DOCSLIB.ORG

Table S11. Genes Differentially Expressed in Seawater Arctic Charr

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Table S11. Genes Differentially Expressed in Seawater Arctic Charr Table S11. Genes differentially expressed in seawater Arctic charr (Salvelinus alpinus) gill tissue for family 10 that are located within 40 kbp of one another on stickleback (Gasterosteus aculeatus) chromosomes. Ga Start End Gene C # # G ER Chr. (Mbp) (Mbp) Symbol ENSGACG Gene Description 1 2 - II 11.375629 11.389195 GCOM1 15829 GRINL1A complex locus 1 [Source:HGNC Symbol;Acc:26424] - II 11.422567 11.478619 TCF12 15831 transcription factor 12 [Source:HGNC Symbol;Acc:11623] 2 2 - II 11.605084 11.609951 FAM65A (2 of 2) 15863 family with sequence similarity 65, member A [Source:HGNC Symbol;Acc:25836] + II 11.613372 11.616719 CTCF (2 of 2) 15865 CCCTC-binding factor (zinc finger protein) [Source:HGNC Symbol;Acc:13723] 3 2 - II 11.794052 11.818684 FURIN (1 of 2) 15911 furin (paired basic amino acid cleaving enzyme) [Source:HGNC Symbol;Acc:8568] - II 11.842600 11.848089 RHCG (2 of 2) 15923 Rh family, C glycoprotein [Source:HGNC Symbol;Acc:18140] minichromosome maintenance complex component 6 [Source:HGNC 4 2 + III 0.042337 0.047073 MCM6 12377 Symbol;Acc:6949] - III 0.050881 0.052959 CXCR4 (2 of 2) 12386 chemokine (C-X-C motif) receptor 4 [Source:HGNC Symbol;Acc:2561] 5 2 + III 8.582456 8.586301 NR2F6 (1 of 2) 15583 nuclear receptor subfamily 2, group F, member 6 [Source:HGNC Symbol;Acc:7977] + III 8.606524 8.616555 15590 6 2 + IV 0.975199 0.979549 16381 minichromosome maintenance complex component 7 [Source:HGNC + IV 0.989900 0.996481 MCM7 16398 Symbol;Acc:6950] solute carrier family 30 (zinc transporter), member 9 [Source:HGNC 7 2 - IV 8.060100 8.066467 SLC30A9 17554 Symbol;Acc:1329] - IV 8.068088 8.074516 GSR 17557 glutathione reductase [Source:HGNC Symbol;Acc:4623] NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q 8 2 - IV 9.217179 9.221203 NDUFS8 (1 of 2) 17764 reductase) [Source:HGNC Symbol;Acc:7715] + IV 9.245999 9.256786 SSRP1 17801 structure specific recognition protein 1 [Source:HGNC Symbol;Acc:11327] 9 2 - IV 11.715125 11.716496 C1QTNF2 18143 C1q and tumor necrosis factor related protein 2 [Source:HGNC Symbol;Acc:14325] - IV 11.755003 11.767757 ATP7A 18161 ATPase, Cu++ transporting, alpha polypeptide [Source:HGNC Symbol;Acc:869] 10 2 + V 8.786189 8.791902 CEP55 6663 centrosomal protein 55kDa [Source:HGNC Symbol;Acc:1161] - V 8.794308 8.796691 RBP4 6673 retinol binding protein 4, plasma [Source:HGNC Symbol;Acc:9922] 11 2 + V 9.782975 9.788580 MMP25 7839 matrix metallopeptidase 25 [Source:HGNC Symbol;Acc:14246] - V 9.789146 9.793419 7849 potassium channel tetramerisation domain containing 5 [Source:HGNC 12 2 + V 10.845959 10.854423 KCTD5 8924 Symbol;Acc:21423] + V 10.867443 10.875176 C7orf50 8975 chromosome 7 open reading frame 50 [Source:HGNC Symbol;Acc:22421] 13 2 + VI 14.319276 14.327176 KIF11 11110 kinesin family member 11 [Source:HGNC Symbol;Acc:6388] - VI 14.351690 14.358209 SULT6B1 11156 sulfotransferase family, cytosolic, 6B, member 1 [Source:HGNC Symbol;Acc:33433] Ga Start End Gene C # # G ER Chr. (Mbp) (Mbp) Symbol ENSGACG Gene Description 14 2 + VII 19.401048 19.401119 SNORD65 22375 Small nucleolar RNA SNORD65 [Source:RFAM;Acc:RF00571] + VII 19.401751 19.401824 SNORD65 22376 Small nucleolar RNA SNORD65 [Source:RFAM;Acc:RF00571] 15 2 + VII 19.937626 19.971002 FRY (2 of 2) 20551 furry homolog (Drosophila) [Source:HGNC Symbol;Acc:20367] + VII 20.006248 20.008918 RFC3 20554 replication factor C (activator 1) 3, 38kDa [Source:HGNC Symbol;Acc:9971] 16 2 - VIII 0.727890 0.736429 3046 + VIII 0.737555 0.742548 3052 17 2 + VIII 2.095817 2.111218 TPRG1 3852 tumor protein p63 regulated 1 [Source:HGNC Symbol;Acc:24759] + VIII 2.120808 2.122478 AATF 3882 apoptosis antagonizing transcription factor [Source:HGNC Symbol;Acc:19235] 18 2 + VIII 11.686865 11.691542 LSG1 9323 large subunit GTPase 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:25652] - VIII 11.692873 11.693913 FAM43A 9337 family with sequence similarity 43, member A [Source:HGNC Symbol;Acc:26888] 19 3 + VIII 19.010290 19.014567 CHAF1A 14428 chromatin assembly factor 1, subunit A (p150) [Source:HGNC Symbol;Acc:1910] + VIII 19.018011 19.024558 UBXN6 14431 UBX domain protein 6 [Source:HGNC Symbol;Acc:14928] + VIII 19.058633 19.063046 SERBP1 (1 of 2) 14467 SERPINE1 mRNA binding protein 1 [Source:HGNC Symbol;Acc:17860] 20 2 - IX 4.852741 4.874111 16669 - IX 4.859254 4.872299 16687 21 2 + IX 5.418267 5.430482 FAM193A 16832 family with sequence similarity 193, member A [Source:HGNC Symbol;Acc:16822] + IX 5.435213 5.437268 TNIP2 16837 TNFAIP3 interacting protein 2 [Source:HGNC Symbol;Acc:19118] 22 2 +/- IX 14.766588 14.767493 18877 +/- IX 14.773354 14.774187 18880 23 2 + X 2.034216 2.038495 SRSF4 2389 serine/arginine-rich splicing factor 4 [Source:HGNC Symbol;Acc:10786] + X 2.048132 2.052324 2413 24 2 + X 9.860314 9.861991 HOXA2 (1 of 2) 7090 homeobox A2 [Source:HGNC Symbol;Acc:5103] - X 9.866271 9.869714 HOXA3 7094 homeobox A3 [Source:HGNC Symbol;Acc:5104] 25 3 - X 14.681072 14.685142 TMEM65 (1 of 2) 9573 transmembrane protein 65 [Source:HGNC Symbol;Acc:25203] - X 14.688813 14.709542 MTSS1 (2 of 2) 9593 metastasis suppressor 1 [Source:HGNC Symbol;Acc:20443] - X 14.747980 14.771097 9653 26 2 + XI 1.282516 1.288019 COIL 5339 coilin [Source:HGNC Symbol;Acc:2184] + XI 1.295931 1.300251 ENGASE 5388 endo-beta-N-acetylglucosaminidase [Source:HGNC Symbol;Acc:24622] 27 2 - XI 2.627552 2.637707 6215 - XI 2.655509 2.658968 6228 28 2 + XI 12.567980 12.570256 ERAS 12896 ES cell expressed Ras [Source:HGNC Symbol;Acc:5174] Ga Start End Gene C # # G ER Chr. (Mbp) (Mbp) Symbol ENSGACG Gene Description polymerase (DNA directed), delta 1, catalytic subunit [Source:HGNC + XI 12.570916 12.579298 POLD1 12911 Symbol;Acc:9175] 29 2 + XI 13.506470 13.516007 TYK2 13787 tyrosine kinase 2 [Source:HGNC Symbol;Acc:12440] + XI 13.517054 13.523523 13818 30 2 + XII 10.049636 10.051951 GPR61 (1 of 2) 7810 G protein-coupled receptor 61 [Source:HGNC Symbol;Acc:13300] + XII 10.081862 10.084000 7830 31 2 - XII 10.763216 10.767443 G6PD (2 of 2) 8614 glucose-6-phosphate dehydrogenase [Source:HGNC Symbol;Acc:4057] - XII 10.768324 10.773457 8620 src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation 32 2 - XII 12.968113 12.976463 SRMS 10298 sites [Source:HGNC Symbol;Acc:11298] pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish) - XII 12.996899 13.000505 PPDPF (1 of 2) 10310 [Source:HGNC Symbol;Acc:16142] 33 2 - XII 15.200347 15.204783 GDI1 11384 GDP dissociation inhibitor 1 [Source:HGNC Symbol;Acc:4226] inter-alpha-trypsin inhibitor heavy chain family, member 6 [Source:HGNC - XII 15.207911 15.214798 ITIH6 11406 Symbol;Acc:28907] Rho guanine nucleotide exchange factor (GEF) 28 [Source:HGNC 34 2 - XIII 1.800877 1.831918 ARHGEF28 4374 Symbol;Acc:30322] + XIII 1.863747 1.869084 AGPAT9 4452 1-acylglycerol-3-phosphate O-acyltransferase 9 [Source:HGNC Symbol;Acc:28157] 35 2 - XIII 3.898678 3.912857 Sep-05 5538 septin 5 [Source:HGNC Symbol;Acc:9164] + XIII 3.944131 3.948474 CDC45 5574 cell division cycle 45 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:1739] 36 2 + XIII 8.683680 8.691483 EWSR1 8603 Ewing sarcoma breakpoint region 1 [Source:HGNC Symbol;Acc:3508] + XIII 8.691995 8.693226 RHBDD3 8626 rhomboid domain containing 3 [Source:HGNC Symbol;Acc:1308] 37 2 + XIV 6.916359 6.921808 MAT2A (2 of 2) 17156 methionine adenosyltransferase II, alpha [Source:HGNC Symbol;Acc:6904] + XIV 6.931758 6.938344 17166 38 2 + XIV 10.212476 10.220709 KIAA0020 17878 KIAA0020 [Source:HGNC Symbol;Acc:29676] + XIV 10.227780 10.257484 VLDLR 17886 very low density lipoprotein receptor [Source:HGNC Symbol;Acc:12698] 39 2 - XIV 14.386348 14.395337 18468 - XIV 14.398698 14.411000 SH3GLB2 (2 of 2) 18470 SH3-domain GRB2-like endophilin B2 [Source:HGNC Symbol;Acc:10834] 40 3 + XIX 3.052440 3.058328 KLHDC4 3198 kelch domain containing 4 [Source:HGNC Symbol;Acc:25272] solute carrier family 7 (amino acid transporter light chain, L system), member 5 + XIX 3.070008 3.081445 SLC7A5 3209 [Source:HGNC Symbol;Acc:11063] - XIX 3.108408 3.114404 LCAT 3242 lecithin-cholesterol acyltransferase [Source:HGNC Symbol;Acc:6522] 41 3 - XV 5.566137 5.574768 FGFRL1 (1 of 2) 8282 fibroblast growth factor receptor-like 1 [Source:HGNC Symbol;Acc:3693] Ga Start End Gene C # # G ER Chr. (Mbp) (Mbp) Symbol ENSGACG Gene Description transforming, acidic coiled-coil containing protein 3 [Source:HGNC + XV 5.576413 5.581458 TACC3 8294 Symbol;Acc:11524] + XV 5.584365 5.594649 KIF15 8300 kinesin family member 15 [Source:HGNC Symbol;Acc:17273] cleavage and polyadenylation specific factor 3, 73kDa [Source:HGNC 42 2 + XV 6.135762 6.140354 CPSF3 (2 of 2) 8929 Symbol;Acc:2326] ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 [Source:HGNC + XV 6.146115 6.183986 ASAP2 (1 of 2) 8955 Symbol;Acc:2721] 43 2 + XVI 1.700437 1.705166 DDX18 1563 DEAD (Asp-Glu-Ala-Asp) box polypeptide 18 [Source:HGNC Symbol;Acc:2741] + XVI 1.707019 1.718011 1577 44 2 + XVI 6.436768 6.447555 WDR75 2705 WD repeat domain 75 [Source:HGNC Symbol;Acc:25725] solute carrier family 40 (iron-regulated transporter), member 1 [Source:HGNC - XVI 6.452754 6.457586 SLC40A1 2715 Symbol;Acc:10909] 45 3 - XVI 7.809993 7.814079 CARKD 3514 carbohydrate kinase domain containing [Source:HGNC Symbol;Acc:25576] - XVI 7.820982 7.852127 COL4A2 3532 collagen, type IV, alpha 2 [Source:HGNC Symbol;Acc:2203] - XVI 7.880804 7.897351 COL4A1 3548 collagen, type IV, alpha 1 [Source:HGNC Symbol;Acc:2202] tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta 46 2 + XVII 0.805182 0.813396 YWHAB (1 of 2) 3522 polypeptide [Source:HGNC Symbol;Acc:12849] + XVII 0.830417 0.835546 3559 UTP3, small subunit (SSU) processome component, homolog (S.
Load more

Recommended publications
  • Allele-Specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish
    Allele-specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish by Ailu Chen A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Auburn, Alabama August 1, 2015 Keywords: catfish, interspecific hybrids, allele-specific expression, ribosomal protein Copyright 2015 by Ailu Chen Approved by Zhanjiang Liu, Chair, Professor, School of Fisheries, Aquaculture and Aquatic Sciences Nannan Liu, Professor, Entomology and Plant Pathology Eric Peatman, Associate Professor, School of Fisheries, Aquaculture and Aquatic Sciences Aaron M. Rashotte, Associate Professor, Biological Sciences Abstract Interspecific hybridization results in a vast reservoir of allelic variations, which may potentially contribute to phenotypical enhancement in the hybrids. Whether the allelic variations are related to the downstream phenotypic differences of interspecific hybrid is still an open question. The recently developed genome-wide allele-specific approaches that harness high- throughput sequencing technology allow direct quantification of allelic variations and gene expression patterns. In this work, I investigated allele-specific expression (ASE) pattern using RNA-Seq datasets generated from interspecific catfish hybrids. The objective of the study is to determine the ASE genes and pathways in which they are involved. Specifically, my study investigated ASE-SNPs, ASE-genes, parent-of-origins of ASE allele and how ASE would possibly contribute to heterosis. My data showed that ASE was operating in the interspecific catfish system. Of the 66,251 and 177,841 SNPs identified from the datasets of the liver and gill, 5,420 (8.2%) and 13,390 (7.5%) SNPs were identified as significant ASE-SNPs, respectively.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Nucleolin and Its Role in Ribosomal Biogenesis
    NUCLEOLIN: A NUCLEOLAR RNA-BINDING PROTEIN INVOLVED IN RIBOSOME BIOGENESIS Inaugural-Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultät der Heinrich-Heine-Universität Düsseldorf vorgelegt von Julia Fremerey aus Hamburg Düsseldorf, April 2016 2 Gedruckt mit der Genehmigung der Mathematisch-Naturwissenschaftlichen Fakultät der Heinrich-Heine-Universität Düsseldorf Referent: Prof. Dr. A. Borkhardt Korreferent: Prof. Dr. H. Schwender Tag der mündlichen Prüfung: 20.07.2016 3 Die vorgelegte Arbeit wurde von Juli 2012 bis März 2016 in der Klinik für Kinder- Onkologie, -Hämatologie und Klinische Immunologie des Universitätsklinikums Düsseldorf unter Anleitung von Prof. Dr. A. Borkhardt und in Kooperation mit dem ‚Laboratory of RNA Molecular Biology‘ an der Rockefeller Universität unter Anleitung von Prof. Dr. T. Tuschl angefertigt. 4 Dedicated to my family TABLE OF CONTENTS 5 TABLE OF CONTENTS TABLE OF CONTENTS ............................................................................................... 5 LIST OF FIGURES ......................................................................................................10 LIST OF TABLES .......................................................................................................12 ABBREVIATION .........................................................................................................13 ABSTRACT ................................................................................................................19 ZUSAMMENFASSUNG
    [Show full text]
  • Comprehensive Array CGH of Normal Karyotype Myelodysplastic
    Leukemia (2011) 25, 387–399 & 2011 Macmillan Publishers Limited All rights reserved 0887-6924/11 www.nature.com/leu LEADING ARTICLE Comprehensive array CGH of normal karyotype myelodysplastic syndromes reveals hidden recurrent and individual genomic copy number alterations with prognostic relevance A Thiel1, M Beier1, D Ingenhag1, K Servan1, M Hein1, V Moeller1, B Betz1, B Hildebrandt1, C Evers1,3, U Germing2 and B Royer-Pokora1 1Institute of Human Genetics and Anthropology, Medical Faculty, Heinrich Heine University, Duesseldorf, Germany and 2Department of Hematology, Oncology and Clinical Immunology, Heinrich Heine University, Duesseldorf, Germany About 40% of patients with myelodysplastic syndromes (MDSs) 40–50% of MDS cases have a normal karyotype. MDS patients present with a normal karyotype, and they are facing different with a normal karyotype and low-risk clinical parameters are courses of disease. To advance the biological understanding often assigned into the IPSS low and intermediate-1 risk groups. and to find molecular prognostic markers, we performed a high- resolution oligonucleotide array study of 107 MDS patients In the absence of genetic or biological markers, prognostic (French American British) with a normal karyotype and clinical stratification of these patients is difficult. To better prognosticate follow-up through the Duesseldorf MDS registry. Recurrent these patients, new parameters to identify patients at higher risk hidden deletions overlapping with known cytogenetic aberra- are urgently needed. With the more recently introduced modern tions or sites of known tumor-associated genes were identi- technologies of whole-genome-wide surveys of genetic aberra- fied in 4q24 (TET2, 2x), 5q31.2 (2x), 7q22.1 (3x) and 21q22.12 tions, it is hoped that more insights into the biology of disease (RUNX1, 2x).
    [Show full text]
  • Supplementary Table
    Supporting information Additional Supporting Information may be found in the online version of this article: Supplementary Table S1: List of deregulated genes in serum of cancer patients in comparision to serum of healthy individuals (p < 0.05, logFC ≥ 1). ENTREZ Gene ID Symbol Gene Name logFC p-value q-value 8407 TAGLN2 transgelin 2 3,78 3,40E-07 0,0022 7035 TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 3,53 4,30E-05 0,022 28996 HIPK2 homeodomain interacting protein kinase 2 3,49 2,50E-06 0,0066 3690 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 3,48 0,00053 0,081 7035 TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 3,45 1,80E-05 0,014 4900 NRGN neurogranin (protein kinase C substrate, RC3) 3,32 0,00012 0,037 10398 MYL9 myosin, light chain 9, regulatory 3,22 8,20E-06 0,011 3796 KIF2A kinesin heavy chain member 2A 3,14 0,00015 0,04 5476 CTSA cathepsin A 3,08 0,00015 0,04 6648 SOD2 superoxide dismutase 2, mitochondrial 3,07 4,20E-06 0,0077 2982 GUCY1A3 guanylate cyclase 1, soluble, alpha 3 3,07 0,0015 0,13 8459 TPST2 tyrosylprotein sulfotransferase 2 3,05 0,00043 0,074 2983 GUCY1B3 guanylate cyclase 1, soluble, beta 3 3,04 3,70E-05 0,021 145781 GCOM1 GRINL1A complex locus 3,02 0,00027 0,059 10611 PDLIM5 PDZ and LIM domain 5 2,87 1,80E-05 0,014 5567 PRKACB protein kinase, cAMP-dependent, catalytic, beta 2,85 0,0015 0,13 25907 TMEM158 transmembrane protein 158 (gene/pseudogene) 2,84 0,0068 0,27 8848 TSC22D1 TSC22 domain family, member 1 2,83 0,00058 0,084 26 351 APP amyloid beta (A4) precursor protein 2,82 0,00018 0,045 9240 PNMA1 paraneoplastic antigen MA1 2,78 0,00028 0,06 400073 C12orf76 chromosome 12 open reading frame 76 2,78 0,00069 0,091 649260 ILMN_35781 PREDICTED: Homo sapiens similar to LIM and senescent cell antigen-like domains 1 (LOC649260), mRNA.
    [Show full text]
  • Human C7orf50 ORF Mammalian Expression Plasmid, C-Gfpspark Tag
    Human C7orf50 ORF mammalian expression plasmid, C-GFPSpark tag Catalog Number: HG14587-ACG General Information Plasmid Resuspension protocol Gene : chromosome 7 open reading frame 50 1. Centrifuge at 5,000×g for 5 min. Official Symbol : C7ORF50 2. Carefully open the tube and add 100 l of sterile water to Synonym : YCR016W dissolve the DNA. Source : Human 3. Close the tube and incubate for 10 minutes at room cDNA Size: 585bp temperature. RefSeq : BC006224 4. Briefly vortex the tube and then do a quick spin to Description concentrate the liquid at the bottom. Speed is less than Lot : Please refer to the label on the tube 5000×g. Vector : pCMV3-C-GFPSpark 5. Store the plasmid at -20 ℃. Shipping carrier : Each tube contains approximately 10 μg of lyophilized plasmid. The plasmid is ready for: Storage : • Restriction enzyme digestion The lyophilized plasmid can be stored at ambient temperature for three months. • PCR amplification Quality control : • E. coli transformation The plasmid is confirmed by full-length sequencing with primers • DNA sequencing in the sequencing primer list. Sequencing primer list : E.coli strains for transformation (recommended but not limited) pCMV3-F： 5’ CAGGTGTCCACTCCCAGGTCCAAG 3’ Most commercially available competent cells are appropriate for pcDNA3-R ： 5’ GGCAACTAGAAGGCACAGTCGAGG 3’ the plasmid, e.g. TOP10, DH5α and TOP10F´. Or Forward T7 ： 5’ TAATACGACTCACTATAGGG 3’ ReverseBGH ： 5’ TAGAAGGCACAGTCGAGG 3’ pCMV3-F and pcDNA3-R are designed by Sino Biological Inc. Customers can order the primer pair from any oligonucleotide supplier. Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. NOT FOR USE IN HUMANS. Fax :+86-10-51029969 Tel:+86- 400-890-9989 http://www.sinobiological.com Human C7orf50 ORF mammalian expression plasmid, C-GFPSpark tag Catalog Number: HG14587-ACG Vector Information All of the pCMV vectors are designed for high-level stable and transient expression in mammalian hosts.
    [Show full text]
  • High Constitutive Cytokine Release by Primary Human Acute Myeloid Leukemia Cells Is Associated with a Specific Intercellular Communication Phenotype
    Supplementary Information High Constitutive Cytokine Release by Primary Human Acute Myeloid Leukemia Cells Is Associated with a Specific Intercellular Communication Phenotype Håkon Reikvam 1,2,*, Elise Aasebø 1, Annette K. Brenner 2, Sushma Bartaula-Brevik 1, Ida Sofie Grønningsæter 2, Rakel Brendsdal Forthun 2, Randi Hovland 3,4 and Øystein Bruserud 1,2 1 Department of Clinical Science, University of Bergen, 5020, Bergen, Norway 2 Department of Medicine, Haukeland University Hospital, 5021, Bergen, Norway 3 Department of Medical Genetics, Haukeland University Hospital, 5021, Bergen, Norway 4 Institute of Biomedicine, University of Bergen, 5020, Bergen, Norway * Correspondence: [email protected]; Tel.: +55-97-50-00 J. Clin. Med. 2019, 8, x 2 of 36 Figure S1. Mutational studies in a cohort of 71 AML patients. The figure shows the number of patients with the various mutations (upper), the number of mutations in for each patient (middle) and the number of main classes with mutation(s) in each patient (lower). 2 J. Clin. Med. 2019, 8, x; doi: www.mdpi.com/journal/jcm J. Clin. Med. 2019, 8, x 3 of 36 Figure S2. The immunophenotype of primary human AML cells derived from 62 unselected patients. The expression of the eight differentiation markers CD13, CD14, CD15, CD33, CD34, CD45, CD117 and HLA-DR was investigated for 62 of the 71 patients included in our present study. We performed an unsupervised hierarchical cluster analysis and identified four patient main clusters/patient subsets. The mutational profile for each f the 62 patients is also given (middle), no individual mutation of main class of mutations showed any significant association with any of the for differentiation marker clusters (middle).
    [Show full text]
  • NF-Y Controls Fidelity of Transcription Initiation at Gene Promoters
    ARTICLE https://doi.org/10.1038/s41467-019-10905-7 OPEN NF-Y controls fidelity of transcription initiation at gene promoters through maintenance of the nucleosome-depleted region Andrew J. Oldfield 1,6, Telmo Henriques1,2,8, Dhirendra Kumar1,8, Adam B. Burkholder3,8, Senthilkumar Cinghu1, Damien Paulet4,5, Brian D. Bennett3, Pengyi Yang 1,7, Benjamin S. Scruggs1, Christopher A. Lavender3, Eric Rivals 4,5, Karen Adelman1,2 & Raja Jothi1 1234567890():,; Faithful transcription initiation is critical for accurate gene expression, yet the mechanisms underlying specific transcription start site (TSS) selection in mammals remain unclear. Here, we show that the histone-fold domain protein NF-Y, a ubiquitously expressed transcription factor, controls the fidelity of transcription initiation at gene promoters in mouse embryonic stem cells. We report that NF-Y maintains the region upstream of TSSs in a nucleosome- depleted state while simultaneously protecting this accessible region against aberrant and/or ectopic transcription initiation. We find that loss of NF-Y binding in mammalian cells disrupts the promoter chromatin landscape, leading to nucleosomal encroachment over the canonical TSS. Importantly, this chromatin rearrangement is accompanied by upstream relocation of the transcription pre-initiation complex and ectopic transcription initiation. Further, this phenomenon generates aberrant extended transcripts that undergo translation, disrupting gene expression profiles. These results suggest NF-Y is a central player in TSS selection in metazoans and highlight the deleterious consequences of inaccurate transcription initiation. 1 Epigenetics and Stem Cell Biology Laboratory, National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, Durham, NC 27709, USA. 2 Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA 02115, USA.
    [Show full text]
  • The Transcriptional and Epigenetic Role of Brd4 in the Regulation of the Cellular Stress Response
    THE TRANSCRIPTIONAL AND EPIGENETIC ROLE OF BRD4 IN THE REGULATION OF THE CELLULAR STRESS RESPONSE INAUGURAL-DISSERTATION to obtain the academic degree Doctor rerum naturalium (Dr. rer. nat.) submitted to the Department of Biology, Chemistry and Pharmacy of Freie Universität Berlin by Michelle Hussong from Zweibrücken 2015 Die vorliegende Arbeit wurde im Zeitraum von Juli 2012 bis September 2015 am Max- Planck-Institut für Molekulare Genetik in Berlin sowie an der Universität zu Köln unter der Leitung von Frau Prof. Dr. Dr. Michal-Ruth Schweiger angefertigt. 1. Gutachter: Prof. Dr. Dr. Michal-Ruth Schweiger 2. Gutachter: Prof. Dr. Rupert Mutzel Disputation am 07.12.2015 ACKNOWLEDGMENT ACKNOWLEDGMENT This dissertation would not have been possible without the guidance and the help of many people who in one way or another contributed to the preparation and completion of this study. Firstly, I would like to express my sincere gratitude to my advisor Prof. Dr. Dr. Michal-Ruth Schweiger, for her continuous support throughout my PhD study, for her patience, motivation, and immense knowledge. I am eminently thankful for the multiple possibilities she gave me to work on this interesting and challenging field of research. I also want to thank Professor Dr. Rupert Mutzel for taking the time of being my second supervisor. My sincere thanks also goes to Prof. Dr. Hans Lehrach for having given me the opportunity to do my PhD thesis in the extraordinary and inspiring environment at the Max-Planck- Institute for Molecular Genetics in Berlin. Especially, the multitude of technologies and knowledge in his department made my work successful.
    [Show full text]
  • RNA–Protein Interaction Mapping Via MS2- Or Cas13-Based APEX Targeting
    RNA–protein interaction mapping via MS2- or Cas13-based APEX targeting Shuo Hana,b,c,1, Boxuan Simen Zhaoa,b,c,1, Samuel A. Myersd, Steven A. Carrd, Chuan Hee,f, and Alice Y. Tinga,b,c,2 aDepartment of Genetics, Chan Zuckerberg Biohub, Stanford University, Stanford, CA 94305; bDepartment of Biology, Chan Zuckerberg Biohub, Stanford University, Stanford, CA 94305; cDepartment of Chemistry, Chan Zuckerberg Biohub, Stanford University, Stanford, CA 94305; dThe Broad Institute of Massachusetts Institute of Technology and Harvard University, Cambridge, MA 02142; eDepartment of Chemistry, Institute for Biophysical Dynamics, Howard Hughes Medical Institute, University of Chicago, Chicago, IL 60637; and fDepartment of Biochemistry and Molecular Biology, Institute for Biophysical Dynamics, Howard Hughes Medical Institute, University of Chicago, Chicago, IL 60637 Edited by Robert H. Singer, Albert Einstein College of Medicine, Bronx, NY, and approved July 24, 2020 (received for review April 8, 2020) RNA–protein interactions underlie a wide range of cellular pro- and oncogenesis by serving as the template for reverse transcrip- cesses. Improved methods are needed to systematically map RNA– tion of telomeres (26, 27). While hTR’s interaction with the protein interactions in living cells in an unbiased manner. We used telomerase complex has been extensively characterized (28), hTR two approaches to target the engineered peroxidase APEX2 to is present in stoichiometric excess over telomerase in cancer cells specific cellular RNAs for RNA-centered proximity biotinylation of (29) and is broadly expressed in tissues lacking telomerase protein protein interaction partners. Both an MS2-MCP system and an (30). These observations suggest that hTR could also function engineered CRISPR-Cas13 system were used to deliver APEX2 to outside of the telomerase complex (31), and uncharacterized the human telomerase RNA hTR with high specificity.
    [Show full text]
  • High-Resolution Human Core-Promoter Prediction with Coreboost HM
    Downloaded from genome.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press Methods High-resolution human core-promoter prediction with CoreBoost_HM Xiaowo Wang,1,2,3 Zhenyu Xuan,2,3 Xiaoyue Zhao,2 Yanda Li,1 and Michael Q. Zhang2,4 1MOE Key Laboratory of Bioinformatics and Bioinformatics Division, TNLIST/Department of Automation, Tsinghua University, Beijing 100084, China; 2Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724, USA Correctly locating the gene transcription start site and the core-promoter is important for understanding transcriptional regulation mechanism. Here we have integrated specific genome-wide histone modification and DNA sequence features together to predict RNA polymerase II core-promoters in the human genome. Our new predictor CoreBoost_HM out- performs existing promoter prediction algorithms by providing significantly higher sensitivity and specificity at high resolution. We demonstrated that even though the histone modification data used in this study are from a specific cell type (CD4+ T-cell), our method can be used to identify both active and repressed promoters. We have applied it to search the upstream regions of microRNA genes, and show that CoreBoost_HM can accurately identify the known promoters of the intergenic microRNAs. We also identified a few intronic microRNAs that may have their own promoters. This result suggests that our new method can help to identify and characterize the core-promoters of both coding and noncoding genes. [Supplemental material is available online at www.genome.org.] Transcription initiation is a key step in the regulation of gene 2004, 2006; Zhang 2007). However, it is still a challenging prob- expression.
    [Show full text]
  • Identification of MAZ As a Novel Transcription Factor Regulating Erythropoiesis
    Identification of MAZ as a novel transcription factor regulating erythropoiesis Darya Deen1, Falk Butter2, Michelle L. Holland3, Vasiliki Samara4, Jacqueline A. Sloane-Stanley4, Helena Ayyub4, Matthias Mann5, David Garrick4,6,7 and Douglas Vernimmen1,7 1 The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Easter Bush, Midlothian EH25 9RG, United Kingdom. 2 Institute of Molecular Biology (IMB), 55128 Mainz, Germany 3 Department of Medical and Molecular Genetics, School of Basic and Medical Biosciences, King's College London, London SE1 9RT, UK 4 MRC Molecular Haematology Unit, Weatherall Institute for Molecular Medicine, University of Oxford, John Radcliffe Hospital, Oxford OX3 9DS, United Kingdom. 5 Department of Proteomics and Signal Transduction, Max Planck Institute of Biochemistry, 82152 Martinsried, Germany. 6 Current address : INSERM UMRS-976, Institut de Recherche Saint Louis, Université de Paris, 75010 Paris, France. 7 These authors contributed equally Correspondence: [email protected], [email protected] ADDITIONAL MATERIAL Suppl Fig 1. Erythroid-specific hypersensitivity regions DNAse-Seq. (A) Structure of the α-globin locus. Chromosomal position (hg38 genome build) is shown above the genes. The locus consists of the embryonic ζ gene (HBZ), the duplicated foetal/adult α genes (HBA2 and HBA1) together with two flanking pseudogenes (HBM and HBQ1). The upstream, widely-expressed gene, NPRL3 is transcribed from the opposite strand to that of the HBA genes and contains the remote regulatory elements of the α-globin locus (MCS -R1 to -R3) (indicated by red dots). Below is shown the ATAC-seq signal in human erythroblasts (taken from 8) indicating open chromatin structure at promoter and distal regulatory elements (shaded regions).
    [Show full text]