DOE Bioenergy Technologies Office (BETO) 2021 Project Peer Review

PROGRESS TOWARDS A NEW MODEL CHEMOLITHOAUTOTROPHIC HOST

March 15, 2021 AGILE Biofoundry Consortium

Dan Robertson Kiverdi

This presentation does not contain any proprietary, confidential, or otherwise restricted information Project Overview

• Cupriavidus necator has the potential to be a model engineering host for direct bioconversion of CO2 to value-added products

• Performs autotrophic, e.g., knallgas, fermentations on CO2 + H2 + O2, or heterotrophic fermentation on sugars or glycerol

• Grows rapidly to high density (OD ~200) on CO2; H2O is the only byproduct • Energetically superior metabolism for product synthesis; High productivity (>2g/L/hr) and yield on CO2 • History of use for industrial production of a natural polymer, PHB • Kiverdi has developed strains, reactors, fermentations and processes and demonstrated technoeconomic and life cycle advantages • LBNL and ORNL have experience engineering non-model engineering hosts • NREL brings experience with development of gene editing tools

2 Challenges

• Genetic tools for C necator are limited, making metabolic engineering slow and laborious • DNA transformation efficiencies of C. necator are poor • There is currently no general method for chromosomal integration of pathways into C. necator • Control elements for gene expression are limited and not well-developed • It is difficult to inactivate multiple genes in C. necator • Reaching productivity goals of non-native products in C. necator has been challenging

3 Project Goals

• Develop a multi-level metabolic engineering toolbox for C necator comprised of: • An efficient DNA transformation and chromosome integration system for C necator (ORNL) • A C necator CRISPR gene editing system (NREL) • Libraries of genetic control elements with broad ranges of amplification; ribosome binding sites (RBS), promoters (ORNL)

• Construct and express the genes of an engineered metabolic pathway for the C12 fatty alcohol, dodecanol (Kiverdi/LBNL)

• Demonstrate dodecanol production from CO2/H2/O2 in lab bioreactor (Kiverdi) • Using the toolbox, fine tune pathway gene expression, delete competing pathways, modulate metabolic regulation for highest dodecanol yield (All)

4 Knallgas Engineering Chassis

CO 2 VALUE-ADDED CHEMICALS H2 • Fatty alcohols O2 CARBON • Fatty acids METABOLISM • BIOMASS ETHANOL Alkanes • Organic acids • Alcohols H2O • Diols A B VAC • Olefins ENZYME 1 ENZYME 2 • Isoprenes OPERON CONSTRUCTION • PHAs • Terpenes

promoter rbs GENE 1 rbs GENE 2 • Lactams CHROMOSOME • PLA TOOLBOX • Terepthlates

• INTEGRASES • PROMOTERS • RBS • CRISPR

5 Heilmeier Catechism 1. What are we trying to do? • Deploy a platform biotechnology that leverages the distinct advantages of knallgas fermentation for productivity and sustainability. • Develop a toolbox enabling creation of a model C necator chassis for engineering the production of a broad range of commodity and specialty chemicals.

• Demonstrate a knallgas process for dodecanol synthesis from CO2 to replace non-sustainable production from palm oil. 2. Hows i it done today and what are the limits?

• Unlike knallgas, most heterotrophic fermentations produce CO2 or other byproducts that divert carbon and energy, and impact productivity and yield. • Chemicals have been produced in metabolically engineered C necator though not at industrially relevant yields. 3. Whys i it important? • The ability to fine tune engineered pathways in an organism with an industrially beneficial phenotype will enable high productivity in sustainable CO2-consuming processes 4. What are the risks?

• The current cost of H2 is the greatest cost of goods (COGS) sensitivity for scaled dodecanol production. It is forecast that by 2025 green hydrogen at a projected $1/kg will match the long-term breakeven price in Europe of natural gas ($7.5/mmBTU), achieving fossil fuel parity • Productivity has a large effect on the predicted internal rate of return (IRR) of the dodecanol process. The tools developed in the project will enable fine tuning of metabolism and direct carbon to dodecanol 6 Project Structure

Altering C. necator Developing Cas9 RBSs for 1-dodecanol Bioreactor restriction modification gene editing production experiments system Cas9-based Genome Editing

Cas9 RBS RBS RBS RBS PAM 5’ 3’ ’tesA far ‘tesA far 3’ 5’ 1 6 6 1

5’ sgRNA 2 7 7 2

PAM 3 8 5’ 3’ 8 3 3’ 5’ DNAB DS 4 9 9 4 Non-homologous End Joining Homology Directed repair (HDR) (NHEJ) 5 10 10 5 PAM Ge nomic DNA 5’ 5’ 3’ 3’ 3’ 5’ 3’ Re pair Te mplate 5’ Re pair Te mplate 3’ 5’

3’ Ge nomic DNA Indel mutation 5’ 5’ 3’ 3’ 5’

Precise Gene Editing 5’ 3’ 3’ 5’ Steve Singer Adam Guss Carrie Eckert John Reed Kenneth Zahn Kenneth Zahn

• Project manager is Steve Singer, LBNL • Project tasks are managed by the institutional Project Leaders • Tasks, timelines, milestones and deliverables are defined in the project plan • Quarterly updates are conducted; focusing on progress to milestones, experimental and operational challenges and mitigations Technical Strategy

• Improve C. necator transformation efficiency at least 10-fold (ORNL). • Identify at least 1 functional CRISPR/Cas system for genome editing (NREL). • Demonstrate simultaneous editing of at least 2 genes (NREL). • CRISPR-based editing with pooled library > 4 mutations (NREL). • Using RFP as a reporter, characterize expression strength in C. necator of at least 10 RBSs from a library with a wide range of calculated Translation Initiation Factors (TIFs) (LBNL, Kiverdi). • Construct in C. necator a heterologous pathway for biosynthesis of 1-dodecanol from dodecanoic acid. Perform initial optimization of the pathway by: • Varying the RBSs in dodecanol pathway operon • Knocking out at least two acyl-CoA dehydrogenases (to disable β-oxidation) (LBNL/Kiverdi/ORNL). • To facilitate commercialization, initiate optimization and scale-up of C. necator chemolithoautotrophic fermentation with H2 and CO2 (Kiverdi).

8 Impact ● Fatty alcohols are intermediates in the production of detergents, cosmetics and agricultural chemicals. ● The market is predicted to reach $10B/yr by 2023 with strongest growth in the surfactant sector. ● Fatty alcohols are currently produced either from triglycerides derived from palm, coconut and soy oils, or from fossil fuel-derived ethylene polymerization. ● The use of processing chemicals, deforestation and land diversion as well as waste generation by palm kernel oil production results in a large negative carbon footprint (estimated 5.27 CO2e/kg dodecanol vs -2.4 CO2e/kg dodecanol for knallgas. ● Replacing these molecules with renewable alternatives is essential to advance the US bioeconomy and to mitigate the climate effects of producing these molecules from palm oil and petroleum ● The project aligns with a strategic partnership between Kiverdi and SC Johnson, a world leader in surfactants DNA Transformation

Task 1: Method(s) for 10-fold improved transformation efficiency in C. necator • C. necator electroporation efficiency was increased to 100 times greater than previously published protocols (Biotechnol Biofuels 2018 Jun 20;11:172) • Recognition sites for 10 phage integrases were incorporated into C. necator chromosome at H16_A0006 site • High efficiency and insertional accuracy were achieved for several of the phage integrases Promoter Library

Task 1: Method(s) for 10-fold improved transformation efficiency in C. necator

• Evaluated library of promoters expressing fluorescent protein from chromosome • Promoters cover a 500-fold range of expression levels 105

104

3 600 10

102 RFU/OD 101

0 10 C 5b 8a 9a j5 wt 7a 6a 5b 13a 8a 9a 4c 10a 14c14c 13a 11a 549 pta c g25g25 1548 1548 3079 3079 Plac 12821282 Ptac 12861286 Pj5

noprom Ppha strong rbs PlacUV5

No Reporter Promoter PromoterPromoter No Promoter Promoter Promoter no prom Promoter Promoter Promoter Promoter PromoterPromoter Promoter Promoter Nitrogen Starvation Induction

Task 1: Method(s) for 10-fold improved transformation efficiency in C. necator A B Nitrogen Limited Nitrogen Limited 1010 00 005

10 004 0 600 10 1.0 10000 RFU 600 1010 003

102 0 OD 0.5 5000 10

101 RFU/OD 10 • Built inducible gene expression 0.0 0 1001 0 20 40 60 system using nitrogen Time (hrs) starvation as the signal and T7 Nitrogen Rich Nitrogen Rich C D 10 004 0 polymerase to amplify the 10 10 003 1.0 10000 600 10 RFU 600 )

102 0 signal ( 10 OD 0.5 5000 10101 0.0 0 RFU/OD 1001 0 20 40 60 • Promoters span ~1000-fold Time (hrs) Log Growth F Log Growth range in expression upon N- E 1010 003 1000 600 RFU starvation 1.0 750 10102 0 600 500 () OD 0.5 10101 250 RFU/OD

0.0 0 1001 0 5 10 15 20 1 2 3 43 4 55 Time (hrs) Promoter OD600 / RFU: ■ No T7RNAP ■ / ■ T7RNAP ■ T7RNAP ■ / ■ T7RNAP:lysY ■T7RNAP:lysY CRISPR Installation

Task 2: Develop Cas9 mediated editing in C. necator

• Vectors and Cas9/GFP expressing strains were delayed due to lack of available researcher • Recently recruited a student intern at NREL to resume task • Cas9 -based editing was demonstrated for C. necator

Cas9-based Genome Editing

Cas9

PAM 5’ 3’ 3’ 5’

5’ sgRNA

PAM 5’ 3’ 3’ 5’ BDNA DS

Non-homologous End Joining Homology Directed repair (HDR) (NHEJ) PAM Ge nomic DNA 5’ 5’ 3’ 3’ 3’ 5’ 3’ Re pair Template 5’ Re pair Te mplate 3’ 5’

3’ Ge nomic DNA Indel mutation 5’ 5’ 3’ 3’ 5’

Precise Gene Editing 5’ 3’ 3’ 5’ Gene Translational Control Elements

Task 3: Develop Ribosome Binding Sequence library for C. necator

• An in silico RBS calculator* developed by AGILE was used to create a library of synthetic RBSs with broad strength range

10 20 30 40 50 60 70 80 90 RBS strength ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|- Consensus GGAGACCACAACGGUUUCCCUCUAGAAAUAAUUUUGUCUCAAAAGGAGGUAUCUUUAUGGCGAGUAGCGAAGACGUUAUCAAAGAGUUCAU 0 20000 40000 60000 80000 100000120000

cal_rbs_RFP1 GGAGACCACAACGGUUUCCCUCUAGAAAUAAUUUUGgCUCAAAAGGAGuUAgCcccAUGGCGAGUAGCGAAGACGUUAUCAAAGAGUUCAU RBS 1

cal_rbs_RFP2 GGAGACCACAACGGUUUCCCUCUAGAAAUAAUUUUGUCUCAgggaGAGGUccgaaaAUGGCGAGUAGCGAAGACGUUAUCAAAGAGUUCAU RBS 2

cal_rbs_RFP3 GGAGACCACAACGGUUUCCCUCUAGAAAUAAUUUUGUuUCAguAGGAGGcAaCcaUAUGGCGAGUAGCGAAGACGUUAUCAAAGAGUUCAU RBS 3

cal_rbs_RFP4 GGAGACCACAACGGUUUCCCUCUAGAAAUAAUUUUGaaaagAggaGgGagAagcUUAUGGCGAGUAGCGAAGACGUUAUCAAAGAGUUCAU RBS 4

cal_rbs_RFP5 GGAGACCACAACGGUUUCCCUCUAGAAAUAAUUUUGaCUuugAAGGgGGcAgaUccAUGGCGAGUAGCGAAGACGUUAUCAAAGAGUUCAU RBS 5

cal_rbs_RFP6 GGAGACCACAACGGUUUCCCUCUAGAAAUAAUUUUGgaUCAAAAGGcuGggUuUUUAUGGCGAGUAGCGAAGACGUUAUCAAAGAGUUCAU RBS 6

cal_rbs_RFP7 GGAGACCACAACGGUUUCCCUCUAGAAAUAAUUUUGUucCAAAAGGAGGcccCggcAUGGCGAGUAGCGAAGACGUUAUCAAAGAGUUCAU RBS 7

cal_rbs_RFP8 GGAGACCACAACGGUUUCCCUCUAGAAAUAAUUUUGaagaAAAAGGucGguUuUUUAUGGCGAGUAGCGAAGACGUUAUCAAAGAGUUCAU RBS 8

RBS 9 cal_rbs_RFP9 GGAGACCACAACGGUUUCCCUCUAGAAAUAAUUUUGUaagcgcgGGAGGUAUuaUaAUGGCGAGUAGCGAAGACGUUAUCAAAGAGUUCAU

RBS 10 cal_rbs_RFP10 GGAGACCACAACGGUUUCCCUCUAGAAAUAAUUUUGcCUCAAAAGGAGGUAgCUUaAUGGCGAGUAGCGAAGACGUUAUCAAAGAGUUCAU

RBS 11 cal_rbs_RFP11 GGAGACCACAACGGUUUCCCUCUAGAAAUAAUUUUGcCcCcAAAGGAGGUAgCUaUAUGGCGAGUAGCGAAGACGUUAUCAAAGAGUUCAU RBS 12 cal_rbs_RFP12 GGAGACCACAACGGUUUCCCUCUAGAAAUAAUUUUGUCUCAcgAGGAGGUuUaUUaAUGGCGAGUAGCGAAGACGUUAUCAAAGAGUUCAU RBS 13 cal_rbs_RFP13 GGAGACCACAACGGUUUCCCUCUAGAAAUAAUUUUGUCcggAAAGGAGGUAcgcaaAUGGCGAGUAGCGAAGACGUUAUCAAAGAGUUCAU RBS 14 cal_rbs_RFP14 GGAGACCACAACGGUUUCCCUCUAGAAAUAAUUUUGagagcuAAGGAGGUuUaUUUAUGGCGAGUAGCGAAGACGUUAUCAAAGAGUUCAU Cal rbs rfp region input seq RFP input seq De novo seq

Bi, C., Su, P., Müller, J. et al. (2013) Development of a broad-host synthetic biology toolbox for Ralstonia eutropha and its application to engineering hydrocarbon biofuel production. Microb Cell Fact 12, 107 Gene Translational Control Elements

Task 3: Develop RBS library for C. necator

• Plasmids for 14 distinct synthetic RBSs were constructed by AGILE DiVA team • RFP fluorescence was roughly correlated with predicted RBS expression strength

RBS#12

Selected C. necator RFP constructs RBS#6 intensity

RBS#8

Time RBS#3 Fluorescence Design-Build-Test for Dodecanol

Task 4: 1-dodecanol production

Design: PBAD- RBS(1-11)-’tesA-RBS(3- 14)-jojoba Plasmid Construction Build: Design: ○ RBS (1-11)- tesA-scaffold Switch thioesterase from ‘tesA to alternatives in ○ RBS(3-14)- successful libraries jojoba •Transform tesA RBS ◘ Sequence 1 2 3 4 5 6 7 8 9 10 11 °°° Store 3 ○ ◙ ○ ◙ ○ ◙ ○ ○ ◙ 4 ○ ◙ ○ ◙ ○ ○ ◙ ○ ○ ◙ 5 ○ ◙ ○ ◙ ○ ○ ◙ ○ ○ ◙ Learn: 6 ○ ◙ ○ ◙ ○ ○ ◙ ○ ○ ◙ Legend 7 ◙ ○ ◙ ○ ○ ◙ ○ ○ ◙ Identify pairs of RBS for

○ Ligation RBS 8 ◙ ○ ◙ ○ ○ ◙ ○ ○ ◙ thioesterase and acyl CoA • 9 ○ ○ ○ ○ ○ reductase that maximize Test: Transformed ◙ ◙ ◙ ◙ production x PCR conf 10 ◙ ○ ◙ ○ ○ ◙ ○ ○ ◙ * Electroporate ◙ Sequenced jojoba 11 ◙ ○ ○ ○ ◙ ○ ○ ◙ ◙ !Fermentation Assay °°° -85°C 12 ○ ◙ ○ ○ ○ ◙ ○ ○ ◙ ◙ + GC-MS * Electroporate 13 ○ ◙ ○ ○ ◙ ○ ○ ○ ◙ ! Ferment 14 ○ ◙ ○ ○ ◙ ○ ○ ◙ ○ + GC-MS -- °°° °°° °°° °°° °°° °°° °°° °°° °°° °°° • Table. Current status of strains construction and analysis 1. Project Milestones

Task 1: Method(s) for 10-fold improved transformation efficiency in C. necator (ORNL) (Complete) Subtask Due % fin Issues if any Improve transformation efficiency of 9/30/19 100% WT C. necator H16 at least 10-fold

Task 2: Developing CRISPR/Cas9 editing in C. necator (NREL) Subtask Due % fin Issues if any Identify at least 1 functional CRISPR/Cas system for gene 9/30/20 100% editing Demonstrate simultaneous editing 3/31/21 50% of at least two genes CRISPR-based editing with pooled 9/30/21 15% library >4 mutations 2. Project Milestones

Task 3: Develop RBS library for C. necator (LBNL/Kiverdi) (Complete) Subtask Due % fin Issues if any Identify at least 10 RBSs to be 6/30/19 100% tested RFP readouts for 10 RBSs in C. 3/31/21 100% necator

Task 4: 1-Dodecanol production (LBNL/Kiverdi) Subtask Due % fin Issues if any Plasmids and background C. necator strain developed for 9/30/20 100% dodecanol production Transform C. necator with RBS 12/31/20 100% variant plasmids Measure dodecanol production in 3/31/20 45% strain variants 3. Project Milestones

Task 5: Autotrophic Production of 1-Dodecanol (Kiverdi) Subtask Due % fin Issues if any Optimize C. necator fermentation 6/30/21 0% with H2/CO2

Task 6: Chromosomal integration of dodecanol pathway (LBNL/Kiverdi/ORNL) Subtask Due % fin Issues if any Integration of 1-dodecanol pathway 3/31/21 10% into C. necator chromosome Demonstration of 1-dodecanol production from chromosomal 6/30/21 0% pathway Measure dodecanol production in 9/30/21 0% strain variants Next Steps

1 Task 2: Develop Cas9 mediated editing in C necator Demonstrate multi-gene disruptions with Cas9 Target C. necator thioesterases to improve 1-dodecanol production 2 Task 4: 1-dodecanol production Test 1-dodecanol production under heterotrophic conditions Completion of RBS set for ‘tesA and jojoba acr Replacement of ‘tesA with other thioesterases; overexpress native fadD to improve titers 3 Task 5: Autotrophic Production of 1-Dodecanol

Most promising strains from heterotrophic growth will be tested under H2/CO2 4 Task 6: Chromosomal integration of dodecanol pathway Choice of thioesterase and acyl CoA reductase genes from plasmid-based expression Integration of genes using phage integrase method Project Issues

Issue Approach • Pandemic restrictions have prevented LBNL increased scope on project to transfer Kiverdi from performing on-site work at additional engineering tasks LBNL • General delays because of pandemic NCE until 9/30/21 was implemented and restrictions milestones were rescheduled Summary

Key Takeaways • Superior electroporation protocol for DNA transformation attaining 107 cfu/µg DNA • Developed 4 highly efficient site-specific recombinases for C. necator • Developed chromosomal promoter library with 400-fold expression range • 600-fold expression range from chromosomal, nitrogen-limitation inducible T7 system • Developed broad library of RBS expression control elements • DBTL cycle initiated for 1-dodecanol production, will include heterotrophic and autotrophic growth Publication • George L. Peabody, Joshua R. Elmore, Jessica Martinez-Baird, Gara N. Dexter, and Adam M. Guss “Enhanced synthetic biology toolkit for Cupriavidus necator H16” Metabolic Engineering, in revision Commercialization potential • Kiverdi will test 1-dodecanol production strains in bioreactors and assess commercial potential for dodecanol production from CO2 Quad Chart Overview

Timeline • Start 1/1/2019 Project Goal • End 9/30/2021 (Extended) Develop tools for metabolic engineering of model chemolithoautotrophy and demonstrate Y1 Y2 these tools through autotrophic production of 1-dodecanol DOE $450,000 $450,000 Funding End of Project Milestone Cost $192,800 $192,800 Share As a concrete demonstration of this proposed platform’s potential capabilities, we will Total $642,800 $642,800 engineer C. necator to convert H2 and CO2 into the C fatty alcohol, 1-dodecanol (lauryl Project Partners 12 alcohol), commonly used in the production of • Kiverdi, LBNL, ORNL, NREL surfactant and detergent products and currently sourced from palm kernel oil, the cultivation of which is associated with Barriers addressed widespread rainforest destruction. Advanced Bioprocess Development; engineering robust organisms and fermentation regimes for sustainable production of bioproducts Agile Biofoundry CRADA FP00006779 23 Additional Slides

24 Publications

George L. Peabody, Joshua R. Elmore, Jessica Martinez-Baird, Gara N. Dexter, and Adam M. Guss “Enhanced synthetic biology toolkit for Cupriavidus necator H16” Metabolic Engineering, in revision

25