Proc. Nati. Acad. Sci. USA Vol. 88, pp. 4548-4552, May 1991 Population Biology Distinguishing African and European honeybee matrilines using amplified mitochondrial DNA (polymerase chain reaction/restriction fragment length polymorphism/maternal gene flow) H. GLENN HALL* AND DEBORAH R. SMITHt *Department of Entomology and Nematology, 0740 Institute of Food and Agricultural Sciences, University of Florida, Gainesville, FL 32611; and tMuseum of Zoology, Insect Division and Laboratory for Molecular Systematics, University of Michigan, Ann Arbor, MI 48109 Communicated by Charles D. Michener, February 19, 1991 (received for review December 14, 1990)

ABSTRACT Previous DNA studies have revealed that feral African population represents hybrids with European feral neotropical African bees have largely retained an African bees has not been well documented and remains controver- genetic integrity. Additional DNA testing is needed to confirm sial. these findings, to understand the processes responsible, and to Resolution of questions surrounding the African bee has follow African bee spread into the temperate United States. To been hindered by a paucity of genetic markers that can facilitate surveys, the polymerase chain reaction was utilized. distinguish the honeybee subspecies (see discussion in refs. African and European honeybee mitochondrial DNA (mtDNA) 13 and 14). Subtle morphometric traits are primarily used to was identified through ampled segments that carry informa- identify African bees (15) and have been claimed as evidence tive restriction site and length polymorphisms. The ability to for some African-European hybridization (16). However, the discriminate among honeybee subspecies was established by morphometric parameters are subject to environmental ef- testing a total of 129 colonies from Africa and Europe. Matri- fects, and their genetic basis is undefined (17). African bee line identities could thus be determined for imported New introgression has been followed with some of the few allo- World bees. Among 41 managed and feral colonies in the zymes available that show significant frequency differences United States and north Mexico, two European lineages (west among honeybee subspecies (18, 19). and east) were distinguished. From neotropical regions, 72 Recently, DNA polymorphisms have been effective in feral colonies had African mtDNA and 4 had European revealing processes involved in African bee spread. Two mtDNA. The results support earlier conclusions that neotrop- independent studies using mitochondrial DNA (mtDNA) ical African bees have spread as unbroken African maternal demonstrated that the feral neotropical African population is lineages. Old and New World African honeybee populations comprised of unbroken African maternal lineages spreading exhibit different frequencies of a mtDNA length polymor- as swarms (19, 20). Findings with nuclear DNA markers point phism. Through standard analyses, a north African mtDNA to asymmetric paternal gene flow in favor of the African type that may have been imported previously from Spain or genotype (21). Feral African matrilines exhibit little hybrid- Portugal was not detected among neotropical African bees. ization with European drones, whereas European matrilines become strongly Africanized by mating with feral African Since their introduction from South Africa to Brazil 34 years drones. Despite such Africanization, the maternal contribu- ago (1), African honeybees (Apis mellifera scutellata; ref. 2) tion from European apiaries to the expandingferal population have spread through most of tropical America (3) and have has been negligible (19-21). These findings have contradicted recently moved into Texas. Over the next several years, the views that paternal introgression is primarily responsible for bees are expected to colonize the southern United States African bee spread and that the neotropical population rep- (4-6). Because of their defensive stinging and other undesir- resents a "hybrid swarm" (22, 23). able characteristics, African bees will adversely affect the The temporal sequence of introgression and establishment United States beekeeping industry. Consequently, consider- ofthe African population needs to be systematically studied, able economic damage is expected to segments ofagriculture and a more complete view of African-European hybridiza- dependent upon commercial honeybee pollination (6-8). tion in different regions needs to be established. As African The processes by which African bees have come to dom- bees approach temperate environments ofthe United States, inate in the neotropics are poorly understood, but their believed to be of greater advantage to European bees, a success apparently reflects phenomenal differences in eco- hybrid zone between the two may be formed (5-7). DNA logical adaptation among honeybee subspecies (7, 9). A analyses will be increasingly needed to follow African pater- number of European races, Apis mellifera mellifera, iberica, nal and maternal gene flow, to determine genotype frequen- ligustica, carnica, caucasia (2), have been repeatedly intro- cies, and to recognize linkage disequilibrium patterns. Such duced to the Americas (10-12). Early Spanish and Portu- information may reveal the nature ofselective processes (24). guese settlers may have also brought Apis mellifera inter- DNA markers will also be needed for control measures: to missa that had introgressed from north Africa into the Iberian reliably identify African bees and to certify European stock peninsula. Swarms that escaped from the imported European (13, 14, 25). colonies established feral populations in temperate regions. Standard DNA restriction fragment analyses are not suited However, self-sustaining feral honeybee populations were for rapid testing of large numbers of samples, but new established in the neotropics only after the introduction and technical advances greatly facilitate such analyses. With the spread ofthe African A. m. scutellata. The European bees in asymmetries observed in levels of hybridization between neotropical apiaries have been largely replaced by African- African and European matrilines, use of nuclear and mtDNA ized progeny resulting from paternal introgression from feral together will continue to be important, and simplification of African colonies (3, 4, 6). However, the extent to which the the tests for both is needed. In realizing part of that goal, we have employed the polymerase chain reaction (PCR) (26) for more identification of mtDNA. The publication costs of this article were defrayed in part by page charge rapid subspecies-specific payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: IsRNA, large ribosomal; CO, cytochrome c oxidase. 4548 Downloaded by guest on September 28, 2021 Population Biology: Hall and Smith Proc. Natl. Acad. Sci. USA 88 (1991) 4549 mtDNA restriction site and length polymorphisms identify Two regions ofthe east European honeybee mitochondrial three lineages of honeybee subspecies: an east European genome have been sequenced: the lsRNA subunit gene (31) group including A. m. ligustica, carnica, and caucasia, a and the CO-I and CO-II subunit genes including several west European group consisting of A. m. mellifera and flanking tRNA genes and the intervening leucine tRNA gene iberica with mellifera-like mtDNA (predominantly from (32). From the sequenced regions, oligonucleotide primers northern Spain), and an African group including South Af- were synthesized (by the University of Florida Interdiscipli- rican A. m. scutellata and A. m. capensis and north African nary Center for Biotechnology Research core facility) that intermissa and iberica with intermissa-like mtDNA (predom- enabled amplification ofthree polymorphic segments through inantly from southern Spain) (19, 20, 27-30). An EcoRI site the PCR. Fig. 1 shows the primers and locations of the in the large ribosomal (lsRNA) subunit gene and an Xba I site informative restriction sites. The PCR was performed as in the cytochrome c oxidase I (CO-I) subunit gene are found described (26) except that reaction volumes were 25 ,ul and only in bees of the east European group, and a HincII site in Taq polymerase (BRL) was at 2x concentration (1 unit). the CO-I subunit gene is found only in bees of the west About 1 ,ug of total cellular DNA in 2 A1l was added to the European group. Length polymorphisms between the CO-I reaction mixture. The reaction profile was 95°C for 1 min, and CO-II subunit genes are found in the mtDNA of west followed by 35 cycles of 94°C for 1 min, 50°C for 2 min, 72°C European and African bees. The EcoRI polymorphism in the for 3 min, and a final 72°C for 20 min using an MJ Research lsRNA subunit gene was among several others used in the (Cambridge, MA) thermal controller. two (19, 20). Ten-microliter aliquots of PCR mixture were digested with previous studies of neotropical bees either EcoRI, HincII, orXba I (BRL). Taking the PCR buffer This report presents information, obtained by the PCR and into consideration, an equal volume of solution was added by standard methods, about the mtDNA composition of consisting of 1 x the recommended buffer for the respective several Old and New World honeybee populations. The data enzymes, an additional 50 mM NaCl (only for EcoRI) and 10 provide significant additional evidence that the neotropical mM MgCI2, and 25 ,ug of bovine serum albumin, 2 mM African population is derived from unbroken A. m. scutellata dithiothreitol, and 3-5 units of enzyme. The total digestion matrilines. volume was loaded into 2.5% agarose gels, electrophoresed with TAE buffer under standard conditions, and stained with METHODS AND MATERUILS ethidium bromide (33). As a source of mtDNA template for the PCR, total DNA was prepared from larvae, pupae, or adults as described (21). The RESULTS AND DISCUSSION adult preparations required treatment with pancreatic RNase With the PCR method, testing of many samples was greatly (0.1 x volume of a 10 mg/ml stock) to allow PCR amplifica- facilitated, and the mtDNA composition of several Old and tion. Linear cellular DNA (nuclear DNA, nicked and linear- New World populations was determined. These data are ized mtDNA) was also obtained from adults by another summarized in Table 1. Fig. 2 shows the polymorphic frag- procedure (27-29). Analysis ofrestriction fragment polymor- ment patterns from Old World samples, which clearly dis- phisms in isolated mtDNA was as described (27-29). criminate among the east European, west European, and

FIG. 1. Diagrams of three regions of honeybee mtDNA amplified by PCR showing the primers used, their Large Ribosomal Subunit orientation, and the positions of the informative restriction sites (5' -+ 3'). 113 595 850 Sequences for the lsRNA subunit (31) 13 and for the CO-I and CO-II subunits 5' TFITGTACC1TITGTATCAGGGTTG 3. GAATTC ...... 3' CCCTGCTATTCTGGG/ kTATC 5' (32) came from east European 251 mtDNA. The numbered positions 483 above the sequences correspond to Eco RI those in the original sequence data. Uncut size = 738 Below the sequences are given the amplified segment sizes (in base pairs) and the double-stranded frag- Cytochrome C Oxidase Subunit l ment sizes resulting from restriction 372 1146 1415 enzyme cleavage. In the lsRNA re- gion, the EcoRI site is present only in east European bees and is part of the 3'...... GAT ...... 3' GTTATCCACGTCATAAjACGT 5' 5' TTMGATCCCCAGGATCATG GTT known sequence. In the CO-I region, |777 GTPyPuAC 267 the HincIlI site is present only in west Hinc II European bees; its location was Uncut size = 1044 mapped by standard restriction frag- ment analysis (29). The correspond- ing site in east European bees differs Inter- Cytochrome C Oxidase Subunits I and ll by one nucleotide from the HincII 2401 recognition site. In the inter-CO-I/ 1554 1748 2401 CO-II amplified region, within the CO-I an Xba I is T gene, site present 5' TCTATACCACGACGTTATTC 3'...... TCTAGA. 3' CCAGTAGTTACTATAA(CTAG 5 only in east European races and is 649 part of the known sequence. All west 195 1 European and African bees lack this Xba I site and one of inserts Uncut size = 848 4 carry several with inserts = -918 insert size = -70 that increase the length of this ampli- -1118 -270 fied segment (located between the po- -1388 -540 sition of the Xba I site and the right -1658 -810 side primer as indicated by arrow). Downloaded by guest on September 28, 2021 4550 Population Biology: Hall and Smith Proc. Natl. Acad. Sci. USA 88 (1991) Table 1. Summary of honeybee colonies tested and mtDNA types determined by polymorphisms in the amplified regions mtDNA type nTotaol East West European African Location Subspecies colonies European 70 270 540 70 270 540 810 Old World Italy A. m. ligustica 18 18 Austria, Yugoslavia A. m. carnica 14 14 Russia A. m. caucasia 2 2 France, Denmark, Norway, Sweden A. m. mellifera 11 1 9 1 Spain A. m. iberica/mellifera 17 1 13 3 A. m. iberica/intermissa 11 8 3 South Africa A. m. scutellata 52 9 35 6 2 A. m. capensis 4 1 3 New World United States and northern Mexico* Managed 30t 28 1 1 Feral 11 4 3 4 Central and southern Mexico 58t 3 1 32 17 5 Honduras 11 9 1 1 Costa Rica 6 3 3 Venezuela 19 11 8 The east European, west European, and African groups are distinguished by the restriction site polymorphisms summarized in the text. The west European and African groups are further separated according to the inter-CO-I/CO-II length polymorphisms (given in base pairs). All central and southern Mexican samples were feral swarms sampled within a few weeks oftheir capture. All Central and South American samples came from managed colonies established from swarms 2-6 months before sampling. *Just south of the Texas border, still unoccupied by African bees. tTwenty were from a closed breeding population tested previously (20). tEighteen were feral swarms tested previously (20). 1 2 3 4 5 6 7 8 9 10 African subspecies. Fig. 3 shows the characteristic polymor- phisms among New World samples, which identify their maternal ancestry, most importantly, as African or European. The inter-CO-I/CO-Il length polymorphisms are seen in the amplified DNA as well as in restriction digests of the entire mtDNA molecule (Fig. 4 shows a Bc! I digest). In west European and African subspecies, this region is approxi- mately 70, 270, 540, or 810 bp larger than the corresponding region of east European bees. The 70-bp and 810-bp insert sizes were recognized or discovered in this study. Different frequencies of the length classes were found among popula- tions (Table 1). In west European A. m. mellifera and iberica/mellifera, the 270-bp insert was most common, and the 70-bp insert was rare. In the Spanish A. m. iberical intermissa the 70-bp insert was most common, but the 11 III. (A) The 738-base-pair (bp) amplified region, within the lsRNA subunit gene, digested with EcoRI. Only the two east European types in lanes 1 and 2 are cleaved, yielding a 483-bp and a 251-bp fragment. (B) The 1044-bp amplified region, within the CO-I subunit gene, digested with HincII. Only the two west European types in lanes 5 and 6 are cleaved, yielding a 777-bp and a 267-bp fragment. (C) The inter-CO-I/CO-Il amplified region showing length polymorphisms. The east European types in lanes 1 and 2 have the shortest segment (848 bp) lacking inserts. The amplified segments from the A. m. iberica/intermissa samples in lanes 3 and 4 are approximately 70 bp larger (918 bp total). The west European samples in lanes 5 and 6 have amplified segments of about 1118 bp and 1388 bp, respectively (270-bp and 540-bp inserts). The South African samples in lanes 7-10 have amplified segments of about 918 bp, 1118 bp, 1388 bp, and 1658 bp, respectively (insert sizes of 70 bp, 270 bp, 510 bp, and 810 bp). The amount of the amplified product is reduced as the insert size increases. (D) The inter-CO-I/CO-Il amplified region digested with Xba I. Only the 848-bp segment of the two east European types in lanes 1 and 2 is cleaved, yielding a 195-bp and a 649-bp fiagment. In samples carrying the larger inserts within the inter-CO-I/CO-Il region, faint bands correspond to the smaller fragments found in FIG. 2. Samples ofmtDNA from Old World honeybee subspecies other size classes. The cause of this is not certain, but it is not due amplified by PCR and digested with discriminating restriction en- to cross-contamination. The different size classes probably arise zymes. Lane 1, A. m. ligustica from Italy; lane 2, A. m. caucasia from tandem duplications that are suspected to cause an artifact in from Russia; lanes 3 and 4, A. m. iberica/intermissa from southern the PCR. Uncompleted fragments generated in the reaction could Spain; lanes 5 and 6, A. m. mellifera from France; lanes 7-10, A. m. reanneal at the tandem sequences, eliminating one or more of the scutellata from South Africa. The same colony samples are in each duplications. These would serve as primers to form shorter products panel. Size standards in outer lanes: phage 4X174 digested with Hae that, in turn, would function as templates in subsequent cycles. Downloaded by guest on September 28, 2021 Population Biology: Hall and Smith Proc. Natl. Acad. Sci. USA 88 (1991) 4551

1 2 3 4 5 6 7 8 9 10 12 3 4

FIG. 4. End-labeled Bcl I di- gests of honeybee mtDNA show- ing four size classes. Lane 1, A. * ~m. scutellata with additional 540 *e bp relative to A. m. ligustica (lane 4); lane 2, A. m. scutellata with additional 270 bp; lane 3, A. m. scutellata with additional 70 bp; lane 4, A. m. ligustica with small- est size class with no inserts. Size standard: A bacteriophage di- gested with HindlIll; 1% agarose gel. Among United States colonies, the east European mtDNA type was predominant, which reflected the preferred use of Italian and Carniolan bees (A. m. ligustica and carnica) for commercial beekeeping (10-12). The first honeybees brought to the Americas by early European settlers were of the west European group (10-12), and persisting mtDNA of this type was found in a minor proportion of managed colonies. Inter- estingly, west European mtDNA was found in a greater proportion offeral colonies (7 of 11 colonies from Arizona and northern Mexico tested here by the PCR method and 10 of 12 FIG. 3. mtDNA of New World honeybees identified using PCR colonies from Arizona tested by standard restriction fragment and diagnostic restriction and length polymorphisms as described in analysis; D.R.S. and 0. R. Taylor, unpublished results). the legend to Fig. 2. Lanes 1-5, managed colonies from Tucson, The results obtained by PCR identification of neotropical Arizona (United States). Lanes 6-10, colonies established from feral honeybee mtDNA further strengthen the conclusions of the swarms in Honduras. The same colony samples are in each panel. earlier studies: African honeybees have migrated as unbro- The sizes of the fragments are given in Figs. 1 and 2. Size standards ken maternal lineages and there has been little European in outer lanes: phage 4X174 digested with Hae III. (A) Amplified maternal gene flow into the feral African population (19, 20). region, within lsRNA subunit gene, digested with EcoRI. This region An additional 76 neotropical colonies were analyzed, almost from United States samples in lanes 1, 2, and 5 is cleaved, charac- as many as in both previous studies together (85 colonies). teristic of east European subspecies. (B) Amplified region, within These included later collections at the same locations CO-I subunit gene, digested with HincII. This region from United (Ven- States samples in lanes 3 and 4 is cleaved, characteristic of west ezuela and Tapachula and Las Choapas, Mexico) and at European subspecies. (C) Inter-CO-I/CO-II amplified region show- several additional locations (within Costa Rica, Honduras, ing length polymorphisms. The United States samples in lanes 1, 2, and near Veracruz, Mexico). Of the new samples, only four and 5 have the shortest segment, lacking inserts, characteristic of were found to carry European mtDNA (three with the east east European subspecies. The United States samples in lanes 3 and type and one with the west type). All came from near 4 and the Honduran samples in lanes 8 and 9 carry 270-bp or 540-bp Veracruz, in east-central Mexico, within 14 months after Afri- inserts. The Honduran samples in lanes 6, 7, and 10 carry 70-bp can bees first moved into the area. At the time the samples were inserts (compare slight shift in size between lanes S and 6). The length collected, this region still supported large populations of man- polymorphisms are characteristic of west European and African subspecies, but their mtDNA is distinguished by the HincIl site in the aged European bees. European mtDNA was not found in the CO-I region (B). (D) Inter-CO-I/CO-II amplified region digested with more established African honeybee populations. Xba I. This region in United States samples in lanes 1, 2, and 5 is Honeybees of the Iberian peninsula (A. m. iberica) carry cleaved, characteristic of east European subspecies. one of two mtDNA types: those ofA. m. mellifera and A. m. intermissa, the latter apparently due to infiltration from north Africa the African mtDNA in neo- colonies tested were not a sufficient number to draw strong (30). Therefore, present tropical populations could include A. m. iberica/intermissa conclusions about the mtDNA class frequencies. Among mtDNA imported previously by early Spanish and Portu- South African A. m. scutellata (obtained from five widely guese colonists. The amplified regions of the mitochondrial separated locations in the Transvaal) and A. m. capensis, the genome do not contain known polymorphisms that distin- short 70-bp class was found in 18% of the colonies (n = 56). guish the A. m. iberica/intermissa mtDNA from that ofA. m. However, among neotropical African colonies, which had scutellata. However, an unmapped polymorphic Hinfl frag- been imported from South Africa, the 70-bp class was found ment does distinguish between the two (30). Of 38 Mexican, in 62% of the colonies (n = 90). The discrepancy may reflect 10 Venezuelan, and 9 Brazilian colonies with African drift due to a founder effect or population expansion. To mtDNA, all had the scutellata type, not the intermissa type establish the frequency ofthe mtDNA length polymorphisms (some shown in Fig. 5). Thus, it appears unlikely that a among neotropical African colonies, feral Mexican swarms colony, identified as neotropical African on the basis of the tested previously (20) were included in the PCR screening. polymorphisms utilized here, would have come from an early Downloaded by guest on September 28, 2021 4552 Population Biology: Hall and Smith Proc. Nad. Acad Sci. USA 88 (1991)

-1 2 3 4 5 2 .:3 4 5 6 9101 ;. c.3 I 4..57 B -.0

FIG. 5. End-labeled Hinfl di- gests of honeybee mtDNA. (A) Old World samples. Lane 1, A. m. mell#era; lane 2, A. m. ligustica; lot-*,t. .-:: i . a . t .0 0, . t;, lane 3, A. m. carnica; lane 4, A. 't .f m. iberica with intermissa-like in1. mtDNA; lane 5, A. m. scutellata. * e A African bees from . l (B) Neotropical ..: Ifll.IFI" Mexico and Venezuela (lanes ,I l|'i i ,,: *1-13) compared withA. m. iberica &v :: :* ;1.g .4 t l *e with intermissa-like mtDNA Qane

:1 i.* 1 s;.: 14) and A. m. scutellata(ane 15). ssE ~Note that, in the samples in A and I B, the A. m. scutellata have a i i j r 4 E ;',, .:.' fragment not present in A. m. in- M.. .-< termissa (arrowheads). The neo- tropical African samples also have this standard: A | i,32 i*, fragment. z.l bacteriophageSizedigested with |.:tit. s ~~~HindIII. introduction of intermissa and not from the more recent 2. Ruttner, F. (1988)Biogeography and Taxonomy ofHoney Bees (Springer, Berlin). introduction ofscutellata. Nevertheless, it would be remark- 3. Michener, C. D. (1975) Annu. Rev. Entomol. 2S, 399-416. able if, after scutellata invasion, the more closely related 4. Taylor, 0. R. (1977) Bee World58, 19-30. intermissa were found to be the only previously imported 5. Taylor, 0. R. & Spivak, M. (1984) Bee World 65, 38-47. 6. Taylor, 0. R. (1985) Bull. Entomol. Soc. Am. 31, 14-24. mtDNA to persist to any significant extent. Making the 7. Taylor, 0. R. (1968) in Africanized Honey Bees and Bee Mites, eds. distinguishing Hinfl site testable by the more rapid PCR Needham, G. R., Page, R. E., Deffinado-Baker, M. & Bowman, C. E. (Horwood, Chichester, U.K.), pp. 29-41. would increase the likelihood of finding rare persisting inter- 8. McDowell, R. (1984) The Africanized Honey Bee in the United States: missa mtDNA in the Americas, if it exists. What Will Happen to the U.S. Beekeeping Industry? (U.S. Dept. of As the remainder of the mitochondrial sequence is deter- Agric., Washington), Agric. Econ. Rep. No. 519. 9. Rinderer, T. E. (1988) in Africanized Honey Bees and Bee Mites, eds. mined and the other distinguishing polymorphisms are Needham, G. R., Page, R. E., Delfinado-Baker, M. & Bowman, C. E. mapped, these will become incorporated into the PCR proto- (Horwood, Chichester, U.K.), pp. 13-28. col. Other investigators have recently amplified another hon- 10. Pellett, F. C. (1938) History ofAmerican Beekeeping (Collegiate, Ames, IA). eybee mtDNA region (34) carrying the polymorphic Bgl II site 11. Oertel, E. (1976) Am. Bee J. 116, 70, 71, 114, 128, 156, 157, 214, 215, 260, used in one of the previous studies of neotropical bees (20). 261, 290. The PCR identification of mtDNA will enable regulatory 12. Sheppard, W. S. (1989) Am. Bee J. 129, 617-619, 664-667. 13. Hall, H. G. (1986) Proc. Natl. Acad. Sci. USA 83, 4874-4877. efforts to be most effective by concentrating on African 14. Hall, H. G. (1988) in Africanized Honey Bees and Bee Mites, eds. maternal lineages that serve as the source offeral populations. Needham, G. R., Page, R. E., Delfinado-Baker, M. & Bowman, C. E. Nuclear markers made PCR in the future will (Horwood, Chichester, U.K.), pp. 287-293. analyzable by 15. Daly, H. V. & Balling, S. S. (1978) J. Kan. Entomol. Soc. 51, 857-869. facilitate the identification of Africanized bees, that is, the 16. Buco, S. M., Rinderer, T. E., Sylvester, H. A., Collins, A. M., Lan- progeny of paternal introgression. Mitochondria and various caster, V. A. & Crewe, R. M. (1987) Apidologie 18, 217-222. nuclear to interactions and different selective 17. Daly, H. V. (1988) in Africanized Honey Bees and Bee Mites, eds. markers, subject Needham, G. R., Page, R. E., Delfmado-Baker, M. & Bowman, C. E. influences, may reveal independent or coordinated introgres- (Horwood, Chichester, U.K.), pp. 245-249. sive behavior into temperate climates. PCR identification of 18. Lobo, J. A., Del Lama, M. A. & Mestriner, M. A. (1989) Evolution 43, specific nuclear DNA alleles, along with that of mtDNA, 794-802. 19. Smith, D. R., Taylor, 0. R. & Brown, W. M. (1989) Nature (London) would greatly enhance the ability to recognize and study such 339, 213-215. processes. 20. Hall, H. G. & Muralidharan, K. (1989) Nature (London) 339, 211-213. 21. Hall, H. G. (1990) Genetics 125, 611-621. We thank the beekeepers of the United States, Europe, and South 22. Rinderer, T. E., Hellmich, R. L., Danka, R. G. & Collins, A. M. (1985) Africa, who allowed us to collect from their apiaries, and the follow- Science 228, 1119-1121. ing, who helped provide honeybee samples: R. Crewe, G. Pretorius, 23. Rinderer, T. E. (1986) Bull. Entomol. Soc. Am. 32, 222-227. 24. Barton, N. H. & Hewitt, G. M. (1989) Nature (London) 341, 497-503. B. Buys (South Africa), B. Vaissiere, J.-M. Cornuet (France), A. 25. Page, R. E. & Erickson, E. H. (1985) Ann. Entomol. Soc. Am. 78, Quero, F. Padilla, F. Puerta (Spain), G. Zuccoli, M. Vecchi, G. Serini 149-158. (Italy), F. Ruttner, H. Pechhacker (Austria), N. Koeniger, G. Koeni- 26. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., ger (Germany), A. Hagen (Norway), I. Fries, T. Kronestedt (Swe- Horn, G. T., Mullis, K. B. & Erlich, H. A. (1988) Science 239,487-491. den), S. Toft, B. Stoklund (Denmark), F. Brizuela, J. A. Gutierrez 27. Smith, D. R. & Brown, W. M. (1988) Experientia 44, 257-260. 28. Smith, D. R. (1988) in Africanized Honey Bees and Bee Mites, eds. (Mexico), H. Arce (Costa Rica), A. Suazo (Honduras), 0. Taylor, M. Needham, G. R., Page, R. E., Delfinado-Baker, M. & Bowman, C. E. Spivak, W. Van der Put, J. Villa, R. Hellmich, T. Rinderer, G. Waller, (Horwood, Chichester, U.K.), pp. 303-312. E. Erickson, A. Collins, W. Rubink (United States), and members of 29. Smith, D. R. & Brown, W. M. (1990)Ann. Entomol. Soc. Am. 63,81-88. Secretarfa de Agricultura y Recursos Hidradlicos (Mexico). We are 30. Smith, D. R., Palopoli, M. F., Taylor, B. R., Garnery, L., Cornuet, particularly grateful to 0. R. Taylor and W. M. Brown for continued J.-M., Solignac, M. & Brown, W. M. (1991) J. Hered., in press. 31. Vlasak, I., Burgschwaiger, S. & Kreil, G. (1987) NucleicAcidsRes. 15, 2388. generous assistance. This work was supported by a United States 32. Crozier, R. H., Crozier, Y. C. & MacKinlay, A. G. (1989) Mol. Biol. Department of Agriculture Competitive Research Grant and a gift Evol. 6, 399-411. from the Florida State Beekeepers Association to H.G.H. and a 33. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular Cloning: A National Science Foundation Grant to D.R.S. This paper is Florida Laboratory Manual (Cold Spring Harbor Lab., Cold Spring Harbor, NY), Agricultural Experiment Station Journal Ser. No. R-00960. 2nd Ed. 34. Crozier, Y. C., Koulianos, S. & Crozier, R. H. (1991) Experientia, in 1. Kerr, W. E. (1967) S. Afr. Bee J. 39, 3-5. press. Downloaded by guest on September 28, 2021