Proc. Natl. Acad. Sci. USA Vol. 89, pp. 2091-2095, March 1992 Developmental Biology Activation of the cytotactin promoter by the homeobox-containing gene Evx-1 (morphogenesis/extracellular matrix/phorbol 12-O-tetradecanoate 13-acetate response element/homeodomain/growth factors) FREDERICK S. JONES*, GEORGES CHALEPAKISt, PETER GRUSSt, AND GERALD M. EDELMAN* *Laboratory of Developmental and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10021; and tDepartment of Molecular Cell Biology, Max Planck Institute of Biophysical Chemistry, 3400 Gottingen, Federal Republic of Germany Contributed by Gerald M. Edelman, December 17, 1991

ABSTRACT Cytotactin is a morphoregulatory molecule of during development in place-dependent patterns that corre- the extracellular matrix affecting cell shape, division, and spond to morphologically significant boundaries (3-6). Cy- migration that appears in a characteristic and complex site- totactin has been shown to affect a variety of processes restricted pattern during embryogenesis. The promoter region including cell spreading or rounding, adhesion and repulsion, of the gene that encodes chicken cytotactin contains a variety and neurite retraction; it can also modulate mitogenesis (4, of potential regulatory sequences. These include putative bind- 7-14). The multifunctionality ofthe molecule may reside in its ing sites for homeodomain proteins and a phorbol 12-0- modular structure (10, 15-19) that contains many indepen- tetradecanoate 13-acetate response element (TRE)/AP-1 ele- dent binding domains. A key question is how the site- ment, a potential target for transcription factors thought to be restricted expression ofcytotactin is genetically controlled in involved in growth-factor signal transduction. To determine a fashion sufficient to assure normal morphogenesis. Ho- the effects of homeobox-containing genes on cytotactin pro- meobox-containing genes appear to be excellent candidates moter activity, we conducted a series of cotransfection exper- for the control of such morphoregulatory molecules, given iments on NIH 3T3 cells using cytotactin promoter- the evidence that they affect neighborhood-specific develop- chloramphenicol acetyltransferase (CAT) reporter gene con- mental patterns in various embryonic axes (20-24). We have structs and plasmids driving the expression ofmouse homeobox described (25) modulation of the expression of N-CAM, the genes Evx-1 and Hox-1.3. Cotransfection withEvx-1 stimulated neural cell adhesion molecule, by Hox genes. The presence cytotactin promoter activity whereas cotransfection in control of sequence motifs resembling homeodomain binding sites in experiments with Hox-1.3 had no effect. To localize the se- the 5' flanking sequence of the cytotactin gene prompted us quences required for Evx-1 activation, we tested a series of to examine cytotactin in a similar fashion. deletions in the cytotactin promoter. An 89-base-pair region We report here that Evx-J, a mouse homeobox gene most containing a consensus TRE/AP-1 element was found to be related to the pair-rule gene even-skipped (eve) from Dro- required for activation. An oligonucleotide segment containing sophila melanogaster (26), induces the expression in NIH this TRE/AP-1 site was found to confer Evx-l inducibility on 3T3 cells of a chloramphenicol acetyltransferase (CAT) re- a simian virus 40 minimal promoter; mutation of the porter gene driven by the chicken cytotactin promoter. TRE/AP-1 site abolished this activity. To explore the potential Deletion analysis performed on the cytotactin promoter role of growth factors in cytotactin promoter activation, region localized the sequences that contributed to the acti- chicken embryo fibroblasts, which are known to synthesize vation to an 89-base-pair (bp) segment containing a phorbol cytotactin, were frnst transfected with cytotactin promoter 12-O-tetradecanoate 13-acetate response element (TRE)/ constructs and cultured under minimal conditions in 1% fetal AP-1 element. This control element has been shown to be a bovine serum. Although the cells exhibited only low levels of target for transcription factors encoded by the fos and jun CAT activity under these conditions, cells exposed for 12 h to gene families (27-29). Mutation of the TRE/AP-1 sequence 10% (vol/vol) fetal bovine serum showed a marked increase in abolished the ability of Evx-J to activate the promoter. The CAT activity. Cotransfection with Evx-1 and cytotactin pro- TRE/AP-1 element was also required to drive expression of moter constructs of cells cultured in 1% fetal bovine serum was the CAT reporter gene in chicken embryo fibroblasts, cells sufficient, however, to produce high levels of CAT activity. known to synthesize cytotactin. Furthermore, transfection These findings are consistent with the hypothesis that Evx-1, a with Evx-J obviated the requirement for the higher concen- homeobox-containing gene, may activate the cytotactin pro- tration of serum otherwise necessary to activate cytotactin moter by a mechanism involving a growth-factor signal trans- promoter constructs containing the TRE/AP-1 site. duction pathway. More generally, the results support the These results, along with those obtained with the N-CAM hypothesis that the place-dependent expression of morphoreg- promoter (25), provide support for the hypothesis that the ulatory molecules may depend upon local cues provided by expression ofmorphoregulatory molecules may be controlled homeobox genes and their encoded proteins. by homeobox gene products. In addition, they raise the possibility that the cytotactin promoter modulation by Evx-J During development, metamorphosis, and regeneration, a may involve a growth-factor signal transduction pathway. number of different morphoregulatory molecules mediating cell and substrate adhesion and junction formation are ex- pressed in defined sequences (1). These molecules act to MATERIALS AND METHODS regulate primary cellular processes such as movement, divi- CAT gene reporter plasmids were constructed in BSCAT, a sion, and cell-cell communication in a place-dependent fash- Bluescript vector (Stratagene) containing a 1.8-kilobase CAT ion (2). A remarkable example of such a molecule is cyto- gene, and also in commercially available pCAT-Basic and tactin/tenascin, an extracellular matrix protein that appears pCAT-Promoter vectors (Promega). Restriction fragments

The publication costs of this article were defrayed in part by page charge Abbreviations: CAT, chloramphenicol acetyltransferase; SV40, sim- payment. This article must therefore be hereby marked "advertisement" ian virus 40; CMV, cytomegalovirus; TRE, phorbol 12-0- in accordance with 18 U.S.C. §1734 solely to indicate this fact. tetradecanoate 13-acetate response element. 2091 Downloaded by guest on September 30, 2021 2092 Developmental Biology: Jones et al. Proc. Natl. Acad. Sci. USA 89 (1992) 1 2 3 4 5 6 7 8 9 10 11 12 Mouse homeobox genes Evx-J and Hox-1.3 were inserted into cytomegalovirus (CMV) and 83-actin promoter vectors, respectively. In cotransfection experiments, these plasmids, designated CMV-Evx-1 and fBA-Hox-1.3, were used as pro- S.0*.. 0 ducers ofthe homeodomain proteins in situ. Test DNAs were -* f transfected into cells with Bluescript carrier DNA, as de- scribed (25). NIH 3T3 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10%o (vol/vol) * @[email protected]. calf serum. Chicken embryo fibroblasts were prepared from 11-day body walls as described (31). Transfectants were harvested 36-72 h after transfection and assayed for CAT activity. Cells were cotransfected with 5 jg of RSV-f3- galactosidase plasmid DNA and extracts were normalized for FIG. 1. Activation of cytotactin promoter activity in NIH 3T3 internal fB-galactosidase activity as described (25). DNase I cells after cotransfection with Evx-1. NIH 3T3 cells were cotrans- footprinting was performed using the fushi tarazu (ftz) ho- fected with 10 ,ug of reporter gene plasmid and with various amounts meodomain protein as described (32). of homeobox gene expression plasmids. Cells were harvested 72 h after transfection and assayed for CAT activity. Reporter plasmids for cotransfections were added as follows: CTP7-CAT (lanes 1-9), RESULTS BSCAT (lanes 10 and 11), and SV40 promoter/enhancer-BSCAT (lane 12). Homeobox gene expression plasmids were transfected in Activation of the Cytotactin Promoter by Evx-1. To test the following concentrations. CMV-Evx-1, 1 jg (lane 2), 2 ,ug (lane whether Evx-1 or Hox-1.3 genes could affect the activity of 3), 5 ,ug (lane 4), and 10 ,ug (lanes 5 and 10); ,BA-Hox-1.3, 1 ,ug (lane the cytotactin promoter, NIH 3T3 cells were cotransfected 6), 2 ,ug (lane 7), 5 ug (lane 8), and 10 ,ug (lanes 9 and 11). with the cytotactin promoter-CAT reporter gene plasmid CTP7-CAT and either the CMV-Evx-l or the /BA-Hox-1.3 from the 5' end and upstream flanking region of the chicken expression plasmids and were then assayed for CAT activity. cytotactin gene that were used to prepare reporter constructs Cells transfected with CMV-Evx-l had significant CAT ac- were derived from plasmids as described (30). Reporter tivity driven by the cytotactin promoter (Fig. 1, compare constructs were designated according to the cytotactin pro- lanes 2-5 to lane 1) but controls transfected with Hox-1.3 moter segments used; the numbers in parentheses refer to showed no detectable CAT activity (Fig. 1, compare lanes positions either upstream (-) or downstream (+) from the 6-9 to lane 1). site of transcription initiation. Reporters used in this study Analysis ofthe Cis Sequences Required forEvx-1 Activation. (-3986 to +374), CTP12-CAT To define further the regions of the cytotactin promoter that were as follows: CTP7-CAT were critical for Evx-1 activation, cytotactin promoter dele- (-1477 to -201), CTP4-CAT (-1312 to +270), CTP3-CAT tion constructs (Fig. 2) were tested for their ability to be (-936 to +121), CTP2-CAT (-289 to +374), and CTP14- activated by CMV-Evx-l after cotransfection in NIH 3T3 CAT (-201 to +121). In addition, one or two copies of a cells. NIH 3T3 cells transfected with each of five cytotactin segment (positions -329 to -263) containing the TRE/AP-1 promoter deletion constructs (CTP12-CAT, CTP4-CAT, site from the cytotactin promoter region were inserted into CTP3-CAT, CTP2-CAT, and CTP14-CAT) showed no de- the pCAT-Promoter vector. These reporters were designated tectable CAT activity (Fig. 3A, lanes 1-5). When cotrans- CT-TRE1-CAT and CT-TRE2-CAT, respectively. Muta- fected with CMV-Evx-1, however, cells showed significant tions were made in the TRE/AP-1 site within this 67-bp CAT activity in four out of the five cytotactin promoter segment. The variant ofthe oligonucleotide was inserted into constructs tested. The CTP12-CAT, CTP4-CAT, CTP3- the pCAT-Promoter vector, giving rise to the reporter CT- CAT, and CTP2-CAT constructs all drove high levels ofCAT TREm-CAT. All oligonucleotides were synthesized, an- activity (Fig. 3B, lanes 1-4, respectively). Cells transfected nealed, and ligated as described (25). with CTP14-CAT (positions -201 to + 121), however,

-1477 -201 -1312 +270 -936 +121 -289 +374 .i -201 +121 Pstl SsU ECoRl Psti Sspl Sphl / Sstl Clal SPI i I

gaTCCTGATAATGCACTCTGCTGATGCTGTAAGGAAAATATTCCTClITTCTGAGTCAT TGCCCTGAG GACTAGGACGTGAGACGACTACGACATTCCTTTTATAAGGAGAAAGACTCAGTAAACGGGACTC cag

TRE/AP-1 FIG. 2. Partial restriction map of the 5' flanking sequence, the first exon (solid box), and part of the first intron of the chicken cytotactin gene. Drawn above the map are five segments of DNA tested in CAT reporter constructs for activation by Evx-1. From top to bottom, they are designated CTP12-CAT, CTP4-CAT, CTP3-CAT, CTP2-CAT, and CTP14-CAT. Map numbers refer to the relative position 5' (-) or 3' (+) ofthe transcriptional start site. An open box drawn below the map demarcates the 67-bp segment of DNA (positions -329 to -263) from which oligonucleotides were made. DNA sequence of the region is shown highlighting the TRE/AP-1 site (shaded box) and mutations made within the site (individual base-pair substitutions are circled). Downloaded by guest on September 30, 2021 Developmental Biology: Jones et al. Proc. Natl. Acad. Sci. USA 89 (1992) 2093 A B 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10

* *.

@,..@ - Evx-1 + Evx-1 FIG. 3. Cis sequences required in the cytotactin gene 5' flanking sequence required for activation by Evx-J. NIH 3T3 cells were transfected with 10 Ag of the following reporter plasmids: CTP12-CAT (lanes 1), CTP4-CAT (lanes 2), CTP3-CAT (lanes 3), CTP2-CAT (lanes 4), CTP14-CAT (lanes 5), CT-TRE1-CAT (lanes 6), CT-TRE2-CAT (lanes 7), CT-TREM-CAT (lanes 8), pCAT-Basic (lanes 9), and pCAT- Promoter (lanes 10). Cells either received no CMV-Evx-1 (A) or were cotransfected with 10 Ag of CMV-Evx-1 (B). Cells were harvested 60 h after transfection and assayed for CAT activity. showed no CAT activity when transfected with CMV-Evx-J for transcriptional regulators encoded by thefos andjun gene (Fig. 3B, lane 5). families (27-29). It mediates responsiveness to a number of These results suggest that cis sequence elements between external stimuli of a battery oftarget genes whose promoters positions -289 and -201 are required for activation of contain this element. These stimuli include growth-factor cytotactin promoter activity by Evx-J. This small segment of signals (33). The patterns of cytotactin/tenascin synthesis DNA was scanned for sequence motifs known to regulate during embryogenesis reflect temporal growth gradients and gene expression in other systems. As shown in Fig. 2, one it appears that local signals secreted by proliferating cells can prominent sequence, a TRE/AP-1 element (27-29) was found induce the synthesis of cytotactin in neighboring cells (3, within the region of positions -289 to -201, centered at 5-7). position -277. An oligonucleotide segment of 67 bp (posi- Although it has been shown that growth factors present in tions -329 to -263 in the cytotactin promoter region) con- serum increase the levels of cytotactin produced by chicken taining the TRE/AP-1 element (Fig. 2) was cloned upstream embryo fibroblasts (16), it is unknown whether serum stimu- of a minimal simian virus 40 (SV40) early promoter and CAT lates transcription of the gene. We therefore tested the ability reporter gene. Plasmids containing one or two copies of this of serum to activate the cytotactin promoter and then exam- sequence (CT-TRE1-CAT and CT-TRE2-CAT) were tested ined whether the TRE/AP-1 element mediated the response. for their ability to confer Evx-J inducibility on an SV40 early minimal promoter. Cells transfected alone with the CT- Cytotactin promoter constructs were transfected into chicken TRE1-CAT and CT-TRE2-CAT constructs showed no de- embryo fibroblasts and either cultured in 1% fetal bovine tectable CAT activity (Fig. 3A, lanes 6 and 7, respectively). serum for 36 h (Fig. 4A) or cultured in medium with 1% fetal However, when cotransfected with CMV-Evx-J, cells exhib- bovine serum for 24 h and then stimulated with 10o fetal ited high levels of CAT activity using either of the CT-TRE- bovine serum for an additional 12 h (Fig. 4B). Transfectants CAT constructs (Fig. 3B, lanes 6 and 7). cultured in 1% fetal bovine serum (Fig. 4A, lanes 1-9) showed To test whether the TRE/AP-1 site was required for low levels of CAT activity. Cells transfected with CTP12- activation by Evx-J, a minimal promoter-CAT gene reporter CAT, CTP4-CAT, CTP3-CAT, CTP2-CAT, and CT-TRE- was constructed containing the 67-bp segment with 4-bp CAT reporter constructs and stimulated with 10%o fetal bovine substitutions in the TRE/AP-1 site (see Fig. 2). Cells trans- serum showed a 5- to 10-fold increase in CAT activity as fected with this plasmid, CT-TREM-CAT, had no detectable compared to cells transfected with the same constructs that CAT activity either without or with cotransfected CMV- were cultured in 1% fetal bovine serum (Fig. 4, compare lanes Evx-J plasmid (Fig. 3 A and B, lanes 8). 1-4 and 6 in B and A). Cells transfected with CTP14-CAT and Stimulation of Cytotactin Promoter Activity by Serum and CT-TREm-CAT (constructs that do not contain the TRE/ by Evx-1 in Chicken Embryo Fibroblasts: Dependence on the AP-1 site) showed no CAT activity above background levels TRE/AP-1 Site. The TRE/AP-1 site is known to be the target when cultured either in 1% fetal bovine serum or when A B C 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9

dboAb gpsqp

.i4 *O 0* 40 a * S a* 0o0 0 o a * o * *.& 4 0

FIG. 4. Serum and Evx-J stimulation of cytotactin promoter activity in chicken embryo fibroblasts. CAT activity assay of extracts from cells transfected with 10 .g of the following constructs: CTP12-CAT (lanes 1), CTP4-CAT (lanes 2), CTP3-CAT (lanes 3), CTP2-CAT (lanes 4), CTP14-CAT (lanes 5), CT-TRE1-CAT (lanes 6), CT-TREM-CAT (lanes 7), pCAT-Basic (lanes 8), and pCAT-Promoter (lanes 9). Cells were cultured in medium with 1% fetal bovine serum for 36 h and harvested (A); cultured in medium with 1% fetal bovine serum for 24 h, switched to medium with 1o fetal bovine serum for another 12 h, and harvested (B); or cotransfected with 10 ,g of CMV-Evx-1, cultured with 1% fetal bovine serum for 36 h, and harvested (C). Downloaded by guest on September 30, 2021 2094 Developmental Biology: Jones et al. Proc. Natl. Acad. Sci. USA 89 (1992) stimulated with 10% fetal bovine serum (Fig. 4 A and B, served with 80 ng of protein. Significantly more protection compare lanes 5 and 7 to lanes 8 and 9). from DNase I cleavage was observed with the upper strand Only those constructs that were driven by cytotactin than with the lower strand. This suggests that more protein- segments that had a TRE/AP-1 element were found to have DNA contacts occur among upper-strand base pairs (Fig. SC) CAT activity (Fig. 4A) or to be inducible by serum (Fig. 4B). than among lower-strand base pairs. The recent resolution of Induction by high doses of serum was not required, however, the homeodomain-DNA complex by two-dimensional NMR when cells were transfected with Evx-1. Thus, chicken em- is in accord with this conclusion (36, 37). Further studies of bryo fibroblasts cotransfected with reporter constructs plus the specific interaction of Evx-J gene product with the CMV-Evx-1 and cultured in 1% fetal bovine serum for 36 h cytotactin promoter should reveal whether these putative (Fig. 4C) produced levels of CAT activity comparable to homeodomain binding sites are involved in a sequence of those from cells that were stimulated with fetal bovine serum events required for activation of the promoter in some cells. (Fig. 4, compare CAT activity levels in C and B). As above, only those reporter constructs that contained the TRE/AP-1 site were activated by Evx-1. These results suggest that the DISCUSSION presence of Evx-J can substitute for high doses of serum and The present experiments indicate that the product of the confirm that responses by the cytotactin promoter are me- mouse homeobox-containing gene Evx-J (26) stimulates diated by the TRE/AP-1 site. chicken cytotactin promoter activity in NIH 3T3 cells. De- An Antennapedia-Type Homeodomain Binds to Cis Se- letion analysis of the promoter region of the cytotactin gene quences Located Upstream of the First Exon of the Cytotactin showed that a small DNA segment of 89 bp (positions -289 Gene. Although activation of the cytotactin promoter in some to -201) contained cis sequences mediating the activation by cells occurs through a TRE/AP-1 element, sequence analysis Evx-1. An oligonucleotide (positions -329 to -263) derived of the 5' flanking region of the chicken cytotactin gene (30) from the cytotactin promoter that contained the TRE/AP-1 has uncovered putative sites for the binding of homeodomain element was found to confer Evx-1 inducibility on a minimal proteins. Two motifs, each having a consensus sequence SV40 promoter. Selective mutation of this TRE/AP-1 site characteristic of antennapedia-type homeodomain binding abolished the ability of the segment from positions -329 to sites (34, 35), appeared to be arranged in tandem at positions -263 to mediate Evx-J induction. -1362 and -1356 bp upstream of the transcription initiation These experiments suggest the hypothesis that activation site (Fig. SC). To test whether these sites could bind homeo- by Evx-J of the cytotactin promoter occurs through the domain proteins, they were assayed for binding to the fushi TRE/AP-1 element by a mechanism involving secondary tarazu homeodomain by DNase I footprinting. As shown in activators; likely candidates include those involved in Fig. 5, the homeodomain protects the tandem homeodomain growth-factor signal transduction. Consistent with this idea, binding sites on both the upper (Fig. 5A) and lower (Fig. 5B) we found that the TRE/AP-1 element at position -277 was strands. Maximal protection and enhancement were ob- essential for CAT gene expression in chicken embryo fibro- blasts, which have been shown (30) to express cytotactin. B Stimulation of these cells with 10% fetal bovine serum 1 2 3 4 1 2 3 4 increased 5- to 10-fold as as ____LAm reporter gene transcription long owl..I_ WI the cytotactin promoter constructs contained the TRE/AP-1 _ -1- with could sub- 64.O. _& __MOV sequence. Cotransfection Evx-J effectively asmo stitute for such serum stimulation. The TRE/AP-1 motif is an element found in the control regions of many viral and cellular promoters. It was originally defined as a site that mediated stimulation oftranscription by AI tumor-promoting phorbol esters through a complex ofprotein factors designated AP-1 (27-29). It is now evident that the TRE/AP-1 element is a binding site for homo- and het- erodimeric complexes of transcription factors that are en- 77"'-I7- coded by thefos andjun gene family (for review, see ref. 29). wi :S _ o Specific combinations of these factors both activate and wow...... <,__ repress expression of target genes (38-42). The transcrip- d.+,, tional response ofparticular genes to growth factors has been found to be mediated by TRE/AP-1 sites present within their control regions (33). It has been proposed that expression of cytotactin during development reflects temporal growth gradients that are an important part of morphogenesis (3-5, 43). Local growth- C I II factor release may be responsible for activating cytotactin TTTTAGTTAGTTCxTCtMM synthesis at specific inductive sites and zones of epithelial- AGACATTSA=CTATATTATTACTG&TTCTm mesenchymal transformations (6) and it has been suggested -1373 -1341 that growth factors elevate levels of cytotactin/tenascin mRNA (16). This suggestion and the results of the present FIG, 5. DNase I footprint analysis of potential homeodomain study are in accord with a number of observations. Interac- binding sites located in the 5' flanking sequence of the chicken tion between peptide growth factors and homeobox genes cytotactin gene with the fushi tarazu (ftz) homeodomain. The upper may act in concert to establish the body axis during embryo- and lower strands__ of tandem sequences designated I and 11(C) were genesis (44-46). Furthermore, homeobox genes themselves analyzed by binding 0 ng (lanes 1), 4 ng (lanes 2), 20 ng (lanes 3), and have been shown to the of factors. 89 ng (lanes 4) offtz homeodomain. (A) Analysis of the upper-strand trigger synthesis growth pattern, on a 300-bp 32P-labeled HindIII-Pvu II fragment from For example, in Drosophila, expression of ultrabithorax CTP12-CAT. (B) Analysis of the lower-strand pattern, on a 310-bp (Ubx) is required for the expression of a gene that encodes a 32P-labeledBamHl-Sac I fragment from CTP12-CAT. + and - signs transforming growth factorfl-like molecule, decapentaplegic indicate enhancement or protection from DNase I cleavage, respec- (dpp) (47). Conversely, growth factors are known to stimulate tively. the synthesis of homeobox gene products; in Xenopus laevis, Downloaded by guest on September 30, 2021 Developmental Biology: Jones et al. Proc. Natl. Acad. Sci. USA 89 (1992) 2095 growth factors induce the expression of a number of ho- 16. Pearson, C. A., Pearson, D., Shibahara, S., Hofsteenge, J. & meobox genes including xhox3, XJHboxJ, and XJHbox6 (45, Chiquet-Ehrismann, R. (1988) EMBO J. 7, 2977-2982. 46). Given these observations, it is an attractive hypothesis 17. Jones, F. S., Hoffman, S., Cunningham, B. A. & Edelman, G. M. (1989) Proc. Natl. Acad. Sci. USA 86, 1905-1909. that Evx-J and other transcription factors localized in precise 18. Gulcher, J. R., Nies, D. E., Marton, L. S. & Stefansson, K. spatial domains within the embryo can mimic or modulate the (1989) Proc. Natl. Acad. Sci. USA 86, 1588-1592. effects of growth factors. 19. Weller, A., Beck, S. & Ekblom, P. (1991) J. Cell Biol. 112, Although it is evident that growth factors and homeobox 355-362. genes act in combination to regulate pattern formation during 20. Graham, A., Papalopulu, N. & Krumlauf, R. (1989) Cell 57, embryogenesis, it is unknown how these molecules actually 367-378. regulate the dynamic cellular processes that shape the ani- 21. Dolle, P. & Deboule, D. (1989) EMBO J. 8, 1507-1515. mal. Results from the present study plus those from the 22. Kessel, M. & Gruss, P. (1990) Science 249, 374-379. accompanying publication (25) suggest that the promoters for 23. Nohno, T., Noji, S., Koyama, G., Ohyama, K., Myokai, F., Kuroiwa, A., Saito, T. & Taniguchi, S. (1991) Cell 64, 1197- the genes encoding morphoregulatory molecules such as 1205. cytotactin and N-CAM are targets for growth-factor signals 24. Yokouchi, T., Sasaki, H. & Kuroiwa, A. (1991) Nature (Lon- and homeoproteins. Moreover, homeobox gene products and don) 353, 443-445. growth factors are but a few of the candidates for regulation 25. Jones, F. S., Prediger, E. A., Bittner, D. A., De Robertis, of the activity of the cytotactin promoter. Recently, we have E. M. & Edelman, G. M. (1991) Proc. Natl. Acad. Sci. USA 89, found that paired box-containing (Pax) genes and glucocor- 2086-2090. ticoids can also influence cytotactin promoter activity (G.C., 26. Bastian, H. & Gruss, P. (1990) EMBO J. 9, 1839-1852. F.S.J., G.M.E., and P.G., unpublished data). Hence, the 27. Lee, W., Haslinger, A., Karin, M. & Tjian, R. (1987) Nature variety of putative control elements found in the cytotactin (London) 325, 326-372. 28. Angel, P., Imagawa, M., Chiu, R., Stein, B., Imbra, R. J., promoter (30) provides a valuable opportunity to study the Rahmsdorf, H. J., Jonat, C., Herrlich, P. & Karin, M. (1987) combinatorial interaction of a number of different factors Cell 49, 729-739. within one transcriptional regulatory system. 29. Curran, T. & Franza, B. R. (1988) Cell 55, 395-397. 30. Jones, F. S., Crossin, K. L., Cunningham, B. A. & Edelman, We are grateful to Jeannette Hyer, David Stein, and Terri Evering G. M. (1990) Proc. Natl. Acad. Sci. USA 87, 6497-6501. for excellent technical assistance. We thank Claude Desplan forftz 31. Hoffman, S., Crossin, K. L. & Edelman, G. M. (1988) J. Cell homeodomain protein, Helge Bastian for the Evx-1 construct, Biol. 106, 519-532. Corinne Lobe for the Hox-1.3 construct, and Esther Harris for 32. Treisman, J., Gonczy, P., Vashishtha, M., Harris, E. & advice and help with footprinting experiments. We thank Joe Gally Desplan, C. (1989) Cell 59, 553-562. for his incisive comments during preparation ofthe manuscript. This 33. Ryseck, R. P., Macdonald-Bravo, H., Mattei, M. G., Ruppert, work was supported by U.S. Public Health Service Grants HD09653 S. & Bravo, R. (1989) EMBO J. 8, 3327-3335. and DK04256 to G.M.E. 34. Muller, M., Affloter, M., Leupin, W., Otting, G., Wuthrich, K. & Gehring, W. J. (1988) EMBO J. 7, 4299-4304. 1. Edelman, G. M., Cunningham, B. A. & Thiery, J. P., eds. 35. Awgulewitsch, A., Bieberich, C., Bogarad, L., Shashikant, C. (1990) Morphoregulatory Molecules (Wiley, New York). & Ruddle, F. H. (1990) Proc. Nail. Acad. Sci. USA 87, 2. Edelman, G. M. (1988) Topobiology: An Introduction to Mo- 6428-6432. lecular Embryology (Basic Books, New York). 36. Otting, G., Qian, Y. Q., Billeter, M., Muller, M., Affolter, M., 3. Crossin, K. L., Hoffman, S., Grumet, M., Thiery, J.-P. & Gehring, W. J. & Wuthrich, K. (1990) EMBO J. 9, 3085-3092. Edelman, G. M. (1986) J. Cell Biol. 102, 1917-1930. 37. Kissinger, C. R., Liu, B., Martin-Blanco, E., Kornberg, T. B. 4. Tan, S.-S., Crossin, K. L., Hoffman, S. & Edelman, G. M. & Pabo, C. 0. (1990) Cell 63, 579-590. (1987) Proc. Natl. Acad. Sci. USA 84, 7977-7981. 38. Bohmann, D., Keller, W., Dale, T., Scholer, H. R., Tebb, G. 5. Mackie, E. J., Tucker, R. P., Halfter, W., Chiquet-Ehrismann, & Mattaj, I. W. (1987) Nature (London) 325, 268-272. R. & Epperlein, H. H. (1988) Development 102, 237-250. 39. Franza, B. R., Jr., Rauscher, F. J., III, Josephs, S. F. & 6. Prieto, A. L., Jones, F. S., Cunningham, B. A., Crossin, K. L. Curran, T. (1988) Science 239, 1150-1153. & Edelman, G. M. (1990) J. Cell Biol. 111, 685-698. 40. Rauscher, F. J., III, Sambucetti, L. C., Curran, T., Distel, 7. Chiquet-Ehrismann, R., Mackie, E. J., Pearson, C. A. & R. J. & Spiegelman, B. M. (1988) Cell 52, 471-480. Sakakura, T. (1986) Cell 47, 131-139. 41. Angel, P., Allegretto, E. A., Okino, S. T., Hattori, K., Boyle, 8. Friedlander, D. R., Hoffman, S. & Edelman, G. M. (1988) J. W. J., Hunter, T. & Karin, M. (1988) Nature (London) 332, Cell Biol. 107, 2329-2340. 166-171. 9. Halfter, W., Chiquet-Ehrismann, R. & Tucker, R. P. (1989) 42. Sassone-Corsi, P., Lamph, W. W., Kamps, M. & Verma, I. M. Dev. Biol. 132, 14-25. (1988) Cell 54, 553-560. 10. Spring, J., Beck, K. & Chiquet-Ehrismann, R. (1989) Cell 59, 43. Tan, S. S., Prieto, A. L., Newgreen, D. F., Crossin, K. L. & 325-334. Edelman, G. M. (1991) Proc. Natl. Acad. Sci. USA 88, 6398- 11. Faissner, A. & Kruse, J. (1990) Neuron 5, 627-637. 6402. 12. Wehrle, B. & Chiquet, M. (1990) Development 110, 401-415. 44. Ruiz i Altaba, A. & Melton, D. A. (1989) Nature (London) 341, 13. Grierson, J. P., Petroski, R. E., Ling, D. S. F. & Geller, H. M. 33-38. (1990) Dev. Brain Res. 55, 11-19. 45. Cho, K. W. Y. & De Robertis, E. M. (1990) Genes Dev. 4, 14. Crossin, K. L. (1991) Proc. Natl. Acad. Sci. USA 88, 11403- 1910-1917. 11407. 46. Cho, K. W. Y., Morita, E. A., Wright, C. V. E. & De Rober- 15. Jones, F. S., Burgoon, M. P., Hoffman, S., Crossin, K. L., tis, E. M. (1989) Cell 57, 367-378. Cunningham, B. A. & Edelman, G. M. (1988) Proc. Natl. 47. Reuter, R., Panganiban, G. E. F., Hoffman, F. M. & Scott, Acad. Sci. USA 85, 2186-2190. M. P. (1990) Development 110, 1031-1040. Downloaded by guest on September 30, 2021