Human COA3 Is an Oligomeric Highly Flexible Protein in Solution † ‡ † ∇ § ∥ Josél

Article

pubs.acs.org/biochemistry

Human COA3 Is an Oligomeric Highly Flexible Protein in Solution † ‡ † ∇ § ∥ JoséL. Neira,*, , Sergio Martínez-Rodríguez, , JoséG. Hernandez-Cifre,́ Ana Camara-Artigas,́ ⊥ # ○ ⊥ # ● ⊥ # ⊥ # Paula Clemente, , , Susana Peralta, , , Miguel Ángel Fernandez-Moreno,́ , Rafael Garesse, , § JoséGarcía de la Torre, and Bruno Rizzuti*,@ † Instituto de Biología Molecular y Celular, Universidad Miguel Hernandez,́ Elche, Alicante, Spain ‡ Biocomputation and Complex Systems Physics Institute, Zaragoza, Spain § Department of Physical Chemistry, University of Murcia, Murcia, Spain ∥ Department of Chemistry and Physics, University of Almería, Agrifood Campus of International Excellence (ceiA3), Almería, Spain ⊥ Departamento de Bioquímica-Instituto de Investigaciones Biomedicaś “Alberto Sols”, Universidad Autonomá de Madrid-Consejo Superior de Investigaciones Cientíﬁcas and Centro de Investigacioń Biomedicá en Red de Enfermedades Raras (CIBERER), Madrid, Spain # Instituto de Investigacioń Sanitaria, Hospital 12 de Octubre (i+12), Madrid, Spain @CNR-NANOTEC, Licryl-UOS Cosenza and CEMIF.Cal, Department of Physics, University of Calabria, 87036 Rende, Italy

*S Supporting Information

ABSTRACT: The assembly of the protein complex of cytochrome c oxidase (COX), which participates in the mitochondrial respiratory chain, requires a large number of accessory proteins (the so-called assembly factors). Human COX assembly factor 3 (hCOA3), also known as MITRAC12 or coiled-coil domain-containing protein 56 (CCDC56), interacts with the first subunit protein of COX to form its catalytic core and promotes its assemblage with the other units. Therefore, hCOA3 is involved in COX biogenesis in humans and can be exploited as a drug target in patients with mitochondrial dysfunctions. However, to be considered a molecular target, its structure and conformational stability must first be elucidated. We have embarked on the description of such features by using spectroscopic and hydrodynamic techniques, in aqueous solution and in the presence of detergents, together with computational methods. Our results show that hCOA3 is an oligomeric protein, forming aggregates of different molecular masses in aqueous solution. Moreover, on the basis of fluorescence and circular dichroism results, the protein has (i) its unique tryptophan partially shielded from solvent and (ii) a relatively high percentage of secondary structure. However, this structure is highly flexible and does not involve hydrogen bonding. Experiments in the presence of detergents suggest a slightly higher content of nonrigid helical structure. Theoretical results, based on studies of the primary structure of the protein, further support the idea that hCOA3 is a disordered protein. We suggest that the flexibility of hCOA3 is crucial for its interaction with other proteins to favor mitochondrial protein translocation and assembly of proteins involved in the respiratory chain.

itochondria are the “powerhouses” of cells, generating (COX) or complex IV, the fourth enzyme of the electron M the bulk of cellular ATP. Cellular respiration occurs transport chain, catalyzes the oxidation of cytochrome c, within them, involving oxygen consumption and ATP release. transferring its electrons to O2. The mammalian complex IV is This process is known as the “electron transport chain” and formed by 13 protein subunits: three of them (COX1 to involves ﬁve protein complexes: four enzymatic respiratory ones and the ATP synthase. Electrons delivered from NADH Received: June 24, 2016 and succinate go through the electron transport chain to O2, Revised: October 26, 2016 ﬁ which is nally reduced to H2O. The cytochrome c oxidase Published: October 28, 2016

COX3) are encoded by the mitochondrial DNA and form the of several types of detergents. We found that the protein is core of the protein complex, whereas the remaining 10 are oligomeric in aqueous solution, as shown by both hydro- encoded in the nuclear genome.1,2 dynamic techniques. Far-UV CD spectroscopy also suggests − COX assembly occurs in a complex linear fashion,3 5 with oligomeric species in the presence of detergents. Thermal and several cofactors necessary in some proteins (required for chemical denaturations suggest that the presence of secondary electron transport) and different subunits being incorporated in structure in aqueous solution, as monitored by far-UV CD and order by the help of the so-called assembly factors. These fluorescence quenching, is labile and nonrigid. In the presence proteins are required at every step of complex formation, from of detergents, there is a slight increase in helical content, but translation of the individual subunits of COX to assembly of the this structure is not rigid. Combined with an in silico analysis, holoenzyme to addition of the prosthetic groups present in a our experimental results suggest that hCOA3 is a disordered few of the protein subunits.4,5 The biogenesis of COX must be protein, with some regions populating different types of tightly modulated to prevent the accumulation of pro-oxidant secondary structure or, alternatively, forming hydrophobic assembly intermediates; for instance, there is a negative clusters. feedback regulatory system in Saccharomyces cerevisae, which regulates the translation of COX1 in membrane-bound ■ EXPERIMENTAL PROCEDURES ribosomes and the accumulation of complex IV assembly Materials. Ultrapure urea was from ICN Biomedicals Inc. 5,6 intermediates. COX biogenesis is important because defects Concentrations of urea were calculated from the refractive in enzyme assembly are a cause of mitochondrial disorders in index of the corresponding solution.19 Trizma acid and base, 7−9 humans. In fact, mitochondrial disorders are thought to be DNase I from bovine pancreas, chloramphenicol, tetracycline, 10 the result of dysfunction of the respiratory chain: most of the NaCl, nickel resin, polyethylenimine (PEI), 3-[(3- COX deficiencies in patients affected by mitochondrial cholamidopropyl)dimethylammonio]-1-propanesulfonate 11 disorders are caused by mutations in COX assembly factors. (CHAPS), sodium dodecyl sulfate (SDS), Nonidet P-40 (NP- Human COX assembly factor 3 (hCOA3), also known as 40), and 8-anilinonaphthalene-1-sulfonic acid (ANS) were from MITRAC12 or coiled-coil domain-containing protein 56 Sigma-Aldrich. Isopropyl β-D-thiogalactopyranoside (IPTG) (CCDC56), is a 106-residue (11.7 kDa) polypeptide that is and ampicillin were from Apollo. The β-ME was from Bio- essential for the formation of the catalytic core of COX. We Rad. Triton X-100 was from Calbiochem. Standard suppliers and other laboratories have recently shown that hCOA3 and its were used for all other chemicals. Water was deionized and 87-residue variant in Drosophila melanogaster are mitochondrial purified on a Millipore system. transmembrane proteins essential for COX biogenesis in either Cloning of hCOA3. Primers Ccdc56_5 (CATATGGCG- 12−14 species; in fact, hCOA3 is an inner mitochondrial TCTTCGGGAGCTGGTGAC) and Ccdc56_3 (CTCGAGG- 14 membrane protein. The sequence of the human protein GACCCTGACGCCCTTGCCAGAGC), including NdeI and also is highly similar with that of yeast COX assembly factor XhoI restriction sites, were used for polymerase chain reaction 11,12,15 3. From a functional point of view, hCOA3 interacts with (PCR) amplification using a pRSET-B vector containing both proteins involved in the early steps of the biogenesis of hCOA3.12 The PCR fragment obtained was purified from an complex IV and the translocation machinery located at the agarose gel using QIAquick (Qiagen) and subcloned using a 14 inner membrane of the mitochondria; in fact, the lack of StrataClone PCR cloning kit (Stratagene). The isolated hCOA3 leads to defective complex IV.12 Therefore, hCOA3 subcloning plasmid was purified using the QIAprep Spin could be considered a new pharmaceutical target, and its miniprep kit (Qiagen) and then digested using NdeI and XhoI structure and conformational stability first must be known in (Fermentas). The digested fragment was purified from an depth to design appropriate and specific drugs. agarose gel using QIAquick (Qiagen) and then ligated into the The primary structure of hCOA3 does not include any pET22b+ plasmid (Novagen) cut with the same enzymes to disulfide bridge or free cysteine residues and encompasses a create plasmid pET22b_CCDC56. Once the fragment had unique tryptophan and three tyrosines as intrinsically been cloned, it was sequenced using the dye dideoxynucleotide fluorescent residues.12 The high abundance of charged amino sequencing method in an ABI 377 DNA sequencer (Applied acids in the sequence of hCOA3 (27%, including 13 Asp/Glu Biosystems). This construction allows the expression of acidic residues and 16 Lys/Arg basic ones) suggests that it may hCOA3 fused to a C-terminal His6 tag in BL21 (DE3) RIL possess large unstructured regions. In this respect, we suspected C+ cells (Agilent). We also tried Escherichia coli strains BL21 that hCOA3 may behave as an intrinsically disordered protein (DE3) and BL21 (DE3) pLys (Novagen), C41 (DE3) and C43 (IDP); that is, it might belong to a class of proteins lacking (DE3) (Lucigen), and BL21 (DE3) Star (Invitrogen, Life stable secondary or tertiary structures.16,17 IDPs exist as an Technologies); however, none of them yielded a visible ensemble of rapidly interconverting structures, which fold into expression of hCOA3 in denaturing SDS gels, after staining. a well-defined three-dimensional structure only in the presence hCOA3 was obtained by growing chemically transformed of their binding partners or their specific ligands,17 in some BL21 (DE3) RIL C+ cells in 250 mL flasks containing cases. Because of their high flexibility, IDPs may act as hubs in ampicillin (100 μg/mL), chloramphenicol (50 μg/mL), and interaction networks performing several functions in the tetracycline (100 μg/mL). The flasks were left overnight at 37 cell,16,17 and they have been recognized as potential drug °C. The next morning 1 L flasks, with the corresponding targets.18 amounts of antibiotics, were inoculated with the culture that In this work, we have used several biophysical methods, had been grown overnight. The cells cultured in the 1 L flasks namely, fluorescence and circular dichroism (CD) spectros- were grown at 37 °C. When the absorbance at 600 nm reached copies, together with analytical ultracentrifugation (AUC) and 0.6−0.8 units, protein expression was induced by addition of dynamic light scattering (DLS) as hydrodynamic techniques, to IPTG at a final concentration of 700 μM, and the temperature describe the stability and structure of hCOA3 in aqueous was decreased to 15 °C. The cells in the 1 L flasks were grown solution. We have also performed experiments in the presence overnight.

6210 DOI: 10.1021/acs.biochem.6b00644 Biochemistry 2016, 55, 6209−6220 Biochemistry Article

Cell pellets were resuspended in 50 mL of buffer A [20 mM did not affect the spectroscopic properties of the protein, as Tris (pH 8.0), 0.5 M NaCl, 1 mM β-ME, 0.1% Triton X-100, 5 expected.21,22 μ ° mM imidazole, 10 g/mL DNase I, and 20 mM MgSO4] Fluorescence. Spectra were recorded at 25 C on a Cary supplemented with a tablet of Sigma Protease Cocktail EDTA- Varian spectrofluorimeter (Agilent), by using a Peltier temper- free. After being incubated with gentle agitation at 4 °C for 10 ature controller. A 1 cm path length quartz cell (Hellma) was min, cells were disrupted by sonication (Branson, 750 W), with used. The final buffer concentrations were 10 mM in all cases. 10 cycles of 45 s at 55% of maximal power output and an Excitation was carried out at 280 and 295 nm. Excitation and interval of 15 s between the cycles. All the sonication steps and emission slits were 5 nm. Emission was measured from 300 to the interval waits were carried out in ice. The lysates were 400 nm, unless stated otherwise. The experiments were clarified by centrifugation at 24000 rpm for 40 min at 4 °Cina prepared the day before and left overnight at 5 °C for sample Beckman JSI30 centrifuge. equilibration. The clarified lysate from this first centrifugation did not Experiments at concentrations ranging from 2.6 to 13.2 μM contain hCOA3, which was present in the precipitate. Thus, the (in protomer units) showed no changes in the maximal precipitate was treated with buffer A supplemented with 8 M wavelength, but there were small changes in the normalized urea. The resuspended sample was treated with another 10 intensity. These results suggest the presence of concentration- cycles of sonication in ice, and the sample was clarified by dependent equilibria. centrifugation at 20000 rpm for 30 min at 4 °C. The hCOA3 Intrinsic Fluorescence. Urea denaturations at pH 7.0 was in the supernatant and was purified by immobilized affinity (phosphate buffer), followed by either fluorescence or CD, chromatography (IMAC). The supernatant was added to 5 mL were carried out by dilution of the proper amount of an 8 M of His-Select HF nickel affinity gel (Sigma-Aldrich) previously urea stock solution. Urea denaturations were reversible. equilibrated in buffer A supplemented with 8 M urea. The Appropriate blank corrections were made in all spectra. Protein mixture was incubated for 20 min at 4 °C, and after that time, concentrations used were 2 and 3 μM (in protomer units); the lysate was separated from the resin by gravity. On-column both urea denaturations did show the same pattern (see refolding was carried out during column wash with 20 mL of Results). buffer B [20 mM Tris (pH 8.0), 0.5 M NaCl, 1 mM β-ME, and The pH of the samples was measured after completion of 20 mM imidazole]; the protein was then eluted by gravity from experiments with an ultrathin Aldrich electrode in a Radiometer the column with buffer C [20 mM Tris (pH 8.0), 0.5 M NaCl, (Copenhagen, Denmark) pH-meter. Salts and acids used (from 1mMβ-ME, and 500 mM imidazole]. The eluted hCOA3 was pH 2.0 to 12.0) have been described previously.24 For the pH extensively dialyzed against buffer C, in the absence of experiments, the protein concentration was 10 μM(in imidazole and β-ME. The final yield of protein was 1.5−2.5 protomer units). mg/L of culture, and the protein was 85−90% pure as judged Experiments in the presence of detergents (CHAPS, NP-40, by SDS gels. SDS, and Triton X-100) were carried out with the same We attempted to repurify the protein recovered from IMAC experimental set described above, except that the protein by using gel filtration chromatography in a Superdex 16/600, concentration was 2.6 μM (in protomer units) and the 75 pg column performed in an AKTA Basic system (GE detergent concentrations used were either below or above Healthcare) by monitoring the absorbance at 280 nm; their respective critical micelle concentrations (CMCs). For nevertheless, the protein was bound to the column, eluting at SDS, we assumed that the CMC was 8 mM;25,26 for CHAPS, volumes larger than the bed volume (∼125 mL). Further the CMC was assumed to be 6 mM.27,28 Triton X-100 and NP- attempts with a Heparin column [5 mL HiTrap Heparin 40 were not used in the fluorescence experiments because of column (GE Healthcare)] were also unsuccessful, leading to the strong fluorescence emission shown. Experiments were protein precipitation during dialysis. The eluted protein from carried out at pH 8.0 (20 mM Tris) with 500 mM NaCl at 25 IMAC showed absorbance at 260 nm, suggesting that hCOA3 °C. was probably contaminated with traces of DNA, even though Control experiments with 2.6 and 13.2 μM protein (in DNase was used during purification. We believe that this protomer units) in CHAPS (at 8 mM) and SDS (at 10 mM) contamination was due to electrostatic interactions between the were also carried out to determine whether different protein highly charged hCOA3 (theoretical pI of 9.22) and the nucleic concentrations affected the shape and the intensity of the acid. The total protein concentration, Pc (in milligrams per spectra (after normalization). The spectra had the same 20 milliliter) was determined by using the expression Pc = maximal wavelengths at the two concentrations, but the − 1.55A280 0.76A260, where A280 and A260 are the absorbances of normalized intensity slightly changed. Furthermore, as the the dialyzed protein solution at 280 and 260 nm, respectively. shape of both spectra and the maximal wavelengths were the However, it is important to note that the presence of DNA same as those of the experiments performed in aqueous traces did not affect the spectroscopic signals in the far-UV solution, we suggest that the presence of the detergent did not region or fluorescence, because DNA is spectroscopically silent alter the oligomerization state of the protein (see Results). in these techniques.21,22 We also tried to eliminate the DNA Thermal Denaturations. Experiments were performed at traces by using different concentrations of PEI [ranging from heating rates of 60 °C/h, from 25 to 90 °C, with an average 0.2 to 1% (v/v)],23 but most of the hCOA3 coprecipitated with time (sampling time) of 1 s. Thermal scans were collected at DNA. After PEI precipitation, the supernatant was concen- 315, 330, and 350 nm after excitation at 280 and 295 nm. trated by using Amicon centrifugal devices (molecular weight Thermal denaturations were reversible. cutoff of 3500 Da, Millipore), and fluorescence and far-UV CD Thermal experiments in the presence of both concentrations spectra were acquired with the concentrated protein stock of detergents (either above or below their CMCs) were solution. Both types of spectra were similar to those acquired in performed with the same experimental set and at the same the absence of PEI (i.e., in the presence of small amounts of protein concentration (2.6 μM in protomer units). Thermal DNA); therefore, these findings indicate that such DNA traces denaturations were reversible.

6211 DOI: 10.1021/acs.biochem.6b00644 Biochemistry 2016, 55, 6209−6220 Biochemistry Article

Fluorescence Quenching. Quenching of tryptophan and steady-state experiments. No drifting of the spectropolarimeter tyrosines with either iodide or acrylamide was examined under was observed. Thermal denaturations were reversible. different solution conditions. The ionic strength was kept For experiments in the presence of detergents, 9.9 μM constant during KI quenching by addition of KCl; also, protein (in protomer units) was used. The employed detergent Na2S2O3 was added (concentration of 0.1 M) to prevent the − concentrations were the lowest among those indicated above. formation of I3 . The presence of KCl did not alter the hCOA3 Thermal denaturations were always reversible. structure as suggested by the absence of changes in the shape Analytical Ultracentrifugation. Experiments were con- and ellipticity of the CD spectra in the presence of 0 and 1 M ducted as described previously.30,31 Briefly, they were KCl (data not shown). For quenching with KI, the data were performed in a Beckman Coulter Optima XL-I analytical fi 29 tted to the equation F0/F =1+Ksv[X], where Ksv is the ultracentrifuge (Beckman-Coulter, Palo Alto, CA) equipped − Stern Volmer constant for collisional quenching, F0 is the with UV−visible absorbance as well as interference optics fl uorescence when KI is not present, and F is that at any KI detection systems, using an An50Ti eight-hole rotor and 12 concentration. The range of KI concentrations explored was 0− fi fl mm path length charcoal- lled Epon double-sector center- 0.7 M. We measured the quenching of uorescent residues at pieces. The experiments were performed at 20 °Cin50mM pH 4.0, 7.0, and 10.0. Experiments were also carried out in the Tris (pH 7.9), with 20 μM protein (in protomer units). The presence of 5 M urea at pH 7.0. laser delay was adjusted prior to the runs to obtain high-quality For acrylamide, the experimental spectroscopic parameters interference fringes. Light at 675 nm was used in the were the same as in KI. However, the Stern−Volmer equation fi interference optics mode. Sedimentation velocity runs were was modi ed to include an exponential term to account for μ 29 ν[X] ν carried out at a rotor speed of 40000 rpm using 400 L dynamic quenching: F0/F =(1+Ksv[X])e , where is the dynamic quenching constant (component). This equation is samples. A series of 900 scans, without time intervals, were identical to the one given above, when ν =0. acquired for each sample. A least-squares boundary modeling of ANS Binding. The excitation wavelength was 380 nm, and the sedimentation velocity data was used to calculate fl sedimentation coefficient distributions with the size distribution emission uorescence was measured from 400 to 600 nm 32 during the pH denaturation. ANS stock solutions were c(s) method, implemented in SEDFIT version 13.0b. The ffi ρ prepared in water and diluted to yield a final concentration sedimentation coe cient in water, s20,w, solvent density ( = η ° of 100 μM. Signals from blank solutions were subtracted from 1.0089 g/mL), and viscosity ( 0 = 1.002 cP) at 20 C were 33 fi the corresponding spectra. estimated using SEDNTERP. The partial speci c volume of Circular Dichroism. CD spectra were recorded on a Jasco the protein, V̅, was 0.7298 mL/g. J815 (Japan) or Jasco J810 spectropolarimeter fitted with a Dynamic Light Scattering. Experiments were performed thermostated cell holder and interfaced with a Peltier unit. The with a Zetasizer Nano ZS instrument (Malvern Instruments − λ instrument was periodically calibrated with (+)-10-camphor- Ltd., Worcestershire, U.K., 4 mV He Ne laser, 0 = 633 nm, sulfonic acid. The molar ellipticity was calculated as described and Θ = 173°) using a thermostated 12 μL quartz sample previously.24 Protein concentrations were 10 μM (in protomer cuvette at 20 °C, as described previously.30 Briefly, protein units) in a 0.1 cm path length cell for pH experiments and 8 samples were prepared in 50 mM Hepes buffer (pH 7.0). The μM (in protomer units) for chemical denaturations. sample concentration was 20 μM (in protomer units). All the Far-UV Spectra. Isothermal wavelength spectra of hCOA3 at solutions were filtered immediately before measurement, and different pH values or urea concentrations were acquired at a protein samples were centrifuged for 30 min at 14000 rpm to scan speed of 50 nm/min with a response time of 4 s and remove any aggregates and dust. Data were analyzed using the ° ff ’ averaged over six scans at 25 C, with 10 mM bu er. Spectra manufacturer s software: the hydrodynamic radius, Rs, and were corrected by subtracting the baseline in all cases. The molecular mass, M, were determined from the Stokes−Einstein chemical and pH denaturations were repeated at least twice equation, assuming a spherical shape for the protein. ff with di erent samples. The samples were prepared the day Analysis of the pH Denaturation Curves. The pH ° before and left overnight at 5 C to allow for equilibration. denaturation curves were analyzed assuming that both For steady-state experiments in the presence of detergents, protonated and deprotonated species contributed to the μ two protein concentrations were explored: 9.9 and 20 M (in monitored spectral feature. The physical property, X, being protomer units). Experiments were carried out at pH 8.0 (20 fl ° observed, either ellipticity or uorescence intensity, depends mM Tris) with 500 mM NaCl at 25 C. The concentrations upon pH according to used for the detergents were 4 and 10 mM for SDS, 2 and 8 mM for CHAPS, 0.1 and 0.5 mM for NP-40, and 0.1 and 1 mM nK(pH− p ) XX+ 10 a for Triton X-100. = ab X − Control experiments with 10 and 16.2 μM protein (in 110+ nK(pH pa ) (1) protomer units) in CHAPS (at 8 mM) and SDS (at 10 mM) were also carried out to determine whether different protein where Xa is the value observed for the acidic species, Xb is that concentrations affected the shape and/or intensity of the at high pH, pKa is the apparent midpoint of the titrating group, 34 spectra after normalization. The spectra had the same shape, and n is the Hill coefficient, which was in the range of 0.9−1.1 but the normalized intensity slightly changed, suggesting the in all the curves. The apparent pKa reported from intrinsic or presence of self-association equilibria even in the presence of ANS fluorescence and CD was obtained from three different detergents. measurements for each technique, performed on different Thermal Denaturations. The experiments were performed samples. at heating rates of 60 °C/h and a response time of 8 s. Thermal Fitting by nonlinear least-squares analysis to eq 1 was scans were collected following the ellipticity at 222 nm from 25 performed by using Kaleidagraph (Abelbeck software) working to 80 °C. Solution conditions were the same as those in the on a personal computer.

6212 DOI: 10.1021/acs.biochem.6b00644 Biochemistry 2016, 55, 6209−6220 Biochemistry Article ■ RESULTS (including the transmembrane domain) is ordered, whereas the N-terminal and C-terminal regions are predicted to be Sequence Analysis Indicates That hCOA3 Contains 43 Intrinsically Disordered Regions. disordered. The use of Fold-Index suggests that only the Our initial studies of the fi primary structure of hCOA3 suggest that the protein has a rst 40 residues were disordered, while the rest of the protein (the transmembrane domain and the coiled-coil regions) is single transmembrane domain (from residue 58 to 78) and a 44 coiled-coil domain (from residue 79 to 104).12 The overall ordered. Furthermore, s2D yielded high percentages of helical fi structure for the regions of residues 30−50 and 80−95 (which amino acid composition identi es hCOA3 as a folded protein 12 in a charge−hydropathy plot.35,36 On the other hand, as shown is the predicted coiled-coil region ), and the rest of the in Figure 1A, both charged and hydrophobic residues are sequence appeared to be disordered. hCOA3 Is an Oligomeric Protein in Aqueous Solution. We tried to characterize the self-association state of hCOA3 with four hydrodynamic techniques. Nuclear magnetic resonance diffusion ordered spectroscopy did not yield reliable results, because the observed peaks were very broad (data not shown). Likewise, we could not carry out size exclusion chromatography experiments because, as discovered during the purification protocol (see Experimental Procedures), hCOA3 was bound to the gel filtration column. Therefore, we carried out hydrodynamic experiments with only AUC and DLS techniques. In the AUC measurements in the interference mode, we could detect one main peak with an s20,w of 1.8 S. However, there were also a secondary peak around an s20,w of 3 S and very broad peaks with an average of s20,w of 8 S (Figure 2A). Fitting

Figure 1. Sequence-based disorder predictors of hCOA3. (A) Protein sequence and distribution of charged residues. Acidic and basic amino acids are indicated with red triangles and blue circles, respectively. (B) Probability of disorder propensity as a function of residue index, as predicted by RONN,39 IUpred,40 DISOclust,41 and PrDOS.42 The cutoff between ordered and disordered conformations is 0.5 in all cases. unevenly distributed along the protein sequence, with the transmembrane domain lacking the former. In fact, both regions preceding and following the transmembrane domain Figure 2. Hydrodynamic measurements in hCOA3. (A) Interference are separately classified as natively unfolded in the same mode of the AUC experiment. The rate of the frictional factor of the charge−hydropathy plot.36 In addition, hCOA3 contains a large protein, f, to that of a spherical protein with the same number of fi amount of Ala residues (14.2%, approximately twice the residues, f/f 0, was xed to 1.5, and the root-mean-square deviation frequency found for proteins37), which typically tend to obtained was 0.0075. (B) DLS experiments shown as a percentage of volume peak. increase the RS and to modulate the backbone sensitivity to local structural perturbations in proteins.38 These results suggest that hCOA3 could behave as an IDP under a range of the first peak with a fixed value of the rate of the frictional of conditions, showing a high flexibility with a low degree of coefficient of the protein with that of a sphere to 1.5 yields a order in large regions of its structure. molecular mass of 15.6 kDa (which is close to that theoretically To test this hypothesis, we submitted the protein sequence calculated from the sequence, 12.8 kDa). However, the to different disorder prediction servers. As shown in Figure 1B, presence of self-associated species, with estimated M values of all of them (RONN, DISOclust, IUPred, and PrDOS) 40 and 200 kDa, is clear (Figure 2A). These results suggest that − suggest39 42 that only the region from residue 50 to 80 hCOA3 does not form a single self-associated species; instead,

6213 DOI: 10.1021/acs.biochem.6b00644 Biochemistry 2016, 55, 6209−6220 Biochemistry Article

Figure 3. Spectroscopic characterization of hCOA3 in aqueous solution. (A) Fluorescence intensity at 330 nm after excitation at 280 nm (●, left axis) and mean molar ellipticity at 222 nm (○, right axis) as the pH was modified. In fluorescence, similar curves were obtained after excitation at 295 nm at any other emission wavelengths. Experiments were performed at 25 °C. (B) Thermal denaturations followed by fluorescence at 330 nm (excitation at 280 nm), at several pH values (the units on the y-axis are arbitrary). (C) ANS fluorescence at 480 nm as the pH was modified. The inset shows the far-UV CD of hCOA3 at pH 7.0. Experiments were conducted at 25 °C. (D) Thermal denaturations followed by changes in ellipticity at 222 nm (the units on the y-axis are arbitrary). ff there are several oligomerization equilibria with di erent hCOA3 is 15.6 Å. In addition, the RS of a folded spherical 46 reaction orders. protein can also be approximated by the equation RS = (4.75 The DLS experiments (in volume) also showed several peaks ± 1.11)N0.29, where N is the number of residues; for a spherical, corresponding to a hydrodynamic radius of 44 ± 6 Å (yielding monomeric hCOA3, this expression yields a value of 19 ± 4Å. an M of 114 ± 65 kDa, assuming a spherical shape for hCOA3) A more accurate formula, specifically designed for IDPs,47 that (Figure 2B), 325 ± 250 Å, and 2600 ± 700 Å. The overall takes into account the fraction of Pro residues and the absolute polydispersity index is 0.47 (68.5% of polydispersity), which net charge of the protein sequence, yields an RS of 25 Å for indicates that the sample is, in fact, polydisperse. However, the hCOA3, which is larger than the values given above. The 94.6% of the sample in the volume distribution graph statistical and maximal uncertainties on this latter estimate are corresponds to the first peak with an only 13.9% polydispersity; ∼2 and ∼4Å,47 respectively, and therefore, even this value is this result suggests that this first peak is monodisperse, but with not compatible with the experimental ones we obtained. Then, a very specific self-association. In summary, all the peaks these theoretical results clearly suggest that the shape of observed in DLS suggest the presence of self-associated protein hCOA3 was not spherical, nor was it a monomer in solution. species. These results further support the presence of several hCOCA3 Acquires a Nonrigid Structure in a Narrow oligomerization equilibria with different reaction orders. pH Range in Aqueous Solution. To elucidate which kind of Although we cannot obtain any measurement of the order of structure (if any) is present in hCOA3, and whether it is stable the oligomerization or the molecular weight of the species over a wide pH range, we could use several biophysical involved, we also recorded far-UV CD spectra at two different techniques: ANS fluorescence, intrinsic fluorescence, and far- protein concentrations: 10 and 16.2 μM (in protomer units). UV CD. All those techniques provide complementary The results (Figure 1 of the Supporting Information) suggest information about different structural features of hCOA3. We that, although both spectra were similarly shaped, there were used ANS fluorescence to monitor the burial of solvent- changes in intensity, and therefore, the protein had a tendency exposed hydrophobic patches.48 Intrinsic fluorescence was used to aggregate. to monitor changes in the tertiary structure of the protein We can further elaborate on the expected theoretical value of around its sole tryptophan (Trp46) and tyrosines (Tyr72, the RS for a protein of the size of hCOA3. The RS value for an Tyr74, and Tyr77). Finally, we carried out far-UV CD ideal spherical molecule can be theoretically calculated by experiments to monitor changes in the secondary structure. considering that the unsolvated molecular volume, MV̅/NA,is Steady-State Fluorescence and Thermal Denaturation. 45 π 1/3 fl ° that of a sphere: RS =(3MV̅/4NA ) ,whereNA is The uorescence spectrum of hCOA3 at pH 7.0 and 20 C had ’ fl Avogadro s number. The calculated RS for a spherical, a maximum at 341 nm, suggesting that (i) protein uorescence monomeric protein with M and V̅corresponding to those of was dominated by the unique tryptophan, Trp46, and (ii) this

6214 DOI: 10.1021/acs.biochem.6b00644 Biochemistry 2016, 55, 6209−6220 Biochemistry Article residue was slightly buried (for a fully solvent-exposed Trp pH, the fluorescent residues are more solvent-shielded than residue, the maximum should be 350 nm19,29). The intensity at they are under the other conditions tested. This tendency is not 330 nm (as at any of the other explored wavelengths) showed a as clearly seen in the presence of acrylamide, because at pH bell shape as the pH varied, with two transitions [Figure 3A 10.0, the Ksv was smaller than at physiological pH; we explain ● fi ± ff ν ( )]. The rst occurred with a pKa of 5.4 0.1, whereas the this e ect as being due to the contribution of . second happened at basic pH and was probably due to the In conclusion, although no sigmoidal thermal transition was titration of the phenol group of some of the three tyrosines; observed at any pH, it seems clear that at physiological pH the this transition was not yet complete at pH 12.0, and therefore, fluorescence residues had a more restricted solvent accessibility. we could not obtain its midpoint. ANS Binding. At low pH, the ANS fluorescence intensity at Thermal denaturations at several pH values (3.1, 5.4, 7.4, and 480 nm was very large and decreased as the pH was increased 12.1) were performed (Figure 3B). We did not observe any (Figure 3C), indicating that hCOA3 had solvent-exposed sigmoidal behavior at any pH; only at pH 7.4 could a very flat hydrophobic regions at low pH. The intensity at 480 nm fi ± transition be guessed. Trying to t this curve led to unreliable showed a sigmoidal behavior, with a pKa of 4.4 0.2. This results, with apparent thermal denaturation midpoints below 0 value was smaller than that obtained from intrinsic °C. All transitions were reversible, except that at pH 3.1, where fluorescence, suggesting that the solvent-exposed hydrophobic scattering at high temperatures was observed (Figure 3B). patches are buried before acquisition of tertiary structure Quenching Experiments. From the results given above, it around the fluorescent residues occurs. seems that there are several pH intervals where the structure of Circular Dichroism. We recorded the far-UV spectrum of hCOA3 could be different: the one at pH <4.0, between pH 6.0 the protein at pH 7.0 and 20 °C. The far-UV CD spectrum had and 8.0, and above pH 8.0. Furthermore, because at a shape resembling that of α-helices (Figure 3C, inset), but the physiological pH the sole tryptophan was partially buried (as maxima at 208 and 222 nm were not very intense. judged from the fluorescence maximum), we wondered Deconvolution of the spectrum by using the online Dichroweb whether in those pH intervals the protein solvent accessibility server49,50 yields percentages of 8% for α-helix, 44% for β-sheet, changed. Therefore, we carried out quenching experiments with and 48% for random coil, but the root-mean-square deviation KI and acrylamide (Table 1) to monitor Trp and Tyr solvent of the experimental and fitted spectra was very poor. These accessibility. results suggest that the main secondary structure component observed is indicative of the presence of a β-sheet, in Table 1. Quenching Parameters of hCOA3 in KI and disagreement with the values of some of the theoretical a Acrylamide predictions (see above), based on the primary structure. Furthermore, the deconvoluted values do not agree with the b KI acrylamide shape of the far-UV CD spectrum (Figure 3C, inset), where the −1 −1 −1 Ksv (M ) Ksv (M ) Ksv (M ) presence of an α-helix structure could be guessed. The reasons −1 condition (280) (295) Ksv (M ) (280) (295) of such a discrepancy are not clear, but a possible explanation is pH 4.0 0.8 ± 0.1 0.2 ± 0.1 6.0 ± 0.7 1.51 ± 0.02 ± that the minimum at 222 nm (and, thus, the expected high (1.5 0.3) (0) content of helical structure) could be due to the presence of pH 7.0 0.5 ± 0.1 0.34 ± 0.05 4.0 ± 0.4 1.42 ± 0.05 51−53 (2.3 ± 0.1) (0) aromatic residues, which also absorb at this wavelength. pH 10.0 2.4 ± 0.5 0.9 ± 0.3 2.4 ± 0.9 1.03 ± 0.05 We also carried out pH denaturation experiments. As the pH (2.7 ± 0.4) (0) was increased, the ellipticity at 222 nm increased (in absolute ± ± ± ± c ± 5 M urea 2.2 0.1 1.6 0.2 8.8 0.6 3.6 0.1 (0) value) in a sigmoidal-like fashion, with a pKa of 6.0 0.1 (2.2 ± 0.2) [Figure 3A(○, right axis)], and thus, at low pH values, the aErrors are from fitting to the quenching equations (see Experimental ellipticity at this wavelength was smaller than at the Procedures). The K values were obtained by fitting of the ff sv physiological wavelength. The pKa value is di erent from that fluorescence intensity at 330 nm vs the concentration of the fl ° b observed by intrinsic and ANS uorescence, suggesting that the quenching agent. Experiments were conducted at 25 C. The value acquisition of secondary structure (monitored by far-UV CD) within the parentheses is ν, the dynamic quenching constant. c occurred at a later stage than both (i) the formation of tertiary Acrylamide quenching at 295 nm resulted in straight lines under fl any condition. The quenching experiments in the presence of urea structure around uorescent residues and (ii) the burial of were conducted at pH 7.0, 10 mM Tris buffer. solvent-exposed hydrophobic amino acids. Thermal denaturations followed by CD, at the same pH values as in the fluorescence experiments, did not show a clear fi In general terms, the Ksv values were larger at 280 nm than at sigmoidal behavior (Figure 3D). Attempts to t these curves to 295 nm for both quenching agents, due to the fact that at 280 the Gibbs−Helmholtz equation30 led to unrealistic values for nm we are exciting both types of fluorescent residues (Tyr and the thermal denaturation midpoints. Trp) whereas at 295 nm we are only exciting the Trp. In the Chemical Denaturations of hCOA3 in Aqueous Solution. presence of 5 M urea, the Ksv values were also much larger than Because thermal denaturations did not lead to a proper in its absence, suggesting that the solvent accessibility of the measurement of hCOA3 stability, we carried out urea sole Trp and of the Tyr residues was partially restricted, denaturations followed by CD (at 10 μM in protomer units) therefore indicating cluster formation around them in aqueous and fluorescence (at 2 and 3 μM in protomer units). ff solution. The Ksv values were also larger for acrylamide than for Denaturations were conducted at pH 7.0 (Tris bu er), where KI due to the presence of its dynamic component (ν). Finally, the spectroscopic properties of the protein seemed to reach a in the presence of KI, it can clearly be seen how at the two plateau (Figure 3A). extremes of pH (4.0 and 10.0) the values of Ksv were larger (but In the CD curves, as the concentration of urea was increased, not as much as in the presence of urea) than those at the minimum at 222 nm disappeared, indicating the disruption physiological pH. These results indicate that at physiological of the protein secondary structure. The denaturation curves

6215 DOI: 10.1021/acs.biochem.6b00644 Biochemistry 2016, 55, 6209−6220 Biochemistry Article were flat, with the absence of defined native and unfolded baselines, especially in the fluorescence experiments (Figure 4).

Figure 4. Chemical denaturation of hCOA3 in aqueous solution. Urea denaturation curves monitored by intrinsic ﬂuorescence at 330 nm (●, left axis) (after excitation at 280 nm) and mean residual ellipticity at 222 nm (■, right axis). Experiments were performed at 25 °C and pH 7.0, in 10 mM Tris buﬀer.

We tried to fit the data to the two-state equilibrium equation,30 but as it happened with the thermal denaturations, both the midpoint and slope of the curve obtained were unrealistic. Similar apparent sigmoidal-like curves (in the absence of either the native or unfolded baselines, but with a likely sigmoidal behavior in a narrow range of temperatures or denaturant concentrations) have been observed during thermal or chemical denaturations of other highly flexible proteins.54,55 These findings suggest the absence of a well-fixed conformation and exclude the possibility of determining the thermodynamic parameters of protein unfolding from the curves. Thus, the results found by using a denaturant are similar to those obtained for thermal denaturations, further suggesting that hCOA3 lacks a rigid conformation. The fact that both fluorescence and CD yield the same result (i.e., the lack of a sigmoidal transition) at two different concentrations (10 μM from CD, vs 2 and 3 μM from fluorescence) suggests that the dissociation constant of the self- association reaction is small, which has been found for other 56 Figure 5. Spectroscopic characterization of hCOA3 in the presence of oligomeric proteins. detergents. (A) Far-UV CD of hCOA3 in the presence of the indicated Spectroscopic Characterization of hCOA3 in the Presence concentrations of SDS (ionic) and CHAPS (zwitterionic). (B) Far-UV of Detergents. Because hCOA3 has a transmembrane region, CD of hCOA3 in the presence of the indicated concentrations of we decided to study its conformational preferences in the nonionic detergents (NP-40 and Triton X-100). (C) Fluorescence presence of several detergents with different features. experiments of hCOA3 in the presence of the indicated concentrations At a first step, we used far-UV CD at two different protein of SDS and CHAPS. The excitation wavelength was 280 nm, but concentrations in the presence of SDS and CHAPS. Results at similar results were obtained by excitation at 295 nm. All experiments ° both protein concentrations (10 and 16.2 μM) with detergent were conducted at 25 C, in the presence of 20 mM Tris (pH 8.0) and concentrations above their CMCs (Figure 2 of the Supporting 500 mM NaCl. Units on the y-axis of the CD spectra are raw data from Information) suggest that there were small changes in the spectropolarimeter to allow comparison among the detergents. intensity of the normalized spectra [smaller than those observed in aqueous solution (Figure 1 of the Supporting ellipticity at 222 nm). On the other hand, the presence of NP- Information)] at the two protein concentrations. These results 40 and CHAPS shifted the ellipticity at 208 and 222 nm toward indicate that the protein in the presence of the detergents also more negative values, indicating an increase in the amount of has a tendency to oligomerize. We used SDS, an ionic detergent helical structure. Finally, the largest variations in the intensity, with a high CMC; NP-40 and Triton X-100, two nonionic as well as in the shape of the spectra, are seen after the addition detergents with low CMCs (0.3 mM for NP-40 and 0.7 mM for of SDS. However, it is important to keep in mind that SDS may − Triton X-100); and CHAPS, a zwitterionic detergent,26 28 also also denature proteins,25,26 which could be suspected from the with a high CMC (6 mM). The CD results (Figure 5A,B) increase in the minimum of the far-UV CD spectrum of − suggest that only Triton X-100 did not induce a large increase hCOA3 at ∼205 nm (where random coil absorbs51 53). Thus, in the level of hCOA3 structure (i.e., an increase of the we conclude from the far-UV CD results that the addition of

6216 DOI: 10.1021/acs.biochem.6b00644 Biochemistry 2016, 55, 6209−6220 Biochemistry Article any type of detergent (ionic, nonionic, or zwitterionic) did membrane); for instance, it has been shown that other well- induce an increase in the helical content of hCOA3, with folded oligomeric coiled coils in crystals may behave as slightly larger effects observed for CHAPS and SDS. Never- disordered and highly flexible oligomeric proteins in solution.54 theless, this increase in helical content did not yield a more The two hydrodynamic techniques indicate that hCOA3 self- rigid structure, as suggested by the lack of sigmoidal behavior associates in aqueous solution. We could not carry out DLS and during the thermal denaturations performed in the presence of AUC experiments in the presence of any of the detergents used a detergent (that is, the thermograms were similar to those because of (i) the restrictions that the presence of such shown in Figure 3D in aqueous solution). detergents impose on the measured frictional coefficient (the As a second step, we used fluorescence at a single protein sedimentation) in AUC (as discussed above, we had difficulties − concentration [2.6 μM (in protomer units)]. The fluorescence in fitting the experiments in aqueous solution)58 62 and (ii) the experiments could be acquired for only SDS and CHAPS, belt of different shaped micelles (and, therefore, the apparent because of the strong fluorescence emission of both nonionic hydrodynamic radii of the protein−micelle complexes) in the detergents used. In CHAPS, there was an increase in the DLS measurements.63,64 Our results in the presence of fluorescence intensity of hCOA3, but in SDS, the intensity of detergents suggest that, even under a more realistic the spectrum remained unaltered; at concentrations of SDS membrane-mimicking environment, the oligomerization state above the CMC, the intensity of the spectrum decreased and of the protein observed in water is maintained [as judged by the the spectrum was blue-shifted, suggesting changes in the concentration dependence in the far-UV CD spectra in the environments of the sole tryptophan (data not shown). In both range of 10−20 μM(Figures 1 and 2 of the Supporting detergents, the maximal wavelength remained at 341 nm Information)]. What we cannot conclude from the far-UV CD (Figure 5C). Because this Trp residue is outside of the is whether the self-association order is the same in aqueous transmembrane region (Figure 1A), our results in the presence solution and in the presence of detergents, or the molecular of detergents indicate that the increase in the level of helix-like weight of the species involved. Therefore, we think that hCOA3 structure (observed by CD) did not involve regions close to the populates similar, if not identical, self-associated states in indole. We suggest that the variation observed in fluorescence aqueous and detergent environments and that these species are intensity could be due to modifications in the environment biologically important. around the two tyrosines belonging to the transmembrane At the moment, we do not know which is the polypeptide region (Figure 1A). The thermal denaturations followed by patch involved in the self-association, but we suspect it is the fluorescence also indicate that the newly formed structure coiled-coil region, because of its usual implication in this kind around those residues is not rigid [i.e., we observed a lack of of intramolecular association (see a recent discussion65 and sigmoidal behavior, and the curves were similar to those in references therein). The self-association constant seems to be aqueous solution (Figure 3B)]. very strong, because aggregated species are observed at In summary, under conditions that mimic better a membrane concentrations as low as 2 μM, as concluded from the absence environment (i.e., in the presence of detergents), the protein of protein concentration dependence in fluorescence experi- acquired a larger population of flexible helical conformation, ments (see Experimental Procedures). In addition, this keeping its oligomeric structure, without conformational association seems to be highly specific, as suggested by the changes around the indole group. small polydispersity in the resulting associated species (Figure 2B), and therefore, it cannot be considered a nonorganized ■ DISCUSSION aggregation of the hCOA3 molecules. We can also conclude Both the biophysical studies and the theoretical predictions in from AUC and DLS experiments in aqueous solution that this this work show that isolated hCOA3 lacks a well-defined self-association involves several equilibria with different reaction structure and is mainly a flexible protein, with neither a stable orders. In addition, this specific self-assembly does not hamper hydrogen bond network nor a well-formed organized core in ANS binding at very acidic pH values. We do not know, aqueous solution. Moreover, the absence of cooperativity however, whether at those low pH values, the molecularity of during the thermal and chemical denaturation experiments protein self-association was modified or, alternatively, if ANS (followed by CD and fluorescence) also suggests that the binding was possible because of spatial rearrangements in a few ff tertiary structure of hCOA3, if any, is very weak; such polypeptide patches, as suggested by the di erent Ksv values noncooperative transitions are typically observed in chemical found (Table 1). These pH-dependent spatial rearrangements denaturations of partially folded states devoid of persistent would explain why the acquisition of structure around long-range tertiary contacts.24 However, there is evidence of (i) fluorescent residues, the formation of secondary structure, hydrophobic clustering, at least around Trp46 (as concluded and the burial of hydrophobic regions occurred at different ff ff from quenching experiments), and (ii) secondary helical-like stages (i.e., with di erent pKa values for the di erent structures (Figure 3C, inset). The band at 222 nm in the far- spectroscopic probes). It is important to indicate that the UV CD spectrum, which disappears at high urea concentrations formation of such self-associated species at any pH did not (Figure 4), could be due to the presence of (i) residual helix- or involve formation of a stable hydrogen-bonded scaffold in turn-like structure or (ii) aromatic residues, absorbing at this hCOA3, as suggested by the absence of cooperativity in the − wavelength.51 53,57 If that shape of the far-UV spectrum is due thermal and chemical denaturation curves. to helical structure, we suggest that the polypeptide patches hCOA3 is one of the few characterized, unstructured, flexible involved could be the transmembrane region, the coiled-coil proteins that self-associates in solution,24,54,65,66 showing region, or both. However, it is important to note that our several oligomeric species [as judged from the hydrodynamic findings on the structure of isolated hCOA3 in aqueous experiments (Figure 2)]. We hypothesize that this self- solution do not imply that the protein could not adopt a well- association could have several functions. First, it might hide folded conformation in a more hydrophobic, or rigid, otherwise solvent-accessible protein regions from the cellular environment (such as that provided by the inner mitochondrial milieu, avoiding degradation. Second, intramolecular interac-

6217 DOI: 10.1021/acs.biochem.6b00644 Biochemistry 2016, 55, 6209−6220 Biochemistry Article tions in hCOA3 could protect regions involved in protein ■ ACKNOWLEDGMENTS interactions with other assembly factors during biogenesis of We are grateful to three anonymous reviewers for suggesting COX. These hindered regions could be exposed upon binding 65,67 the experiments in the presence of detergents. We thank Dr. to other assembly factors, facilitating modulation of Francisco N. Barrera (University of Tennessee, Knoxville, TN) ff hCOA3 at di erent stages of COX biogenesis. Furthermore, for helpful advice on the use of the detergents and Carlos the flexible nature of hCOA3 and the ability to sample different, Alfonso Botello (CIB, CSIC, Madrid, Spain) on the limitations nonrigid helical regions, together with its self-association of AUC use. We deeply thank May Garcıa,́ Marıá del Carmen features, could modulate the interactions with the different Fuster, and Javier Casanova for excellent technical assistance. assembly factors, controlling the order of assembly of subunits.12,13 In addition, the existence of some flexible (not ■ ABBREVIATIONS fully formed) helical structures (chosen by means of the ANS, 8-anilinonaphthalene-1-sulfonic acid; AUC, analytical conformational selection mechanism by other proteins during ultracentrifugation; β-ME, β-mercaptoethanol; CCDC56, assembly) would ensure that hCOA3 would not incur a coiled-coil domain-containing protein 56; CD, circular significant entropic loss associated with adopting a folded state dichroism; CHAPS, 3-[(3-cholamidopropyl)- upon binding to the other assembly factors. Therefore, the dimethylammonio]-1-propanesulfonate; CMC, critical micelle flexible structure of hCOA3 would facilitate and, possibly, concentration; COX, cytochrome c oxidase; DLS, dynamic light accelerate the interactions with other assembly factors during scattering; hCOA3, human COX assembly factor 3; IDP, the assemblage of the respiratory chain and their translational intrinsically disordered protein; IMAC, immobilized affinity regulation. chromatography; IPTG, isopropyl β-D-thiogalactopyranoside; MITRAC, mitochondrial translation regulation assembly ■ ASSOCIATED CONTENT intermediate of cytochrome c oxidase; NP-40, Nonidet P-40 * (octyl phenoxypolyethoxylethanol); PEI, polyethylenimine; RS, S Supporting Information hydrodynamic radius; SDS, sodium dodecyl sulfate; UV, The Supporting Information is available free of charge on the ultraviolet. ACS Publications website at DOI: 10.1021/acs.biochem.6b00644. ■ REFERENCES Far-UV CD spectra of hCOA3 at two different (1) Anderson, S., Bankier, A. T., Barrell, B. G., de Bruijn, M. H. L., concentrations in aqueous solution (Figure 1) and in Coulson, A. R., Drouin, J., Eperon, I. C., Nierlich, D. P., Roe, B. A., Sanger, F., Schreier, P. H., Smith, A. J., Staden, R., and Young, I. G. the presence of either 10 mM SDS (Figure 2A) or 8 mM (1981) Sequence and organization of the human mitochondrial CHAPS (Figure 2B) (PDF) genome. Nature 290, 457−465. (2) Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., ■ AUTHOR INFORMATION Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, R., Yaono, R., and Yoshikawa, S. (1996) The wholé structure of the 13-subunit oxidized Corresponding Authors cytochrome c oxidase at 2.8 Å. Science 272, 1136−1144. *Instituto de Biologıá Molecular y Celular, Edificio Torregai- (3) Nijtmans, L. G., Taanman, J. W., Muijsers, A. O., Speijer, D., and ́ ́ Van den Bogert, C. (1998) Assembly of cytochrome c oxidase in tan, Universidad Miguel Hernandez, Avda. del Ferrocarril s/n, cultured human cells. Eur. J. Biochem. 254, 389−394. 03202 Elche, Alicante, Spain. Telephone: +34 966658459. Fax: (4) Carr, H. S., and Winge, D. R. (2003) Assembly of cytochrome c +34 966658758. E-mail: [email protected]. oxidase within the mitochondrion. Acc. Chem. Res. 36, 309−316. *CNR-NANOTEC, Licryl-UOS Cosenza and CEMIF.Cal, (5) Soto, I. C., Fontanesi, F., Liu, J., and Barrientos, A. (2012) Department of Physics, University of Calabria, 87036 Rende, Biogenesis and assembly of eukaryotic cytochrome c oxidase catalytic Italy. Telephone: +39 0984 496078. Fax: +39 0984 494401. E- core. Biochim. Biophys. Acta, Bioenerg. 1817, 883−897. mail: [email protected]. (6) Mick, D. U., Fox, T. D., and Rehling, P. (2011) Inventory control: cytochrome c oxidase assembly regulates mitochondrial Present Addresses − ∇ translation. Nat. Rev. Mol. Cell Biol. 12,14 20. S.M.-R.: Department of Physical Chemistry, University of (7) Shoubridge, E. A. (2001) Cytochrome c oxidase deficiency. Am. J. Granada, Granada, Spain. Med. Genet. 106,46−52. ○ P.C.: Department of Laboratory Medicine, Karolinska (8) Zee, J. M., and Glerum, D. M. (2006) Defects in cytochrome c Institutet, Stockholm, Sweden. oxidase assembly in humans: lessons from yeast. Biochem. Cell Biol. 84, ● − S.P.: University of Miami, Miller School of Medicine, Miami, 859 869. (9) Díaz, F. (2010) Cytochrome c oxidase deficiency: patients and FL 33136. animal models. Biochim. Biophys. Acta, Mol. Basis Dis. 1802, 100−110. Funding (10) Wallace, D. C. (1999) Mitochondrial diseases in man and − This work was supported by Spanish regional grants of mouse. Science 283, 1482 1488. Generalitat Valenciana (to J.L.N., Prometeo 018/2013), (11) Smeitink, J. A., Zeviani, M., Turnbull, D. M., and Jacobs, H. T. (2006) Mitochondrial medicine: a metabolic perspective on the Comunidad de Madrid (to R.G., P2010/BMD-2402), and − ́ ́ ́ pathology of oxidative phophorylation disorders. Cell Metab. 3,9 13. FundacionSeneca de la Region de Murcia (19353/PI/14 to (12) Peralta, S., Clemente, P., Sanchez-Martínez,́ A., Calleja, M., J.G.H.-C. and J.G.d.l.T.). Further support was provided by the Hernandez-Sierra,R.,Matsushima,Y.,Adá n,́ C., Ugalde, C., National Spanish Ministry of Economy and Competitiveness Fernandez-Moreno,́ M. A., Kaguni, L. S., and Garesse, R. (2012) and FEDER (EU): BIO2012-39922-C02-01/02 (A.C.-A.) and Coiled coil domain-containing protein 56 (CCD56) is a novel CTQ2015-64445-R (J.L.N.). mitochondrial protein essential for cytochrome c oxidase function. J. Biol. Chem. 287, 24174−24185. Notes (13) Clemente, P., Peralta, S., Cruz-Bermudez, A., Echevarría, L., The authors declare no competing financial interest. Fontanesi, F., Barrientos, A., Fernandez-Moreno,́ M. A., and Garesse,

6218 DOI: 10.1021/acs.biochem.6b00644 Biochemistry 2016, 55, 6209−6220 Biochemistry Article

R. (2013) hCOA3 stabilizes cytochrome c oxidase 1 (COX1) and (32) Schuck, P. (2000) Size-distribution analysis of macromolecules promotes cytochrome c oxidase assembly in human mitochondria. J. by sedimentation velocity ultracentrifugation and Lamm equation Biol. Chem. 288, 8321−8331. modeling. Biophys. J. 78, 1606−1619. (14) Mick, D. U., Dennerlein, S., Wiese, H., Reinhold, R., Pacheu- (33) Laue, T. M., Shah, B. D., Ridgeway, T. M., and Pelletier, S. L. Grau, D., Lorenzi, I., Sasarman, F., Weraarpachai, W., Shoubridge, E. (1992) Computer-aided interpretation of analytical sedimentation data A., Warscheid, B., and Rehling, P. (2012) MITRAC links for proteins. In Analytical Ultracentrifugation in Biochemistry and mitochondrial protein translocation to respiratory chain assembly Polymer Science (Harding, S. E., Rowe, A. J., and Horton, J. C., Eds.) pp and translational regulation. Cell 151, 1528−1541. 90−124, Royal Society of Chemistry, Cambridge, U.K. (15) Szklarczyk, R., Wanschers, B. F., Cuypers, T. D., Esseling, J. J., (34) Markley, J. L. (1975) Observation of histidine residues in Riemersma, M., van den Brand, M. A., Gloerich, J., Lasonder, E., van proteins by nuclear magnetic resonance spectroscopy. Acc. Chem. Res. den Heuvel, L. P., Nijtmans, L. G., and Huynen, M. A. (2012) Iterative 8,70−80. orthology prediction uncovers new mitochondrial proteins and (35) Uversky, V. N., Gillespie, J. R., and Fink, A. L. (2000) Why are “ ” identifies C12orf62 as the human ortholog of COX14, a protein natively unfolded proteins unstructured under physiologic con- − involved in the assembly of cytochrome c oxidase. Genome Biol. 13, ditions? Proteins: Struct., Funct., Genet. 41, 415 427. R12. (36) Romero, P., Obradovic, Z., Li, X., Garner, E. C., Brown, C. J., (16) Wright, P. E., and Dyson, H. J. (2014) Intrinsically disordered and Dunker, A. K. (2001) Sequence complexity of disordered protein. − proteins in cellular signalling and regulation. Nat. Rev. Mol. Cell Biol. Proteins: Struct., Funct., Genet. 42,38 48. 16,18−29. (37) Simpson, R. J. (2003) Proteins and proteomics: A laboratory (17) Liu, Z., and Huang, Y. (2014) Advantages of proteins being manual, Cold Spring Harbor Laboratory Press, Plainview, NY. disordered. Protein Sci. 23, 539−550. (38) Perez, R. B., Tischer, A., Auton, M., and Whitten, S. T. (2014) (18) Joshi, P., and Vendruscolo, M. (2015) Druggability of Alanine and proline content modulate global sensitivity to discrete − perturbations in disordered proteins. Proteins: Struct., Funct., Genet. 82, intrinsically disordered proteins. Adv. Exp. Med. Biol. 870, 383 400. − (19) Pace, C. N., and Scholtz, J. M. (1997) Measuring the 3373 3384. conformational stability of a protein. In Protein Structure (Creighton, (39) Yang, Z. R., Thomson, R., McNeil, P., and Esnouf, R. M. (2005) T. E., Ed.) 2nd ed., pp 253−259, Oxford University Press, Oxford, RONN: the bio-basis function neural network technique applied to the detection of natively unfolded proteins. Bioinformatics 21, 3369−3376. U.K. ́ ́ (20) Dunn, M. J. (1995) Initial planning: determination of total (40) Dosztanyi, Z., Csizmok, V., Tompa, P., and Simon, I. (2005) protein concentration. In Protein puriﬁcation methods (Harris, E. L. V., IUPred: web server for the prediction of intrinsically unstructured − regions of proteins based on estimated energy content. Bioinformatics and Angal, S., Eds.) pp 10 20, Oxford University Press, Oxford, U.K. − (21) Neira, J. L. (2013) Fluorescence, circular dichroism and mass 21, 3433 3444. (41) McGuffin, L. J. (2008) Intrinsic disorder prediction from the spectrometry as tools to study virus structure. Subcell. Biochem. 68, analysis of multiple protein fold recognition models. Bioinformatics 24, 177−202. 1798−1804. (22) Chemes, L. B., Alonso, L. G., Noval, M. G., and Prat-Gay, G. (42) Ishida, T., and Kinoshita, K. (2007) PrDOS: prediction of (2014) Circular dichroism techniques for the analysis of intrinsically disordered protein regions from amino acid sequence. Nucleic Acids disordered proteins and domains. In Intrinsically disordered protein Res. 35, W460−W464. analysis: Vol. 1. Methods and experimental tools (Uversky, V. N., and − (43) Prilusky, J., Felder, C. E., Zeev-Ben-Mordehai, T., Rydberg, E. Dunker, A. K., Eds.) Methods in Molecular Biology, Vol. 895, pp 387 H., Man, O., Beckmann, J. S., Silman, I., and Sussman, J. L. (2005) 404, Springer Protocols, Humana Press, Totowa, NJ. FoldIndex: a simple tool to predict whether a given protein sequence (23) Burgess, R. R. (2009) Protein precipitation techniques. Methods is intrinsically unfolded. Bioinformatics 21, 3435−3438. Enzymol. 463, 331−342. ́ (44) Sormanni, P., Camilloni, C., Fariselli, P., and Vendruscolo, M. (24) Neira, J. L., Roman-Trufero, M., Contreras, L. M., Prieto, J., (2015) The s2D method: Simultaneous sequence-based prediction of Singh, G., Barrera, F. N., Renart, M. L., and Vidal, M. (2009) The the statistical populations of ordered and disordered regions in transcriptional repressor RYBP is a natively unfolded protein which − − proteins. J. Mol. Biol. 427, 982 996. folds upon binding to DNA. Biochemistry 48, 1348 1360. (45) Cantor, C. R., and Schimmel, P. R. (1980) Biophysical Chemistry, (25) Suzuki, H., and Terada, H. (1988) Removal of dodecyl sulphate W. H. Freeman, New York. − from protein solution. Anal. Biochem. 172, 259 263. (46) Wilkins, D. K., Grimshaw, S. B., Receveur, V., Dobson, C. M., (26) Mogensen, J. E., Sehgal, P., and Otzen, D. E. (2005) Activation, Jones, J. A., and Smith, L. J. (1999) Hydrodynamic radii of native and inhibition and destabilization of Thermomyces lanuginosus lipase by denatured proteins measured by pulse field gradient NMR techniques. − detergents. Biochemistry 44, 1719 1730. Biochemistry 38, 16424−16431. (27) Seddon, A. M., Curnow, P., and Booth, P. J. (2004) Membrane (47) Marsh, J. A., and Forman-Kay, J. D. (2010) Sequence proteins, lipids and detergents: not just a soap opera. Biochim. Biophys. determinants of compaction in intrinsically disordered proteins. − Acta, Biomembr. 1666, 105 117. Biophys. J. 98, 2383−2390. (28) Johnson, M. (2013) Detergents: Triton X-100, Tween-20 and (48) Ptitsyn, O. B. (1995) Molten globule and protein folding. Adv. more. Mater. Methods 3, 163. Protein Chem. 47,83−229. ﬂ (29) Lakowicz, J. R. (1999) Principles of uorescence spectroscopy, 2nd (49) Whitmore, L. B., and Wallace, B. A. (2008) Protein secondary ed., Plenum Press, New York. structure analysis from circular dichroism spectroscopy: methods and ́ ́ ̃ (30) Domenech, R., Hernandez-Cifre, J. G., Bacarizo, J., Díez-Pena, reference databases. Biopolymers 89, 392−400. A. I., Martínez-Rodríguez, S., Cavasotto, C. N., García de la Torre, J., (50) Whitmore, L. B., and Wallace, B. A. (2004) Dichroweb: an Camara-Artigas,́ A., Velazquez-Campoy,́ A., and Neira, J. L. (2013) online server for protein secondary structure analyses from circular The histidine-phosphocarrier protein of the phosphoenolpyruvate: dichroism spectroscopy data. Nucleic Acids Res. 32, W668−W673. sugar phosphotransferase system of Bacillus sphaericus self-associates. (51) Vuilleumier, S., Sancho, J., Loewenthal, R., and Fersht, A. R. PLoS One 8, e69307. (1993) Circular dichroism studies of barnase and its mutants: (31) Perez-Sá nchez,́ H., Tatarenko, K., Nigen, M., Pavlov, G., characterization of the contribution of aromatic side chains. Imberty, A., Lortat-Jacob, H., García de la Torre, J., and Ebel, C. Biochemistry 32, 10303−10313. (2006) Organization of human interferon g-heparin complexes from (52) Woody, A. Y., and Woody, R. W. (2003) Individual tyrosine solution properties and hydrodynamics. Biochemistry 45, 13227− side-chain contributions to circular dichroism of ribonuclease. 13238. Biopolymers 72, 500−513.

6219 DOI: 10.1021/acs.biochem.6b00644 Biochemistry 2016, 55, 6209−6220 Biochemistry Article

(53) Woody, R. W. (1995) Circular dichroism. Methods Enzymol. 246,34−71. (54) Spínola-Amilibia, M., Rivera, J., Ortiz-Lombardía, M., Romero, A., Neira, J. L., and Bravo, J. (2013) BRMS151−98 and BRMS151−84 are crystal oligomeric coiled coils with different oligomerization states, which behave as disordered protein fragments in solution. J. Mol. Biol. 425, 2147−2163. (55) Muro-Pastor, M. I., Barrera, F. N., Reyes, J. C., Florencio, F. J., and Neira, J. L. (2003) The inactivating factor of glutamine synthetase, IF7, is a natively unfolded protein. Protein Sci. 12, 1443−1454. (56) Mok, Y. K., Alonso, L. G., Lima, L. M., Bycroft, M., and de Prat- Gay, G. (2000) Folding of a dimeric beta-barrel: residual structure in the urea denatured state of the human papillomavirus E2 DNA binding domain. Protein Sci. 9, 799−811. (57) Kelly, S. M., Jess, T. J., and Price, N. C. (2005) How to study proteins by circular dichroism. Biochim. Biophys. Acta, Proteins Proteomics 1751, 119−139. (58) le Maire, M., Arnou, B., Olesen, C., Georgin, D., Ebel, C., and Møller, G. V. (2008) Gel chromatography and analytical ultracentrifugation to determine the extent of detergent binding and aggregation, and Stokes radiusofmembraneproteinsusing sarcoplasmic reticulum Ca2+−ATPase as an example. Nat. Protoc. 3, 1782−1795. (59) Champeil, P., Orlowski, S., Babin, S., Lund, S., Le Maire, M., Møller, J., Lenoir, G., and Montigny, C. (2016) A robust method to screen detergents for membrane protein stabilization, revisited. Anal. Biochem. 511,31−35. (60) Salvay, S. G., Santamaria, M., Le Maire, M., and Ebel, C. (2007) Analytical ultracentrifugation sedimentation velocity for the characterization of detergent-solubilized membrane proteins Ca2+-ATPase and ExbB. J. Biol. Phys. 33, 399−419. (61) Josse, D., Ebel, C., Stroebel, D., Fontaine, A., Borges, F., Echalier, A., Baud, D., Renault, F., Le Maire, M., Chabrieres,̀ E., and Masson, P. (2002) Oligomeric states of the detergent-solubilized human serum paraoxonase. J. Biol. Chem. 277, 33386−33397. (62) Le Roy, A., Wang, K., Schaack, B., Schuck, P., Breyton, C., and Ebel, C. (2015) AUC and small-angle scattering for membrane proteins. Methods Enzymol. 562, 257−286. (63) Zouni, A., Kern, J., Frank, J., Hellweg, T., Behlke, J., Saenger, W., and Irrgang, K.-D. (2005) Size determination of cyanobacterial and higher plant photosystem II by gel permeation chromatography, light scattering, and ultracentrifugation. Biochemistry 44, 4572−4581. (64) Meyer, A., Dierks, K., Hussein, R., Brillet, K., Brognaro, H., and Betzel, C. (2015) Systematic analysis of protein−detergent complexes applying dynamic light scattering to optimize solutions for crystallization trials. Acta Crystallogr., Sect. F: Struct. Biol. Commun. 71,75−81. (65) Sigalov, A. B. (2016) Structural biology of intrinsically disordered proteins: revisiting unsolved mysteries. Biochimie 125, 112−118. (66) Aguado-Llera, D., Bacarizo, J., Gregorio-Teruel, L., Taberner, F. J., Camara-Artigas,́ A., and Neira, J. L. (2012) Biophysical characterization of the isolated C terminal region of the transient receptor potential vanilloid 1. FEBS Lett. 586, 1154−1159. (67) Wu, H., and Fuxreiter, M. (2016) The structure and dynamics of higher-order assemblies: amyloids, signalosomes and granules. Cell 165, 1055−1066.

6220 DOI: 10.1021/acs.biochem.6b00644 Biochemistry 2016, 55, 6209−6220