ANTICANCER RESEARCH 32: 4833-4842 (2012)

Suppression of Cell Invasion and Migration by Propofol Are Involved in Down-regulating Matrix Metalloproteinase-2 and p38 MAPK Signaling in A549 Human Lung Adenocarcinoma Epithelial Cells

KING-CHUEN WU1, SU-TSO YANG2,3, TE-CHUN HSIA4, JAI-SING YANG5, SHANG-MING CHIOU6, CHI-CHENG LU7, RICK SAI-CHUEN WU8* and JING-GUNG CHUNG9,10*

1Department of Anesthesiology, E-DA Hospital/I-Shou University, Kaohsiung, Taiwan, R.O.C.; Departments of 2Radiology, 4Internal Medicine, and 8Anesthesiology, 6Department of Functional Neurosurgery and Gamma Knife Center, China Medical University Hospital, Taichung, Taiwan, R.O.C.; 3School of Chinese Medicine, and Departments of 5Pharmacology, 9Biological Science and Technology, China Medical University, Taichung, Taiwan, R.O.C.; 7Department of Life Sciences, National Chung Hsing University, Taichung, Taiwan, R.O.C.; 10Department of Biotechnology, Asia University, Taichung, Taiwan, R.O.C.

Abstract. Metastasis is a major cause of death of patients also showed that propofol inhibited the mRNA gene expression with malignant tumors. Matrix metalloproteinases (MMPs) are of MMP-2, -7 and -9, and enhanced that of tissue inhibitor of important for the migration and invasion of various types of metalloproteinase 1 (TIMP1) and TIMP2 in A549 cells. Taken cancer cell. Propofol is a known anesthetic agent, widely used together, these data show that propofol inhibits MMP-2 and -9 for short-term anesthesia and for longer-term sedation. mRNA and protein expressions, resulting in suppression of lung Propofol inhibits the proliferation of a variety of tumor cells, cancer cell invasion and migration in vitro. but there is no available information regarding propofol- inhibited migration and invasion of tumor cells in vitro. In this Lung cancer remains the most common fatal malignancy in study, we investigated the effects of propofol on the migration the Western world (1-3) and is one of the leading causes of and invasion of human lung carcinoma A549 cells. Wound death worldwide (4). Based on the 2011 report from the healing assay and Boyden chamber assays indicated that Department of Health, R.O.C. (Taiwan), approximately 26 propofol inhibited the migration and invasion of A549 cells in people per 100,000 die annually from lung cancer in Taiwan. vitro. Gelatin zymographic analysis showed the inhibitory effect Patients with lung cancer commonly present with advanced of propofol on the activation of expression MMP-2. Western metastatic disease that if untreated leads to a mean survival of blot analysis also indicated that propofol suppressed the 4-5 months and 1-year survival rate of less than 10% (4, 5). protein expiration of growth factor receptor-bound protein 2 The invasive and metastatic capacity of tumor cells plays an (GRB2), Jun N-terminal kinases 1/2 (p-JNK1/2), p-p38, MMP- important role in malignant tumor development (6, 7). It is well 2 and MMP-9 in A549 cells. Results from real-time PCR assay known that metastasis occurs through a series of sequential steps for cancer cells to invade adjacent tissues, intravasation, transport through the circulatory system, arrest at a secondary *Both Authors contributed equally to this work. site, extravasations, and growth in a secondary organ (8). The most important steps in tumor metastasis are directly correlated Correspondence to: Dr. Jing-Gung Chung, Department of with cell adhesion and detachment (1) and there are both Biological Science and Technology, China Medical University. No regulated by cell-cell and cell-extracellular matrix (ECM) 91, Hsueh-Shih Road, Taichung 40402, Taiwan, R.O.C. E-mail: interactions which coordinate the invasive mechanism (9). [email protected], and Dr. Rick Sai-Chuen Wu, Currently, the treatment of lung cancer includes Department of Anesthesiology, China Medical University Hospital. chemotherapy and radiotherapy, but the survival is still very No 2, Yude Road, Taichung 40447, Taiwan, R.O.C. E-mail: [email protected] poor when the disease is diagnosed at an advanced stage and better treatments are desperately needed. Much evidence Key Words: Propofol, invasion, migration, human lung adenocarcinoma indicates that new targets in cancer cells associated with epithelial A549 cells, MMP-2, p38 MAPK. metastasis are needed.

0250-7005/2012 $2.00+.40 4833 ANTICANCER RESEARCH 32: 4833-4842 (2012)

Figure 1. Propofol affects the percentage of viable A549 cells. Cells Figure 2. Propofol inhibits the adhesion of A549 cells. Cells were were placed in F12K medium + 10% fetal bovine serum (FBS) and exposed to 25, 50 and 100 μg/ml of propofol for 24 and 48 h, and PBS treated with 0, 15, 20 and 25 μg/ml of propofol for 24 and 48 h. The as control sample (Ctl). The adhesion assay was performed on 24-well cells from each treatment were collected and analyzed for cell viability plates coated with collagen for 2-h incubation as described in the by flow cytometry as described in the Materials and Methods. Each Materials and Methods. The results are presented as the percentage of point is the mean±S.D. of three experiments. the vehicle-treated control (Ctl). Each bar represents the mean±SD of three independent experiments. *p<0.05, statistically significant when compared with the untreated control.

Propofol (2,6-di-isopropylphenol) is a sedative and migration and invasion of human lung cancer cells has not anesthetic agent, widely used in the intensive care units for been systematically evaluated or reported. Therefore, the short-term anesthesia and for longer-term sedation (10). present study investigated whether propofol inhibits Propofol is also being used with increasing frequency for migration and invasion of human lung cancer A549 cells. pediatric and obstetric procedures requiring anesthesia or sedation. It was reported that propofol interacts with both γ- Materials and Methods aminobutyric acid (GABAA) receptors and N-methyl-D- aspartate (NMDA) glutamate receptors (11, 12) and mediated Materials and reagents. Propofol was obtained from B. Braun the activation of GABAA receptors and the inhibition of Melsungen AG (Schwarzenberger Weg, Melsungen, Germany). NMDA receptors; both receptors are involved in the alterations Stock solution of propofol was prepared in phosphate buffered saline (PBS), and an equal volume of PBS (0.1%) was added to the in calcium fluxes through slow calcium ion channels (13). controls. Propidium iodide (PI), crystal violet, Tween-20, Propofol has been shown to possess antioxidant properties formaldehyde and β-Actin were purchased from Sigma-Aldrich both in vitro (14-17) and in vivo (18), and has the capability Corp. (St. Louis, MO, USA). F12K medium, L-glutamine, fetal to scavenge hydrogen peroxide (H2O2) (19), to reduce the bovine serum (FBS), penicillin-streptomycin and trypsin-EDTA formation of lipid peroxides (20) and the expression of nitric were obtained from Invitrogen Life Technologies (Carlsbad, CA, oxide synthase (21), and to stabilize the mitochondrial USA). Anti-MMP-9 (Cat. AB19016), Millicell Hanging Cell Culture membrane (22). When propofol was administered together Inserts (Cat. PIEP12R48) and Immobilon-P transfer membrane (Cat. IPVH00010) were brought from Merck Millipore Corp. (Billerica, with ketamine to infant mice, it caused neurodegeneration MA, USA). Primary antibodies to growth factor receptor-bound and subsequent neurocognitive disturbances (23). protein 2 (GRB2), phosphorylated c-Jun N-terminal kinases (p- Furthermore, many reports have shown that propofol JNK1/2), p-p38, matrix metalloproteinase-2 (MMP-2), MMP-9 and attenuated reperfusion injury in the cerebral cortex (24), β-actin, and secondary antibodies were purchased from Santa Cruz kidney (25), cerebral parenchymal arterioles (26) and Biotechnology, Inc. (Santa Cruz, CA, USA) and diluted in PBS intestinal mucosa (27). It has been reported that propofol can Tween-20 before use. Matrigel was obtained from BD Biosciences induce apoptosis of human leukemia HL-60 cells (28) and (Franklin Lakes, NJ, USA). murine leukemia RAW264.7 cells (29). A previous study Cell culture. Human lung carcinoma cell line (A549) was purchased demonstrated that propofol suppresses the invasion and from the Food Industry Research and Development Institute metastatic actions of tumor cells through modulating Rho A (Hsinchu, Taiwan, R.O.C.). Cells were placed onto 75 cm2 tissue signaling and that it exhibits an anti-invasive effect in vivo culture flasks and maintained in F12K medium supplemented with (30). However, the ability of propofol by itself to inhibit 10% FBS, 100 units/ml penicillin, 100 ng/ml streptomycin and

4834 Wu et al: Propofol Inhibits Migration and Invasion of A549 Cells

Figure 3. Propofol affects the motility and migration of A549 cells. Cells were exposed to 15, 20 and 25 μg/ml of propofol for 12 and 24 h. Cell migration was examined by wound healing assay (A) and the migrated cells were quantitied (B) as described in the Materials and Methods. Each point is the mean±S.D. of three experiments. *p<0.05, statistically significant when compared with the untreated control.

2 mM L-glutamine, and grown at 37˚C under 5% CO2 and 95% air Boyden chamber assay for migration assay. The chemotactic humidified at one atmosphere (31). directional migration assay was used for the measurements of migration of A549 cells (37, 38). Briefly, a 24-well Transwell with Determination of percentage of viable cells by PI extrusion. A549 8 μM pore filter (Merck Millipore, corp.) were coated with 30 μg cells at a density of 2×105 cells/well were placed in 12-well type Ι collagen (Merck Millipore) for 1 h. A549 cells (1×104 plates and treated with 0, 15, 20 and 25 μg/ml of propofol for 24 cells/0.4 ml) in F12K medium were placed in the upper chamber and 48 h, respectively. Cells were harvested, stained with PI (4 and treated with PBS (as a control) and with propofol (15, 20 and μg/ml) and then immediately analyzed by flow cytometry 25 μg/ml) before undergoing migration for 0, 12 and 24 h. Non- (FACSCalibur; BD Biosciences, San Jose, CA, USA) as migrated cells were removed from the upper chamber by using a previously described (32, 33). cotton swab and the filter from each treatment was individually stained with 2% crystal violet in 2% ethanol after fixing with 3.8% Cell adhesion assay. A549 cells at a density of 2×105 cells/well were formaldehyde in PBS. Migrated cells adhering to the underside of placed in 12-well plates and then exposed to propofol at final the filter were examined, photographed and counted using a light concentrations of 0, 25, 50 and 100 μg/ml for 24 and 48 h. Cells were microscope at ×200 magnification. Each treatment including the then harvested and seeded for 2 h onto 24-well plates which were control condition was assayed twice and three independent coated with 150 μl type I collagen (10 μg/ml) (Merck Millipore, experiments were performed as previously described (36, 38). corp.) overnight. At the end of incubation, non-adherent cells were removed and washed with PBS, and adherent cells were fixed in 70% Boyden chamber assay for invasion assay. Matrigel-coated transwell ethanol for 15 min. Cells were stained with 0.2% crystal violet for 10 cell culture chambers (insets of 8 μm pore size, Merck Millipore, min, and fixed cells were lysed in 0.2% Triton X-100 for 30 min. The corp.) were used for the measurements of invasion of A549 cells as lysed solution (150 μl) was added to each well of the 96-well ELISA previously described (35, 36). A549 cells were cultured for 24 h in plates, and then the absorbance at 540 nm was measured as serum-free-F12 medium, collected and re-suspended in serum-free previously described (34, 35). medium. A549 cells (1×104 cells/well) were placed in the upper chamber of the transwell insert and treated with PBS (as a control) Wound healing assay. A549 cells at a density of 1×106 cells/well or propofol (15, 20 and 25 μg/ml). F12K medium containing 10% were placed in 6-well plates for 24 h to form a confluent FBS was placed in the lower chamber. All samples were incubated monolayer and then cells were wounded with a 200-μl pipette tip. for 24 and 48 h at 37˚C in a humidified atmosphere with 95% air All cells in each well were treated with or without 15, 20 and 25 and 5% CO2. In the upper chamber, the non-invasive cells were μg/ml of propofol for 12 and 24 h. At the end of incubation, cells removed by using a cotton swab and the invasive cells were fixed in each well were photographed under phase-contrast microscopy. with 3.8% formaldehyde in PBS and stained with 2% crystal violet The cell-free area of each treatment in the well was measured as in 2% ethanol. Invasive cells on the lower surface of the filter which previously described (36, 37). Cell migration was calculated as the penetrated through the Matrigel then were counted and percentage of the remaining cell-free area compared with the area photographed using a light microscope at ×200 magnification as of the initial wound. previously described (36, 38).

4835 ANTICANCER RESEARCH 32: 4833-4842 (2012)

Figure 4. Continued

Gelatin zymography assay. A549 cells at a density of 2×105 Western blotting analysis. A549 cells at a density of 2×106 cells/well cells/well were placed in 12-well plates and then were incubated in were placed in 6-well plates and then were incubated with or without serum-free F12K medium in the presence or absence of 15, 20 and propofol (15, 20 and 25 μg/ml) for 24 and 48 h. Cells were collected 25 μg/ml of propofol for 24 and 48 h. The conditioned medium was from each treatment and were re-suspended in PRO-PREP™ protein then collected and proteins were separated by electrophoresis on extraction solution (iNtRON Biotechnology, Seongnam, Gyeonggi-Do, 10% SDS-PAGE containing 0.18% gelatin (Sigma-Aldrich Corp.). Korea) to extract the total protein fraction. Each sample was centrifuged After electrophoresis, the gels were soaked in 2.5% Triton X-100 in at 13,000 ×g for 10 min at 4˚C to remove cell debris and for collecting ddH2O twice for a total of 60 min at 25˚C, and then were incubated the supernatant. Bio-Rad protein assay kit (Hercules, CA, USA) using in substrate buffer (50 mM Tris base, 0.2 M NaCl, 5 mM CaCl2 and bovine serum albumin (BSA) as the standard was used to measure the 0.02% Brij 35 in distilled water, pH 8.0) at 37˚C for 24 h. Bands total protein from each treatment (32, 36). Protein abundance of GRB2, corresponding to activity of MMP-2 were visualized by negative p-JNK1/2, p-p38, MMP-2 and MMP-9 were measured by sodium staining using 0.3% Coomassie blue (Sigma-Aldrich Corp.) in 50% dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and methanol and 10% acetic acid as previously described (35, 38). western blotting as previously described (32, 33, 39).

4836 Wu et al: Propofol Inhibits Migration and Invasion of A549 Cells

Figure 4. Propofol influences migration and invasion of A549 cells. Cells were treated with or without 15, 20 and 25 μg/ml of propofol for 24 and 48 h. A, B: Cell migration was examined by the Boyden chamber assay and type Ι collagen-coated transwell. C, D: Cell invasion was examined by using Matrigel-coated transwell cell culture chambers. Ability of migration (B) and invasion (D) of A549 cells were quantified by counting the number of cells that migrated or invaded the underside of the porous polycarbonate membrane under a phase-contrast microscope. Data represent the average of three experiments. *p<0.05, statistically significant when compared with the untreated control (Ctl).

Real-time PCR assay. A549 cells (2×106 cells/well) maintained in 6- forward and reverse primers for each gene as shown in Table I. Each well plates were maintained with or without 25 μg/ml propofol for assay was run on an Applied Biosystems 7300 Real-time PCR system 12 and 24 h. The total RNA from each treatment was extracted by in triplicates and expression fold-changes were derived using the using the Qiagen RNeasy Mini Kit (Qiagen, inc, Valencia, CA, USA) comparative threshold cycles (CT) method (38, 41). as previously described (32, 40). RNA samples from each treatment were then individually reverse-transcribed with High Capacity cDNA Statistical analysis. All data are presented as means±S.D. of three Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA, USA). experiments. Statistical comparisons were performed using the Quantitative PCR from each sample was carried out for amplifications Student’s t-test and differences were between propofol-treated and using 2× SYBR Green PCR Master Mix (Applied Biosystems) and control groups considered significant at a p-value of less than 0.05

4837 ANTICANCER RESEARCH 32: 4833-4842 (2012)

Figure 5. Propofol alters matrix metalloproteinase-2 (MMP-2) enzyme activity in A549 cells. Cells (2×106 cells/well) were incubated with 0, 15, 20 and 25 μg/ml of propofol for 24 and 48 h. The supernatant was harvested after treatment and protein separated by gelatin zymography as described in the Materials and Methods. The MMP-2 activity was quantitied using ImageJ software.

Figure 7. Propofol affects on matrix metalloproteinase-2 (MMP-2), MMP-7, MMP-9, tissue inhibitor of metalloproteinases 1 (TIMP1) and TIMP2 mRNA expression in A549 cells. The total RNA was extracted from A549 cells treated with propofol (20 and 40 μg/ml) for 12 and 24 h, and RNA samples were reverse-transcribed for real-time PCR as described in the Materials and Methods. The ratios of MMP-2, MMP-7 MMP-9, TIMP1 and TIMP2 mRNA expression to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) are presented. Data represent the mean±S.D. of three experiments. *p<0.05 significantly different from the untreated control.

percentage of viable A549 cells was reduced in cells treated with up to 25 μg/ml of propofol when compared to the untreated control group. These results indicated that propofol Figure 6. Propofol affects the level of proteins associated with migration did not significantly reduce the percentage of viable A549 6 and invasion of A549 cells. Cells (1×10 cells/well) were treated with cells at the examined concentrations. 15, 20 and 25 μg/ml of propofol for 24 and 48 h. The total proteins were collected and the levels of growth factor receptor-bound protein 2 (GRB2), phospho-c-jun N-terminal kinase 1/2 (p-JNK1/2), p-p38, matrix Propofol inhibits the adhesion of A549 cells. Cells were metalloproteinase-2 (MMP-2) and matrix metalloproteinase-9 (MMP- harvested and assayed for cell adhesion and the results are 9) were examined by sodium dodecyl sulfate polyacrylamide gel shown in Figure 2. A significant inhibitory effect on cell electrophoresis (SDS-PAGE) and western blotting as described in the adhesion was observed in propofol-treated A549 cells at the Materials and Methods. Direct reprobing with anti-β-actin antibody was used as an internal control. concentration of 25, 50 and 100 μg/ml for 24 and 48 h exposure when compared with the untreated (control) cells. Importantly, these inhibitory effects of propofol on A549 cells are not due to a cytotoxic effect of propofol because the Results viability of these cells was barely affected by propofol at the examined concentration range. Propofol affects the percentage of viable A549 cells. After A549 cells were treated with different concentrations of Propofol affects the motility and migration of A549 cells. The propofol for 24 and 48, cells were collected for PI staining to wound closure assay was used to examine the effects of measure the cell viability. As shown in Figure 1, the propofol on migration of A549 cells and the results are shown

4838 Wu et al: Propofol Inhibits Migration and Invasion of A549 Cells

Figure 8. Schematic presentation of the mechanism of propofol-suppressed migration and invasion in A549 human lung adenocarcinoma epithelial cells.

Table I. The DNA sequence was evaluated using the Primer Express the migration inhibition was 28-37% and 54-77% when cells software and each assay was run on an Applied Biosystems 7300 Real- were incubated with propofol for 24 and 48 h, respectively. time PCR system. The invasion assay indicated that A549 cells moved from the upper chamber to the lower chamber in the absence of Primer name Primer sequence propofol (control group). However, the penetration of the homo MMP-2-F CCCCAGACAGGTGATCTTGAC EHS-coated filter by A549 cells was inhibited in the homo MMP-2-R GCTTGCGAGGGAAGAAGTTG presence of propofol. The percentage inhibition at 15-25 homo MMP-7-F GGATGGTAGCAGTCTAGGGATTAACT μg/ml was 75-99% and 53-89% (Figure 4D) when cells were homo MMP-7-R AGGTTGGATACATCACTGCATTAGG incubated with propofol for 24 and 48 h, respectively. homo MMP-9-F CGCTGGGCTTAGATCATTCC homo MMP-9-R AGGTTGGATACATCACTGCATTAGG Importantly, the inhibitory effects of propofol on the homo TIMP1-R GGGCCAAAGCGGTCAGT migration and invasion of A549 cells are not due to a homo TIMP1-R TTGAACATCTTTATCTGCTTGATCTCA cytotoxic effect of propofol. homo TIMP2-R TGTTTATCCATCCCCTGCAAA homo TIMP2-R CAAGGTGACGGGACTGGAA Propofol reduces MMP-2 enzyme activity in A549 cells. It is well homo GAPDH-F ACACCCACTCCTCCACCTTT homo GAPDH-R TAGCCAAATTCGTTGTCATACC documented that MMP-2 plays an important role in the invasion of cancer cells (42, 43). Thus, we examined whether propofol Each assay was conducted at least thrice to ensure reproducibility. inhibits the secretion of MMP-2 in A549 cells. Cells were GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MMP, matrix exposed to propofol (0, 15, 20 and 25 μg/ml) for 24 and 48 h, metalloproteinase; TIMP, tissue inhibitor of metalloproteinase. and then the conditioned medium was harvested for examining the MMP-2 activity using gelatin zymography. As shown in Figure 5, propofol inhibited MMP-2 activity in A549 cells. in Figure 3A, which indicates that relative wound closure in Propofol alters the levels of proteins associated with control cells, was higher than in the propofol-treated cells. migration and invasion in A549 cells. To examine whether Figure 3B indicates that the inhibition rates were 28% and or not propofol inhibits the migration and invasion of A549 65% when cells were incubated with propofol at 20 and 25 cells through the inhibition of associated proteins, we μg/ml for 24 h, respectively. These effects indicated that examined the effects of propofol using western blotting. Our propofol inhibited cell migration in a dose-dependent manner. results presented in Figure 6, showed that propofol reduced the protein levels of GRB2, p-JNK1/2, p-p38, MMP-2 and Propofol influences migration and invasion of A549 cells. MMP-9 in A549 cells, which may lead to the inhibition of The effects of propofol on migration and invasion of A549 migration and invasion of A549 cells in vitro. cells in vitro were investigated by using Boyden chamber assay and the results are shown in Figure 4. Propofol had a Propofol reduces the mRNA expression of MMP-2, MMP-7 significant inhibitory effect on cell migration at and MMP-9, and increases that of TIMP1 and TIMP2 in concentrations between 15-25 μg/ml. Figure 4B shows that A549 cells. It is well known that MMPs and tissue inhibitor

4839 ANTICANCER RESEARCH 32: 4833-4842 (2012) of metalloproteinases (TIMPs) play a critical role in tumor and activator protein-1 (AP-1) (52, 53). Several reports have invasion and metastasis (43-45). A549 cells were treated with indicated that activation of PKC can cause translocation of propofol (25 μg/ml) for 12 and 24 h and then cells were the protein to membranes affecting the expression of MMP- harvested for isolation of total RNA to examine MMP-2, 9 via modulation of transcription factors such as NF-κB MMP-7, MMP-9, TIMP1 and TIMP2 mRNA expression by through the MAPK and PI3K signaling pathways. Propofol real-time PCR. Results are shown in Figure 7. The mRNA inhibited the PKC activity, such as JNK and p38 (Figure 6). expression levels of MMP-2, MMP-7 and MMP-9 were Therefore, the downstream regulation of MAPK (p38 and reduced by propofol after a 24-h treatment. However, JNK) pathway, may be involved in the propofol-suppressed propofol increased the mRNA levels of TIMP1 and TIMP2 MMP-2 and -9 expression and invasion of A549 cells. in propofol-treated A549 cells. However, we did not demonstrate any significant MMP-9 activity in the A549 lung cancer cell line, suggesting a more Discussion important role for MMP-2 in this model. Moreover, propofol up-regulated the levels of TIMP1 and TIMP2 in A549 cells In this study, we investigated the inhibitory effects of (Figure 6). propofol on the migration and invasion of human lung cancer In conclusion, our findings suggest that propofol has multiple A549 cells in vitro. Several studies have shown that propofol anti-metastatic activities in A549 cells. The possible signaling induced cytotoxic effects in human leukemia HL-60 cells pathways of propofol-inhibited migration and invasion in A549 (28) and murine leukemia cells (29). However, there is no cells may be via blocking MMP-2 and -9 mRNA expressions, information on how propofol affects migration and invasion leading to in inhibition of MMP-2 and MMP-9 and stimulation of cancer cells. Herein, we demonstrated that propofol of TIMP1 and TIMP2, as summarized in Figure 8. significantly inhibited the migration and invasion of human lung cancer A549 cells and inhibited the MMP-2 activity at Acknowledgements low concentrations (15-25 μg/ml). Multiple molecular mechanisms regulate invasion and This work was supported by the grant CMU100-ASIA-4 from China migration of cancer cells. The interaction of cancer cells with Medical University, Taichung, Taiwan. the ECM is essential for metastasis which is the principal References cause of death of cancer patients (46). MMPs are involved in tumor angiogenesis, metastasis and stimulation of growth 1 Hodkinson PS and Sethi T: Advances in the prevention and factor release from the ECM (44). Increased expression of treatment of lung cancer. J R Coll Physicians Edinb 41: 142-149, MMPs is involved in tumor invasion and metastasis (47). 2011. Inhibition of MMP expression or MMP activity have been 2 Soria JC, Kim ES, Fayette J, Lantuejoul S, Deutsch E and Hong recognized as early targets in preventing cancer metastasis WK: Chemoprevention of lung cancer. Lancet Oncol 4: 659-669, (43-45). Both MMP-2 and -9 are the key enzymes that are 2003. 3 Schiller JH: Lung cancer: therapeutic modalities and involved in degrading type-I and -IV collagens and ECM cytoprotection. Lung 176: 145-164, 1998. (43, 45). In particular, both MMP-2 and -9 have been 4 Fonseca FL, Azzalis LA, Feder D, Nogoceke E, Junqueira VB, reported to be related to the invasive metastatic potential of Valenti VE and de Abreu LC: Adhesion molecules affected by tumor cells (42). treatment of lung cancer cells with epidermal growth factor. In human ovarian cancer cells, MMP-2 plays a key role in Lung 189: 383-389, 2011. this process, and its activity is regulated by complex protein- 5 Blackhall F, Ranson M and Thatcher N: Where next for gefitinib protein interactions at the posttranslational level (42, 43). in patients with lung cancer? Lancet Oncol 7: 499-507, 2006. Tumor metastasis involves tumor cell attachment, invasion, 6 Osmak M, Niksic D, Brozovic A, Ristov AA, Vrhovec I and Skrk J: Drug resistant tumor cells have increased levels of tumor migration, vessel formation and cell proliferation, and these markers for invasion and metastasis. Anticancer Res 19: 3193- steps are regulated by an extremely complex mechanism (48, 3197, 1999. 49). Thus, several agents which can inhibit or block metastasis 7 Akedo H, Shinkai K, Mukai M and Komatsu K: Potentiation and of cancer cells have been investigated (50). However, the inhibition of tumor cell invasion by host cells and mediators. efficacy of available agents remains unsatisfactory. Invasion Metastasis 9: 134-148, 1989. Propofol is clinically used for patients, but its effects on 8 Mehlen P and Puisieux A: Metastasis: A question of life or cancer cell migration and invasion have not been so far death. Nat Rev Cancer 6: 449-458, 2006. reported. Here, we demonstrated that propofol inhibited the 9 Forest V, Campos L, Vergnon JM, Cornillon J and Guyotat D: Characterization of the focal adhesion complex in human non-small protein expression of MMP-2 and MMP-9 in A549 cells cell lung cancer cell lines. Anticancer Res 25: 4135-4139, 2005. (Figure 6). MMP-2 is constitutively overexpressed in highly 10 Deegan RJ: Propofol: a review of the pharmacology and metastatic tumors (51), whereas MMP-9 can be stimulated applications of an intravenous anesthetic agent. Am J Med Sci by cytokine through activation of nuclear factor-κB (NF-κB) 304: 45-49, 1992.

4840 Wu et al: Propofol Inhibits Migration and Invasion of A549 Cells

11 Irifune M, Takarada T, Shimizu Y, Endo C, Katayama S, Dohi T 26 Nakahata K, Kinoshita H, Azma T, Matsuda N, Hama-Tomioka and Kawahara M: Propofol-induced anesthesia in mice is K, Haba M and Hatano Y: Propofol restores brain microvascular mediated by gamma-aminobutyric acid-A and excitatory amino function impaired by high glucose via the decrease in oxidative acid receptors. Anesth Analg 97: 424-429, 2003. stress. Anesthesiology 108: 269-275, 2008. 12 Kozinn J, Mao L, Arora A, Yang L, Fibuch EE and Wang JQ: 27 Liu KX, Rinne T, He W, Wang F and Xia Z: Propofol attenuates Inhibition of glutamatergic activation of extracellular signal- intestinal mucosa injury induced by intestinal ischemia- regulated protein kinases in hippocampal neurons by the intra- reperfusion in the rat. Can J Anaesth 54: 366-374, 2007. venous anesthetic propofol. Anesthesiology 105: 1182-1191, 2006. 28 Tsuchiya M, Asada A, Arita K, Utsumi T, Yoshida T, Sato EF, 13 Trapani G, Altomare C, Liso G, Sanna E and Biggio G: Propofol in Utsumi K and Inoue M: Induction and mechanism of apoptotic anesthesia. Mechanism of action, structure-activity relationships, cell death by propofol in HL-60 cells. Acta Anaesthesiol Scand and drug delivery. Curr Med Chem 7: 249-271, 2000. 46: 1068-1074, 2002. 14 Wang B, Luo T, Chen D and Ansley DM: Propofol reduces 29 Wu RS, Liu KC, Tang NY, Chung HK, Ip SW, Yang JS and apoptosis and up-regulates endothelial nitric oxide synthase protein Chung JG: cDNA microarray analysis of the gene expression of expression in hydrogen peroxide-stimulated human umbilical vein murine leukemia RAW 264.7 cells after exposure to propofol. endothelial cells. Anesth Analg 105: 1027-1033, 2007. Environ Toxicol, 2011, in press. 15 Xu JJ and Wang YL: Propofol attenuation of hydrogen peroxide- 30 Mammoto T, Mukai M, Mammoto A, Yamanaka Y, Hayashi Y, mediated oxidative stress and apoptosis in cultured Mashimo T, Kishi Y and Nakamura H: Intravenous anesthetic, cardiomyocytes involves haeme oxygenase-1. Eur J Anaesthesiol propofol inhibits invasion of cancer cells. Cancer Lett 184: 165- 25: 395-402, 2008. 170, 2002. 16 Chen J, Gu Y, Shao Z, Luo J and Tan Z: Propofol protects 31 Lin SS, Lai KC, Hsu SC, Yang JS, Kuo CL, Lin JP, Ma YS, Wu against hydrogen peroxide-induced oxidative stress and cell CC and Chung JG: Curcumin inhibits the migration and invasion dysfunction in human umbilical vein endothelial cells. Mol Cell of human A549 lung cancer cells through the inhibition of Biochem 339: 43-54, 2010. matrix metalloproteinase-2 and -9 and vascular endothelial 17 Wang B, Shravah J, Luo H, Raedschelders K, Chen DD and growth factor (VEGF). Cancer Lett 285: 127-133, 2009. Ansley DM: Propofol protects against hydrogen peroxide-induced 32 Chiang JH, Yang JS, Ma CY, Yang MD, Huang HY, Hsia TC, injury in cardiac H9c2 cells via Akt activation and Bcl-2 up- Kuo HM, Wu PP, Lee TH and Chung JG: Danthron, an regulation. Biochem Biophys Res Commun 389: 105-111, 2009. anthraquinone derivative, induces DNA damage and caspase 18 Kobayashi K, Yoshino F, Takahashi SS, Todoki K, Maehata Y, cascades-mediated apoptosis in SNU-1 human gastric cancer Komatsu T, Yoshida K and Lee MC: Direct assessments of the cells through mitochondrial permeability transition pores and antioxidant effects of propofol medium chain triglyceride/long BAX-triggered pathways. Chem Res Toxicol 24: 20-29, 2011. chain triglyceride on the brain of stroke-prone spontaneously 33 Lu CC, Yang JS, Huang AC, Hsia TC, Chou ST, Kuo CL, Lu HF, hypertensive rats using electron spin resonance spectroscopy. Lee TH, Wood WG and Chung JG: Chrysophanol induces Anesthesiology 109: 426-435, 2008. necrosis through the production of ROS and alteration of ATP 19 Gulcin I, Alici HA and Cesur M: Determination of in vitro levels in J5 human liver cancer cells. Mol Nutr Food Res 54: antioxidant and radical scavenging activities of propofol. Chem 967-976, 2010. Pharm Bull (Tokyo) 53: 281-285, 2005. 34 Chen PN, Chu SC, Chiou HL, Kuo WH, Chiang CL and Hsieh 20 Kahraman S, Kilinc K, Dal D and Erdem K: Propofol attenuates YS: Mulberry anthocyanins, cyanidin 3-rutinoside and cyanidin formation of lipid peroxides in tourniquet-induced ischaemia- 3-glucoside, exhibited an inhibitory effect on the migration and reperfusion injury. Br J Anaesth 78: 279-281, 1997. invasion of a human lung cancer cell line. Cancer Lett 235: 248- 21 Peng Z, Luo M, Ye S, Critchley LA, Joynt GM, Ho AM and Yao 259, 2006. S: Antioxidative and anti-endotoxin effects of propofol on 35 Liu KC, Huang AC, Wu PP, Lin HY, Chueh FS, Yang JS, Lu CC, endothelial cells. Chin Med J (Engl) 116: 731-735, 2003. Chiang JH, Meng M and Chung JG: Gallic acid suppresses the 22 Eriksson O: Effects of the general anaesthetic Propofol on the migration and invasion of PC-3 human prostate cancer cells via Ca 2(+)-induced permeabilization of rat liver mitochondria. inhibition of matrix metalloproteinase-2 and -9 signaling FEBS Lett 279: 45-48, 1991. pathways. Oncol Rep 26: 177-184, 2011. 23 Fredriksson A, Ponten E, Gordh T and Eriksson P: Neonatal 36 Ho YT, Yang JS, Li TC, Lin JJ, Lin JG, Lai KC, Ma CY, Wood exposure to a combination of N-methyl-D-aspartate and gamma- WG and Chung JG: Berberine suppresses in vitro migration and aminobutyric acid type A receptor anesthetic agents potentiates invasion of human SCC-4 tongue squamous cancer cells through apoptotic neurodegeneration and persistent behavioral deficits. the inhibitions of FAK, IKK, NF-kappaB, u-PA and MMP-2 and Anesthesiology 107: 427-436, 2007. -9. Cancer Lett 279: 155-162, 2009. 24 Feng CS, Ma HC, Yue Y, Zhang YQ and Qu XD: Effect of 37 Ma CY, Ji WT, Chueh FS, Yang JS, Chen PY, Yu CC and Chung propofol on the activation of nuclear factor-kappa B and JG: Butein inhibits the migration and invasion of SK-HEP-1 expression of inflammatory cytokines in cerebral cortex during human hepatocarcinoma cells through suppressing the ERK, transient focal cerebral ischemia-reperfusion: experiment with JNK, p38, and uPA signaling multiple pathways. J Agric Food rats. Zhonghua Yi Xue Za Zhi 84: 2110-2114, 2004. Chem 59: 9032-9038, 2011. 25 Sanchez-Conde P, Rodriguez-Lopez JM, Nicolas JL, Lozano FS, 38 Chen YY, Chiang SY, Lin JG, Ma YS, Liao CL, Weng SW, Lai Garcia-Criado FJ, Cascajo C, Gonzalez-Sarmiento R and Muriel TY and Chung JG: Emodin, aloe-emodin and rhein inhibit C: The comparative abilities of propofol and sevoflurane to migration and invasion in human tongue cancer SCC-4 cells modulate inflammation and oxidative stress in the kidney after through the inhibition of gene expression of matrix aortic cross-clamping. Anesth Analg 106: 371-378, 2008. metalloproteinase-9. Int J Oncol 36: 1113-1120, 2010.

4841 ANTICANCER RESEARCH 32: 4833-4842 (2012)

39 Lo C, Lai TY, Yang JS, Yang JH, Ma YS, Weng SW, Lin HY, 47 Rao JS: Molecular mechanisms of glioma invasiveness: The role Chen HY, Lin JG and Chung JG: Gallic acid inhibits the of proteases. Nat Rev Cancer 3: 489-501, 2003. migration and invasion of A375.S2 human melanoma cells 48 Fidler IJ: The organ microenvironment and cancer metastasis. through the inhibition of matrix metalloproteinase-2 and Ras. Differentiation 70: 498-505, 2002. Melanoma Res 21: 267-273, 2011. 49 Fidler IJ, Kim SJ and Langley RR: The role of the organ 40 Mozaffarieh M, Konieczka K, Hauenstein D, Schoetzau A and microenvironment in the biology and therapy of cancer Flammer J: Half a pack of cigarettes a day more than doubles metastasis. J Cell Biochem 101: 927-936, 2007. DNA breaks in circulating leukocytes. Tob Induc Dis 8: 14, 50 Chakraborti S, Mandal M, Das S, Mandal A and Chakraborti T: 2010. Regulation of matrix metalloproteinases: An overview. Mol Cell 41 Heid CA, Stevens J, Livak KJ and Williams PM: Real-time Biochem 253: 269-285, 2003. quantitative PCR. Genome Res 6: 986-994, 1996. 51 Stetler-Stevenson WG, Hewitt R and Corcoran M: Matrix 42 Zhang L, Shi J, Feng J, Klocker H, Lee C and Zhang J: Type IV metalloproteinases and tumor invasion: From correlation and collagenase (matrix metalloproteinase-2 and -9) in prostate causality to the clinic. Semin Cancer Biol 7: 147-154, 1996. cancer. Prostate Cancer Prostatic Dis 7: 327-332, 2004. 52 Sawicki G, Radomski MW, Winkler-Lowen B, Krzymien A and 43 Guruvayoorappan C and Kuttan G: Amentoflavone inhibits Guilbert LJ: Polarized release of matrix metalloproteinase-2 and experimental tumor metastasis through a regulatory mechanism -9 from cultured human placental syncytiotrophoblasts. Biol involving MMP-2, MMP-9, prolyl hydroxylase, lysyl oxidase, Reprod 63: 1390-1395, 2000. VEGF, ERK-1, ERK-2, STAT-1, NM23 and cytokines in lung 53 Kondapaka SB, Fridman R and Reddy KB: Epidermal growth tissues of C57BL/6 mice. Immunopharmacol Immunotoxicol 30: factor and amphiregulin up-regulate matrix metalloproteinase-9 711-727, 2008. (MMP-9) in human breast cancer cells. Int J Cancer 70: 722- 44 Coussens LM and Werb Z: Matrix metalloproteinases and the 726, 1997. development of cancer. Chem Biol 3: 895-904, 1996. 45 Waas ET, Wobbes T, Lomme RM, DeGroot J, Ruers T and Hendriks T: Matrix metalloproteinase-2 and -9 activity in patients with colorectal cancer liver metastasis. Br J Surg 90: 1556-1564, 2003. 46 Tsuji T, Kawada Y, Kai-Murozono M, Komatsu S, Han SA, Takeuchi K, Mizushima H, Miyazaki K and Irimura T: Regulation of melanoma cell migration and invasion by laminin-5 and Received August 1, 2012 alpha3beta1 integrin (VLA-3). Clin Exp Metastasis 19: 127-134, Revised October 11, 2012 2002. Accepted October 12, 2012

4842