Immune Deficiency Pathway Innate Immune Response Activated by The

The Drosophila Protein Mustard Tailors the Innate Immune Response Activated by the Immune Deficiency Pathway

This information is current as Zhipeng Wang, Cristin D. Berkey and Paula I. Watnick of October 2, 2021. J Immunol 2012; 188:3993-4000; Prepublished online 16 March 2012; doi: 10.4049/jimmunol.1103301 http://www.jimmunol.org/content/188/8/3993 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2012/03/16/jimmunol.110330 Material 1.DC1

References This article cites 45 articles, 17 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/188/8/3993.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists by guest on October 2, 2021 • Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

The Drosophila Protein Mustard Tailors the Innate Immune Response Activated by the Immune Deﬁciency Pathway

Zhipeng Wang, Cristin D. Berkey, and Paula I. Watnick

In this study, we describe a Drosophila melanogaster transposon insertion mutant with tolerance to Vibrio cholerae infection and markedly decreased transcription of diptericin as well as other genes regulated by the immune deﬁciency innate immunity signaling pathway. We present genetic evidence that this insertion affects a locus previously implicated in pupal eclosion. This genetic locus, which we have named mustard (mtd), contains a LysM domain, often involved in carbohydrate recognition, and a TLDc domain of unknown function. More than 20 Mtd isoforms containing one or both of these conserved domains are predicted. We establish that the mutant phenotype represents a gain of function and can be replicated by increased expression of a short, nuclearly localized Mtd isoform comprised almost entirely of the TLDc domain. We show that this Mtd isoform does not block Relish cleavage or translocation into the nucleus. Lastly, we present evidence suggesting that the eclosion defect previously attributed to the Mtd locus may be the result of the unopposed action of the NF-kB homolog, Relish. Mtd homologs Downloaded from have been implicated in resistance to oxidative stress. However, to our knowledge this is the ﬁrst evidence that Mtd or its homologs alter the output of an innate immunity signaling cascade from within the nucleus. The Journal of Immunology, 2012, 188: 3993– 4000.

he epithelia of most animals are continually exposed to protein recognition of meso-diaminopimelic acid-type peptido- microorganisms. By necessity, these animals have evolved glycan. Through a series of intermediates, this leads to activation http://www.jimmunol.org/ T signaling pathways that enable symbiotic interactions with of the caspase 8 homolog Dredd and the IkK complex consisting beneficial microbes and activate an innate immune defense against of the catalytic subunit IkKb, encoded by ird5, and the regulatory invading pathogens. subunit IkKg, encoded by Kenny (key). Phosphorylation of Relish The common fruit fly Drosophila melanogaster harbors two by the IkK complex at residues 528 and 529 is required for ac- distinct innate immune signaling pathways, namely the immune tivation of Relish targets. Dredd is required for cleavage of the deficiency (Imd) pathway, which responds primarily to Gram- Relish C-terminal inhibitory ankyrin repeat domain, allowing negative bacteria, and the Toll pathway, which responds primar- nuclear translocation of a 68 kDa N-terminal RHD-containing ily to Gram-positive bacteria and fungi (1, 2). Both of these fragment and activation of an immune response against Gram- by guest on October 2, 2021 pathways regulate nuclear translocation of NF-kB homologs, negative and some Gram-positive bacterial pathogens (4–7). which activate the transcription of many genes, including those Many studies have demonstrated that, in addition to generation that encode small cationic antimicrobial peptides (AMPs). of reactive oxygen species by the host (8, 9), IMD pathway sig- Three NF-kB homologs are encoded in the Drosophila genome. naling plays a role in the Drosophila innate immune response to Two of these, Dorsal and Dorsal-related immunity factor, respond both commensal and pathogenic intestinal bacteria (10–12). To to signaling through the Toll pathway (3). The third NF-kB ho- protect the host against its own immune response, signaling molog, Relish, comprised of an N-terminal Rel homology domain through this pathway is tightly regulated (12–18). (RHD) and a C-terminal ankyrin repeat domain, responds to sig- Vibrio cholerae, a Gram-negative, halophilic bacterium, is re- naling through the IMD pathway, which is initiated by receptor sponsible for the severe diarrheal disease cholera (19). Further- more, it has been associated with both marine and terrestrial Division of Infectious Diseases, Children’s Hospital Boston, Boston, MA 02115 arthropods in the environment (20–24), and arthropods have been Received for publication November 30, 2011. Accepted for publication February 11, proposed as both reservoirs and vectors of V. cholerae. We de- 2012. veloped D. melanogaster as a model in which to study the inter- This work was supported by National Institutes of Health Grant AI071147 (to P.I.W.). action of V. cholerae with the arthropod intestine (25) and The Intellectual and Developmental Disabilities Research Center Imaging Core, previously reported that IMD pathway mutants have increased Children’s Hospital Boston is supported by National Institutes of Health Grant P30-HD-18655. The Children’s Hospital Boston Molecular Genetics Core Facility tolerance to oral V. cholerae infection (26). is supported by National Institutes of Health Grants P50-NS40828 and P30- As part of a genetic screen for host susceptibility factors, we HD18655. identified a mutant with increased tolerance to oral V. cholerae The microarray data presented in this article have been deposited in the Gene Ex- infection and a transcriptional profile similar to that of an IMD pression Omnibus database (http://www.ncbi.nlm.nih.gov/geo/) under accession no. GSE35439. pathway mutant. This mutant, which we have named Mustard (Mtd), carries a P-element insertion in a complex genetic locus Address correspondence and reprint requests to Dr. Paula I. Watnick, Division of Infectious Diseases, Children’s Hospital Boston, 300 Longwood Avenue, Boston, encoding conserved LysM and TLDc domains. LysM domains are MA 02115. E-mail address: [email protected] often involved in carbohydrate recognition (27). Although the The online version of this article contains supplemental material. TLDc domain has been associated with resistance to oxidative Abbreviations used in this article: AMP, antimicrobial peptide; HA, hemagglutinin; stress, its mechanism of action is unknown (28). The Mtd locus is IMD, immune deficiency; key, Kenny; LB, Luria–Bertani; Mtd, Mustard; qRT-PCR, predicted to give rise to 21 transcripts containing one or both of quantitative RT-PCR; RHD, Rel homology domain; ROS, reactive oxygen species. these conserved domains (29). We show that the phenotype of the Copyright Ó 2012 by The American Association of Immunologists, Inc. 0022-1767/12/$16.00 Mtd mutant represents a gain of function and can be reproduced www.jimmunol.org/cgi/doi/10.4049/jimmunol.1103301 3994 MUSTARD TAILORS IMD PATHWAY OUTPUT by expression of a nuclearly localized isoform containing only collected and homogenized in 200 ml PBS. Dilutions of the suspension the TLDc domain. TLDc domains are widespread in eukaryotes. were plated on LB agar supplemented with streptomycin. CFUs per fly In this study, to our knowledge we present the first evidence for were enumerated. No colonies were cultured from flies fed LB broth alone, suggesting that all bacteria retrieved from LB agar plates supplemented modulation of the IMD innate immune signaling pathway by with streptomycin were V. cholerae. Statistical significance was calculated a TLDc domain-containing protein. using a Mann–Whitney U test.

Materials and Methods Quantitative RT-PCR Bacterial strains, fly stocks, and growth media Flies were homogenized in TRIzol reagent (Invitrogen). Total RNA was extracted once, treated with DNase I, and then extracted a second time. MO10, a V. cholerae O139 clinical isolate, was used in all Drosophila Purified RNA (1 mg) was used as a template for synthesis of cDNA using infections (30). Either w1118 or yw stocks obtained from the Bloomington a QuantiTect reverse transcription system (Qiagen). The resulting cDNA Drosophila stock center at Indiana University were used as controls. The was used for quantitative PCR with iTaq SYBR Green supermix with details of other fly lines used in these experiments are available upon re- carboxy-X-rhodamine (ROX; Bio-Rad) and 2 pmol relevant primers in quest. Other than the decreased rates of eclosion observed for insertion a 20-ml reaction volume. The sequence of primers used for quantitative mutants with global defects in Mtd transcription, no developmental defects RT-PCR (qRT-PCR) is available on request. The experiments were con- were noted for the fly lines used in these experiments. D. melanogaster ducted with a StepOnePlus PCR system (Applied Biosystems). The tran- strains were reared at 24˚C on standard Drosophila medium, and bacterial script level of each gene was quantified by comparison with a standard strains were propagated in Luria–Bertani (LB) broth supplemented with curve and normalized using the level of the reference gene rp49. Ten to streptomycin (100 mg/ml) at 27˚C. 15 flies were used per biological replicate, and three biological replicates Transposon localization were performed for each experiment. Error bars represent the SEM, and statistical significance was calculated using a Student t test. Each experi-

Inverse PCR was used to identify the P-element insertion site of the ment was performed at least twice with the exception of those in Sup- Downloaded from mtdEY04695 mutant as follows. Genomic DNA was prepared from 25 adult plemental Fig. 3, which were performed once. flies using a QIAamp DNA Mini Kit (Qiagen) and then digested with In control yw flies, we found that, after 24 h of V. cholerae ingestion, MspI. The resulting DNA fragments were self-ligated overnight at 16˚C dipt expression increased ∼35-fold and remained at this level over several using T4 DNA ligase (Invitrogen) to create a mixture of circular fragments. days. Therefore, in oral infections, dipt transcription was measured after DNA flanking the 59 end of the transposon was amplified from this mix- 24 h. Six hours after septic injury, we found that dipt transcription had ture using the outward facing primer pair Pwht1 (GTAACGCTAAT- increased ∼230-fold. It continued to increase over the next 3 h and then CACTCCGAACAGGTCACA) and Plac1 (CACCCAAGGCTCTGCTCC- was maintained at 300 times baseline (data not shown). Therefore, for CACAAT). DNA flanking the 39 end of the transposon was amplified septic injury, dipt expression was measured after 6 h. http://www.jimmunol.org/ using the primer pair Pry4 (CAATCATATCGCTGTCTCACTCA) and Pry1 (CCTTAGCATGTCCGTGGGGTTTGAAT). PCR products were se- Western analysis quenced and aligned with the Drosophila genome sequence available from Protein extracts for Western analysis were prepared as follows. Ten adult the Berkeley Drosophila Genome Project. flies were homogenized in a 200 ml volume of NP-40 cell lysis buffer Transgenic fly construction (Invitrogen) supplemented with 1 mM PMSF and a protease inhibitor tablet (Roche). Extracts were spun at 14,000 rpm for 10 min at 4˚C to The mtd-RC transcript was reverse-transcribed from Drosophila RNA pellet debris. Sixty microliters of the resulting supernatant was then prepared as described below using a primer specific to the 39 end of the RC combined with 15 ml Lane Marker Reducing Sample Buffer (Pierce), transcript and the SuperScript III First-Strand synthesis system (Invi- boiled for 5 min, and spun at 14,000 rpm for 1 min. Proteins in this mixture trogen). The resulting cDNA was amplified with a 59 primer including an were separated on an 8% Precise protein gel (Pierce). Full-length Relish by guest on October 2, 2021 EcoRI site and a 39 primer including an XhoI site. This PCR product was and the products of its proteolysis were visualized with the following two inserted into pCR2.1-TOPO using a TOPO TA cloning kit (Invitrogen) and primary Abs: 1) a mouse IgG mAb to the C terminus of Relish (Devel- then excised and ligated into pUAST using the EcoRI and XhoI restriction opmental Studies Hybridoma Bank), and 2) a polyclonal rabbit IgG Ab sites. A pUAST vector encoding hemagglutinin (HA)-tagged Mtd-RC was raised against a peptide fragment within the N-terminal RHD domain created similarly except that an HA tag was added in two steps by PCR (Pacific Immunology). Each primary Ab was used in a 1:1000 dilution. amplification with primers encoding the tag. We first confirmed the pres- Anti-mouse or anti-rabbit IgG secondary Ab conjugated to horseradish ence of mtd-RH by reverse-transcribing, amplifying, and sequencing this peroxidase (Amersham) was used as appropriate in a 1:5000 dilution. The transcript. Then, mtd-RH and mtd-RH-HA transcripts were amplified from HRP-conjugated secondary Abs were visualized by chemiluminescence the pUAST plasmids containing either mtd-RC or mtd-RC-HA, respec- with the ECL Plus Western blotting system (Amersham Biosciences). tively, using a forward primer including a 59 EcoRI site and a reverse primer including a 39 XhoI site. After digestion with EcoRI and XhoI, Immunofluorescence these products were ligated into pUAST. All inserts were confirmed by Fly tissues were dissected in PBS, transferred immediately to 4% form- sequence analysis. Plasmids were sent to Rainbow Transgenics for injec- aldehyde in PBS, and incubated for 30 min at room temperature. Tissues tion into w1118 embryos. Homozygous transgenic fly stocks were gener- were then rinsed three times for 30 min each in PBS supplemented with ated from these offspring. 0.1% Triton X-100 and 1% BSA and incubated overnight with one of the Oral and systemic bacterial infections following primary Abs: mouse anti-HA (1:100; Santa Cruz Biotechnology), mouse anti-Flag (1:500; Sigma-Aldrich), or rabbit anti-HA (1:100; Santa Flies were infected orally as previously described (25). Briefly, three fly Cruz Biotechnology). After rinsing, a second overnight incubation was vials were prepared with a cellulose acetate plug containing 2 ml of an performed with one of the following secondary Abs: Alexa 488 goat anti- overnight culture of V. cholerae diluted in a 1:10 ratio in LB broth. Thirty mouse IgG (1:100; Invitrogen), Dylight 549 goat anti-mouse IgG (1:100; male flies were divided evenly between these three vials. Numbers of vi- Jackson ImmunoResearch Laboratories), or Alexa 488 goat anti-rabbit IgG able flies in each vial were recorded at least once each day. Survival curves (1:200; Invitrogen). The tissues were rinsed again with addition of DAPI (1 were constructed, and log-rank analysis was used to determine statistical mg/ml) to the last wash. Tissues were mounted in Vectashield and exam- significance. Reproducibility of all survival data was confirmed in at least ined using an LSM700 confocal microscope. two independent experiments. Septic injury was used to produce systemic infection for experiments as Microarray analysis noted. In this model, 30 flies were anesthetized with CO and pricked in the 2 RNA was prepared as described above except that 100 flies were used. This dorsal thorax with a fine needle (Fine Science Tools) dipped in a solution RNA was supplied to the Molecular Genetics Core Facility at Children’s containing either fresh LB broth or LB broth harboring an overnight cul- Hospital Boston where it was labeled and hybridized to a GeneChip V. cholerae ture of . After septic injury, flies were returned to food vials, Drosophila Genome 2.0 Array (Affymetrix) according to the manu- where they remained until the specified time. facturer’s instructions. Data analysis was carried out using GeneSpring Measurements of bacterial load software (Silicon Genetics, Redwood City, CA). Statistical significance was determined using a one-way ANOVAwith a threshold p value of 0.05. Quantification of bacterial load within infected flies was assayed as pre- Microarray data have been deposited in the Gene Expression Omnibus viously described (26). After 24 h of V. cholerae ingestion, 10 flies were database (accession no. GSE35439; http://www.ncbi.nlm.nih.gov/geo/). The Journal of Immunology 3995

Results Identification of a transposon-insertion mutant with increased tolerance to oral V. cholerae infection In a forward genetic screen of homozygous viable Drosophila transposon-insertion mutants, we identified a line, P{EPgy2}l(3) 82FdEY04695, that, similar to IMD pathway mutants, showed prolonged survival in the face of oral V. cholerae infection (Fig. 1A) (26). We named this mutant Mustard. The bacterial load of the mtdEY04695 mutant was similar to that of IMD pathway mutants and slightly less than that of control flies (Fig. 1B). Because the mtdEY04695 mutant was comparably susceptible to colonization by V. cholerae but less susceptible to lethal infection than were control flies, we describe it as tolerant to V. cholerae infection (31). Although Relish cleavage proceeds normally, diptericin transcription is decreased in the mtdEY04695 mutant We questioned whether IMD pathway signaling might be blocked EY04695 FIGURE 2. dipt transcription is decreased in the mtdEY04695 mutant. in the mtd mutant. The IMD pathway directly regulates Downloaded from expression of the antimicrobial peptide Diptericin (32). Therefore, qRT-PCR analysis of dipt levels in (A) uninfected and (B) systemically and C EY04695 , to evaluate signaling through the IMD pathway, we compared dipt ( ) orally infected yw (WT) and mtd mutant flies. ***p 0.001 transcription in the mtdEY04695 mutant to that in control flies in the presence and absence of oral or systemic infection with V. chol- a relE20 mutant. This suggests that, in the mtdEY04695 mutant, erae. As shown in Fig. 2, dipt levels were dramatically reduced in signaling through the IMD pathway proceeds past the point of uninfected, orally infected, and systemically infected mtdEY04695 Relish cleavage. http://www.jimmunol.org/ mutant flies. In multiple experiments, Rel68 but not Rel49 appeared to be Because dipt transcription was decreased in the mtdEY04695 increased in the uninfected mtdEY04695 mutant as compared with mutant, we hypothesized that IMD pathway signaling might be control flies. This may suggest that the Rel68 peptide is less blocked prior to Relish cleavage. To examine this possibility, we susceptible to proteolytic degradation in the mtdEY04695 mutant. performed Western analysis on protein extracts derived from EY04695 Similarities and differences in gene regulation in an IMD control flies and mtd mutant flies before and after systemic pathway mutant and the mtdEY04695 mutant infection with V. cholerae. As shown in Fig. 3, Relish and its EY04695 cleavage products were equally abundant in extracts from wild- Because cleavage of Relish proceeds normally in the mtd EY04695 mutant, we questioned whether transcription of other AMPs was type and mtd mutant flies postinfection. As a control, nei- by guest on October 2, 2021 ther full length Relish nor its cleavage products were present in repressed in this mutant. Therefore, we measured the transcript levels of a number of AMPs in flies orally infected with V. cholerae (Fig. 4). Interestingly, although attacin, cecropin, defensin, drosocin, and metchnikowin transcripts were decreased in the IMD pathway mutant, levels of these transcripts in the mtdEY04695 mutant were similar to those in control flies. Transcription of drosomycin, which is regulated by the Toll pathway, was slightly but significantly decreased in both mutants. To determine whether there might be other genes whose transcription was similarly altered in an IMD pathway mutant and the mtdEY04695 mutant, we compared the transcriptomes of orally infected key1 and mtdEY04695 mutant flies with those of w1118

FIGURE 1. The mtdEY04695 mutant phenocopies IMD pathway mutants. (A) Fractional survival during oral V. cholerae infection of the control strain yw (WT), the transposon insertion line mtdEY04695, and the IMD pathway mutants, dreddB118 and key1. Log-rank analysis demonstrated a statistically significant difference between survival of control flies and mtdEY04695 mutants (p , 0.001), key1 mutants (p , 0.001), and dreddB118 mutants (p , 0.05). (B) Bacterial burden of yw, mtdEY04695, dreddB118, and key1. flies after 48 h infection. There was a statistically significant difference in bacterial burden between control flies and mtdEY04695 (p = 0.0022) FIGURE 3. Proteolytic cleavage of Relish is similar in control flies and or key1 (p = 0.0022) mutant flies. However, the difference in bacterial the mtdEY04695 mutant. Western analysis of Relish cleavage fragments in burden between control flies and dreddB118 mutant flies was not statisti- uninfected or infected w1118 (WT), mtdEY04695,orrelE20 flies by probing cally significant (p = 0.0931). with anti-Rel49 (A) and anti-Rel68 Abs (B). 3996 MUSTARD TAILORS IMD PATHWAY OUTPUT

a result of alternative splice sites and alternative promoters (29). Mtd isoforms include one or both of the conserved LysM and TLDc domains encoded within the Mtd locus (Fig. 6A). The LysM domain is present in prokaryotic and eukaryotic proteins that bind carbohydrates such as peptidoglycan and chitin (27, 33–35), whereas the TLDc domain has no known function but has been associated with resistance to oxidative stress (28, 36–41). Eleven of the predicted mtd transcripts include both LysM and TLDc domains (LysM/TLDc), nine of the predicted shorter transcripts include only the TLDc domain (TLDc-only), and one predicted transcript, RD, includes only the LysM domain (LysM-only). Transposon mapping by inverse PCR and subsequent sequence FIGURE 4. Transcript abundance of genes encoding antimicrobial analysis indicated that the P-element was located 200 bp upstream peptides in control flies, an IMD pathway mutant, and a mtdEY04695 mutant of the start codon of a transcript encoding the TLDc-only isoform, orally infected with V. cholerae. qRT-PCR analysis of (A) attacin A (AttA), mtd-RC (Fig. 6A). B C D E ( ) cecropin A (CecA), ( ) defensin (Def), ( ) drososin (Drc), ( ) Given the complexity of the mtd locus, our first goal was to F metchnikowin (Mtk), and ( ) drosomycin (Drom) transcription in control identify mtd transcripts whose abundance was altered in the Drosophila melanogaster (WT), a mtdEY04695 mutant (mtd), and an IMD mtdEY04695 mutant. We hypothesized that the insertion would pathway mutant (key). *p , 0.05. decrease levels of mtd-RC and might also alter the abundance of other mtd transcripts. To test this hypothesis, we identified Downloaded from control flies by microarray analysis. Three hundred ninety-eight amplicons (shown in Fig. 6A) that allowed us to uniquely measure genes were differentially regulated in the mtdEY04695 mutant and 1 the abundance of the TLDc-only transcripts, mtd-RC and mtd-RH, 434 genes were differentially regulated in the key mutant as and the LysM-only transcript mtd-RD. Additionally, we measured compared with control flies. Of these, 40% were similarly regu- EY04695 1 the overall abundance of LysM/TLDc transcripts using primers lated in mtd and key mutant flies (Supplemental Table 1). just downstream of the LysM domain. We compared transcript For a small group of the most highly regulated genes, we con- levels in control flies and the mtdEY04695 mutant. Whereas tran- http://www.jimmunol.org/ firmed the microarray results by qRT-PCR. As shown in Fig. 5, scription of mtd-RC in the mutant was 12-fold less than that in transcript levels of Edin, CG12498, and CG10725 were similarly control flies, levels of mtd-RH and all long transcripts were in- decreased in the two mutants, whereas levels of CG13659 were creased by 66.8 and 37.9%, respectively (Fig. 6B, 6C, 6E). Mtd- increased. The effect of the transposon insertion on the mtd locus is complex The mtdEY04695 mutant harbors a P-element insertion within the mtd locus, which is predicted to encode 20 unique isoforms as by guest on October 2, 2021

FIGURE 6. Impact of the mtdEY04695 insertion on transcription of rep- resentative Mtd transcripts. (A) Diagram of the TLDc-only Mtd transcripts mtd-RH and mtd-RC, the LysM-only transcript mtd-RD, and a representa- tive LysM/TLDc transcript mtd-RB encoded in the mtd locus. Small rec- tangles represent exons. The exons containing the conserved LysM and TLDc domains are labeled and filled in white and black, respectively. Triangles indicate the sites of transposon insertions studied. The box below contains the locations of the amplicons generated in qRT-PCR experiments FIGURE 5. Additional genes that are similarly regulated in an IMD shown in (B)–(E) and the corresponding transcript detected. (B–E) Relative pathway mutant and a mtdEY04695 mutant as compared with control flies transcript levels of mtd-RC, mtd-RH, mtd-RD, and all long transcripts orally infected with V. cholerae. qRT-PCR analysis of (A) edin,(B) (TLDc + LysM) in the mtdEY04695 mutant as compared with yw flies (WT). CG12498,(C) CG10725, and (D) CG13659. *p , 0.05, ***p , 0.001. ***p , 0.001. The Journal of Immunology 3997

FIGURE 7. Overexpression of mtd-RH but not mtd-RC blocks activation of dipt transcription. (A) qRT-PCR measurement of mtd- RC transcript levels in a strain with ubiquitous overexpression of mtd-RC (UAS-Mtd- RC/Da-Gal4) and a driver-only control (+/Da- Gal4). (B) qRT-PCR measurement of dipt transcript levels in a strain with ubiquitous overexpression of mtd-RC (UAS-Mtd-RC/Da- Gal4) and a driver-only control (+/Da-Gal4). (C) Same experiment as (B) performed with ﬂies infected with V. ch ol erae by septic injury. (D) qRT-PCR measurement of mtd-RH transcript levels in a strain with ubiquitous overexpression of mtd-RH (UAS-Mtd-RH/Da- Gal4) and a driver-only control (+/Da-Gal4). (E)qRT-PCRmeasurementofdipt transcript levels in a strain with ubiquitous overexpression of mtd-RH (UAS-Mtd-RH/Da-Gal4) and a driver-only control (+/Da-Gal4). (F)Same experiment as (D) performed with ﬂies infec- Downloaded from ted with V. cholerae by septic injury. *p , 0.05, **p , 0.01, ***p , 0.001.

RD transcription was unchanged in the mtdEY04695 mutant (Fig. rental strain to generate flies with a comparable genetic back- 6D). Based on these data, we concluded that the mtdEY04695 mu- ground. Two independent precise excision lines (EP13 and EP18) tant phenotype could result either from decreased levels of mtd- were studied in detail. http://www.jimmunol.org/ RC or from increased levels of mtd-RH and the longer LysM/ Transcription of both mtd-RC and mtd-RH in the EP13 and TLDc transcripts. EP18 precise excision lines was significantly different from that of Because the mtdEY04695 mutant was more tolerant to oral in- the mtdEY04695 mutant and closer to that of control flies (Supple- fection with V. cholerae, we were particularly interested in mtd mental Fig. 2A, 2B). The dipt transcription in precise excision transcripts that were expressed in the intestine. We found high lines was also closer to that of control flies (Supplemental Fig. levels of mtd-RH, mtd-RC, and full-length transcripts in the in- 2C). We compared the susceptibility of precise excision lines to testine. In contrast, expression of mtd-RD in the intestine was oral V. cholerae infection with that of control flies. The suscep- negligible (Supplemental Fig. 1). Furthermore, oral infection did tibility to infection of both the EP13 and EP18 precise excision by guest on October 2, 2021 not alter the levels of any of the measured transcripts either in lines was significantly greater than that of the mtdEY04695 mutant. whole flies or specifically in the intestine (Supplemental Fig. 1). However, only the susceptibility of the EP18 line approached that of control flies (Supplemental Fig. 2D, 2E). Taken together, these Precise excision suggests that the transposon insertion is results strongly suggest that the P-element insertion in the mtd responsible for the mtdEY04695 mutant phenotype locus is responsible for the phenotype of the mtdEY04695 mutant. We first used sequence analysis to establish that the extremely low EY04695 expression of dipt in the mtdEY04695 mutant was not the result of The mtd mutant phenotype is not due to a decrease in a mutation in the promoter or coding sequence of the dipt gene the mtd-RC transcript (data not shown). We then confirmed that the phenotype of the We hypothesized that the mtdEY04695 mutant phenotype could be mtdEY04695 mutant was, in fact, due to the P-element insertion by due either to a decrease in transcription of mtd-RC or to increased crossing the mtdEY04695 mutant with flies carrying the P-element levels of another transcript. To determine whether decreased mtd transposase. PCR amplification of the insertion site was used to levels could be responsible for the mtdEY04695 mutant phenotype, screen for precise excision lines. This was confirmed by sequence we generated a hemizygous mutant by crossing the mtdEY04695 fly analysis. Precise excision lines were then backcrossed to the pa- line with a deficiency strain lacking the mtd gene region (Df(3R)3-

FIGURE 8. Overexpression of mtd-RH but not mtd-RC increases tolerance to oral V. cholerae infection. Fractional survival of flies with (A) ubiquitous expression of mtd-RC (UAS-Mtd-RC/Da-Gal4) or mtd-RH (UAS-Mtd-RH/Da-Gal4) compared with driver-only control flies (+/Da-Gal4) and (B) midgut- only expression of mtd-RC (UAS-Mtd-RC/NP1-Gal4) or mtd-RH (UAS-Mtd-RH/NP1-Gal4) compared with driver-only control flies (+/NP1-Gal4). Log- rank analysis demonstrated a statistically significant difference between survival of control flies and flies expressing mtd-RH either ubiquitously (p , 0.0001) or in the midgut alone (p , 0.0001) but not between survival of control flies and flies expressing mtd-RC ubiquitously (p . 0.05) or in the midgut alone (p . 0.05). 3998 MUSTARD TAILORS IMD PATHWAY OUTPUT

4, Df). As expected, transcription of mtd-RC in the resulting transgenic flies carrying a similar mtd-RC construct. Mtd isoform hemizygous fly (mtdEY04695/Df) was decreased (Supplemental Fig. C (Mtd-PC) differs from isoform H (Mtd-PH) only by the pres- 3A). However, dipt transcription in this hemizygote was similar to ence of 70 additional amino acids at its N terminus. that of the heterozygote control (Supplemental Fig. 3B). Fur- When induced by the ubiquitous driver Daughterless (Da-Gal4), thermore, susceptibility to V. cholerae infection was comparable transcription of mtd-RC and mtd-RH increased .10-fold in to that of control flies (Supplemental Fig. 3C). This suggested to comparison with the Gal4 control (Fig. 7A, 7D). Overexpression us that a decrease in the level of the mtd-RC transcript was not the of mtd-RC did not alter dipt transcription either in uninfected or basis of the mtdEY04695 mutant phenotype. systemically infected flies (Fig. 7B, 7C). In contrast, overex- To further support this conclusion, we examined a series of pression of mtd-RH significantly repressed dipt transcription in mutants from the Harvard Exelixis stock collection carrying uninfected and systemically infected flies (Figs. 7E, 7F). insertions in the mtd locus (Fig. 6A). In these mutants, levels of the We also tested the susceptibility of these flies to V. cholerae mtd-RC and LysM/TLDc transcripts were reduced, whereas mtd- infection. Overexpression of mtd-RH but not mtd-RC both ubiq- RH transcription was not altered (Supplemental Fig. 3D–F). In uitously and in the midgut prolonged survival (Fig. 8). These contrast to the mtdEY04695 mutant, these mutants were all more results support the conclusion that the phenotype of the mtdEY04695 susceptible to infection (Supplemental Fig. 3G). Taken together, mutant is due, at least in part, to an increase in the level of the these results suggest that the mtdEY04695 phenotype is not the re- mtd-RH transcript. sult of a decrease in mtd-RC transcription. Mtd-PC and Mtd-PH exhibit distinct subcellular distributions Overexpression of mtd-RH but not mtd-RC phenocopies the EY04695 Mtd-PC and Mtd-PH differ only in 70 aas at their N termini; mtd mutant however, overexpression of these two proteins leads to very dif- Downloaded from Next, we examined the possibility that the mtdEY04695 phenotype ferent effects on IMD pathway signaling and resistance to oral might result from an increase in the level of mtd-RH. We con- infection. Because Rel68 relocates to the nucleus, we hypothesized firmed the presence of RC and RH transcripts and generated that the different functions of these two transcripts could be the transgenic flies encoding a wild-type mtd-RH allele downstream result of distinct subcellular distributions. To examine this hy- of a UAS element controlled by Gal4. As a control, we generated http://www.jimmunol.org/ by guest on October 2, 2021

FIGURE 10. Overexpression of mtd-RH does not prevent nuclear localization of Rel68 in the larval fat body but does rescue the eclosion- lethal phenotype resulting from overexpression of rel68. Immunofluores- cence of larval fat bodies overexpressing (A) rel68-FLAG (Rel68), (B) rel68-FLAG and mtd-RC-HA (Rel68 + Mtd-RC), or (C) rel68-FLAG and mtd-RH-HA (Rel68 + Mtd-RH) driven by Da-Gal4. Nuclei are stained FIGURE 9. Mtd-PH is nuclearly localized, whereas Mtd-PC is excluded with DAPI. Scale bars, 10 mm. (D) Images of the eclosion phenotypes in from the nucleus. Immunofluorescence of Mtd-PC-HA (A) and Mtd-PH- flies expressing rel68, rel68, and mtd-RC together (Rel68 + Mtd-RC), or HA (B) in the adult midgut. Immunofluorescence of Mtd-PC-HA (C) and rel68 and mtd-RH together (Rel68 + Mtd-RH) driven by Da-Gal4. The Mtd-PH-HA (D) in the larval fat body. In all cases, expression was driven images were taken with a 23 objective. (E) Quantification of the fraction by Da-Gal4. The tagged protein is visualized with Alexa 488 (green), and of abnormal pupa in flies overexpressing rel68 (Rel68), rel68, and mtd-RC nuclear DNA is stained with DAPI (blue). The mosaic pattern of expres- (Rel68 + Mtd-RC), or rel68 and mtd-RH (Rel68 + Mtd-RH) driven by Da- sion is a characteristic of the Da-Gal4 driver. Scale bars, 20 mm. Gal4. ***p , 0.001 as compared with rel68 overexpression alone. The Journal of Immunology 3999 pothesis, we generated flies carrying wild-type mtd-RC or mtd-RH intestinal epithelium against oxidative stress. However, RNA alleles with a C-terminal human influenza HA tag added down- interference knockdown of the dual oxidase transcript, over- stream of a Gal4-UAS promoter. We used the Da-Gal4 driver to expression of the immune regulated catalase, and oral adminis- express these proteins in the midgut. Interestingly, although Da- tration of glutathione did not prolong survival of orally infected Gal4 is considered a ubiquitous driver, the transgenes were not control flies (data not shown), suggesting that ROS itself is not equally expressed in all midgut epithelial cells, leading to a mo- an important factor in fly mortality and that Mtd does not in- saic pattern (Fig. 9). A similar pattern was noted when Da-Gal4 crease host tolerance by directly or indirectly scavenging ROS was used to drive a UAS-GFP transgene, demonstrating that this generated by the host immune response. However, it is possible mosaic pattern of expression is not specific to Mtd (data not that oxidation of Mtd by host-derived ROS could modulate its shown). function. Mtd-PC and Mtd-PH were visualized by immunofluorescence We also considered that the low level of diptericin transcription both in the larval fat body and in the adult midgut. Whereas isoform in the mtd mutant reflected a less invasive infection leading to C was observed exclusively in the cytoplasm of larval fat body and decreased activation of the IMD pathway. However, we observed adult midgut epithelial cells (Fig. 9A, 9C), isoform H was also that, in oral infection, the abundance of other IMD-regulated AMP present in the nucleus (Fig. 9B, 9D). Thus, despite the high sim- transcripts was similar to that of control flies, suggesting that ilarity of Mtd-PC and Mtd-PH, these proteins have distinct dis- the IMD pathway is similarly activated in control and mtdEY04695 tributions within the cell. This is likely the basis for their distinct mutant flies. Alternative mechanisms for the observed effect of effects on targets of the IMD pathway. Mtd-PH on transcription of genes in the Relish regulon include 1) interaction with Rel68 at specific promoters, 2) interaction with mtd-RH rescues the eclosion defect that results from rel68 Downloaded from DNA at a subset of Rel68-regulated promoters, 3) interaction with overexpression another protein that modulates transcription of genes in the Relish To determine whether Mtd-PC or Mtd-PH altered the subcellular regulon, or 4) direct modulation of transcription of a protein that distribution of Rel68, we coexpressed tagged alleles of mtd-RH affects Relish function by binding to DNA. These hypotheses are and rel68 and visualized the subcellular locations of these two currently under investigation. proteins in larval fat body cells by immunofluorescence. As shown The loci encoding the two human homologs of Mtd, Oxr1 and in Fig. 10A–C, neither Mtd-PC nor Mtd-PH blocked nuclear lo- NCOA7, are also predicted to give rise to multiple transcripts and http://www.jimmunol.org/ calization of Rel68. However, while rearing Rel68 overexpression isoforms (28, 38, 40, 45). Interestingly, although there is consid- flies, we noticed that although these flies developed normally, erable variability in the central regions of the fly and human many of them were unable to eclose (Figure 10D, 10E). Inter- homologs, the LysM and TLDc domains of these proteins are estingly, co-overexpression of mtd-RH and rel68 rescued this .50% identical. Furthermore, the TLDc domains of these proteins eclosion defect. Coexpression of mtd-RC with rel68 did not mit- are much more similar to each other than they are to other TLDc igate the eclosion defect and, in fact, appeared to exacerbate it. domain-containing proteins in their respective genomes, suggest- These data support a genetic interaction of Mtd-PH but not Mtd- ing that they may function similarly in flies and humans. There- PC with the NF-kB homolog Relish. fore, this work provides a rationale for the systematic investigation by guest on October 2, 2021 of the short isoforms of Oxr1 and NCOA7. Such studies may yield Discussion additional nuclearly localized isoforms that have new and im- In a screen for factors that alter Drosophila susceptibility to oral V. portant functions in regulation of gene transcription and modu- cholerae infection, we identified an infection-tolerant transposon- lation of the innate immune response in mammals. insertion mutant in the complex l(3)82Fd locus, which we have renamed mustard (mtd). Subsequent experiments suggested that Acknowledgments the phenotype of this mutant was the result of increased expres- We acknowledge Drs. Neil Silverman, Norbert Perrimon, Lorri Marek, Jon sion of a short Mtd transcript containing only a TLDc domain. The Kagan, Alexandra Purdy, and Michael Volkert for helpful discussions dur- mtd locus was previously described as an ecdysone-activated, late ing the course of this work. We also thank Drs. Neil Silverman, Norbert puff gene whose mutation led to the inability of adult flies to Perrimon, Svenja Stoven, Won Jae Lee, and the Exelixis Collection at Har- eclose (42, 43). It encodes at least 20 unique isoforms, including vard Medical School for providing fly stocks and Dr. Qing Ji for valuable a LysM-only isoform, several TLDc-only isoforms, and several contributions to program development and data processing. Microscopy was with both domains. In this study, we report a novel function for performed at the Intellectual and Developmental Disabilities Research Cen- a short, nuclearly localized Mtd isoform in tailoring of the IMD ter Imaging Core, Children’s Hospital Boston with expertise provided pathway-activated innate immune response. by Lihong Bu and Anthony Hill. The Molecular Genetics Core Facility The Mtd homolog Oxr1 has been shown to protect cells against at Children’s Hospital Boston carried out microarray hybridizations. reactive oxygen species (ROS), which are produced during intestinal infection as well as in neurodegenerative disease, by in- Disclosures creasing the transcription of genes that scavenge ROS such as The authors have no financial conflicts of interest. catalase and glutathione peroxidase (9, 41, 44). Furthermore, investigators have shown that C753 of the mouse Mtd homolog itself can be oxidized by H2O2 (41). This residue (C167) is con- References served in Mtd-PH. We previously showed that breakdown of the 1. Aggrawal, K., and N. Silverman. 2007. Peptidoglycan recognition in Drosophila. Biochem. Soc. Trans. 35: 1496–1500. Drosophila midgut epithelium occurs during V. cholerae infection 2. Kim, T., and Y. J. Kim. 2005. Overview of innate immunity in Drosophila. J. of wild-type Drosophila and presented evidence that increased cell Biochem. Mol. Biol. 38: 121–127. turnover within the intestines of IMD pathway mutants might 3. Ashok, Y. 2009. Drosophila Toll pathway: the new model. Sci. Signal. 2: jc1. 4. Ganesan, S., K. Aggarwal, N. Paquette, and N. Silverman. 2011. NF-kB/Rel enhance tolerance to infection (26). Therefore, we initially hy- proteins and the humoral immune responses of Drosophila melanogaster. pothesized that breakdown of the fly intestinal epithelium during Curr. Top. Microbiol. Immunol. 349: 25–60. 5. Sto¨ven, S., I. Ando, L. Kadalayil, Y. Engstro¨m, and D. Hultmark. 2000. Acti- V. cholerae infection was the result of ROS production by dual vation of the Drosophila NF-kB factor Relish by rapid endoproteolytic cleavage. oxidase and that Mtd increased host tolerance by protecting the EMBO Rep. 1: 347–352. 4000 MUSTARD TAILORS IMD PATHWAY OUTPUT

6. Stoven, S., N. Silverman, A. Junell, M. Hedengren-Olcott, D. Erturk, 25. Blow, N. S., R. N. Salomon, K. Garrity, I. Reveillaud, A. Kopin, F. R. Jackson, Y. Engstrom, T. Maniatis, and D. Hultmark. 2003. Caspase-mediated processing and P. I. Watnick. 2005. Vibrio cholerae infection of Drosophila melanogaster of the Drosophila NF-kB factor Relish. Proc. Natl. Acad. Sci. USA 100: 5991–5996. mimics the human disease cholera. PLoS Pathog. 1: e8. 7. Ertu¨rk-Hasdemir, D., M. Broemer, F. Leulier, W. S. Lane, N. Paquette, 26. Berkey, C. D., N. Blow, and P. I. Watnick. 2009. Genetic analysis of Drosophila D. Hwang, C. H. Kim, S. Sto¨ven, P. Meier, and N. Silverman. 2009. Two roles melanogaster susceptibility to intestinal Vibrio cholerae infection. Cell. Micro- for the Drosophila IKK complex in the activation of Relish and the induction of biol. 11: 461–474. antimicrobial peptide genes. Proc. Natl. Acad. Sci. USA 106: 9779–9784. 27. Buist, G., A. Steen, J. Kok, and O. P. Kuipers. 2008. LysM, a widely distributed 8. Ha, E. M., K. A. Lee, Y. Y. Seo, S. H. Kim, J. H. Lim, B. H. Oh, J. Kim, and protein motif for binding to (peptido)glycans. Mol. Microbiol. 68: 838–847. W. J. Lee. 2009. Coordination of multiple dual oxidase-regulatory pathways in 28. Durand, M., A. Kolpak, T. Farrell, N. A. Elliott, W. Shao, M. Brown, and responses to commensal and infectious microbes in drosophila gut. Nat. M. R. Volkert. 2007. The OXR domain defines a conserved family of eukaryotic Immunol. 10: 949–957. oxidation resistance proteins. BMC Cell Biol. 8: 13. 9. Ha, E. M., C. T. Oh, Y. S. Bae, and W. J. Lee. 2005. A direct role for dual oxidase 29. McQuilton, P., S. E. St Pierre, and J. Thurmond; FlyBase Consortium. 2012. in Drosophila gut immunity. Science 310: 847–850. FlyBase 101: the basics of navigating FlyBase. Nucleic Acids Res. 40(Database 10. Ryu, J. H., E. M. Ha, C. T. Oh, J. H. Seol, P. T. Brey, I. Jin, D. G. Lee, J. Kim, issue): D706–D714. D. Lee, and W. J. Lee. 2006. An essential complementary role of NF-kBpathwayto 30. Waldor, M. K., R. Colwell, and J. J. Mekalanos. 1994. The Vibrio cholerae O139 microbicidal oxidants in Drosophila gut immunity. EMBO J. 25: 3693–3701. serogroup antigen includes an O-antigen capsule and lipopolysaccharide viru- 11. Buchon, N., N. A. Broderick, M. Poidevin, S. Pradervand, and B. Lemaitre. lence determinants. Proc. Natl. Acad. Sci. USA 91: 11388–11392. 2009. Drosophila intestinal response to bacterial infection: activation of host 31. Ayres, J. S., and D. S. Schneider. 2012. Tolerance of infections. Annu. Rev. defense and stem cell proliferation. Cell Host Microbe 5: 200–211. Immunol. 30: 271–294. 12. Ryu, J. H., S. H. Kim, H. Y. Lee, J. Y. Bai, Y. D. Nam, J. W. Bae, D. G. Lee, 32. Tanji, T., X. Hu, A. N. Weber, and Y. T. Ip. 2007. Toll and IMD pathways S. C. Shin, E. M. Ha, and W. J. Lee. 2008. Innate immune homeostasis by the synergistically activate an innate immune response in Drosophila melanogaster. homeobox gene caudal and commensal-gut mutualism in Drosophila. Science Mol. Cell. Biol. 27: 4578–4588. 319: 777–782. 33. Heilmann, C., G. Thumm, G. S. Chhatwal, J. Hartleib, A. Ueko¨tter, and 13. Gesellchen, V., D. Kuttenkeuler, M. Steckel, N. Pelte, and M. Boutros. 2005. An G. Peters. 2003. Identification and characterization of a novel autolysin (Aae) RNA interference screen identifies inhibitor of apoptosis protein 2 as a regulator with adhesive properties from Staphylococcus epidermidis. Microbiology 149: of innate immune signalling in Drosophila. EMBO Rep. 6: 979–984. 2769–2778. 14. Lhocine, N., P. S. Ribeiro, N. Buchon, A. Wepf, R. Wilson, T. Tenev, 34. de Jonge, R., H. P. van Esse, A. Kombrink, T. Shinya, Y. Desaki, R. Bours, S. van Downloaded from B. Lemaitre, M. Gstaiger, P. Meier, and F. Leulier. 2008. PIMS modulates im- der Krol, N. Shibuya, M. H. Joosten, and B. P. Thomma. 2010. Conserved fungal mune tolerance by negatively regulating Drosophila innate immune signaling. LysM effector Ecp6 prevents chitin-triggered immunity in plants. Science 329: Cell Host Microbe 4: 147–158. 953–955. 15. Aggarwal, K., F. Rus, C. Vriesema-Magnuson, D. Ertu¨rk-Hasdemir, N. Paquette, 35. Zhang, X. C., S. B. Cannon, and G. Stacey. 2009. Evolutionary genomics of and N. Silverman. 2008. Rudra interrupts receptor signaling complexes to neg- LysM genes in land plants. BMC Evol. Biol. 9: 183. atively regulate the IMD pathway. PLoS Pathog. 4: e1000120. 36. Brandt, S. M., G. Jaramillo-Gutierrez, S. Kumar, C. Barillas-Mury, and 16. Maillet, F., V. Bischoff, C. Vignal, J. Hoffmann, and J. Royet. 2008. The Dro- D. S. Schneider. 2008. Use of a Drosophila model to identify genes regulating

sophila peptidoglycan recognition protein PGRP-LF blocks PGRP-LC and IMD/ Plasmodium growth in the mosquito. Genetics 180: 1671–1678. http://www.jimmunol.org/ JNK pathway activation. Cell Host Microbe 3: 293–303. 37. Shkolnik, K., S. Ben-Dor, D. Galiani, A. Hourvitz, and N. Dekel. 2008. Mo- 17. Kleino, A., H. Myllyma¨ki, J. Kallio, L. M. Vanha-aho, K. Oksanen, J. Ulvila, lecular characterization and bioinformatics analysis of Ncoa7B, a novel D. Hultmark, S. Valanne, and M. Ra¨met. 2008. Pirk is a negative regulator of the ovulation-associated and reproduction system-speciﬁc Ncoa7 isoform. Repro- Drosophila Imd pathway. J. Immunol. 180: 5413–5422. duction 135: 321–333. 18. Ryu, J. H., K. B. Nam, C. T. Oh, H. J. Nam, S. H. Kim, J. H. Yoon, J. K. Seong, 38. Elliott, N. A., and M. R. Volkert. 2004. Stress induction and mitochondrial lo- M. A. Yoo, I. H. Jang, P. T. Brey, and W. J. Lee. 2004. The homeobox gene calization of Oxr1 proteins in yeast and humans. Mol. Cell. Biol. 24: 3180–3187. Caudal regulates constitutive local expression of antimicrobial peptide genes in 39. Fischer, H., X. U. Zhang, K. P. O’Brien, P. Kylsten, and E. Engvall. 2001. C7, Drosophila epithelia. Mol. Cell. Biol. 24: 172–185. a novel nucleolar protein, is the mouse homologue of the Drosophila late puff 19. Reidl, J., and K. E. Klose. 2002. Vibrio cholerae and cholera: out of the water product L82 and an isoform of human OXR1. Biochem. Biophys. Res. Commun. and into the host. FEMS Microbiol. Rev. 26: 125–139. 281: 795–803. 20. Shukla, B. N., D. V. Singh, and S. C. Sanyal. 1995. Attachment of non-culturable 40. Volkert, M. R., N. A. Elliott, and D. E. Housman. 2000. Functional genomics

toxigenic Vibrio cholerae O1 and non-O1 and Aeromonas spp. to the aquatic reveals a family of eukaryotic oxidation protection genes. Proc. Natl. Acad. Sci. by guest on October 2, 2021 arthropod Gerris spinolae and plants in the River Ganga, Varanasi. FEMS USA 97: 14530–14535. Immunol. Med. Microbiol. 12: 113–120. 41. Oliver, P. L., M. J. Finelli, B. Edwards, E. Bitoun, D. L. Butts, E. B. Becker, 21. Colwell, R. R., A. Huq, M. S. Islam, K. M. Aziz, M. Yunus, N. H. Khan, M. T. Cheeseman, B. Davies, and K. E. Davies. 2011. Oxr1 is essential for A. Mahmud, R. B. Sack, G. B. Nair, J. Chakraborty, et al. 2003. Reduction of protection against oxidative stress-induced neurodegeneration. PLoS Genet. 7: cholera in Bangladeshi villages by simple filtration. Proc. Natl. Acad. Sci. USA e1002338. 100: 1051–1055. 42. Thummel, C. S. 2002. Ecdysone-regulated puff genes 2000. Insect Biochem. 22. Fotedar, R. 2001. Vector potential of houseflies (Musca domestica) in the Mol. Biol. 32: 113–120. transmission of Vibrio cholerae in India. Acta Trop. 78: 31–34. 43. Stowers, R. S., S. Russell, and D. Garza. 1999. The 82F late puff contains the 23. Halpern, M., Y. B. Broza, S. Mittler, E. Arakawa, and M. Broza. 2004. Chi- L82 gene, an essential member of a novel gene family. Dev. Biol. 213: 116–130. ronomid egg masses as a natural reservoir of Vibrio cholerae non-O1 and non- 44. Jaramillo-Gutierrez, G., A. Molina-Cruz, S. Kumar, and C. Barillas-Mury. 2010. O139 in freshwater habitats. Microb. Ecol. 47: 341–349. The Anopheles gambiae oxidation resistance 1 (OXR1) gene regulates expres- 24. Broza, M., H. Gancz, M. Halpern, and Y. Kashi. 2005. Adult non-biting midges: sion of enzymes that detoxify reactive oxygen species. PLoS ONE 5: e11168. possible windborne carriers of Vibrio cholerae non-O1 non-O139. Environ. 45. Shao, W., S. Halachmi, and M. Brown. 2002. ERAP140, a conserved tissue- Microbiol. 7: 576–585. specific nuclear receptor coactivator. Mol. Cell. Biol. 22: 3358–3372.