for reptiles and are also host to a dispersers of specific species such as Pandanus variety of species of prey. Insular species are fascicularis. particularly known to consume large quantites of
Interactions with Mammals
Mammal species also play a variety of via predation. Bats are useful agents of pollination roles in these ecosystems including pollination for a variety of plants that bloom at night and and seed dispersal, pest control, etc. While being highly mobile, they also perform the role of certain groups such as bats, rodents, hares and seed dispersers very effectively. In this study high ungulats perform more effective roles as visitation rates by mammals were recorded for pollinators and seed dispersers, other such as Mimosaceae (among shrubs) and Rhamnaceae small felids, mongoose, etc. play an effective role and Cactaceae (among trees).
Visitation rates by different mammals on different families of shrubs
Shrub Family Nectrivores Frugivores Insectivores members visited by Habitat users Total visitors mammals mammals mammals the mammals Apocynaceae - - 7 1 8 Arecaceae 7 28 10 45 Asclepiadaceae - - 12 2 14 Boranginaceae - 2 24 7 33 Caesalpiniaceae - 4 13 5 22 Celastraceae - 3 16 1 20 Combretaceae - - 12 2 14 Euphorbiaceae - - 11 2 13 Malvaceae - - 16 3 19 Meliaceae - 8 12 3 23 Mimosaceae 3 10 38 10 61 Moraceae 12 18 10 40 Myrtaceae 3 6 8 4 21 Pandanaceae - - 6 - 6 Papilionaceae - - 7 4 11 Rhamnaceae 3 2 4 2 11 Rhizophoraceae - - 4 - 4 Rhizophoraceae - - 9 2 11 Salvadoraceae - - 10 - 10 Verbenaceae - - 9 - 9
371 Visitation rates by different mammals on different families of trees
Frugivores Habitat Insectivores Total S.No Family name mammals users mammals visitors
1 Amaranthaceae - 2 - 2 2 Asclepiadaceae - 3 - 3 3 Avicenniaceae - 6 - 6 4 Cactaceae 4 9 - 13 5 Capparaceae 5 6 1 11 6 Chenopodiaceae - 5 - 5 7 Euphorbiaceae 4 3 - 7 8 Goodeniaceae - 2 - 2 9 Goodeniaceae 5 3 - 8 10 Liliaceae 2 2 1 4 11 Lythraceae 6 3 2 9 12 Papilionaceae - 4 1 4 13 Papilionaceae 3 2 2 5 14 Rhamnaceae 6 7 2 13 15 Sapindaceae 4 6 1 10 16 Solanaceae 4 3 - 7 17 Surianaceae 4 8 - 12 18 Verbenaceae 3 5 - 8
Reasons for Landscape Change and the Directions Forward
The main reason for landscape level To reverse some of these changes, changes in this island group is habitat distruction landscape restoration is required to be carried by human action. In addition to loss of vegetation out in affected inland forest sites in the cover, anthropogenic factors are also responsible Mandapam group. Biodiversity conservation for the introduction of exotics such as Prosopis would particularly benefit if interventions which sp., Dolichos lablak, Coccinia grandis, Cucumis facilitate the foraging activities of pollinators and pubescens, Momordica dioica as well as a number of seed dispersers are attempted. In this context, it species which remain to be identified. These is important at least to incorporate the ‘Big Bs’ species threaten the remaining native flora of the (bats, birdsm butterflies, bees, bugs and beetles) island. The second main reason for changes into these conservation planning exercises. inlcude erosion of mutualistic relationships, especially those relating to pollination and seed dispersal. This study alone reports mutualistic and commensal interactions among a number of species.
372 Plant Animal Interdependence in Mangrove Forests Mangroves are tropical or subtropcial Crinum latifolium, Cymbopogon caesius , Cymodocea evergreen shrubs or trees that grow along tidal serrulata, Hedyofis puberula, Launaea sarmentosa, marshes and shores. True mangroves are those Scaevola plumieri, and Sesuviam portulacastrum also mangroves that are found along tidal shores that grow in saline, water-logged habitats. Climbers such have evolved breathing roots and vivipary as as Ipomoea crolaceae, Ipomoea pescaprae, Coccinia adaptation to their specific environment. Minor indica, Momordica dioica and Tinospora cordifolia are mangroves are those that are also found in inland also found in these habitats. areas and are usually associated with true To carry out plant-animal interactions, a mangroves. The only true mangroves in the number of mangroves were also selected from Mandapam group of islands include Rhizophora different islands in the Mandapam group. In mmucronata, Ceriops tagal, Avicennia marina and additionn to mangroves a number of species of Lumnitzera racemosa. Minor mangroves include trees shrubs and climbers were also identified to Excoecaria agallocha, Salvadora persica, Suriana have high levels of interactions with faunal maritima, Pemphis acidula and Premna serratifolia. elements. Herbaceous plants such as Asystasia gangetica,
Focal mangrove species selected for the study of plant animal interactions
Sl.No Focal plant Family Name Place Location of the plant
1 Avicennia marina (Forssk.) Avicenniaceae Hare island Ele: 34ft N: 09 º14.532' E:079 º14.094' Vierth Ele: 94ft N: 09 º14.567' E:079 º14.961' Ele: 56ft N: 09 º11.803' E:079 º05.035' Ele: 34ft N: 09 º14.532' E:079 º14.094' Ele:102ft N: 09 º12.965' E:079 º07.500' Ele: 50ft N: 09 º14.925' E:079 º13.121' 2 Ceriops tagal(perr.)rabins Rhizophoraceae Shingle island Ele: 23ft N: 09 º14.565' E:079 º14.068' Poomarichan island, Ele: 98ft N: 09 º14.570' E:079 º10.913' Pullivasal island Ele: 94ft N: 09 º14.467' E:079 º10.961' Hare island, Ele: 39ft N: 09 º11.938' E:079 º04.843' Manoli island Ele: 123ft N: 09 º12.938' E:079 º07.525'
3 Clerodendrum inerme (L.) Verbenaceae Pullivasal island Ele: 96ft N: 09 º14.472' E:079 º10.981' Gaertn 4 Excoecaria agallocha L. Euphorbiaceae Pullivasal island, Ele: 96ft N: 09 º14.572' E:079 º10.977' Hare island, Ele: 50ft N: 09 º14.925' E:079 º13.121' Manoli island Ele: 127ft N: 09 º12.858' E:079 º07.595' 5 Lumnitzera racemosus Wild. Combretaceae Kurusadai island Ele: 50ft N: 09 º14.925' E:079 º13.121' 6 Pemphis acidula forst Lythraceae Poomarichan island, Ele: 87ft N: 09 º14.495' E:079 º10.963' Pullivasal island, Ele: 96ft N: 09 º14.572' E:079 º10.977' Hare island, Ele: 53ft N: 09 º11.789' E:079 º05.024' Manoli island, Ele: 123ft N: 09 º12.938' E:079 º07.525' Kurusadai island Ele: 35ft N: 09 º14.858' E:079 º10.595' 7 Premna serratifolia L. Verbenaceae Hare island Ele: 56ft N: 09 º11.803' E:079 º05.035'
8 Rhizophora mucornata poir Rhizophoraceae Poomarichan,Hair Ele: -91ft N: 09 º14.603' E:079 º10.804' island Ele: 50ft N: 09 º14.925' E:079 º13.121' 9 Salvadora persicaLinn. Salvadoraceae Pullivasal island, Ele: 96ft N: 09 º14.572' E:079 º10.977' Hare island, Ele: 96ft N: 09 º14.652' E:079 º10.977' Manoli island, Ele: 123ft N: 09 º14.602' E:079 º10.849' Kurusadai island Ele: 23ft N: 09 º14.602' E:079 º10.849' 10 Suriana maritima L. Surianaceae Shingle island, Ele:11ft N: 09 º14.577' E:079 º14.048' Poomarichan island, Ele: 98ft N: 09 º14.570' E:079 º10.913' Pullivasal island Ele: 96ft N: 09 º14.572' E:079 º10.977'
373 Phenology are important to understand detailed aspects of Seasonal sampling of all sites yielded an pollination and seed dispersal as well as for understanding of the phenology of different focal monitoring changes occurring due to plants in the Mandapam group. Phenological studies environmental factoes and climate change. Phenology of focal tree species
Phenology of the tree species Status of Phenology Sl.No Focal plant species Family Name Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 1 Wrightia tinctoria Apocynaceae 2 Borassus flabellifer Arecaceae 3 Cocos nucifera Arecaceae 4 Phoenix pusillagaertn Arecaceae 5 Watta kaka volublis (L.F)stapf. Asclepiadaceae 6 Avicennia marina(Forssk.) Vierth Avicenniaceae 7 Cardia obliqua Willd Boraginaceae 8 Cardia subcordata lamt Boranginaceae 9 Tamarindus indica Caesalpiniaceae 10 Pleurostylia opposita(wall.)Alston Celastraceae 11 Lumnitzera racemosus Wild. Combretaceae 12 Excoecaria agallocha L. Euphorbiaceae 13 Thespesia populnea cav. Malvaceae 14 Azardiracta indica Meliaceae 15 Accacia planiformis Mimosaceae 16 Albizzia lebbeck Mimosaceae 17 Dichrostachys cinera Mimosaceae 18 Pithecolobium dulce Mimosaceae 19 Prosopis cineraria Mimosaceae 20 Ficus bengalensis Moraceae 21 Ficus tsiela Moraceae 22 Syzygium cumini Myrtaceae 23 Pandanus fascicularis Lam. Pandanaceae 24 Pongamia pinnata(L.)pierre Papilionaceae 25 Zizyphs mauritiana Rhamnaceae 26 Ceriops tagal(perr.)rabins Rhizophoraceae 27 Rhizophora mucornata poir Rhizophoraceae 28 Salvadora persicaLinn. Salvadoraceae 29 Premna serratifolia L. Verbenaceae
Phenology of shrub species
Phenology of the Shrub species Status of Phenology
Sl.No Focal plant species Family Name Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec
1 Achyranthes aspera Linn. Var. aspera Amaranthaceae
2 Calotropis gigantea Asclepiadaceae Avicenniamarina 3 Avicenniaceae Opuntia dillenii 4 Cactaceae Capparis brevispina DC. 5 Capparaceae Atriplex repens roth. 6 Chenopodiaceae Breynia vitis - ideae (burn.f)c.fischer 7 Euphorbiaceae 8 Scaevola plumieri(L.) vahl Goodeniaceae 9 Scaevola sericea(L.) vahl Goodeniaceae 10 Asparagus racemosus wild. Liliaceae 11 Pemphis acidula forst Lythraceae
12 Crotalaria tecta heyne ex roth Papilionaceae 13 Indigofera oblongifolia forsk Papilionaceae
14 Zizyphus nummularia (burnf )white&Arn Rhamnaceae
15 Dodonaea viscosa (L.)jacg. Sapindaceae
16 Suriana maritima L. Surianaceae
17 Clerodendrum inerme (L.) Gaertn Verbenaceae
374 Penology of herb species
Phenology of the Shrub species Status of Phenology
Sl.No Focal plant species Family Name Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec
1 Asystasia gangetica(L.)T.And Acanthaceae 2 Crinum latifolium L. Amaryllidiaceae 3 Launaea sarmentosa (Wild.) Sch.Bip.ex Compositae Kuntze 4 Vernonia cinerea(L.) Compositae 5 Phyllanthus amarus Schum.&Thonn. Euphorbiaceae
6 Scaevola plumieri(L.)vahl Goodeniaceae 7 Cymbopogon caesius Nees ex Hook Poaceae
8 Spinifix littoreus(Burm.f.)Merr. Poaceae (Graminae)
9 Cymodocea Potamogetonaceae serrulata(R.Br)Asch.&magnus 10 Hedyofis puberula(G.Don)Arn Rubiaceae 11 Sesuviam portulacastrum L. Rubiaceae Phenology of the Climber species Status of Phenology Sl.No Focal plant species Family Name Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 1 Ipomoea crolaceae Convolvulaceae 2 Ipomoea pes - caprae(L)R..Br Convolvulaceae
3 Coccinia indica Cucurbitaceae 4 Coccinia grandis Cucurbitaceae 5 Cucumis pubescens willd Cucurbitaceae 6 Momordica dioica roxb.ex.willd . Cucurbitaceae 7 Tinospora cordifolia miers Menispermaceae 8 Dolichos lablak linn Papilionaceae 9 Solanum trilobatum Linn Solanaceae 10 Cissus quadrangularis Viaceae Gloriosa superba Colchicaceae
Current Threats for the Survival of Native Species in the Mandapam Group
During this study, a number of activities the mainland. that threatened the survival of native speces on · Collection and removal of dead wood for these islands were recorded. These include: firewood by daily wage workers employed by the · The presence of existing trails and paths in the department. islands. · Effects of an ongoing government project which · Relgious activities taking place on these islands. has created artificial channels for the entry if sea · The presence of places for stopovers and night water into Hare island. This activity is making the halts. soil in the area saline and killing native plants such · Settlements of poachers who fish near as Ficus bengalensis, Thespesia populnea and Cordia mangrove habitats and coral beds. subcordata, and also affecting the diversity of · Invasive species and epiphytes brought in from animal species that are dependent on them.
375
Published by the Gulf of Mannar Biosphere Reserve Trust
Role of Microbial Chitinase from Marine Crustacean Shell as a source of Fungicide and Insecticide
science outreach series no 25 Work Title: Role of Microbial Chitinase from Marine Crustacean Shell as a source of Fungicide and Insecticide
Funding Agency : Gulf of Mannar Biosphere Reserve Trust, Ramanathapuram
Implementing Ethiraj College for Women, Chennai Institution:
Duration : 2 Years
Cost : Rs. 3,00,000/ - Methodology into 1 ml of 70% ethanol for 30 seconds. DNA was resuspended in 100 - 200 ml TE buffer. 1) 16S r DNA sequencing : Steps Involved : 2. Agarose gel electrophoresis on 0.7% gel. (Ogden, R.C., and Adams, D.A., 1987) 1. Isolation of genomic DNA from pure Reagents required : bacterial cultures : (modified from Experimental techniques in bacterial genetics, TAE Buffer Jones and Bartlet, 1990). 6XSample Loading Buffer Reagents required : 0.5M EDTA (pH 8.0) i) TE buffer DNA ladder standard ii) 10% (w/v) sodium dodecyl sulfate Electrophoresis chamber iii) Proteinase K (20 mg / ml) Power supply iv) Phenol / chloroform Gel casting tray and combs v) Isopropanol DNA stain vi) 70% ethanol TAE Buffer : vii) 3M sodium acetate pH 5.2 4.84 g of Tris base was added to ~900 ml
Steps : H2 O. Then 1.14 ml of acetic acid and 2 ml of 0.5M 1ml each of pure bacterial culture from EDTA (pH 8.0) was added to the solution and the broth is transferred to a microfuge and mixed. The mixture was then poured into 1 L spinned for 2 minutes. Decant the supernatant. graduated cylinder and water was added to make Resuspend the pellet in 467 ml TE buffer up a total volume of 1 L. by repeated pipetting. 30 ml of 10% SDS and 3 ml of 6X Sample Loading Buffer 20 mg / ml Proteinase K was added, mixed and 1 ml sterile H2 O incubated for 1 hr at 37o C. 1 ml Glycerol An equal volume of Phenol / chloroform Enough bromophenol blue was added to make was added and mixed well by inverting the tube ~ until the phases are completely mixed. The DNA/ the buffer deep blue ( 0.05 mg) phenol mixture was transferred carefully into a ii) Steps involved : centrifuge tube and spinned for 2 minutes. 1. The gel casting tray and comb was assembled The upper aqueous phase was such that the comb should not touch the bottom transferred to a new tube and an equal volume of of the tray. Phenol / chloroform was added. It was again 2. 1 g of agarose was added to 65 ml 0.5 x TBE mixed well and transferred to a new tube and buffer. using a microwave, the agarose solution is spinned for 2 minutes. The upper aqueous phase melted. was transferred to another new tube. 3. When the agarose solution has cooled to about 1/10 volume of sodium acetate was added. 50o C, it was poured directly into the casting tray, 0.6 volumes of isopropanol was added ensuring that no bubbles get into the gel. (rinse and mixed gently until the DNA precipitates. the flask immediately) Spool DNA onto a glass rod. 4. The gel gets solidified and become slightly DNA was washed by dipping end of rod opaque within 20 to 30 minutes. Then black end
376 5. The gel is submerged within the Amount Final concentration electrophoretic tank by adding approximately Template 1.0 ml 10 ng 1 L of 0.5X TBE running buffer to cover the gel by about a half a centimeter. Reaction buffer 2.0 ml 1X 6. The comb is carefully removed by lifting it gently at one end, tilting the comb as it comes d-NTP mix 2.0 ml 100 mM of each dNTPs out. It was ensure that the wells are Forward primer 1.0 ml 10 pmol submerged and filled with buffer. 7. The DNA samples were prepared for Reverse primer 1.0 ml 10 pmol loading using glycerol loading buffer. Taq DNA polymerase 0.15 ml 0.75 U 8. A maximum of 10 ml of each sample is loaded into individual wells with a gel loading Sterile distilled water 12.85 ml tip and a P-20 Pipetman. 9. Once all the samples were loaded, the cover 20 ml is placed on the gel apparatus. The leads are Reaction buffer : Tris HCL, pH:9, 10mM., KCL connected so that the red (positive) lead is at 50mM and MgCl 15mM. the end of the gel to which the DNA will 2 migrate and the black (negative) lead is at the The reaction mix was overlaid with a end of the gel containing the wells. The power drop of mineral oil and amplification was supply isturned on and set according to the carried out in a perkin-elmer 480 DNA instructor's guidelines. The gel was checked for thermal cycler. The PCR conditions were as migration after a few minutes and maintained follows : at a constant voltage of 200 volts. o Step-1 Initial denaturation 4 min 94 C 10. When the blue tracking dye (which runs in o these gels along with a DNA fragment of Step-2 Denaturation 30 sec 94 C about 200 - 400 bp) has migrated about 75% Annealing 1 min 50 oC of the distance to the end of the gel (usually within 60-90 minutes), the power supply was Extension 2 min 72 oC turned off and the power leads were disconnected. Step-3 Repeat Step-2 35 times
11. The DNA bands were visualized with UV Step-4 Final elongation 10 min 72 oC light. Step-5 Hold 4 oC 3. Amplification of 16S r DNA gene by PCR PCR amplification was performed with The PCR products were analysed in 1.2% 10 ng of genomic DNA using Universal 16sr agarose gels. DNA primers (Sequence of primers : 4. Agarose gel electrophoresis of PCR FORWARD 5'- AGAGTTTGAT and REVERSE product on 1.2% agarose gel 5'- AAGGAGGTGT). Amplifications were The amplified products were once again carried out in 20 ml reactions, which contains loaded onto agarose gel electrophoresis the following constituents : Table 5 : according to the protocol given in step 2.
377 5. Sequencing and sequence analysis : Results and Discussion : The sequencing of 16S r DNA gene was Sequencing : performed in an automated sequencer using Further, the isolation of non-identical ABI PRISM 377 DNA Sequencer. A similarity species were confirmed by 16s rDNA search for the nucleotide sequence of 16S r sequencing. The 16s rDNA sequence for each DNA of the test isolates were analyzed using of the isolated strains Vibrio alginolyticus, BLAST search at NCBI (Altschul et al., 1990) Flavobacterium odoratus, Shewenella putrefaciens, and the organism name was interpreted. Exiguobacterium strain, Bacillus subtilis and Bacillus atrophaeus were shown below. 2) Purification by Chromatography : i) Vibrio alginolyticus The dialysed protein was subjected to GTAATGCCTAGGAAATTGCCTGATGTGGG ion exchanger, DEAE - Sephadex colum (1.5 x GGATAACCATTGGAAACGATGGCTAATAC 12 cm). The adsorbed chitinase was eluted by CGCATGATGCCTACGGGCCAAAAAGGGG a linear gradient of NaCl from 0 to 0.25 M in GACCTTCGGGCCTCTCGCGTCAGGATAT the same buffer. Chitinase activity was assayed GCCTAGGTGGGATTAGCTAGTTGGTGAGG in each 5.0 ml fraction at a flow rate of 42 ml TAAGGGCTCACCAAGGCAACCATCCCTA h-1. In final step, the active fractions were ACTGGTCTGAGAGGATGATCACCCACACT pooled, concentrated by polyethylene glycol GGAACTGACACACGGTCCACACTCCTAC and dialysed against Tris-HCl, pH 7.5 and GGGAGGCATCAGTGGGGAATATTGCACA loaded onto a gel filtration column (2.2 cm x ATGGGCGCAAGCCTGATGCACCCCTGCC 90 cm), Sephadex G-200 and flow rate was GCGTGTATAAAGAAGGCCTTCGGGTTGTA maintained at 20 ml h-1. The molecular weight AAGCACTTTCAGTCGTGAGGAAGGCGGT was estimated from a standard curve obtained TTCGTTAATAGCGTTCTTTTTTGACGTTAG from the proteins with their molecular CCAAAAAAAGAAACACCGGCTTACTCCG weights known (68 kDa, bovine serum albumin, TGCCAGCAGCCGCGATAATACGGGAGGG 45 kDa, ovalalbumin and 30 kDa, casein). GGGCGAGCGT
3) In vitro antifungal activity : ii) Enterobacterium : The antifungal activity was assayed in TATAAGATGGGCATGCGTATCATTA vitro by inhibiting the growth of GCTAGTTGGTGTGGTAACGGCATACCAAG phytopathogenic fungus on PDA media GCAACGATGATTAGGGGTCCTGAGAGGG (Altindag et al., 2006). The bacterial inoculum AGATCCCCCACACTGGTACTGAGACACG of the six chitinolytic isolates were picked GACCAGACTCCTACGGGAGGCAGCAGTG aseptically and streaked in the center of AGGAATATTGGTCAATGGAGGCAACTCTG petridish. Fungal inocula consisted of agar disc AACCAGCCATGCCGCGTGCAGGATGACG (1 cm diameter) punched out with sterilized GTCCTATGGATTGTAAACTGCTTTTGTACA corkborer from the growing margin of GGAAGAAACCTCCCTACGAGTAGGGACT colonies and was placed on either side of TGACGGTACTGTAAGAATAAGGATCGGCT bacteria inoculated plates. The Petri plates AACTCCGTGCCAGCAGCCGCGGTAATAC o were incubated at 28 C for five days. The GGAGGATCCGAGCGTTATCCGGAATTATT diameter of hyaline inhibition zones were measured and the experiments were repeated iii) Aeromonas sp : three times. TATAAGATGGGCATGCGTATCATTAGCTAG
378 TTGGTGTGGTAACGGCATACCAAGGCAA GGTAGCTGAGTACTGTACGATAGCACGCT CGATGATTAGGGGTCCTGAGAGGGAGATC ACTCCGTGCCAGCGCGTAATACGGAGGG CCCCACACTGGTACTGAGACACGGACCA TGCAAGCGTATCCGGATTTATTGGGTTTA GACTCCTACGGGGAGGCAGCAGTGAGGA AAGGGTCCGTAGGCGGACCTGTAAGTCA ATATTGGTACAATGGAGGCAACTCTGAAC GTGGTGAAATCTCATAGCTTAACTATGAAA CAGCCATGCCGCGTGCAGGATGACGGTC CTGCCATTGATACTGCAGCTCTTGAGTAA CCTATGGATTGTAAACTGCTTTTGTACAG ATTTGAAGTGG GAAGAAACCTCCCTACGAGTAGGGACTT GACGGTACTGTAAGAATAAGGATCGGCTA Enzyme Activity : ACTCCGTGCCAGCAGGTAATACGGAGGAT For all the samples, the chitinase CCGAGCGTTATCCGGAATTATT activity and protein concentration was determined after purification. iv) Streptomyces sp : S.No. Name of Sample Protein(mg) Total Activity(u) ACCTGCCCATAGGTCTGGGATAACCACGA GAAAATCGGGGCTAATACCGGATGTGTCA 1 V. alginolyticus 0.32 34.6 TCGGACCGCATGGTCCGCTGATGAAAGG CGCTCCGGCGTCACCCATGGATGGCTTT 2 Enterobacterium 0.15 29.2 GCGGTGCATTAGCTAGTTGGTGGGGTAAC 3 Aeromonas sp 0.8 58.5 GGCCCACCAAGGCGACGATGCATACCCG ACCTGAGAGGGTGATCGGCCACACTGGG 4 Streptomyces sp 0.2 14.0 ACTGAAACACGGCCCACACTCCTAGGGA GGCAGCAGTAGGGAATCTTCCACAATGG 5 B. subtilis 0.05 18.3 ACGAAAGTCTGATGGAGCAACGCCGCGT 6 B. pumilus 0.39 29.2 GAACGATGAAGGCTTTCGGGTCGTAAAG TTCTGTTGTAA Antifungal Activity v) Bacillus subtillis : Antifungal activity - TTGTTAGGGAAGAACAAGTACCGTTCGAA Inhibition zones (cm) S.No Name of Sample TATGGCGGTACCTTGACGGTACCTAACCA Fusarium Aspergillus Aspergillus GAAAGCCACGGCTAACTACGTGCCAGCA solani niger flavus GCCGCGGTAATACGTAGGTGGCAAGCGT 1 V. alginolyticus 5.2 5.0 3.0 TGTCCGGAATTATTGGGCGTAAAGGGCTC 2 Enterobacterium 4.6 1.2 3.6 GCAGGCGGTTTCTTAAGTCTGATGTGAAA GCCCCCGGCTCAACCGGGGAGGGTCATT 3 Aeromonas sp 2.8 0.5 2.5 GGAAACTGGGGAACTTGAGTGCAGAAGA 4 Streptomyces sp 3.7 1.0 4.0 GGAGAGTGGAATTCCACGTGTAGCGGTG 5 B. subtilis 4.0 0.9 2.9 AAATGCGTAGAGATGTGGAGGAACACCA 6 B. pumilus 4.5 1.6 3.6 GTGGCGAAGGCGACTCTCTGGTCTGTAA CTGAC Table showing antifungal activity in PDA plate vi) Bacillus pumilus : mixed with of 5% culture supernatanat from AGAATATGACATGGTGAAAGCTGATCAGC respective bacterial strains. ATCCGCGTGAGATGACGTCTATGATGTAA The fungal growth inhibition by the CTCTTTGTACAGGATAACTACTCTCGTGA bacterial strains are likely to be due to the
379 Figure showing the control PDA plates not inoculated with culture supernatant
presence of extracellular metabolites both over 100 microbial products are in use today hydrolytic enzymes and secondary antifungal as antibiotics, antitumour agents, and compound(s). Hence, crude chitinase form all agrochemicals (Carte et al., 1996). The studies the strains were used to study the antifungal made by the scientists at the Scripps potential. The six strains showed different Institution of Oceanography show that marine inhibitory activity towards different fungal bacteria are capable of producing unusual species. The inhibitory effect of chitinolytic bioactive compounds that are not observed in strains on phytopathogens were determined terrestrial sources (Fenical, 1993 and Fenical by their level of inhibition towards the growth and Jensen, 1993). of fungal species on Potato Dextrose Agar Thermo-stable proteases, lipases, plate incubated at room temperature for three esterases, and starch and xylan degrading days. The Potato Dextrose Agar plate enzymes have been actively sought and in inoculated with fungal species alone serves as many cases are found in bacterial and archaeal the control. hyperthermophilic microorganisms (Bertoldo, 5. Conclusion 2002). An unusual gram-positive bacterium Nature has been a source of medicinal from deep-sea sediment, which produced a agents for thousands of years and an series of new natural products, macrolaction impressive number of modern drugs have been A-F of an unprecedented C24 linear acetogen isolated from microorganisms, many based on origin has been isolated (Gustafson et al., their use in traditional medicine. In the past 1989). A microbial metabolite (from century, however, an increasing role has been Alteromonas spp.) has been developed with played by microorganisms in the production of anti-HIV potential as reverse transcriptase antibiotics and other drugs for the treatment inhibitor from marine microbes isolated from of some serious diseases. Since the discovery the tissues of Bermudian marine sponge. Some of penicillin in 1929 to the Taq DNA Vibrio species have been found to produce a polymerase obtained from Thermus aquaticus variety of extra cellular proteases. Vibrio (Yellowstone hot spring) in 1989, nearly species have been found to produce a variety 50,000 natural products have been discovered of extra cellular proteases. Vibrio alginolyticus from microorganisms. Over 10,000 of these produces six proteases including an unusual are reported to have biological activity and detergent-resistant, alkaline serine
380 exoprotease. This marine bacterium also hydrolyzing enzymes from thermophilic archea produces collagenase, an enzyme with a and bacteria. Curr. Opin. Chem. Biol., 6 : 151-160. variety of industrial and commercial Bright, D.B., F.E. Durham and J.W. KnudesenN applications, including the dispersion of cells in 1960. King crab investigations of Cook Inlet, tissue culture studies (Fenical alnd Jensen, Carte, B.K. 1996. Biomedical potential of 1993). marine natural products. Bioscience. 46 : 271- Thus, the present research work 286. suggests that chitin degrading bacterial strains C.-J. Huang and C.-Y. Chen 2004. Gene cloning of marine environment can be explored either and biochemical characterization of chitinase as a potential candidate for the conversion of CH from Bacillus cereus 28-9, Annals of shell waste of sea animals or in the production Microbiology, 54(3) : 289-297. of industrially important chitin derivatives. Chakraborty, S., G.B. Nair and S. Shinoda 1997. They can also be used in the formulation of Pathogenic vibrios in the natural aquatic Fungicides and furthering the utilization of environment. Rev. Environ. Health. 12 : 63-80. chitinase in the biotechnological and agro technological industries. However, media Chiang, C.L., C.T. Chang, H.Y. Sung 2003. optimization and scale up studies are required Enzyme Microb. Technol., 32 : 260-267. for the development of an economic Cook, V.J., C.Y. Turenne, J. Wolfe, R. Pauls and bioprocess for the industrial exploitation of A.Kabani 2003. Conventional methods versus these organisms for chitinase production. 16S Ribosomal DNA sequencing for identification of nontuberculous mycobacteria: References cost analysis. J. Clin. Microbiol., 41(3):1010-1015. Ajit, N.S., R. Verma and V. Shanumugam 2006. Collinge, D.B., K.M. Kragh, J.A. Mikkelsen, K.K. Extracellular chitinases of fluorescent Nielsen, U. Rasmuseen and K. Vad 1993. Plant pseudomonads antifungal to Fusarium chitinases. Plant J., 3 : 31-40. oxysporum f. sp. dianthi causing carnation wilt. Currier, J.E., and B.E. Duemmling 1949. The Curr. Microbiol., 52 : 310-316. shell disease - its effect on gills and chitin of Alam, M.M., T. Mizutani, M. Isono, N. Nikaidou the lobster (Homarus americanus). and T. Watanabe 1996. Three chitinase genes Dahiya, N., R. Tewari, R.P. Tiwari and G.S. (chiA, chiC and chiD) comprise the chitinase Hoondal 2005. Chitinase from Enterobacter sp. system of Bacillus circulans WL-12. Journal of NRG4 : Its purification, characterization and Fermentation and Bioengineering 82 : 28-36. reaction pattern. Electronic J. Biotechnol., 8 : Altindag, M., M. Sahin, A. Esitken, S. Ercisli, M. 134-145. Guleryuz, F.M. Donmez and Sahin 2006. Ding, X., Z. Luo, L. Xia, B. Gao, Y. Sun and Biological control of brown rot (Moniliana laxa Y.Zhang 2008. Improving the insecticidal Ehr.) on apricot (Prunus remeniaca L. cv. activity by expression of a recombinant crylAc Hacihaliloglu) by Bacillus, Burkholdria and gene with chitinase-encoding gene in Pseudomonas application under in vitro. acrystalliferous Bacillus thuringiensis. Curr. Austin, B. 1988. Marine Microbiology. Microbiol., 56 : 442-446. Cambridge : Cambridge University Press. Emmert, E.A.B. and J. Handelsman 1999. Bergey's manual of Systematic Bacteriology. Biocontrol of plant disease : a (Gram-) positive Bertoldo, C. and G. Antranikian 2002. Starch perspective. FEMS Microbiol. Lett., 171 : 1-9.
381 Ezaki, S., K. Miyaoku, K. Nishi, T. Tanaka, howard, J.B. and A.N. Glazer 1967. Studies of S.Fujiwara, M. Takagi, H. Atomi and T. Imanaka the Physicochemical and Enzymatic Properties 1999. Gene analysis and enzymatic properties of Papaya Lysozyme, J. Biol. Chem., 242 : 5715- of thermostable b-glycosidase from Pyrococcus 5723. kodakaraensis KODI. J. Biosci. Bioeng.,88:130-135. Huber, R., J. Sto'hr, S. Hohenhaus, R. Rachel, Fenical, W. 1993. Chemical studies of marine S.Burggraf, H.W. Jannasch and K.O. Stetter bacteria : developing a new resource. Chem. 1995. Thermococcus chitonophagus sp. nov., a Rev., 1673-1683. novel, chitin-degrading, hyperthermophilic Flach, J., P.E. Pilet and P. Jolles 1992. Whats new archaeum from a deep-sea hydrothermal vent in chitinase research? Experientia 48 : 701-716. environment. Arch. Microbiol., 164 : 255-264. Friedhelm Meinhardt, Jens Waldeck, Gabriele Hugenholtz, P. and N.R. Pace 1996. Identifying Daum and Bernward Bisping 2006. Isolation microbial diversity in natural environment : a and Molecular Characterization of Chitinase- molecular phylogenetic approach. Trends Deficient Bacillus licheniformis Strains Capable Biotechnol., 14: 190-197. of Deproteinization of Shrimp Shell Waste To Jeuniaux, C. and C. Cornelius 1978. Obtain Highly Viscous Chitin, Applied and Distribution and activity of chitinolytic Environmental Microbiology, p. 7879-7885. enzymes in the digestive tract of birds and Gustafson, K., M. Roman and W. Fenical 1989. mammals; In : Proceedings of the first The microlactins, a novel class of antiviral and international conference on chitin/chitosan. cytotoxic macrolides from deep-sea marine Muzzarelli, R.A.A. and Pariser, E.R. (eds.). MIT bacterium. J. Am. Chem. Soc., 111 : 7519-7524. Sea Grant Report MITSC, USA. pp. 542-549. Han, B.K., W.J. Lee and D.H. Jo 1997a. Keyhani, N.O. and S. Roseman 1996. The chitin Chitinolytic enzymes from the gizzard and the catabolic cascade in the marine bacterium chyme of the broiler (Gallus gallus L.) Vibrio furnissii. Journal of Biological Chemistry, Biotechnol. Lett., 19 : 981-984. 271 : 33414-33424. Han, B.K., W.J. Lee, T. You, I.H. Park and D.H. Jo Kono, M., T. Matsui and C. Shimizu 1987. 1997b. Survey on the chitinolytic activity from Purification and some properties of chitinase some plants for industrial utilization. Agric. from the stomach of red sea bream Pagrus Chem. Biotechnol., 39 : 466-371. major. Nippon Suisan Gakkaishi, 53 : 131-136. Hiraga, K., L. Shou, M. Kitazawa, S. Takahashi, M. Kono, M., T. Matsui, C. Shimizu and D. Koga Shimada, R. Sato and K. Oda 1997. Isolation 1990. Purification and some properties of and characterization of chitinase from a ake- chitinase from the stomach of Japanese eel, chitin degrading marine bacterium, Aeromonas Anguilla japonica. Agric. Biol. Chem., 54 : 973- hydrophila H-2330. Bioscience, Biotechnology and 978. Biochemistry 61 : 174-176. Kono, M., T. Matsui and C. Shimizu 1987. hitoshi, S., F. Shizu, Y. Naoko, K. Norioki, N. Chitindecomposing bacteria in digestive tracts Atsuyoshi, M. Einosuke, H. Kazumi, A. Huq, of cultured red sea bream and Japanese eel. E.B.Small, P.A.West, HuqMi, R. Rahman and R.R. Nippon Suisan Gakkaishi, 53 : 131-136. Colwell 1983. Ecological relationships between Kramer, K.J. and S. Muthukrishnan 1992. Insect Vibrio choleare and planktonic crustacean chitinases : molecular biology and potential copepods. Appl. Environ. Microbiol., 45:275-283. use as biopestisides. Insec Biochem. Molec. Biol.,
382 27 : 887-900. cuticles for bio control of Aedes aegypti Kramer, K.J., T.L. hopkins and J. Schaefer 1995. mosquito. Biotechnol. Lett. 18 : 373-376. Applications of solids NMR to the analysis of Miller, G.L. 1959. Use of Dinitrosalicylicacid insect sclerotized structures. Insect Biochem. reagent for determination of reducing sugars. Mol. Biol., 25 : 1067-1080. Anal. Chem., 31 : 426-428. Laemmli, U.K. 1970. Cleavage of structural Morgavi, D.P., M. Sakurda, Y. Tomita and R. proteins during the assembly of the head of Onodera 1994. Presence in rumen bacterial bacteriophage T4. Nature, 227 : 680-685. and Protozoal populations of enzymes capable Liu, M., QX. Cai, H.Z. Liu, B.H. Zhang, J.P. Yan of degrading fungal cell walls. Microbiology, 140 : and Z.M. Yuan 2002. Chitinolytic activities in 631-636. Bacillus thuringiensis and their synergistic Nalin, D.R. 1976. Cholera, copepods, and effects on larvicidal activity. J. Appl. Microbiol., 93 chitinase. Lancet. 2:958. : 374-379. Nalin, D.R., V. Daya, A. Reid, M.M. Levine and Lowry, O.H., N.J. Rosebrough, L.A. Farr and L.Cisneros 1979. Adsorption and growth of R.J.Randall 1951. Protein measurement with Vibrio cholerae on chitin. Infect Immun. 25 : 768- the folin phenol reagent. J. Biol. Chem., 193 : 770. 265-275. Omumasaba, C.A., N. Yoshida, Y. Sekiguchi, K. Masahiro Matsumiya, Y., Yasuyuki ARAKANE, Kariya and K.J. Ogawa 2000. Gen. Appl. Microbiol., Atsunobu HAGA, Subaratnam Muthukrishnan 46 : 19-27. and Karl J. Kramer 2006. Substrate Specificity Ordentlich, A., Y. Elad and I. Chet 1988. The of Chitinases from Two Species of Fish, role of chitinase of Serratia marcescens in Greenling, Hexagrammos otakii, and Common biocontrol of Sclerotium rolfsii. Phytopathology , Mackerel, Scomber japonicus and the Insect, 78 : 84-88. Tobacco Hornworm, Manduca sexta, Biosci. Poulicek, M. and C. Jeuniaux 1982. Biomass and Biotechnol. Biochem., 70(4) : 971-979. biodegradation of mollusk shell chitin in some Mathivanan, N., V. Kabilan and K. Murugesan marine sediments. In : Hirano, S., Tokura, S. 1997. Production of chitinase by Fusarium (eds.). Japanese Society of Chitin and Chitosan, clamydosporum, a mycoparasite to groundnut Tottori, Japan. p. 192-196. rust, Puccinia arachidis, Indian. J. Exp. Biol., 35 : 890-893. Rheinheimer, G. Mikrobiologia wod. PWR i L Warszawa 1987. Matsumiya, M. and A. Mochizuki 1995. Purification and characterization of chitinase Sawyer, W.H., Jr. and C.C. Taylor 1949. The from the stomach of common mackerel effect of shell disease on the gills and chitin of Scomber japonicus. Bull. Coll. Agr. Vet. Med., lobsters (Homarus americanus). Dept. Sea and Nihon Univ. (in Japanese), 52 : 131-136. Shore Fisheries. Augusta Res. Bull., 1 : 10 p. Melent'ev, A.I. and G.E. Aktuganov 1999. Appl. Silo-Suh, L.A., B.J. Lethbridge, S.J. Raffel, H. He, J. Biochem. Microbiol. (Moscow), 35 : 556-560. Clardy and J. Handelsman 1994. Biological activities of two fungistatic antibiotics Mendonsa E.S., P.H. Vartak, J.U. Rao and produced by Bacillus cereus UW85. Appl. Environ. M.V.Deshpande 1996. An enzyme from Microbiol., 60 : 2023-2030. Myrothecium verrucaria that degrades insect Someya, N., S. Numata, M. Nakajima, A. Haseba,
383 T. Hibi and K. Akutsu 2003. Biological control Vaidya, R.J., I.M. Shah, P.R. Vyas and H.S. of rice blast by the epiphytic bacterium Erwinia Chhatpar 2001. Production of chitinase and its annanas transformed with a chitinolytic optimization from a novel isolate Alcaligenes enzyme gene from an antagonistic bacterium, xylosoxydans : potential antifungal biocontrol. Serratia marcescens strain B2. J. Gen. Plant. Pathol., World J. Microbiol. Biotechnol., 17:62-69. 69: 276-282. Van Aalten, D.M.F., B. Synstad, M.B. Brurberg, E. Svitil, A.L., S.M. NoA Chadhain, J.A. Moore and Hough, B.W. Riise, V.G.H. Eijsink and R.K. D.L. Kirchman 1997. Chitin degradation Wierenga 2000. Proc. Natl. Acad. Sci., USA, 97 : proteins produced by the marine bacterium 5842-5847. Vibrio harveyi growing on different forms of Vogan, C.L., C. Costa-Ramos and A.F. Rowley chitin. Applied Environmental Microbiology, 63 : 2001. A histological study of shell disease 408-413. syndrome in the edible crab, Cancer pagurus. Taylor, C.C. 1948. Shell disease as a mortality Dis Aquat Org. 47 : 209-217. factor in the lobster (Homarus americanus). Vyas, P. and M.V. Deshpande 1989. Chitinase Department of sea and shore fisheries, production by Myrothecium verrucaria and its Augusta, Marine Fish. Cinc. 4 : 8 pp. significance for fungal mycelia degradation. J. TADAYUKI IMANAKA, TAKESHI TANAKA, 1 Gen. Appl. Microbiol., 35 : 343-350. SHINSUKE FUJIWARA, 2 SHINGO Vyas, P. and M.V. Deshpande 1991. Enzymatic NISHIKORI, 2 TOSHIAKI FUKUI and hydrolysis of chitin by Myrothecium verrucaria MASAHIRO TAKAGI 1999. A Unique Chitinase chitinase complex and its utilization to with Dual Active Sites and Triple Substrate produce SCP. J. Gen. Appl. Microbiol., 37 :265-275. Binding Sites from the Hyperthermophilic Wang, S.L., I.L. Shih, C.H. Wang, K.C. Tseng, W.T. Archaeon Pyrococcus kodakaraensis KODI, Chang, Y.K. Twu, J.J. Ro and C.L. Wang 2002. Applied and Environmental Microbiology. p. Enzyme Microb. Technol., 31 : 321-328. 5338-5344. Watanabe, T., W. Oyanagi, K. Suzuki and H. Tao Yong, Jin Hong, Long Zhangfu, Ding Tanaka 1990. Chitinase system of Bacillus Xiuqiong, Tao Ke, Ge Shaorong, Liu Shigui 2005. circulans WL-12 and importance of chitinase A Purification and characterization of an 1 in chitin degradation. J. Bacteriol., 172: 4017- extracellular chitinase produced by bacterium 4022. C4. Annals of Microbiology, 55(3) : 213-218. Watanabe, T., K. Kimura, T. Sumiya, N. Nikaidou, Terayama, H., S. Takahashi and H.C. Kuzuhara K. Suzuku, M. Suzuki, M. Taiyoji, S. Ferrer and M. 1989. Large-scale preparation of N. '' - Regue 1997. J. Bacteriol., 179 : 7111-7117. diacetylchitobiose by enzymatic degradation of chitin and its chemical modification. J. Carbohyd. Wen, C.M., C.S. Tseng, C.Y. Chen and Y.K. Li Chem., 12 : 81-93. 2002. Purification, characterization and cloning of a chitinases from Bacillus sp. NCTU2. Thanmthiankul, S., S. Suan-Ngay, S. Biotechnol. Appl. Biochem., 35 : 213-219. Tantimavanich and W. Panbangred 2001. Chitinase from Bacillus thuringiensis subsp. Woo, C.J. and H.D. Park 2003. An extracellular Pakistani. Appl. Microb. Biotechnol., 56 : 395-401. Bacillus sp. chitinase for the production of chitotriose as a major chitinolytic product. Tharanathan, R.N. and F.S. Kittur 2003. Crit. Rev. Biotechnol Lett. 25 : 409-412. Food Sci., 43 : 61-87.
384 Wiwat, C., S. Thaithanum, S. Pantuwatana and Zobell, C.E. and S.C. Rittenberg 1937. The A.Bhumiratana 2000. Toxicity of chitinase - occurrence and characteristics of producing Bacillus thuringiensis spp. kurstaki chitinoclastic bacteria in the sea. J. Bacteriol., 35 HD-1 (G) toward Plutella xylostella. J. Invertebr. : 275-287. Pathol., 76 : 270-277.
385
For further details contact : Chief Conservator of Forests & Trust Director Gulf of Mannar Biosphere Reserve Trust Jawan Bhavan Building (1st Floor) 102/26, Devipattinam Road, Kenikarai Ramanathapuram - 623 504, Tamilnadu, India Ph. : 04567 - 226335 Fax : 04567 - 229228 E-mail : [email protected] Web. : www.gombrt.org